MN blood group genotype detection kit using molecular method
The Tetra-ARMs-PCR method addresses the limitations of serological methods by offering a rapid, cost-effective, and specific approach to determine MN blood group genotypes, enhancing transfusion safety and reducing complications in patients with chronic transfusions.
Patent Information
- Application Number
- IR140250140003003857
- Authority / Receiving Office
- IR · IR
- Patent Type
- Patents
- Current Assignee / Owner
- Filing Date
- 2023-08-27
- Publication Date
- 2024-10-23
- Estimated Expiration
- 2043-08-27
AI Technical Summary
Existing serological methods for determining the MN blood group genotype in patients with chronic and frequent blood transfusions, such as those with thalassemia or sickle cell anemia, are unreliable due to mixed-field agglutination and require high costs and time, leading to potential hemolytic reactions and incompatibility issues.
A molecular method using Tetra-ARMs-PCR, which employs two pairs of primers to detect single-point polymorphisms, allowing for rapid, sensitive, and specific determination of homozygous and heterozygous states of the MN blood group genotype with a single PCR step and one electrophoresis step, reducing costs and improving accuracy.
The Tetra-ARMs-PCR method provides rapid, cost-effective, and highly specific detection of MN blood group genotypes, minimizing treatment costs and complications from blood incompatibility by ensuring accurate blood selection for transfusions.
Smart Images

Figure 00000011_0000 
Figure 00000011_0001 
Figure 00000011_0002
Abstract
Description
Description of the invention Title of the invention (as stated in the declaration) MN blood group genotype detection kit using molecular method Molecular method and kit for MN blood group genotyping The technical background of Astronomy This invention relates to the fields of blood transfusion, medicine, research, and diagnostics. The technical problem of the invention's objectives The "MNSsU blood group system antigens" are formed on glycophorins or sialoglycoproteins. These proteins span the width of the blood cell membrane and have extracellular domains at the amino terminus and cytoplasmic domains at the carboxyl terminus. Expression of the MNSs system is restricted to red blood cells, such as the erythrocyte. The M and N antigens are located on glycophorin A, the major sialomucin of red blood cells. Each red blood cell has about one million copies of the glycophorin GYPA, CD235A (A). GYPA is expressed as a dimer in the membrane and is usually associated with band 3, an anion exchange channel. The M and N antigenic markers are located in the 5 amino-terminal amino acids, the M-related ones being Ser1, Ser2, Thr3, Thr4, Gly5 and the N-related ones being Leu1, Ser2, Thr3, Thr4, Glu5. Glycophorin A forms the WRb antigen in contact with band 3. The M and N antigens are codominant or co-dominant. If a person is negative for the N antigen and positive for M, the possibility of homozygosity for M (MM) arises; this is also true for other antigens. Anti-M and anti-N are IgM antibodies and are naturally occurring antibodies. Autoanti-N has been observed in dialysis patients whose dialysis machines are sterilized with formalin. In this condition, the N antigen is converted to a neoantigen under the influence of formalin, which is called NF; F is the formalin sign. Alloanti-N in the M+NSsU- phenotype is very strong and can cause acute hemolysis and, by crossing the placenta, cause hemolytic anemia of the fetus and newborn (HDFN). Antibodies to the M and N antigens have a dosage effect, meaning that anti-M reacts more strongly with homozygous M cells than with heterozygous ones. Some types of anti-M and anti-N react more strongly at pH = 6.5, and the use of albumin diluent or incubation of red blood cells in glucose-containing solutions before testing also enhances the reaction. Some types of anti-M and anti-N are of clinical importance and are associated with hemolytic reactions with blood transfusions and fetal-maternal hemolytic anemia, and are sometimes present with a mixture of IgG and IgM. Glycophorins A and B are likely to be receptors for Plasmodium falciparum. GYPA is also a receptor for the red blood cell parasite Babesia. The importance of the MN blood type is in hemolytic disease of the fetus and newborn (HDFN) and in blood transfusions for people who receive chronic and frequent blood transfusions, including people with thalassemia, aplastic anemia, or sickle cell anemia. The main treatment for thalassemia is bone marrow transplantation (BMT) and cord blood, but other treatments include blood transfusions, splenectomy, along with treatment of side effects and the use of adjunctive therapies such as hydroxyurea to reduce ineffective hematopoiesis. Among the treatments mentioned, blood transfusion is common because it has desirable therapeutic effects such as reducing tissue hypoxia caused by anemia, and the patient can also regain normal physical and social activity and stop defective RBC production due to inhibition of BM. If diagnosed on time and blood transfusion is started at the right time for the patient, skeletal disorders and skull deformities of the patient will be prevented.But blood transfusion is a double-edged sword. In addition to the benefits mentioned, it can cause problems in the individual, including acute hemolytic reactions, delayed hemolytic reactions due to the formation of autoantibodies against blood groups (including blood group MN), febrile non-hemolytic reactions due to the formation of autoantibodies against leukocyte and platelet antigens, allergic reactions, increased iron load, and infections. In the meantime, delayed hemolytic reactions that occur due to the formation of autoantibodies following repeated blood transfusions against blood groups are common. Autoantibodies are antibodies that the body's immune system produces against foreign antigens (naturally or innately). Natural antibodies are antibodies that are produced early in life against foreign antigens. For example, in blood group B, anti-A is naturally present. However, immune-type antibodies are antibodies that are produced when a person's immune system comes into contact with foreign antigens.Late hemolytic reactions often occur 5-10 days after blood transfusion and in most cases, the patient presents with anemia, lethargy and jaundice. Sometimes the amount of antibodies produced decreases, but with the reinfusion of blood containing a specific antigen, hemolytic crisis occurs in the body. The frequency of alloimmunization has been reported to be 37.2% to 50% in different parts of the world. Iran has a high prevalence of thalassemia, especially in provinces such as Khuzestan and Sistan and Baluchestan. To reduce the complications of blood transfusion, we can examine the patient's blood sample to identify antibodies and select blood that does not contain the antigen against which the patient has produced antibodies in subsequent blood transfusions. It is also possible to identify the patient's phenotypic and genotypic pattern before starting blood transfusion. For example, the combination of A, B and O alleles determines the individual's genotype, while the blood type indicates the individual's phenotype. Serological methods are usually used to examine the phenotype of RBCs. These methods examine the antigen and antibody reaction in vitro, in fact, through hemagglutination.However, many studies have shown that serological methods in patients who have received blood transfusions are problematic due to the antibody staining of the patient's RBCs and the mixed RBC population, and as a result, the interpretation of hemagglutination results will be unreliable. On the other hand, substitution and deletion mutations, which cause thalassemia and α-thalassemia, respectively, are responsible for the creation of gene fragments of different lengths. Given these problems, molecular methods can be used to detect the genotype of RBCs that are not affected by successive blood transfusions. Molecular methods have many applications in immunohematology, including the detection of antigen genotypes in patients who have recently received transfusions, RBCs that are DAT positive, the detection of D antigen, and also in the diagnosis of hemolytic disease of the fetus and newborn (HDFN). Given that molecular methods have considerable sensitivity and specificity compared to serological methods, and that no invention has been made so far with the Tetra-ARMs-PCR[1] method to diagnose the MN blood group genotype in people who receive chronic and frequent blood transfusions (including people with thalassemia, aplastic anemia, or sickle cell anemia), we decided to design a new diagnostic kit in this field, with the aim of being able to determine the MN blood group genotype using a molecular method for patients and prepare suitable blood for transfusion, and in this regard, take an important step towards improving the health status of these patients. Description of the state of the art and history of advances related to the invention of the common law. "Many blood-related organizations, including blood transfusion organizations, the Red Crescent, etc., perform tests on blood samples, and in many cases it is necessary to determine the person's blood type and to identify the genetic antigens on the person's blood cells that determine their blood type. For example, before a blood transfusion is given to a patient, it is necessary to perform tests on the patient's blood and the donated blood. A small mistake in these cases can be fatal for the patient. Typically, antigens A and B (from the ABO blood group system) and antigen D (from the RH blood group system) are tested. Agglutination (clotting) of these antigens on red blood cells in the presence of foreign antibodies is used as a standard test for determining blood group, and traditionally this method is used on slides in laboratories. The technician first mixes the blood sample and antibody on a glass slide and observes it under a microscope after incubation (reaction time). The accuracy of the traditional method depends on the skill of the technician and this method does not provide high speed and high workload of laboratories. On the other hand, blood groups such as blood group MN can also be problematic if there is incompatibility between the donor and the recipient of blood. Because of the high cost and time spent on serological methods, it is not possible to perform all these compatibility tests in blood transfusion centers. M / N antigens occur only as a result of single amino acid polymorphisms in the glycophorin A protein. The difference between M and N antigens is a single amino acid at amino acid position (20), which corresponds to the M amino acid serine and the N amino acid leucine. This blood group is caused by a missense mutation in the rs7682260 polymorphism. Recent research has shown that molecular techniques have significant advantages over serological methods in terms of sensitivity and specificity, as well as time and cost. Genotyping will play an important role in the diagnosis of blood groups in the future. It should be noted that it will not replace serological methods, but it will allow a wide range of minor antigens of donors and patients to be examined and searched, and on the other hand, it will improve the quality of blood in reference laboratories and confirm the results obtained from serological methods. The new DNA-based genotyping kit is more convenient than the standard serological method and, as a new diagnostic kit, can be used as an alternative to serological methods. If patients are typed only for ABO and D before the first transfusion, it may be impossible to correctly detect other RBC antigens, including MN after repeated transfusions, by serological methods due to the formation of mixed-field agglutination. Serological methods, either standard agglutination or flow cytometry methods, often lead to false blood group typing results in mixed blood samples due to the repeated use of RBC concentrates that are only compatible for ABO and D. Many studies have been conducted on the genotyping of blood groups in Iran and other countries. In these studies, the most common method used for genotyping was ASO-PCR. While Flow cytometry, Real time PCR, and DNA microarray methods were used to a lesser extent, the method used in this invention, Tetra-ARMs-PCR, had not been used so far. The patent (patent No. CN101065499A) discloses a method for determining the genotype of ABO and RHD blood groups using multiplex PCR, which is a molecular method. The inventor was able to determine the genotype of individuals by using primers specific for polymorphic nucleotides that determine the genotype of that blood group. The patent (patent No EP1718661A4) discloses a diagnostic method for genotyping blood groups and platelet antigens. This invention also used a multiplex PCR method, which is based on single nucleotide polymorphisms determining the antigens. The patent (patent No. US20140255923A1) has determined the genotype of RHD blood group antigens using the multiplex PCR method. Difference: Unlike the multiplex PCR method, which requires 2 specific primers for each polymorphism point, the Tetra-ARMs-PCR method uses 4 primers. The new MN blood group genotyping kit here uses the Tetra-ARMs-PCR method, which is a new, rapid, sensitive, specific, and very inexpensive method. This method is used to detect single-point polymorphisms and uses two pairs of primers, one of which contains primers specific to allele 1 and the other contains primers specific to allele 2. Both primer pairs are poured into a microtube, which in this case forms two bands in homozygous cases and three bands in heterozygous cases. The patent (patent No EP0791076A1) discloses another diagnostic method that can genotype Kell blood group based on polymorphic points of Kell blood group and by molecular method PCR-RFLP[2]. This method consists of two separate steps including integration of standard PCR method and subsequent cleavage at the target region by restriction enzymes. Difference: The new MN blood group genotype detection kit here uses the Tetra-ARMs-PCR method, which is a new, rapid, sensitive, specific, and very inexpensive method. Unlike the PCR-RFLP method, which requires a PCR step plus an enzymatic cleavage step and a long incubation period, as well as two subsequent electrophoresis steps, it does not require the use of enzymes and can detect an individual's genotype with only one PCR step and one electrophoresis step (Figure 1, Difference between PCR-RFLP and Tetra-ARMs-PCR methods). Patent No. NL1044005A and Patent No. WO2014145870A2 (Patent No. CN104714035A) disclose another diagnostic method that uses a method for human blood group genotype analysis based on high throughput sequencing. This method requires whole genome sequencing and then introducing the mutated gene into K582 cells for high expression, and then performing a Western blot test to confirm the antigen type. Difference: As is known, this method requires a very high cost and the use of several molecular and cellular techniques to detect blood group, but in the Tetra-ARMs-PCR method, the genotype of an individual's blood group can be detected with only one PCR step and one electrophoresis step. Providing a solution to an existing technical problem accompanied by an accurate, sufficient, and integrated invention To determine the genotype of the MN blood group, the Tetra-ARMS-PCR method, which is a new, rapid, sensitive, specific, and very inexpensive method, is used. In this way, all homozygous and heterozygous states are determined with just one PCR run. For this purpose, a blood sample is taken from a patient with transfusion-dependent thalassemia. This sampling is in accordance with ISBT[3] standards and EDTA[4] anticoagulant is used. DNA extraction is performed from the blood sample with a standard kit, then the MN blood group system is examined by molecular method. Here, the Tetra-ARMs-PCR technique is used, then the amplified fragment in PCR is separated by electrophoresis and the formed bands are examined for the presence or absence of the allele. To confirm the work, the sample can be sequenced. The Tetra-ARMs-PCR method is used to determine the genotype of the MN blood group. In this way, with only one PCR process under completely similar temperature conditions and the same concentration of materials, all homozygous and heterozygous states of the MN blood group will be determined. The design of two primer pairs for the MN blood group is done in such a way that one of them contains primers specific to allele 1 and the other contains primers specific to allele 2. Both primer pairs are poured into a microtube, which in this case forms two bands in homozygous cases and three bands in heterozygous cases. Oligo 7 software and Nucleotide BLAST: Align two or more sequences using BLAST were used to design specific primers to determine the genotype of the MN blood group. The following describes the polymorphism characteristics (Table 1), bioinformatics details (Table 2), PCR conditions (Table 3 and Table 4), and primers (Table 5) used to determine the MN blood group genotype. Considering the difference in TM of the primers, the best temperature at which both products from the 4 primers were synthesized was selected using a temperature gradient to set the annealing temperature to the same. Steps 1) Library Studies and Bioinformatics 2) Selecting patients with thalassemia major and taking blood samples from them 3) Extracting DNA from the remaining blood samples taken from patients 4) Design of desired primers 5) Performing molecular tests to determine the genotype of the MN blood group Equipment and materials required for MN blood group genotype detection using Tetra-ARMs-PCR method 1) DNA sample 2) Inner and Outer primers related to S and s antigens 3) Taq DNA Polymerase 1.1x Master Mix RED (1.5 mM MgCl2 final concentration) 4) Thermocycler 5) Sampler and resampler 6) 0.2 ml microtube 7) 0.5 ml microtube 8) Distilled deionized water 9) DMSO[5] Table 1: Characteristics of the polymorphism determining the MN blood group GYPBA(MN) SNP rs7682260 � TTTTATACAGCAATTGTGAGCATATCAGCAT[C / T]AAGTACCACTGGTGTGGCCAATGCACACTTC rs7682260������������� MN 002 MNS MNS 46 GYPA, GYPB, GYPE -cro4 MNS��� GYPA��� M / N� �59C>T,��� �S20L Table 2: Bioinformatic characteristics of the MN blood group determining polymorphism Chr. position mRNA pos dbSNP rs# cluster id Hetero-zygosity MAF Clinical Significance Function dbSNP allele Protein residue Codon pos Amino acid pos 144120567 175 rs7682260 0.119 0.2851 - missense T Leu [L] 2 20 Table 3: Ingredients for Tetra-ARMs-PCR reaction for blood group MN Material amounts μl 10 PCR master mix 1.5 μl Primer forward inner 10 pmol 1.5 μl Primer reverse inner 10 pmol 0.8 μl Primer forward outer 10 pmol 0.8 μl Primer reverse outer 10 pmol μl 0.5 - 3 DNA template Remaining Up to 20 �l DW Table 4: Temperature cycle of Tetra-ARMs-PCR reaction for blood group MN Repeat Time Temperature (°C) 1 step 5 min 95 32 steps * 30 sec 95 45 sec 5 / 58 60 sec 72 1 step 5 min 72 *32 cycle / 2% gel Agaros / 60 min electrophoresis / Voltage: 85 � 160m Amp / With: TECHNE TC-512 Thermal cycler and BIO RAD Thermal cycler Table 5: PCR conditions, primer sequences and characteristics of the Tetra-ARMS-PCR technique for blood group MN Primer name Primer sequence TM (�C) Cycles Product (bp) MN blood group : T-ARMS-PCR technique F-MN-outer 5�- ATAAGGCCAATAATACAATACTTACCCACA -3� 58.5 32 Product size for C allele = MM: 685 Product size for T allele = NN: 226 Product size of two outer primers = MN: 860 R-MN-outer 5�- GAAAACTACAAGAGAGACTGCCACC-3� F-MN-inner-(C Allele) 5�- TACAGCAATTGTGAGCATATCAGCCTC -3� R-MN-inner-(T Allele) 5�- TGCATTGCCACACCAGTGGTACGTA -3� * Polymorphism-specific nucleotides are bold. Mismatches are underlined. PCR: Polymerase Chain Reaction, F: Forward, R; Reverse, FO; Forward Outer, RO; Reverse Outer, FI; Forward Inner, RI; Reverse Inner. To determine the MN blood group genotype, the Tetra-ARMs-PCR method (Figure 3 of the technical plan schematically shows this technique) is used (Figure 2 of the technical plan shows the results of electrophoresis of several patients and its confirmation by Sanger Sequencing using Chromase Lite software). Materials and equipment required for electrophoresis � Sampler and sampler head � Loading buffer[6] � Electrophoresis device � Safe stain � Ladder 50 and 100 bp � TAE buffer[7] � Agarose powder � Gel Documentation Device � Scales (Sartorius) How to prepare 2% agarose gel Ingredients for preparing 2% agarose gel Material Volume Agarose powder 1.4 gr TAE buffer 1% 70 ml We poured the mentioned amounts into an Erlenmeyer flask and heated it using a microwave. After the solution became clear, it was removed from the heat and about one drop of Safe stain was added to it. Method of performing electrophoresis on 2% agarose gel After preparing the gel and adding Safe stain, we poured this content into special cassettes of the electrophoresis machine. After pouring the gel into the cassette, a special comb was placed in the electrophoresis cassette. After the gel was completely solidified (about 30 minutes), we took out the comb. We placed the gel with its cassette in the electrophoresis tank that had been previously filled with TAE buffer. After placing the gel in the tank, about 5 microliters of Ladder (Size marker) was poured into the first well from the right. We used the second well as a negative control. The negative control consists of Master mix and primer without DNA sample. To load the samples in the remaining wells, between 3 and 6 microliters of the PCR product were added to the wells. By placing the electrophoresis tank lid and connecting the negative and positive pole wires, the current was established. By observing the red color in the Master mix, which is caused by the movement of the contents of the wells, the amount of DNA movement on the gel is estimated. After the completion of electrophoresis, the gel was removed from the tank and DNA bands were observed using the Gel Document device. The Safe stain in the gel creates fluorescence with the PCR product. The Gel Document device is equipped with UV light, which makes DNA bands visible. Kit materials and contents: 1) Inner and Outer primers for S and s antigens 2) Taq DNA Polymerase 1.1x Master Mix RED (1.5 mM MgCl2 final concentration) 3) Headsampler 4) 0.2 ml microtube 5) 0.5 ml microtube 6) Distilled deionized water 7) DMSO[8] 8) Safe stain 9) Ladder 50 and 100 bp 10) TAE buffer[9] 11) Agarose powder Explanation of shapes, patterns, and patterns According to the technical drawing, which is a schematic representation of the kit's functionality (Figure 3 of the technical drawing), the Tetra-ARMs-PCR method is used to detect the MN blood group genotype. In this way, with only one PCR process under completely similar temperature conditions and the same concentration of materials, all homozygous and heterozygous states of the MN blood group will be determined. Two primer pairs are designed for the MN blood group in such a way that one of them contains primers specific to the T allele and the other contains primers specific to the C allele. Both primer pairs are poured into a microtube, which in this case forms two bands in homozygous cases (Figure 2: second column S 14, homozygous SS for the T allele and third column S109, homozygous ss for the C allele) and three bands in heterozygous cases (Figure 2: first column, S 66, heterozygous S / s for the C and T alleles). Oligo 7 software and Nucleotide BLAST: Align two or more sequences using BLAST were used to design specific primers to determine the MN blood group genotype. The PCR amplified fragment is then separated by electrophoresis and the bands formed are examined for the presence or absence of the allele. The 831bp fragment (band) indicates the presence of the Ss blood group gene, the 569bp fragment indicates the presence of the C allele (blood group S), and the 315bp fragment indicates the presence of the T allele (blood group S). The absence of any of these fragments in the electrophoresis gel means the absence of the desired blood group gene. To confirm the work, the sample can be sequenced. A clear and precise statement of the advantages of the claimed invention over prior inventions. 1) Affordable and feasible, and much cheaper than serological methods 2) Short genotyping time compared to other molecular methods 3) The specificity of the primers for polymorphism points, which increases specificity compared to serological methods. 4) Sensitivity of this method: Due to the small amount of DNA, the desired sequence can be amplified to more than a billion copies for genotype detection. 1. Determining the genotype of people with thalassemia major, aplastic anemia, and sickle cell anemia, and other people who need frequent blood transfusions, and determining the appropriate blood groups for transfusion. 2. Reducing treatment costs due to the production of antibodies against incompatible blood groups and subsequent problems. 3. Reducing treatment stress caused by blood incompatibility A description of the minimum steps required to implement the invention. The method of using this diagnostic kit is as follows: to perform PCR, the Tetra-ARMs-PCR method is used. Then, the Inner and Outer primers corresponding to the M and N antigens of the MN blood group are placed together and simultaneously in a thermocycler, and then the blood group genotype is determined by horizontal electrophoresis, which results in a 685bp fragment indicating the presence of the C allele (blood group M) and a 226bp fragment indicating the presence of the T allele (blood group N). The 860bp fragment (band) indicates the presence of the MN blood group gene and is considered as a control. The absence of any of these fragments in the electrophoresis gel means the absence of the desired blood group gene. To confirm the work, the sample can be sequenced. The MN blood group molecular diagnosis kit is prepared in kits of 25, 50 and 100 pieces or in larger quantities upon consumer request. Each kit contains 7 vials, which the consumer must combine the ingredients as follows for each test and then place in the thermocycler according to the program provided. To view the test result, a 2% agarose horizontal electrophoresis routine is used. The users of this kit are provincial blood transfusion departments, research centers with molecular laboratories, medical diagnostic laboratories, and hospitals. Vol. / reaction Component Vial 10�L Taq DNA Polymerase Master Mix 1 1.5 μl Primer forward inner 2 1.5 μl Primer reverse inner 3 0.8 μl Primer forward outer 4 0.8 μl Primer reverse outer 5 μl 0.5 - 3 Temple DNA 6 Remaining Up to 20 �l Distilled Water 7 The thermocycler program that is provided to the consumer along with the kit instructions. Temperature Duration of cycle Cycles 95 5 min 1 95 30 Sec 32 58.5 45 Sec 72 60 Sec 72 5 min 1 Express mention of the industrial application of the invention To produce this kit in the industrial phase, the primer sequences for this blood group must be synthesized in large quantities and transferred specifically into the relevant vials with the relevant name and details, and instructions for use must be placed next to it in accordance with the explanations given in this description. Considering the above explanations, and the urgent need of all blood transfusion centers, medical diagnostic laboratories (more than 30,000 laboratories nationwide), hospital blood banks, Red Crescent centers, and most importantly, considering the high prevalence of thalassemia and other diseases related to continuous blood transfusion in Iran and the region, mass production of the above kit is completely economical and possible. This invention can be used in blood transfusion centers, medical diagnostic laboratories, hospital blood banks, Red Crescent centers, and generally in any situation where determining the blood type of individuals is deemed necessary. � [1] Tetra - primer amplification refractory mutation system - Polymerase Chain Reaction [2]Polymerase chain reaction - Restriction fragment length polymorphism [3]International Society of Blood Transfusion [4]Ethylene diamine tetra acetic acid [5] Dimethyl sulfoxide [6]Loading dye [7]Tris base, acetic acid and EDTA [8] Dimethyl sulfoxide [9]Tris base, acetic acid and EDTA
Claims
Claim What is claimed: Claim 1) The MN blood group genotype detection kit, using the Tetra-ARMs-PCR method, is capable of determining antigens related to the MN blood group. This kit includes products called primers related to M and N antigens specific for the rs7682260 polymorphism, which determines antigens related to the MN blood group. Claim 2) According to claim 1, the sequence of the FORWARD OUTER primer is as follows: FORWARD OUTER: F-MN-outer− 5'- ATAAGGCCAATAATACAATACTTACCACA -3'Control 860 bp Claim 3) According to claim 1, the sequence of the REVERSE OUTER primer is as follows: REVERSE OUTER: R-MN-outer − 5'- GAAAACTAACAAGAGAGACTGCCACC-3' Control 860 bp Claim 4) According to claim 1, the sequence of the INERE FORWARD primer is as follows: INERE FORWARD: F-MN-inner-(C Allele)− 5'- TACAGCAATTGTGAGCATATCAGC CTC -3' C allele = MM: 685 Claim 5) According to claim 1, the sequence of the INEER REVERSE primer is as follows: INEER REVERSE: R-MN-inner-(T Allele)− 5'- TGCATTGCCACACCAGTGGTAC GTA -3' T allele = NN: 226 Claim 6) According to claim number 1, the genotypic pattern of the rs7682260 polymorphism is examined by molecular methods on DNA extracted from all blood, fresh tissue, paraffin-embedded, and cell culture samples.