Ss blood group genotype detection kit using Tetra-ARMs-PCR method

Abstract

They use molecular methods to determine the genotype of red blood cells, which are not affected by repeated blood transfusions. Molecular techniques are superior to serological methods in terms of sensitivity and specificity, time and cost.\nThe importance of blood group Ss is in blood transfusion to people who have chronic and frequent blood transfusions, including people with thalassemia, aplastic anemia and sickle cell anemia.\nMethod: To determine the genotype of blood group Ss, the Tetra-ARMs-PCR method, which is a new, rapid, sensitive, specific and inexpensive method, is used. This method uses two pairs of primers. After DNA is extracted from the blood, the desired sequence is amplified by a thermocycler. 4 The primer is placed in a microtube and after only one PCR process, all homozygous and heterozygous states of the Ss blood group are determined. Subsequently, the amplified fragment in the PCR is separated by electrophoresis and the bands formed are examined for the presence or absence of the allele. \nDiscussion and Conclusion: The new kit for detecting the genotype of the Ss blood group with the Tetra-ARMs-PCR molecular method can prepare blood suitable for injection. \nKeywords: Kit, Genotype, Blood Group, Molecular Method, Ss

Description

Description of the invention Title of the invention Ss blood group genotype detection kit using Tetra-ARMs-PCR method Tetra-ARMs-PCR method and kit for Ss blood group genotyping Technical background This invention relates to the fields of blood transfusion, medicine, research, and diagnostics. Technical problem and objectives of the invention "MNSsU blood group system antigens" are formed on glycophorins or sialoglycoproteins. These proteins span the width of the blood cell membrane and have extracellular domains at the amino terminus and cytoplasmic domains at the carboxyl terminus. Expression of the Ss system is restricted to red blood cells, like the Arhash system. The S, S, and U antigens are located on the sialoglycoprotein B or delta, which is smaller than glycophorin A and has fewer copies than type A, about 170,000 to 250,000. The difference between the S and S antigens is a single amino acid at amino acid position (29), which corresponds to the S amino acid methionine and to the S amino acid threonine. Like many red blood cell-specific genes, the promoter region of the gene contains sequences for SP1 and (GATA1), which are erythroid regulatory transcription factors. The S and s antigens are codominant, or co-dominant. If a person is negative for the S antigen and positive for the s, the possibility of being homozygous for s (ss) is raised; Antibodies to S, S, and U are always clinically significant and are of the IgG type. Glycophorin B is associated with Ehrhäs antigens; therefore, in Ehrhäs null syndrome, there is a reduction in the expression of S, S, and U antigens. Enzymes degrade S antigens, and S antigen is sensitive to chlorine bleach and is destroyed. Some types of anti-S and anti-S have a dosage effect. Glycophorins A and B are likely to be receptors for Plasmodium falciparum. GYPA is also a receptor for the red blood cell parasite Babesia. The importance of blood type Ss is in hemolytic disease of the fetus and newborn (HDFN) and in blood transfusions for people who receive chronic and frequent blood transfusions, including people with thalassemia, aplastic anemia, or sickle cell anemia. The main treatment for thalassemia is bone marrow transplantation (BMT) and cord blood, but other treatments include blood transfusions, splenectomy, along with treatment of side effects and the use of adjunctive therapies such as hydroxyurea to reduce ineffective hematopoiesis. Among the treatments mentioned, blood transfusion is common because it has desirable therapeutic effects such as reducing tissue hypoxia caused by anemia, and the patient can also regain normal physical and social activity and stop defective RBC production due to inhibition of BM. If diagnosed on time and blood transfusion is started at the right time for the patient, skeletal disorders and skull deformities of the patient will be prevented.But blood transfusion is a double-edged sword. In addition to the benefits mentioned, it can cause problems in the individual, including acute hemolytic reactions, delayed hemolytic reactions due to the formation of autoantibodies against blood groups (including blood group Ss), febrile non-hemolytic reactions due to the formation of autoantibodies against leukocyte and platelet antigens, allergic reactions, increased iron load, and infections. In the meantime, delayed hemolytic reactions that occur due to the formation of autoantibodies following repeated blood transfusions against blood groups are common. Autoantibodies are antibodies that the body's immune system produces against foreign antigens (naturally or innately). Natural antibodies are antibodies that are produced early in life against foreign antigens. For example, in blood group B, anti-A is naturally present. However, immune-type antibodies are antibodies that are produced when a person's immune system comes into contact with foreign antigens.Late hemolytic reactions often occur 5-10 days after blood transfusion and in most cases, the patient presents with anemia, lethargy and jaundice. Sometimes the amount of antibodies produced decreases, but with the reinfusion of blood containing a specific antigen, hemolytic crisis occurs in the body. The frequency of alloimmunization has been reported to be 37.2% to 50% in different parts of the world. Iran has a high prevalence of thalassemia, especially in provinces such as Khuzestan and Sistan and Baluchestan. To reduce the complications of blood transfusion, we can examine the patient's blood sample to identify antibodies and select blood that does not contain the antigen against which the patient has produced antibodies in subsequent blood transfusions. It is also possible to identify the patient's phenotypic and genotypic pattern before starting blood transfusion. For example, the combination of A, B and O alleles determines the individual's genotype, while the blood type indicates the individual's phenotype. Serological methods are usually used to examine the phenotype of RBCs. These methods examine the antigen-antibody reaction in vitro, in fact, through hemagglutination.However, many studies have shown that serological methods in patients who have received blood transfusions are problematic due to the antibody staining of the patient's RBCs and the mixed RBC population, and as a result, the interpretation of hemagglutination results will be unreliable. On the other hand, substitution and deletion mutations, which cause thalassemia and α-thalassemia, respectively, are responsible for the creation of gene fragments of different lengths. Given these problems, molecular methods can be used to detect the genotype of RBCs that are not affected by successive blood transfusions. Molecular methods have many applications in immunohematology, including the detection of antigen genotypes in patients who have recently received transfusions, RBCs that are DAT positive, the detection of D antigen, and also in the diagnosis of hemolytic disease of the fetus and newborn (HDFN). Given that molecular methods have considerable sensitivity and specificity compared to serological methods, and that no invention has been made so far with the Tetra-ARMs-PCR[1] method for diagnosing the Ss blood group genotype in people who receive chronic and frequent blood transfusions (including people with thalassemia, aplastic anemia, or sickle cell anemia), we decided to design a new diagnostic kit in this field, with the aim of being able to determine the Ss blood group genotype using a molecular method for patients and prepare suitable blood for transfusion, and in this regard, take an important step towards improving the health status of these patients. Prior knowledge and history of existing developments "Many blood-related organizations, including blood transfusion organizations, the Red Crescent, etc., perform tests on blood samples, and in many cases it is necessary to determine the person's blood type and to identify the genetic antigens on the person's blood cells that determine their blood type. For example, before a blood transfusion is given to a patient, it is necessary to perform tests on the patient's blood and the donated blood. A small mistake in these cases can be fatal for the patient. Typically, antigens A and B (from the ABO blood group system) and antigen D (from the RH blood group system) are tested. Agglutination (clotting) of these antigens on red blood cells in the presence of foreign antibodies is used as a standard test for determining blood group, and traditionally this method is used on slides in laboratories. The technician first mixes the blood sample and antibody on a glass slide and observes it under a microscope after incubation (reaction time). The accuracy of the traditional method depends on the skill of the technician and this method does not provide high speed and high workload of laboratories. On the other hand, blood groups such as blood group Ss can also be problematic if there is incompatibility between the donor and the recipient of blood. Because of the high cost and time spent on serological methods, it is not possible to perform all these compatibility tests in blood transfusion centers. The S / s antigens arise only as a result of single amino acid polymorphisms in the glycophorin B protein. The difference between the S and s antigens is a single amino acid at amino acid position 48 (29), which corresponds to the S amino acid methionine and the s amino acid threonine. This blood group is caused by a missense mutation in the rs7683365 polymorphism. Recent research has shown that molecular techniques have significant advantages over serological methods in terms of sensitivity and specificity, as well as time and cost. Genotyping will play an important role in the diagnosis of blood groups in the future. It should be noted that it will not replace serological methods, but it will allow a wide range of minor antigens of donors and patients to be examined and searched, and on the other hand, it will improve the quality of blood in reference laboratories and confirm the results obtained from serological methods. The new DNA-based genotyping kit is easier to use than the standard serological method and, as a new diagnostic kit, can be used as an alternative to serological methods. If patients are typed only for ABO and D before the first transfusion, it may be impossible to correctly detect other RBC antigens, including ‘Ss after repeated transfusions’, by serological methods due to the formation of mixed-field agglutination. Serological methods, either standard agglutination or flow cytometry methods, often lead to false blood group typing results in mixed-field blood samples due to the repeated use of RBC concentrates that are only matched for ABO and D. Many studies have been conducted on the genotyping of blood groups in Iran and other countries. In these studies, the most common method used for genotyping was ASO-PCR. While Flow cytometry, Real time PCR, and DNA microarray methods were used to a lesser extent, the method used in this invention, Tetra-ARMs-PCR, had not been used so far. The patent (patent No. CN101065499A) discloses a method for determining the genotype of ABO and RHD blood groups using multiplex PCR, which is a molecular method. The inventor was able to determine the genotype of individuals by using primers specific for polymorphic nucleotides that determine the genotype of that blood group. The patent (patent No EP1718661A4) discloses a diagnostic method for genotyping blood groups and platelet antigens. This invention also used a multiplex PCR method, which is based on single nucleotide polymorphisms determining the antigens. The patent (patent No. US20140255923A1) has determined the genotype of RHD blood group antigens using the multiplex PCR method. Difference: Unlike the multiplex PCR method, which requires 2 specific primers for each polymorphism point, the Tetra-ARMs-PCR method uses 4 primers. The new Ss blood group genotyping kit here uses the Tetra-ARMs-PCR method, which is a new, rapid, sensitive, specific, and very inexpensive method. This method is used to detect single-point polymorphisms and uses two pairs of primers, one of which contains primers specific to allele 1 and the other contains primers specific to allele 2. Both primer pairs are poured into a microtube, which in this case forms two bands in homozygous cases and three bands in heterozygous cases. The patent (patent No EP0791076A1) discloses another diagnostic method that can genotype Kell blood group based on polymorphic points of Kell blood group and by molecular method PCR-RFLP[2]. This method consists of two separate steps including integration of standard PCR method and subsequent cleavage at the target region by restriction enzymes. Difference: The new kit for detecting the genotype of the Ss blood group here uses the Tetra-ARMs-PCR method, which is a new, rapid, sensitive, specific and very cheap method. Unlike the PCR-RFLP method, which requires a PCR step plus an enzymatic cleavage step and a long incubation period, as well as two subsequent electrophoresis steps, it does not require the use of enzymes and can detect the individual's genotype with only one PCR step and one electrophoresis step (Figure 1, Difference between PCR-RFLP and Tetra-ARMs-PCR methods). Patent No. NL1044005A and Patent No. WO2014145870A2 (Patent No. CN104714035A) disclose another diagnostic method that uses a method for human blood group genotype analysis based on high throughput sequencing. This method requires whole genome sequencing and then introducing the mutated gene into K582 cells for high expression, and then performing a Western blot test to confirm the antigen type. Difference: As is known, this method requires a very high cost and the use of several molecular and cellular techniques to detect blood group, but in the Tetra-ARMs-PCR method, the genotype of an individual's blood group can be detected with only one PCR step and one electrophoresis step. Providing a solution with a detailed, sufficient and integrated description of the invention To detect the genotype of the Ss blood group, the Tetra-ARMS-PCR method, which is a new, rapid, sensitive, specific, and very inexpensive method, is used. In this way, all homozygous and heterozygous states are determined with just one PCR run. For this purpose, a blood sample is taken from a patient with transfusion-dependent thalassemia. This sampling is in accordance with ISBT[3] standards and EDTA[4] anticoagulant is used. DNA extraction is performed from the blood sample with a standard kit, then the Ss blood group system is examined by molecular method. Here, the Tetra-ARMs-PCR technique is used, then the amplified fragment in PCR is separated by electrophoresis and the formed bands are examined for the presence or absence of the allele. To confirm the work, the sample can be sequenced. The Tetra-ARMs-PCR method is used to determine the genotype of the Ss blood group. In this way, with only one PCR process under completely similar temperature conditions and the same concentration of materials, all homozygous and heterozygous states of the Ss blood group will be determined. The design of two primer pairs for the Ss blood group is done in such a way that one of them contains primers specific to allele 1 and the other contains primers specific to allele 2. Both primer pairs are poured into a microtube, which in this case forms two bands in homozygous cases and three bands in heterozygous cases. Oligo 7 software and Nucleotide BLAST: Align two or more sequences using BLAST were used to design specific primers to determine the genotype of the Ss blood group. The following describes the polymorphism characteristics (Table 1), bioinformatics details (Table 2), PCR conditions (Table 3 and Table 4), and primers (Table 5) used to determine the Ss blood group genotype. Considering the difference in TM of the primers, the best temperature at which both products from the four primers were synthesized was selected using a temperature gradient to set the annealing temperature to the same. Steps 1) Library Studies and Bioinformatics 2) Selecting patients with thalassemia major and taking blood samples from them 3) Extracting DNA from the remaining blood samples taken from patients 4) Design of desired primers 5) Performing molecular tests to determine the genotype of blood group Ss Equipment and materials required for detecting the genotype of blood group Ss using the Tetra-ARMs-PCR method 1) DNA sample 2) Inner and Outer primers related to S and s antigens 3) Taq DNA Polymerase 1.1x Master Mix RED (1.5 mM MgCl2 final concentration) 4) Thermocycler 5) Sampler and presampler 6) 0.2 ml microtube 7) 0.5 ml microtube 8) Distilled deionized water 9) DMSO[5] Table 1: Characteristics of the polymorphism determining the Ss blood group , GYPB (Ss) SNP rs7683365 CCCTTCTTCAGTCACAAAGAGTTACATCTCATCACAGACAAATGGAGAAA[C / T]GGGACAACTTGTCCATCGTTTCACTGTACCAGC >NG_007483.3 Homo sapiens glycophorin B (MNS blood group) (GYPB), RefSeqGene on chromosome 4 Ss 002 MNS MNS 46 GYPA, GYPB, GYPE -cro4 MNS�� GYPB� s / S 143C>T�� T48M (T29Mc) Table 2: Bioinformatic characteristics of the polymorphism determining blood group Ss Chr. position mRNA pos dbSNP rs# cluster id Hetero-zygosity MAF Clinical Significance Function dbSNP allele Protein residue Codon pos Amino acid pos 143999443 199 rs7683365 0.452 0.2352 - missense A Lys [K] 2 48 Table 3: Tetra-ARMs-PCR reaction ingredients for blood group Ss Material amounts μl 10 PCR master mix 1.5 μl Primer forward inner 10 pmol 1.5 μl Primer reverse inner 10 pmol 0.8 μl Primer forward outer 10 pmol 0.8 μl Primer reverse outer 10 pmol μl 0.5 - 3 DNA template Remaining Up to 20 �l DW Table 4: Temperature cycle of Tetra-ARMs-PCR reaction for blood group Ss Repeat Time Temperature (°C) 1 step 5 min 95 32 steps * 30 sec 95 45 sec 5 / 58 60 sec 72 1 step 5 min 72 *32 cycle / 2% gel Agaros / 60 min electrophoresis / Voltage: 85 � 160m Amp / With: TECHNE TC-512 Thermal cycler and BIO RAD Thermal cycler Table 5: PCR conditions, primer sequences and characteristics of the Tetra-ARMS-PCR technique for blood group Ss Primer name Primer sequence TM (�C) Cycles Product (bp) Ss blood group : T-ARMS-PCR technique F-sS-outer 5�- TTCTTCCAATACTTTCTCATTCCTTTCC -3� 58.5 32 Product size for C allele = ss: 569 Product size for T allele = SS: 315 Product size of two outer primers = sS: 831 R-sS-outer 5�- TTTACTTATGTATTGTTTTTGAGACAGG-3� F-sS-inner-(C allele) 5�- ACATTGAAATTTTGCTTTATAGGAGACAC -3� R-sS-inner-(T allele) 5�- GTGAAACGATGGACAAGTTGTCACA -3� * Polymorphism-specific nucleotides are bold. Mismatches are underlined. PCR: Polymerase Chain Reaction, F: Forward, R; Reverse, FO; Forward Outer, RO; Reverse Outer, FI; Forward Inner, RI; Reverse Inner. To determine the genotype of the Ss blood group, the Tetra-ARMs-PCR method (Figure 3 of the technical plan schematically shows this technique) is used (Figure 2 of the technical plan shows the results of electrophoresis of several patients and its confirmation by the Sanger Sequencing method with Chromase Lite software). Materials and equipment required for electrophoresis � Sampler and sampler head � Loading buffer[6] � Electrophoresis device � Safe stain � Ladder 50 and 100 bp � TAE buffer[7] � Agarose powder � Gel Documentation Device � Scales (Sartorius) How to prepare agarose gel%2 Ingredients for preparing 2% agarose gel Material Volume Agarose powder 1.4 gr TAE buffer 1% 70 ml We poured the mentioned amounts into an Erlenmeyer flask and heated it using a microwave. After the solution became clear, it was removed from the heat and about one drop of Safe stain was added to it. Method of performing electrophoresis on 2% agarose gel After preparing the gel and adding Safe stain, we poured this content into special cassettes of the electrophoresis machine. After pouring the gel into the cassette, a special comb was placed in the electrophoresis cassette. After the gel was completely solidified (about 30 minutes), we took out the comb. We placed the gel with its cassette in the electrophoresis tank that had been previously filled with TAE buffer. After placing the gel in the tank, about 5 microliters of Ladder (Size marker) was poured into the first well from the right. We used the second well as a negative control. The negative control consists of Master mix and primer without DNA sample. To load the samples in the remaining wells, between 3 and 6 microliters of the PCR product were added to the wells. By placing the electrophoresis tank lid and connecting the negative and positive pole wires, the current was established. By observing the red color in the Master mix, which is caused by the movement of the contents of the wells, the amount of DNA movement on the gel is estimated. After the completion of electrophoresis, the gel was removed from the tank and DNA bands were observed using the Gel Document device. The Safe stain in the gel creates fluorescence with the PCR product. The Gel Document device is equipped with UV light, which makes DNA bands visible. Kit materials and contents: 1) Inner and Outer primers for S and s antigens 2) Taq DNA Polymerase 1.1x Master Mix RED (1.5 mM MgCl2 final concentration) 3) Headsampler 4) 0.2 ml microtube 5) 0.5 ml microtube 6) Distilled deionized water 7) DMSO[8] 8) Safe stain 9) Ladder 50 and 100 bp 10) TAE buffer[9] 11) Agarose powder Explanation of shapes, maps and diagrams According to the technical drawing, which is a schematic representation of the kit's functionality (Figure 3 of the technical drawing), the Tetra-ARMs-PCR method is used to detect the Ss blood group genotype. In this way, with only one PCR process under completely similar temperature conditions and the same concentration of materials, all homozygous and heterozygous states of the Ss blood group will be determined. Two primer pairs are designed for the Ss blood group in such a way that one of them contains primers specific to the T allele and the other contains primers specific to the C allele. Both primer pairs are poured into a microtube, which in this case forms two bands in homozygous cases (Figure 2: second column S 14 homozygous SS for the T allele and third column S109 homozygous ss for the C allele) and three bands in heterozygous cases (Figure 2: first column, S 66 heterozygous S / s for the C and T alleles). Oligo 7 software and Nucleotide BLAST: Align two or more sequences using BLAST were used to design specific primers to determine the genotype of the Ss blood group. The PCR amplified fragment is then separated by electrophoresis and the bands formed are examined for the presence or absence of the allele. The 831bp fragment (band) indicates the presence of the Ss blood group gene, the 569bp fragment indicates the presence of the C allele (blood group S), and the 315bp fragment indicates the presence of the T allele (blood group S). The absence of any of these fragments in the electrophoresis gel means the absence of the desired blood group gene. To confirm the work, the sample can be sequenced. Benefits of the invention 1) Affordable and feasible, and much cheaper than serological methods 2) Short genotyping time compared to other molecular methods 3) The specificity of the primers for polymorphism points, which increases specificity compared to serological methods. 4) Sensitivity of this method: Due to the small amount of DNA, the desired sequence can be amplified to more than a billion copies for genotype detection. 1. Determining the genotype of people with thalassemia major, aplastic anemia, and sickle cell anemia, and other people who need frequent blood transfusions, and determining the appropriate blood groups for transfusion. 2. Reducing treatment costs due to the production of antibodies against incompatible blood groups and subsequent problems. 3. Reducing treatment stress caused by blood incompatibility Explain at least one implementation method. The method of using this diagnostic kit is as follows: To perform PCR, the Tetra-ARMs-PCR method is used. Then, the Inner and Outer primers corresponding to the S and s antigens of the Ss blood group are placed together and simultaneously in a thermocycler, and then the blood group genotype is determined by horizontal electrophoresis, which results in a 569bp fragment indicating the presence of the C allele (blood group s) and a 315bp fragment indicating the presence of the T allele (blood group S). The 831bp fragment (band) indicates the presence of the Ss blood group gene and is considered as a control. The absence of any of these fragments in the electrophoresis gel means the absence of the desired blood group gene. To confirm the work, the sample can be sequenced. The Ss blood group molecular diagnosis kit is prepared in kits of 25, 50 and 100 pieces or in higher quantities upon consumer request. Each kit contains 7 vials, which the consumer must combine the ingredients as follows for each test and then place in the thermocycler according to the program provided. To view the test result, a 2% agarose horizontal electrophoresis routine is used. The users of this kit are provincial blood transfusion departments, research centers with molecular laboratories, medical diagnostic laboratories, and hospitals. Vol. / reaction Component Vial 10�L Taq DNA Polymerase Master Mix 1 1.5 μl Primer forward inner 2 1.5 μl Primer reverse inner 3 0.8 μl Primer forward outer 4 0.8 μl Primer reverse outer 5 μl 0.5 - 3 Temple DNA 6 Remaining Up to 20 �l Distilled Water 7 The thermocycler program that is provided to the consumer along with the kit instructions. Temperature Duration of cycle Cycles 95 5 min 1 95 30 Sec 32 58.5 45 Sec 72 60 Sec 72 5 min 1 Industrial application of the invention To produce this kit in the industrial phase, the primer sequences for this blood group must be synthesized in large quantities and transferred specifically into the relevant vials with the relevant name and details, and instructions for use must be placed next to it in accordance with the explanations given in this description. Considering the above explanations, and the urgent need of all blood transfusion centers, medical diagnostic laboratories (more than 30,000 laboratories nationwide), hospital blood banks, Red Crescent centers, and most importantly, considering the high prevalence of thalassemia and other diseases related to continuous blood transfusion in Iran and the region, mass production of the above kit is completely economical and possible. This invention can be used in blood transfusion centers, medical diagnostic laboratories, hospital blood banks, Red Crescent centers, and generally in any situation where determining the blood type of individuals is deemed necessary. � [1] Tetra - primer amplification refractory mutation system - Polymerase Chain Reaction [2]Polymerase chain reaction - Restriction fragment length polymorphism [3]International Society of Blood Transfusion [4]Ethylene diamine tetra acetic acid [5] Dimethyl sulfoxide [6]Loading dye [7]Tris base, acetic acid and EDTA [8] Dimethyl sulfoxide [9]Tris base, acetic acid and EDTA

Claims

Claim What is claimed: Claim 1) The Ss blood group genotype detection kit detects antigens related to the Ss blood group using the Tetra-ARMs-PCR method, and this kit includes products called primers related to the S and s antigens specific for the rs7683365 polymorphism, which determines the antigens related to the Ss blood group. Claim 2) According to claim number 1: The sequence of the FORWARD OUTER primer is as follows: FORWARD OUTER: F-sS-outer− 5'- TTCTTCCAATACTTTCTCATTCCTTTCC -3'Control 831 bp Claim 3) According to claim number 1: The sequence of the REVERSE OUTER primer is as follows: REVERSE OUTER: R-sS-outer− 5'- TTTACTTATGTATTTGTTTTTGGAGACAGG-3' #x200f #x200f Control 831 bp Claim 4) According to claim number 1: The sequence of the INERE FORWARD primer is as follows: INERE FORWARD: F-sS-inner-(C allele) #x200f #x200f − 5'- ACATTGAAATTTTGCTTTATAGGAGGA CAC -3' C allele = ss: 569 Claim 5) According to claim number 1: The sequence of the INEER REVERSE primer is as follows: INEER REVERSE: R-sS-inner-(T allele)−5'- GTGAAACGATGGACAAGTTGTCACA -3' #x200f #x200f T allele = SS: 315 Claim 6) According to claim number 1: The genotypic pattern of the rs7683365 polymorphism is examined by molecular methods on DNA extracted from all blood, fresh tissue, paraffin-embedded, and cell culture samples.

Images