Oligonucleotides for inducing paternal UBE3A expression

Abstract

The invention relates to oligonucleotides capable of inducing expression of the paternal allele of the ubiquitin protein E3A ligase (UBE3A) in animal or human neurons. The suppressor oligonucleotides target the paternal UBE3A allele by hybridizing to the non-coding long downstream RNA SNHG14 of SNORD109B. The invention also relates to pharmaceutical compositions and methods of treating Engelman syndrome.

Description

Oligonucleotides for inducing paternal UBE3A expression Field of invention The invention relates to oligonucleotides (oligomers) that are complementary to and hybridize to SNHG14 downstream of SNORD109B, which results in the induction of paternal expression of the protein-ubiquitin ligase E3A (UBE3A) in an animal or human. The invention also relates to pharmaceutical compositions and methods of treating Engelman syndrome. History of the invention Engelman syndrome is a genetic neurological disorder caused by deletion or inactivation of the UBE3A gene on the inherited chromosome 15q11.2. The paternal copy of the UBE3A gene is subject to genomic imprinting and silencing in neurons by a native UBE3A antisense transcript called SNHG14 (also called UBE3A-ATS) (Meng et al. 2012 Hum Mol Genet. Vol. 21 pp. 3001–12). Cell types other than neurons appear to express the UBE3A gene from both the maternal and paternal alleles. Engelman syndrome is characterized by severe intellectual and developmental disabilities, sleep disorders, seizures, jerky movements, EEG abnormalities, frequent laughter or smiling, and profound language impairment. WO 2012 / 064806 discloses a method of inducing UBE3A expression in a cell using a topoisomerase inhibitor. This method can be used to treat Engelman syndrome. Antisense oligonucleotides are not disclosed. WO 2014 / 004572 discloses an oligonucleotide with a 2'-O-methoxyethyl-RNA (MOE) modification targeting mouse UBE3A-ATS. The oligonucleotides are only tested in mouse assays. There is no conservation between mouse and human in the region downstream of the MBII-52 snoRNA (also called SNORD115) and upstream of the UBE3A pre-mRNA. Therefore, oligonucleotides targeting mouse UBE3A-ATS cannot be translated into oligonucleotides that function in a human. No oligonucleotide targeting human UBE3A-ATS is disclosed. The purpose of this invention This invention identifies novel oligonucleotides that induce paternal expression of human UBE3A in neurons without significant expression of the paternal transcripts SNORD115, SNORD116, and SNRPN. Summary of the invention The invention relates to oligonucleotides targeting a nucleic acid capable of suppressing the expression of UBE3A and to the treatment or prevention of diseases associated with reduced UBE3A activity, particularly in neuronal cells. Accordingly, in a first aspect, the invention provides oligonucleotides comprising a contiguous nucleotide sequence of 10 to 30 nucleotides in length with at least 98% complementarity to a portion of a long human non-coding RNA corresponding to positions 25278410 to 25419462 on human chromosome 15 version GRCh38.p2. This region is also identical to SEQ ID NO: 1. The oligonucleotide may be an antisense oligonucleotide, and preferably of discrete design. Preferably, the oligonucleotide is capable of stimulating UBE3A expression, in particular paternal UBE3A tumor expression in a neuron, by destroying, reducing or removing the UBE3A repressor, in particular by reducing the length of the downstream non-coding RNA SNORD109B transcription factor SNHG14. Re-expression of UBE3A is achieved without significantly affecting the expression of SNORD115. Destruction of the target nucleic acid is preferably accomplished through the use of nucleases. In one aspect, this invention provides pharmaceutical compositions comprising the oligonucleotides of this invention and pharmaceutically acceptable diluents, carriers, salts and / or adjuvants thereof. In one aspect, the invention provides methods of inducing in vivo and in vitro expression in a target cell in which UBE3A expression is suppressed, by administering an oligonucleotide of the invention in an effective amount to said cell. In another aspect, the invention provides methods of treating or preventing a disease, disorder, or dysfunction associated with UBE3A activity in vivo comprising administering a therapeutically or prophylactically effective amount of an oligonucleotide of the invention to a subject suffering from or susceptible to the disease, disorder, or dysfunction. In another aspect, the oligonucleotide or compound of the invention is used to treat or prevent Engelman syndrome. Brief description of the shapes Figure 1: The upper strand shows the SNHG14 transcriptional region downstream of SNORD109B (UBE3A-ATS), where the black boxes indicate the soluble location of the mouse oligonucleotides tested. The lower strand shows the UBE3A coding region, where the black boxes indicate the exons. Exon 1 is located at approximately 160 kb. The oligonucleotides are located in the antisense region 9 (located at ~97 kb), exon 10 (located at ~92 kb), exon 13 (located at ~77 kb), and the 5' end of exon 16 (located at ~60 kb). Figure 2: Demonstration of the ability of oligonucleotides, tested in Example 2, to induce re-expression of UBE3A in human neuronal cell cultures. Oligonucleotides complementary to the human SNHG14 non-coding RNA region of length between SNORD109B and the region upstream of the UBE3A coding region (positions 1 to 55318 of SEQ ID NO: 1) are indicated by non-overlap . Oligonucleotides complementary to the human SNHG14 non-coding RNA region of length that is antisense to the UBE3A pre-mRNA (positions 55319 to 141053 of SEQ ID NO: 1) are indicated by overlap . Oligonucleotides from Table 3 with conservation to human and rhesus monkey are indicated at the bottom of each plot as . Conservation between human:rhesus:mouse is indicated by . Oligonucleotide concentrations were 0.2, 1, and 5 microM, as indicated in each panel on the right. Definitions Oligonucleotides The term "oligonucleotide" is understood by those skilled in the art to mean a molecule consisting of two or more covalently linked nucleosides. Such covalently linked nucleosides may be referred to as nucleic acid molecules or oligomers. Oligonucleotides are typically made in the laboratory using solid state chemical synthesis followed by purification. When referring to an oligonucleotide sequence, the sequence or arrangement of nucleobase moieties or variations thereof from covalently linked nucleotides or nucleosides is referred to. Oligonucleotides of the invention are man-made and are derived from chemical synthesis and are typically purified or isolated. Oligonucleotides of the invention may include one or more modified nucleosides or nucleotides. Antisense oligonucleotides The term "antisense oligonucleotide" as used herein means an oligonucleotide capable of modulating the expression of a target gene by hybridizing to a target nucleic acid, particularly to a contiguous sequence on a target nucleic acid. Antisense oligonucleotides are generally not double-stranded and are therefore not siRNAs. Preferably, the antisense oligonucleotides of the invention are single-stranded. Contiguous nucleotide sequence The term "contiguous nucleotide sequence" as used herein is a region of an oligonucleotide that is complementary to a target nucleic acid. This term is also used herein in place of the term "contiguous nucleobase sequence" and the term "oligonucleotide motif sequence". In some configurations, the oligonucleotide nucleotides are present in a contiguous nucleotide sequence. In some configurations, the oligonucleotide comprises a contiguous nucleotide sequence and may optionally comprise nucleotide(s), for example a nucleotide linker region that can be used to attach a functional group to the contiguous nucleotide sequence. The nucleotide linker region may or may not be complementary to the target nucleic acid. Nucleotide Nucleotides are the building blocks of oligonucleotides and polynucleotides, and in this invention include both natural and unnatural nucleotides. In nature, nucleotides, such as DNA and RNA nucleotides, consist of a ribose half-molecule, a nucleobase half-molecule, and one or more phosphate groups (which are absent in nucleosides). Nucleosides and nucleotides may also be referred to interchangeably as "units" or "monomers". Modified nucleoside The term "modified nucleoside" or "nucleoside modification" in this context means that modified nucleosides are modified in comparison to DNA or DNA nucleoside equivalents by introducing one or more minor changes in the sugar half-molecule or the (nucleo)base half-molecule. In a preferred configuration, the modified nucleoside comprises a modified sugar half-molecule. The term modified nucleoside can also be used in the form of "nucleoside analogs" or modified "units" or "monomers". Modified internucleoside linkage The term "modified internucleoside linkage" is defined by one of ordinary skill in the art as a linkage other than a phosphodiester (PO) linkage that covalently couples two nucleosides together. Nucleosides with a modified linkage are also referred to as "modified nucleotides." In some configurations, a modified internucleoside linkage increases the nitrogen resistance of the oligonucleotide compared to a phosphodiester linkage. For natural oligonucleotides, the internucleoside linkage includes phosphate groups forming a phospho-sodium bond of the adjacent internucleoside linkage. Modified internucleoside linkages are particularly useful in stabilizing oligonucleotides for in vivo use and may serve to protect against cleavage of the DNA or RNA nucleoside regions in the oligonucleotides of the invention, for example in the cleavage region of gapmer oligonucleotides, as well as in modified nucleoside regions. In one embodiment, the oligonucleotide comprises one or more internucleoside linkages modified from a natural phosphodiester to a linkage that is, for example, more resistant to nuclease attack. Nucleoresistance may be determined by incubating the oligonucleotide in blood serum or by using a nuclease resistance assay (e.g., snake venom phosphodiesterase (SVPD)), both of which are well known in the art. Internucleoside linkages that are capable of increasing the nuclease resistance of an oligonucleotide are termed nuclease-resistant internucleoside linkages. In preferred embodiments, at least 50% of the internucleoside linkages in the oligonucleotide or its contiguous nucleotide sequence are modified, such as at least 60%, such as at least 70%, such as at least 80% or at least 90% of the internucleoside linkages in the oligonucleotide or its contiguous nucleotide sequence. It is understood that, in some configurations, the nucleosides that link the oligonucleotides of this invention to a non-nuclear functional group, such as a conjugate, may be phosphodiesters.In some configurations, all internucleoside junctions, or their contiguous nucleotide sequence, are nucleophilic internucleoside junctions. Modified internucleoside linkages can be selected from the group consisting of phosphorothionate, diphosphorotionate and borane phosphate. In preferred configurations, modified internucleoside linkages are compatible with RNaseH utilization by the oligonucleotides of the invention, for example phosphorothionate, diphosphorotionate and borane phosphate. In some configurations, the modified internucleoside linkages contain sulfur (S), such as a phosphorothioate internucleoside linkage. A phosphorothioate internucleoside linkage is particularly useful due to its resistance to nucleolysis, advantageous pharmacokinetics, and ease of manufacture. In preferred configurations, at least 50% of the internucleoside linkages in the oligonucleotides or their contiguous nucleotide sequences are phosphorothioates, such as at least 60%, including at least 70%, including at least 80%, or at least 90% of the internucleoside linkages in the oligonucleotides or their contiguous nucleotide sequences are phosphorothioates. In some configurations, all of the internucleoside linkages in the oligonucleotides or their contiguous nucleotide sequences are phosphorothioates. In some configurations, the oligonucleotides comprise one or more internucleoside linkages, particularly an internucleoside linkage selected from phosphotriester, methylphosphonate, MMI, amide-3, formasterol, or thioformasterol. The internucleoside linkage is disclosed in WO2009 / 124238 (incorporated herein by reference). In one embodiment, the internucleoside linkage is selected from the linkers disclosed in WO2007 / 031091 (incorporated herein by reference). In particular, the internucleoside linkage may be selected from -OP(O)2-O-, -OP(O,S)-O-, -OP(S)2-O-, -SP(O)2-O-, -SP(O,S)-O-, -SP(S)2-O-, -OP(O)2-S-, -OP(O,S)-S-, -SP(O)2-S-, -O-PO(RH)-O-, 0-PO(OCH3)-0-, -O-PO(NRH)-O-, -O-PO(OCH2CH2S-R)-O-, -O-PO(BH3)-O-, -O-PO(NHRH)-O-, -OP(O)2-NRH-, -NRH-P(O)2-O-, -NRH-CO-O-, -NRH-CO-NRH- The internucleoside linkage may be selected from the group consisting of: -O-CO-O-, -O-CO-NRH-, -NRH-CO-CH2-, -O-CH2-CO-NRH-, -O-CH2-CH2-NRH-, -CO-NRH-CH2-, -CH2-NRHCO-, -O-CH2-CH2-S-, -S-CH2-CH2-O-, -S-CH2-CH2-S-, -CH2-SO2-CH2-, -CH2-CO-NRH-, -O-CH2-CH2-NRH-CO -, -CH2-NCH3-O-CH2- where RH is selected from hydrogen and C1-4-alkyl. Nucleo-resistant linkages are particularly useful for phosphosite linkages in regions of the oligonucleotide that are capable of attracting nucleases when forming a duplex with the target nucleic acid, such as the G region for gapmers or the unmodified nucleoside region of hemers and telmers. Phosphothionate linkages may also be useful for regions that do not utilize nucleases and / or affinity-enhancing regions, such as the F and F' regions for gapmers, or the unmodified nucleoside region of hemers and telmers. Any of the design regions may however form internucleoside linkages other than phosphorothioate, such as phosphodiester linkages, particularly in regions where modified nucleosides, such as LNA, protect the linkage from nitrogen-degrading degradation. The addition of steric phosphodiester linkages, such as one or two linkages, particularly between modified or adjacent nucleoside units (typically in non-core regions) can alter the bioavailability and / or biodistribution of an oligonucleotide - see WO2008 / 113832, which is incorporated herein by reference. In one configuration, all internucleoside linkages in the oligonucleotide are phosphorothioate or boranophosphate linkages. Preferably, all internucleoside linkages in the oligonucleotide are phosphorothioate linkages. Nucleobase The term nucleobase includes purine (e.g. adenine and guanine) and pyrimidine (e.g. uracil, thymine and cytosine) residues found in nucleosides and nucleotides that form hydrogen bonds in nucleic acid hybridization. In the context of the present invention, the term nucleobase also includes modified nucleobases that may differ from the natural nucleobase residues but function during nucleic acid hybridization. In this context, "nucleobase" refers to both the natural nucleobases such as adenine, guanine, cytosine, thymidine, uracil, xanthine and hypoxanthine as well as variants that do not occur in nature. These variants are described, for example, in Hirao et al (2012) Accounts of Chemical Research vol 45 page 2055 and Bergstrom (2009) Current Protocols in Nucleic Acid Chemistry Suppl. 37 1.4.1 are described. In some configurations, the nucleobase half molecule is modified with a purine or pyrimidine to a purine or pyrimidine, such as a substituted purine or substituted pyrimidine, such as a nucleobase selected from isocytosine, pseudoisocytosine, 5-methyl cytosine, 5-thiozolo-cytosine, 5-propynyl-cytosine, 5-propynyl-uracil, , 5-bromouracil 5-thiazolo-uracil 2-thio-uracil, 2'thio-thymine, inosine, diaminopurine, 6-aminopurine, 2-aminopurine, 2,6-diaminopurine, and 2-chloro-6-aminopurine. The nucleobase half-molecule may be represented by a letter code for each corresponding nucleobase, for example A, T, G, C, or U, where each letter may optionally include a modified nucleobase with equivalent functionality. For example, in the example oligonucleotides, the nucleobase half-molecules are selected from A, T, G, C, and 5-methyl cytosine. Optionally, for LNA gapmers, 5-methyl cytosine LNA nucleosides may be used. Modified oligonucleotides The term modified oligonucleotide is an oligonucleotide consisting of one or more modified nucleosides, sugars and / or modified internucleoside linkages. The term oligonucleotide is the term used in the literature to describe oligonucleotides with modified nucleosides. Complementary The term complementarity describes the capacity for Watson-Crick base pairing of nucleosides / nucleotides. Watson-Crick pairs are guanine (G)-cytosine (C) and adenine (A)-thymine (T) / uracil (U). It is understood that oligonucleotides may contain nucleosides with modified nucleobases, for example 5-methyl cytosine is often used instead of cytosine, and thus the term complementarity encompasses base pairing between Watson-Crick modified and unmodified nucleobases (e.g. Hirao et al (2012) Accounts of Chemical Research vol 45 page 2055 and Bergstrom (2009) Current Protocols in Nucleic Acid Chemistry Suppl. 37 1.4.1) Please refer. The term "percent complementarity" in this context refers to the number of nucleotides in the percentage of adjacent nucleotide sequences in a nucleic acid molecule (e.g., oligonucleotide) that are complementary at a particular position (e.g., Watson Crick base pairing) to a contiguous nucleotide sequence at a particular position of a separate nucleic acid molecule (e.g., target nucleic acid). This percentage is calculated by counting the number of pivot bases that form pairs between the two sequences, dividing by the total number of nucleotides in the oligonucleotide, and multiplying by 100. In such a comparison, a nucleobase / nucleotide that does not align (form a base pair) is called a mismatch. The term "100 percent complementarity" refers to 100 percent complementarity. Hybridization The term "hybridization" or "hybridizer" in this context should be understood as two nucleic acid strands (e.g. an oligonucleotide and a target nucleic acid) forming hydrogen bonds between base pairs on opposite strands. The binding affinity between the two nucleic acid strands is the strength of the hybridization. This is often defined in terms of the melting temperature (Tm) as the temperature at which half of the Tms are duplexed with the target nucleic acid. Under physiological conditions, Tm is not proportional to the binding affinity alone. (Mergny and Lacroix, 2003, Oligonucleotides 13:515–537). The standard state Gibbs-free energy ΔG° is a more accurate representation of the binding affinity and is related to the dissociation constant (Kd) of the reaction by ΔG°=-RTln(Kd), where R is the gas constant and T is the absolute temperature. Therefore, a very low ΔG° of the reaction between the oligonucleotide and the target nucleic acid indicates strong hybridization between the oligonucleotide and the target nucleic acid. The ΔG° is the energy corresponding to the reaction at a water concentration of 1 mM, pH 7, and temperature of 37°C.Hybridization of an oligonucleotide to a target nucleic acid is a spontaneous reaction and for a spontaneous reaction ΔG° is less than zero. ΔG° can be measured experimentally, for example, using the isothermal stabilization catheterization (ITC) method described in Hansen et al., 1965, Chem. Comm. 36–38 and Holdgate et al., 2005, Drug Discov Today. The skilled person will recognize that commercial equipment is available for measuring ΔG°. ΔG° can also be calculated numerically using the nearest neighbor model described by SantaLucia, 1998, Proc Natl Acad Sci USA. 95: 1460–1465 using the parameters described in Sugimoto et al., 1995, Biochemistry 34:11211–11216 and McTigue et al., 2004, Biochemistry 43:5388–5405. In order to allow for the modification of the desired target nucleic acid by hybridization, the oligonucleotides involved in this hybridization to a target nucleic acid have ΔG° values ​​below -10 kcal for oligonucleotides of 10–30 nucleotides in length.In some embodiments, the degree or strength of hybridization is measured by the standard Gibbs free energy ΔG°. Oligonucleotides may be hybridized to a target nucleic acid with a ΔG° value below the range of -10 kcal, such as below -15 kcal, such as below -20 kcal, and as below -25 kcal for oligonucleotides of 8 to 30 nucleotides in length. In some experiments, oligonucleotides are hybridized to a target nucleic acid with a ΔG° value of -10 to -60 kcal, such as -12 to -40, such as -15 to -30 kcal, or -16 to -27 kcal, such as -18 to -25 kcal. Goal The target is the protein that needs to be modulated. Target nucleic acid A target nucleic acid is a desired target to which the oligonucleotide of the invention hybridizes and may be, for example, a gene, RNA, a non-coding RNA, a long non-coding RNA, an mRNA and pre-mRNA, a mature mRNA, or a cDNA sequence. In some configurations, the target nucleic acid is a non-coding RNA or a long non-coding RNA, or a sequence thereof. For use in vitro or in vivo, the oligonucleotide of the invention is capable of reducing the level of SNHG14 transcription downstream of SNORD109B, thereby suppressing the transcription of the paternal UBE3A in the desired target cell. The native nucleobase sequence of the oligonucleotide of this invention is complementary to the target nucleic acid, measured along the length of the oligonucleotide, optionally excluding one or two mismatches, and optionally excluding nucleotide-based linker regions that may link the oligonucleotide to an optional functional group, such as a conjugate. Target sequence An oligonucleotide comprises a sequence of nucleotides that is complementary to or a combination of a subsequence of a target nucleic acid molecule. The term "target sequence" as used herein refers to a nucleotide sequence present in the target nucleic acid that includes a nucleobase sequence that is complementary to an oligonucleotide of the invention. In some configurations, the target sequence comprises a region in the target nucleic acid that is complementary to the nucleotide sequence adjacent to the oligonucleotide of the invention. In some configurations, the target sequence is longer than the complementary sequence of a single oligonucleotide, and may, for example, represent a desired region of the target nucleic acid that may be targeted by multiple oligonucleotides of the invention. The oligonucleotide of the invention comprises a contiguous nucleotide sequence that is complementary to a target nucleic acid, such as a target sequence. An oligonucleotide comprises a contiguous nucleotide sequence of at least 8 nucleotides that is complementary to or hybridizes to a target sequence present in a target nucleic acid molecule. The contiguous nucleotide sequence (and thus the target sequence) comprises at least 8 contiguous nucleotides, such as 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 contiguous nucleotides, such as 12-25, such as 14-18 contiguous nucleotides. Target cell The term "target cell" as used herein refers to a cell that expresses a target nucleic acid. In some configurations, the target cell may be in vivo or in vitro. In some configurations, the target cell is a mammalian cell, such as a rodent cell, such as a mouse cell or a rat cell, or a primary mammalian cell, such as a monkey cell or a human cell. In preferred configurations, the target cell is a neuronal cell. Variant that occurs in nature The term "natural variant" refers to SNHG14 downstream transcriptional variants of the SNORD109B gene or transcripts that originate from the same genetic loci as the target nucleic acid, but may be due to the degeneracy of the genetic code resulting from codon redundancy in long non-coding RNA. Thus, the oligonucleotides of the invention can be designed to target the target nucleic acid and its naturally occurring variants. Modulating expression The term "expression modulation" in this context means a general term for the ability of an oligonucleotide to change the amount of UBE3A protein compared to the amount of UBE3A before the oligonucleotide is used. Alternatively, expression modulation can be determined by reference to a control experiment in which the oligonucleotide of the invention is not used. Modulation by an oligonucleotide may relate to its ability to reduce, eliminate, prevent, attenuate, or terminate the repression of paternal UBE3A transcription, for example by attenuating or eliminating the transcription of the non-coding SNHG14 downstream SNORD109B or by blocking or preventing the polymerase activity associated with the transcription of the non-coding SNHG14 downstream SNORD109B. Modulation can be interpreted as the ability of the oligonucleotide to restore, increase or enhance the expression of paternal UBE3A, i.e., remove or block the effective repressor mechanism of transcription of the non-coding SNHG14 downstream of SNORD109B. Modified nucleosides with high binding affinity A modified high affinity nucleoside is a modified nucleotide that, when incorporated into an oligonucleotide, increases the binding affinity of the oligonucleotide for its complementary target, for example, as measured by the melting temperature (Tm). The modified high affinity nucleotide of the subject invention is preferably modified to increase the melting temperature by +0.5 to +12°C, more preferably by +1.5 to +10°C, most preferably by between +3 and +8°C per nucleoside. Modified high affinity nucleosides are known in the art and include, for example, multiple substituted nucleosides, as well as locked nucleic acids (e.g., (LNA) (see eg Freier & Altmann; Nucl. Acid Res., 1997, 25, 4429-4443 and Uhlmann; Curr. Opinion in Drug Development, 2000, 3(2), 293-213) Please refer. Sugar Reforms The oligomer of the invention may comprise one or more nucleosides having a modified sugar moiety, i.e., a modification of the sugar moiety compared to the ribose sugar moiety found in DNA and RNA. A large number of nucleosides have been constructed by altering the ribose sugar regime primarily with the aim of improving specific properties of oligonucleotides, such as binding affinity and / or resistance. These modifications include those where the structure of the ribose ring is modified, for example by substitution with a hexose ring (HNA) or a bicyclic ring usually having a dibasic bridge between C2 and C4 on the ribose ring (LNA) or a non-bonding ribose ring usually lacking a bond between carbons C2 and C3 (e.g. UNA). Other sugar-modified nucleosides include, for example, bicyclohexose nucleic acids (WO2011 / 017521) or tricyclic nucleic acids (WO2013 / 154798). Modified nucleosides also include nucleosides in which the sugar moiety is replaced by a non-sugar moiety, for example in the case of peptide nucleic acids (PNA) or morpholino nucleic acids. Sugar modifications also include modifications that occur by changing the substituent groups on the ribose ring to groups other than hydrogen, or the 2'-OH group that occurs naturally in DNA and RNA nucleosides. For example, substitutions may be placed at the 2', 3', 4', and 5' positions. Nucleosides with modified sugar half-molecules also include '2'-modified nucleosides, such as 2'-substituted nucleosides. In fact, much focus has been devoted to the development of '2'-substituted nucleosides, and numerous 2'-substituted nucleosides have been shown to have properties in combination with oligonucleotides, such as nucleoside-resistant properties and increased binding affinity. '2 Substituted nucleosides A '2' substituted nucleoside is a nucleoside that is linked to a substituent other than or at the 2' position (2' substituted nucleoside) or contains a 2' diradical, or contains 2' substituted nucleosides and nucleosides (with a 2'-4' diradical bridge). For example, the 2' modified sugar may have enhanced binding affinity and / or increased nuclease resistance. Examples of sugar-substituted nucleotides are 2'-O-alkyl-RNA, 2'-O-methyl-RNA, , 2'-alkoxy-RNA 2'-O-methoxyethyl-RNA (MOE), 2'-amino-DNA, 2'-Fluoro-RNA, 2'-Fluoro-RNA and 2'-fluoro-ANA (F-ANA). For more examples, see Freier & Altmann; Nucl. Acid Res., 1997, 25, 4429-4443 and Uhlmann; Curr. Opinion in Drug Development, 2000, 3(2), 293-213; and Deleavey and Damha, Chemistry and Biology 2012, 19, 937 See below for examples of some 2'-substituted modified nucleosides. Locked nucleic acid nucleosides (LNA). LNA nucleosides are modified nucleosides that contain a linking group (referred to as a diradical or bridge) between the C2' and C4' of the ribose sugar ring of the nucleotide. These nucleosides are also referred to in the scientific literature as nucleic acids or bipolar nucleic acids (BNA). In some configurations, the modified nucleoside or oligomeric LNA nucleosides of the invention have the general structure of Formula I or II: Or #x200fFormula#x200f#x200e I#x200eFormula II wherein W is selected from -O-, -S-, -N(Ra)-, -C(RaRb)-, such as in some configurations -O-; B is a nucleobase or a modified nucleobase half-molecule; Z is an internucleoside linkage to an adjacent nucleoside, a or a 5' terminal group; Z* is an internucleoside linkage to an adjacent nucleoside, a or a 3' terminal group; X is a group selected from a list consisting of -C(RaRb)-, -C(Ra)=C(Rb)-, -C(Ra)=N-, -O-, -Si(Ra)2-, -S-, -SO2-, -N(Ra)-, and >C=Z In some configurations, X is selected from the group consisting of –O-, -S-, NH-, NRaRb, -CH2-, CRaRb, -C(=CH2)-, and -C(=CRaRb)-. In some configurations, X is -O. A group selected from the group consisting of -C(RaRb)-, -C(Ra)=C(Rb)-, -C(Ra)=N-, -O-, -Si(Ra)2-, -S-, -SO2-, -N(Ra)-, and >C=Z. In some configurations, Y is selected from the group consisting of: –CH2-, -C(RaRb)-, –CH2CH2-, -C(RaRb)-C(RaRb)-, –CH2CH2CH2-, -C(RaRb)C(RaRb)C(RaRb)-, -C(Ra)=C(Rb)- and -C(Ra)=N-. In some configurations, Y is selected from the group consisting of: –CH2-, -CHRa-, -CHCH3-, and CRaRb- or -XY- together form a divalent linking group (also called a radical) together form a divalent linking group consisting of 1, 2, 3 or 4 groups / atoms selected from the group -C(RaRb)-, -C(Ra)=C(Rb)-, -C(Ra)=N-, -O-, -Si(Ra)2-, -S-, -SO2-, -N(Ra)-, and >C=Z. In some configurations, -XY- is a diradical selected from the groups -X-CH2-, -X-CRaRb-, -X-CHRa-, -XC(HCH3)-, -OY-, -O-CH2-, -S-CH2-, -NH-CH2-, -O-CHCH3-, -CH2-O-CH2, -O-CH(CH3CH3)-, -O-CH2-CH2-, -O-CH2-CH2-, -O-CH2OCH2-, -O-NCH2-, -C(=CH2)-CH2-, -NRa-CH2-, NO-CH2, -S-CRaRb- and -S-CHRa- are. In some configurations, -XY- is –O-CH2- or –O-CH(CH3)-. wherein Z is selected from -O-, -S- and -N(Ra)-, and Ra, and Rb, when present, are each hydrogen, optionally substituted C1-6-alkyl, optionally substituted C2-6-alkenyl, optionally substituted C2-6-alkynyl, hydroxy, optionally substituted C1-6-alkoxy, C2-6-Alkoxyalkyl, C2-6-alkenyloxy, carboxy, C1-6-Alkoxycarbonyl, C1-6-alkylcarbonyl, formyl, aryl, aryloxy-carbonyl, aryloxy, arylcarbonyl, heteroaryl, heteroaryloxy-carbonyl, heteroaryloxy, heteroarylcarbonyl, amino, mono- and di(C1-6-alkyl)amino, carbamoyl, mono- and di(C1-6-alkyl)-amino-carbonyl, amino-C1-6-alkyl-aminocarbonyl, mono- and di(C1-6-alkyl)amino-C1-6-alkyl-aminocarbonyl, C1-6-alkyl-carbonylamino, carbamido, C1-6-alkanoyloxy, Sulfono, C1-6-alkylsulphonyloxy, nitro, azido, sulfonyl, C1-6-alkylthio, halogen where aryl and heteroaryl may be optionally substituted and where the two germinal substituents Ra and Rb are optionally substituted with both methylene (=CH2), where for all chiral centers, the asymmetric groups may be found in the R or S direction. wherein R1, R2, R3, R5, and R5* are each independently selected from the group consisting of: hydrogen, optionally substituted C1-6-alkyl, optionally substituted C2-6-alkenyl, optionally substituted C2-6-alkynyl, hydroxy, optionally substituted C1-6-alkoxy, C2-6-Alkoxyalkyl, C2-6-alkenyloxy, carboxy, C1-6-Alkoxycarbonyl, C1-6-alkylcarbonyl, formyl, aryl, aryloxy-carbonyl, aryloxy, arylcarbonyl, heteroaryl, heteroaryloxy-carbonyl, heteroaryloxy, heteroarylcarbonyl, amino, mono- and di(C1-6-alkyl)amino, carbamoyl, mono- and di(C1-6-alkyl)-amino-carbonyl, amino-C1-6-alkyl-aminocarbonyl, mono- and di(C1-6-alkyl)amino-C1-6-alkyl-aminocarbonyl, C1-6-alkyl-carbonylamino, carbamido, C1-6-alkanoyloxy Sulfono, C1-6-alkylsulphonyloxy, nitro, azido, sulfonyl, C1-6-alkylthio, halogen where aryl and heteroaryl may be optionally substituted, and where the two germinal substituents may be oxo, thioxo, imino or optionally methylene which is optionally substituted. In some configurations, R1, R2, R3, R5, and R5* are each independently selected from C1-6alkyl, such as methyl and hydrogen. In some configurations, R1, R2, R3, R5, and R5* are all hydrogen. In some configurations, R1, R2, and R3 are all hydrogen, and each of R5, and R5* is also hydrogen, and R5, and R5* is other than hydrogen, such as C1-6alkyl, such as methyl. In some configurations, Ra is either hydrogen or methyl. In some configurations, when Rb is present, it is hydrogen or methyl. In some configurations, the doradical -XY- is -O-CH2-, W is O, and all of R1, R2, R3, R5, and R5* are hydrogen. These LNA nucleotides are disclosed in WO99 / 014226, WO00 / 66604, WO98 / 039352, and WO2004 / 046160, all of which are incorporated herein by reference, and include what are commonly referred to as beta-D-oxy LNA and alpha-L-oxy LNA nucleosides. In some configurations, the doradical -XY- is -S-CH2-, W is O, and all of R1, R2, R3, R5, and R5* are hydrogen. These thio LNA nucleotides are disclosed in WO99 / 014226 and WO2004 / 046160, which are incorporated herein by reference. In some configurations, the doradical -XY- is -NH-CH2-, W is O, and all of R1, R2, R3, R5, and R5* are hydrogen. These LNA nucleotides are disclosed in WO99 / 014226 and WO2004 / 046160, which are incorporated herein by reference. In some configurations, the doradical –XY- is –O-CH2-CH2- or –O-CH2-CH2- CH2-, W is O, and all of R1, R2, R3, R5, and R5* are hydrogen. These LNA nucleotides are disclosed in WO00 / 047599 and Morita et al, Bioorganic & Med.Chem. Lett. 12 73-76, which are incorporated herein by reference, and include what are commonly referred to as 2'-O-4'C-ethylene bridged nucleic acids (ENA). In some configurations, the doradical -XY- is -O-CH2-, W is O, and all of R1, R2, and R3 and one of R5, and R5* are hydrogen and R5, and R5* other than hydrogen are C1-6alkyl such as methyl. These 5' substituted LNA nucleotides are disclosed in WO2007 / 134181, which is incorporated herein by reference. In some configurations, the doradical –XY- is –O-CRaRb-, where Ra and Rb are hydrogen and R5, and R5* are other than hydrogen, such as C1-6alkyl such as methyl. W is O, and all of R1, R2, and R3 and one of R5, and R5* are hydrogen and R5, and R5* are other than hydrogen, such as C1-6alkyl such as methyl. These modified LNA nucleotides are disclosed in WO2010 / 077578, which is incorporated herein by reference. In some configurations, the doradical –XY- is a divalent linking group. -O-CH(CH2OCH3)-(2' O-methoxyethyl bicyclic nucleic acid - Seth at al., 2010, J. Org. Chem. Vol 75(5) pp. 1569-81) In some configurations, the doradical –XY- is a divalent linking group. -O-CH(CH2OCH3)-(2' O-methoxyethyl bicyclic nucleic acid - Seth at al., 2010, J. Org. Chem. Vol 75(5) pp. 1569-81) In some configurations, the doradical –XY- is a divalent linking group. -O-CH(CH2CH3)-(2'O-ethyl bicyclic nucleic acid - Seth at al., 2010, J. Org. Chem. Vol 75(5) pp. 1569-81) In some configurations, the -XY- doradical is -O-CHRa-, W is O, and all of R1, R2, and R3 and one of R5, and R5* are hydrogen. These 6'-substituted LNA nucleosides are disclosed in WO10036698, which is incorporated herein by reference. In some configurations, the doradical –XY- is –O-CH(CH2OCH3)-, W is O, and all of R1, R2, R3, R5, and R5* are hydrogen. These LNA nucleosides in this series are also called cyclic MOEs (cMOE) and are disclosed in WO07090071. In some configurations, the doradical –XY- is a divalent linker group in the –O-CH(CH3)- R- or S-configuration. In some configurations, the doradical –XY- is a divalent linker group –O-CH2-O-CH2- (Seth at al., 2010, J. Org. Chem). In some configurations, the doradical –XY- is –O-CH(CH3)-, W is O, and all of R1, R2, R3, R5, and R5* are hydrogen. These 6'-substituted LNA nucleosides in WO10036698 are also called cET nucleosides in this series and may be the stereoisomer (S)cET or (R)cET, as disclosed in WO07090071 (beta-D) and WO2010 / 036698 (alpha-L), which are incorporated herein by reference. In some configurations, the doradical –XY- is –O-CRaRb-, neither Ra nor Rb is hydrogen, W is O, and all of R1, R2, R3, R5, and R5* are hydrogen. In some configurations, Ra and Rb are both methyl. These 6'-substituted LNA nucleosides are disclosed in WO 2009006478, which is incorporated herein by reference. In some configurations, the doradical –XY- is –S-CHRa-, W is O, and all of R1, R2, R3, R5, and R5* are hydrogen. These 6'-substituted LNA nucleosides are disclosed in WO11156202, which is incorporated herein by reference. In some configurations of the 6'-substituted thio LNA, Ra is methyl. In some configurations, the doradical –XY- is –C(=CH2)-C(RaRb)- such as –C(=CH2)-CH2- or –C(=CH2)-CH(CH3)-, W is O, and all of R1, R2, R3, R5, and R5* are hydrogen. These vinylcarboate LNA nucleosides are disclosed in WO08154401 and WO09067647, which are incorporated herein by reference. In some configurations, the doradical –XY- is –N(-ORa)-, W is O, and all of R1, R2, R3, R5, and R5* are hydrogen. In some configurations, Ra is C1-6alkyl, such as methyl. These nucleosides are also called N-substituted LNAs and are disclosed in WO2008 / 150729, which is incorporated herein by reference. In some configurations, the doradical –XY- is accompanied by a divalent linking group –O-NRa-CH3- (Seth at al., 2010, J. Org. Chem). In some configurations, the doradical –XY- is –N(Ra)-, W is O, and all of R1, R2, R3, R5, and R5* are hydrogen. In some configurations, Ra is C1-6alkyl, such as methyl. In some configurations, one or both of R5, and R5* are hydrogen, and each of R5, and R5* is a C1-6alkyl, such as methyl. In such a configuration, all of R1, R2, and R3 may be hydrogen, and the radical -XY- may be selected from -O-CH2- or -OC(HCRa)-, such as -OC(HCH3)-. In some configurations, the doradical –XY- is CRaRb-O-CRaRb such as CH2-O-CH2-, W is O, and all of R1, R2, R3, R5, and R5* are hydrogen. In some configurations, Ra is C1-6alkyl such as methyl. These LNA nucleosides are also called conformationally restricted nucleotides (CRNs) and are disclosed in WO2013036868, which is incorporated herein by reference. In some configurations, the doradical –XY- is –O-CRaRb-O-CRaRb- such as O-CH2-O-CH2-, W is O, and all of R1, R2, R3, R5, and R5* are hydrogen. In some configurations, Ra is C1-6alkyl such as methyl. These LNA nucleosides are also called COC nucleotides and are disclosed in Mitsuoka et al., Nucleic Acids Research 2009 37(4), 1225-1238, which is incorporated herein by reference. It is understood that, unless otherwise noted in this text, LNA nucleosides may be in the beta-D or alpha-L stereoisoform. Some examples of LNA nucleosides are presented in Schedule 1. Program 1 As seen in the examples, in preferred configurations of this invention the LNA nucleosides in the oligonucleotides are beta-D-oxy-LNA nucleosides. Decay caused by Newcastle Nuclease-induced decay refers to an oligonucleotide that is capable of mediating the decay of a complementary nucleotide sequence upon formation of a duplex with that sequence. In some configurations, the oligonucleotide may function by degrading the target nucleic acid via a nuclease, while the oligonucleotides of the invention are capable of attracting a nuclease, particularly an endonuclease, preferably an endoribonuclease (RNase) such as RNase H. Examples of oligonucleotide designs that are nuclease-dependent are oligonucleotide-linked mechanisms that typically include a region of at least 5 or 6 DNA nucleosides and are flanked on one or both sides by uptake-enhancing nucleosides, e.g., gapmers, hemers, and telomers. RNase H activity and use The RNase H activity of an antisense oligonucleotide refers to its ability to bind RNase H in a duplex with a complementary RNA molecule. WO01 / 23613 provides in vivo methods for determining RNase H activity that can be used to determine the ability to bind RNase H. Typically, an oligonucleotide is capable of employing RNase H if, when complemented with a target nucleic acid sequence, the initial rate in pmol / l / min is at least 10% or more than 20% of the initial rate determined when using an oligonucleotide with the same base sequence as the modified oligonucleotide under test, but containing only DNA monomers with a phosphothioic bond between all monomers of the oligonucleotide and using the method provided by Examples 91-95 of WO01 / 23613 (incorporated herein by reference). Gapmers The term gapmer in this context refers to an antisense oligonucleotide that contains a region of RNase H extracted oligonucleotide (cleft) flanked 5' and 3' by one or more affinity-enhancing modified nucleosides. Various gapmer designs are described herein. Hedmers and tailmers are oligonucleotides capable of employing RNase H that are absent from one of the flanks, i.e., only one end of the oligonucleotide contains affinity-enhancing modified nucleosides. For hedmers, the 3' flank is absent (i.e., the 5' flank contains affinity-enhancing modified nucleosides) and for tailmers, the 5' flank is absent (i.e., the 3' flank contains affinity-enhancing modified nucleosides). Gapmer The term LNA gapmer is a gapmer oligonucleotide in which at least one modifying nucleoside enhances the binding affinity of an LNA nucleoside. Mixed wing gapmer The term mixed-wing gapmer refers to an LNA gapmer in which the flanking regions comprise at least one LNA nucleoside and at least one non-LNA nucleoside such that at least one 2'-modified nucleoside is substituted, such as, for example, 2'-O-alkyl-RNA, 2'-O-methyl-RNA, 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA (MOE), 2'-amino-DNA, 2'-Fluoro-RNA and 2'-F-ANA. In some configurations, the mixed-wing gapmer has one flank comprising the LNA nucleoside (e.g., 5' or 3') and the other flank (3' or 5', respectively) comprising the 2'-modified nucleoside(s). Conjugation The term conjugate in this context refers to an oligonucleotide that is covalently linked to a non-nucleotide half-molecule (conjugated half-molecule or C-region or third region). Conjugating an oligonucleotide of the invention to one or more non-nucleotide half-molecules may improve the pharmacology of the oligonucleotide, for example by affecting the activity, cellular distribution, cellular uptake or stability of the oligonucleotide. In some configurations, the conjugated half-molecule improves the pharmacokinetic properties of the oligonucleotide by improving the cellular distribution, bioavailability, metabolism, excretion, permeability and / or cellular uptake of the oligonucleotide. In particular, the conjugate may enhance the delivery of the oligonucleotide to an organ, tissue or cell type and thus increase the effect of the oligonucleotide in that organ, tissue or cell type. At the same time, the conjugate may reduce the activity of the oligonucleotide in that organ, tissue or cell type, for example by reducing off-target activity or non-target activity of that organ, tissue or cell type. WO 93 / 07883 and WO 2013 / 033230 provide suitable conjugated half-molecules, which are incorporated herein by reference.WO 2012 / 143379 provides a method for delivering a drug across the blood-brain barrier by conjugating an antibody fragment with affinity binding to the transferrin receptor, which is incorporated herein by reference. Oligonucleotide conjugates and their synthesis in comprehensive studies by Manoharan in Antisense Drug Technology, Principles, Strategies, and Applications, ST Crooke, ed., Ch. 16, Marcel Dekker, Inc., 2001 and Manoharan, Antisense and Nucleic Acid Drug Development, 2002, 12, 103 It is reported that each of them is cited as a reference in this text. In one configuration, the non-nucleotide moiety (conjugated moiety) is selected from the group consisting of carbohydrates, cell surface receptor ligands, drugs, hormones, lipophilic materials, polymers, proteins, peptides, toxins (such as bacterial toxins), vitamins, viral proteins (such as capsids), or combinations thereof. In some configurations, the non-nucleotide moiety is an antibody or antibody fragment, such as an antibody or antibody fragment that facilitates delivery across the blood-brain barrier, particularly an antibody or antibody fragment targeting the transferrin receptor. Connectors A linker is a connection of two atoms that connects a chemical group or moiety of interest to another chemical group or moiety of interest via one or more covalent bonds. Conjugated half-molecules can be attached to an oligonucleotide directly or through a linking half-molecule (e.g., linker or tether). Linkers serve to connect a third region, e.g., a conjugated half-molecule (region C), to a first region, e.g., an oligonucleotide (region A). In some configurations of the invention, the conjugate or oligonucleotide conjugate of the invention may optionally comprise a linker region (region II or region B and / or region Y) located between the oligonucleotide (region A or region I) and the conjugate half-molecule (region C or region III). Region B of the biodegradable linker comprises or consists of a physiologically labile bond that is cleavable under conditions normal to or similar to those of the mammalian body. The conditions under which the physiologically labile bond undergoes chemical changes (such as cleavage) include chemical conditions such as pH, temperature, oxidizing or reducing conditions or salt concentrations present in mammalian cells or the like. The intracellular conditions of mammals also include enzymatic activity such as proteolytic enzymes or hydrolytic enzymes or nuclei normally present in mammalian cells. In a preferred configuration, the nuclease-susceptible linker comprises between 1 and 10 nucleosides, such as 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 nucleosides, more preferably between 2 and 6 nucleosides, most preferably between 2 and 6 nucleosides, and most preferably between 2 and 4 nucleosides linked by at least two consecutive phosphodiester linkers, such as 3 or 4 or 5 consecutive phosphodiester linkers. Preferably, the nucleosides are DNA or RNA.Phosphodiesters containing biodegradable linkers are described in more detail in WO 2014 / 076195 (incorporated herein by reference). Region Y refers to linkers that are necessarily biodegradable but primarily function to covalently attach a conjugated half-molecule (region C or region III) to an oligonucleotide (region A or region I). Region Y may comprise a chain structure or an oligomer of repeating units such as ethylene glycol, amino acid units or alkyl amino groups. Oligonucleotide conjugates of the invention can be made from the following region elements AC, ABC, ABYC, AYBC or AYC. In some configurations, the linker (region Y) is an alkylamino group, such as a C2 - C36 alkylamino group, including, for example, C6 to C12 alkylamino groups. In a preferred configuration, the linker (region Y) is a C6 alkylamino group. Control The term "control" as used herein in connection with measuring the effect of an oligonucleotide generally means that the control is an uninfected individual or target cell or an individual or target cell treated with a non-targeting nucleotide (mimicking). However, an individual may be treated with standard care as required. Treatment The term "treatment" in this context refers to the treatment of an existing condition (i.e., the disease or disorder referred to in this context), or the prevention of a condition, i.e., a preventive action. It is therefore clear that the treatment referred to in this context may, in some configurations, be a preventive action. Detailed description of the invention Purpose of the invention One aspect of the invention is to modulate the expression of porcine, primate or human UBE3A protein, particularly in human neuronal cells. The human UBE3A protein exists in different isoforms, which are listed in Uniprot nr. Q05086. Multiple mutations of UBE3A in the maternal gene can lead to Engelman syndrome. The target nucleic acid for the oligonucleotide of the invention is RNA, particularly long non-coding RNA. The long non-coding RNA targeted by the oligonucleotide of the invention is human SNHG14 (also known as UBE3A-ATS with accession number ENSG00000224078, version GRCh38.p2). In particular, the target nucleic acid is a downstream region of SNORD109B corresponding to positions 25278410 to 25419462 on chromosome 15 (SEQ ID NO: 1). The rhesus monkey (Macaca mulatta) UBE3A repressor is defined as a downstream region of SNORD109A corresponding to positions 4222848 to 4373084 (forward strand) on chromosome 7 using the MMUL 1.0 assembly (SEQ ID NO: 2). In some configurations, the target nucleic acid is sequence identity number 1, or naturally occurring variants thereof. In some configurations, the target nucleic acid corresponds to regions that are conserved between (SEQ ID NO:1) human and rhesus monkey (SEQ ID NO:2). In some configurations, the target nucleic acid corresponds to regions that are conserved between (SEQ ID NO:1) human, rhesus monkey (SEQ ID NO:2) and mouse (SEQ ID NO:3). In some configurations, the nucleic acid is a region that is antisense to UBE3A pre-mRNA, the region corresponding to positions 55319 to 141053 of sequence identity number 1. In some configurations, the nucleic acid is a region that is downstream of SNORD109B and upstream of a region that is antisense to UBE3A pre-mRNA, this region corresponding to positions 1 to 55319 of SEQ ID NO:1. In some configurations, the target nucleic acid is present in a cell, such as a mammalian cell in a human cell in vitro or in vivo (the target cell). In some configurations, the target cell is a neuron, preferably human neuronal cells. The target sequence may be a target nucleic acid fragment sequence. In some configurations, the oligonucleotide targets a subsequence selected from the group consisting of the antisense region of exon 9, exon 10, exon 13, exon 14, overtone 14, exon 15, intron 15, and exon 16 of UBE3A. In some configurations, the oligonucleotide or contiguous nucleotide sequence hybridizes to or complements a single-stranded nucleic acid molecule consisting of the group consisting of positions 55319-76274, 77483-77573, 92157-93403, and 97056-97354 of SEQ ID NO: 1. In some configurations, the oligonucleotide or contiguous nucleotide sequence hybridizes to or complements a single-stranded nucleic acid molecule consisting of the group consisting of positions 60821-60849, 77567-77583, 92323-92339, and 97156-97172 of SEQ ID NO:1. In some configurations, the target nucleic acid is a region corresponding to position 9200-9250 of sequence identity number 1. In some configurations, the target nucleic acid is a region corresponding to positions 11505-11555 of SEQ ID NO:1. In some configurations, the target nucleic acid is a region corresponding to positions 15100-15150 of sequence identity number 1. In some configurations, the target nucleic acid is a region corresponding to positions 30590-30740 of SEQ ID NO:1. In some configurations, the target nucleic acid is a region corresponding to positions 46380-46430 of SEQ ID NO:1. Oligonucleotides of the invention The invention relates to oligonucleotides capable of modulating the expression of paternal UBE3A, in particular modulating the induction or regulation of paternally expressed UBE3A in neuronal cells. This modulation is achieved by hybridizing to a target nucleic acid located in the long non-coding RNA SNHG14 transcript downstream of SNORD109B. In some configurations, the oligonucleotides of the invention hybridize to a target nucleic acid subsequence of SEQ ID NO: 1 with a ΔG° of less than -10 kcal, such as a ΔG° between -10 and -60 kcal, such as -12 and -40 kcal, such as -15 and -30 kcal, or -16 and -27, such as -18 and -25 kcal. The oligonucleotides of this invention are an antisense oligonucleotide that targets the SNHG14 transcript downstream of the SNORD109B gene of the pig, rhesus monkey, and / or animal. In some configurations, the antisense oligonucleotide is capable of modulating the expression of a target by ablating, interfering with, or reducing the repression of the target. Preferably, the oligonucleotides of the invention induce UBE3A expression in a cell, particularly paternal UBE3A expression in a neuron, by ablating or ablating the transcription of SNHG14 downstream of SNORD109B. In some configurations, the oligonucleotides of the invention are capable of increasing UBE3A expression by at least 20% compared to the level of UBE3A expression in a neuronal cell treated with saline or a non-targeting oligonucleotide, more preferably by at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 80%, 100%, 120%, 150%, 160%, 170%, 180%, 190%, 200%, 210% 220%, 230%, 240% or 250% compared to a neuronal cell treated with saline or a non-targeting oligonucleotide.In other configurations, the oligonucleotides of the invention are capable of reducing the level of SNHG14 downstream SNORD109B transcript (particularly the portion of the transcript that is antisense to the UBE3A pre-mRNA region) by at least 20% compared to the level of SNHG14 downstream SNORD109B transcript in a neuronal cell with saline or a non-targeting oligonucleotide, more preferably by at least 30%, 40%, 50%, 60%, 70%, 80%, 90% or 95% compared to the level of SNHG14 downstream SNORD109B transcript in a neuronal cell with saline or a non-targeting oligonucleotide, up to a maximum of 0%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 12%, 14%, 16%, SNORD115 levels in a neuronal cell were reduced by 18%, 20%, 25%, or 30% compared to the levels of SNORD115 in a saline-treated or non-targeting oligonucleotide. SNRPN and SNORD116 transcripts are upstream of SNORD115 transcription, and therefore, if SNORD115 transcription is not reduced by the oligonucleotide, it is highly likely that SNRPN and SNORD116 transcripts will not be reduced either.In one configuration, SNRPN and SNORD116 transcripts are not reduced by more than 0%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 12%, 14%, 16%, 18%, 20%, 25% or 30% compared to the level of SNRPN and SNORD116 in a cell treated with saline or a non-targeting oligonucleotide. Target modulation is induced by a combination of adjacent nucleotide sequences of the oligonucleotide and the target nucleic acid. In some configurations, the oligonucleotides of the invention comprise a mismatch between the oligonucleotide and the target nucleic acid. Despite the mismatch, hybridization to the target nucleic acid can still be sufficient to demonstrate the desired modulation of UBE3A expression. The reduction in binding affinity resulting from the mismatch may be substantially compensated for by increasing the number of nucleotides present in the oligonucleotide and / or increasing the number of modified nucleosides capable of increasing binding affinity to the target, such as 2′ modified nucleosides, including LNA, present within the oligonucleotide sequence. One aspect of the invention relates to an antisense oligonucleotide comprising a contiguous nucleotide sequence of 10 to 30 nucleotides with a length of at least 90%, such as 95%, such as 98%, such as 100% complementary to positions 25278410 to 25419462 on human chromosome 15. In some configurations, the oligonucleotide comprises a contiguous sequence that is at least 90% complementary, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, or 100% complementary to a region of the target nucleic acid represented by SEQ ID NO: 1, 2, or 3. In a preferred configuration of the oligonucleotide of the invention, its contiguous nucleotide sequence is completely complementary (100% complementary) to a target nucleic acid region represented by SEQ ID NO: 1, or in some configurations may contain one or two mismatches between the oligonucleotide and the target nucleic acid. In some configurations, the oligonucleotide sequence is 100% complementary to a corresponding target nucleic acid region present in SEQ ID NO: 1 and SEQ ID NO: 2. In some configurations, the oligonucleotide sequence is 100% complementary to a nucleic acid region present in SEQ ID NO: 1, 2, and 3. In some configurations, the oligonucleotide comprises a contiguous nucleotide sequence of 10 to 30 nucleotides in length with at least 90% complementarity, such as 100% complementarity, to the target nucleic acid region present in SEQ ID NO: 1, wherein the target nucleic acid region is selected from the group consisting of regions A1 to A3649 in Table 1. Table 1: Regions of sequence identity number 1 that may be targeted using the oligonucleotide of this invention Position in sequence identity number 1 from to length Region A Position in sequence Identity number Length Region A Position in sequence Identity number Length Region A Position in sequence Identity number Length From to From to From to 1 10 75 66 1218 50838 50864 27 2434 96887 96916 30 2 77 91 15 1219 50870 50884 15 2435 96928 96944 17 3 93 108 16 1220 50885 50911 27 2436 96946 96959 14 4 168 213 46 1221 50924 50937 14 2437 96970 96990 21 5 217 282 66 1222 50939 50974 36 2438 96992 97021 30 6 284 299 16 1223 50980 51008 29 2439 97023 97037 15 7 301 328 28 1224 51015 51030 16 2440 97039 97073 35 8 330 344 15 1225 51034 51047 14 2441 97075 97366 292 9 361 400 40 1226 51075 51089 15 2442 97368 97393 26 10 415 447 33 1227 51109 51123 15 2443 97420 97466 47 11 449 470 22 1228 51135 51172 38 2444 97469 97507 39 12 472 487 16 1229 51189 51216 28 2445 97513 97529 17 13 489 521 33 1230 51241 51260 20 2446 97531 97583 53 14 523 540 18 1231 51273 51294 22 2447 97585 97600 16 15 551 570 20 1232 51296 51312 17 2448 97602 97631 30 16 590 638 49 1233 51337 51357 21 2449 97633 97683 51 17 652 670 191234 51356 51381 26 2450 97685 97703 19 18 672 733 62 1235 51393 51465 73 2451 97705 97742 38 19 735 756 22 1236 51476 51494 19 2452 97787 97803 17 20 758 773 16 1237 51496 51515 20 2453 97805 97822 18 21 781 829 49 1238 51530 51544 15 2454 97824 97876 53 22 831 870 40 1239 51546 51572 27 2455 97878 97921 44 23 882 903 22 1240 51586 51600 15 2456 97923 97943 21 24 918 949 32 1241 51602 51617 16 2457 97945 97963 19 25 961 990 30 1242 51619 51677 59 2458 97965 97994 30 26 1007 1021 15 1243 51679 51700 22 2459 97995 98011 17 27 1019 1050 32 1244 51727 51741 15 2460 98014 98044 31 28 1052 1090 39 1245 51743 51821 79 2461 98039 98061 23 29 1092 1139 48 1246 51826 51859 34 2462 98055 98076 22 30 1147 1179 33 1247 51884 51912 29 2463 98077 98090 14 31 1175 1212 38 1248 51918 51936 19 2464 98079 98092 14 32 1220 1242 23 1249 51947 51979 33 2465 98085 98098 14 33 1245 1259 15 1250 52004 52017 14 2466 98100 98115 16 34 1265 1278 14 1251 52023 52048 26 2467 98113 98145 33 35 1285 1323 39 125252141 52167 27 2468 98142 98160 19 36 1317 1330 14 1253 52169 52188 20 2469 98162 98180 19 37 1337 1355 19 1254 52204 52225 22 2470 98188 98219 32 38 1357 1403 47 1255 52246 52262 17 2471 98215 98237 23 39 1405 1421 17 1256 52289 52306 18 2472 98227 98240 14 40 1423 1481 59 1257 52321 52339 19 2473 98232 98255 24 41 1486 1515 30 1258 52341 52360 20 2474 98255 98268 14 42 1521 1581 61 1259 52360 52428 69 2475 98264 98287 24 43 1611 1633 23 1260 52430 52504 75 2476 98292 98326 35 44 1631 1644 14 1261 52506 52567 62 2477 98373 98397 25 45 1635 1663 29 1262 52579 52594 16 2478 98399 98428 30 46 1669 1684 16 1263 52591 52610 20 2479 98442 98461 20 47 1685 1709 25 1264 52612 52642 31 2480 98480 98501 22 48 1711 1724 14 1265 52644 52667 24 2481 98499 98520 22 49 1726 1746 21 1266 52672 52686 15 2482 98524 98538 15 50 1754 1808 55 1267 52688 52702 15 2483 98537 98550 14 51 1819 1860 42 1268 52715 52753 39 2484 98545 98585 41 52 1862 1878 17 1269 52770 52783 14 2485 98595 98610 16 53 1896 191015 1270 52779 52792 14 2486 98599 98624 26 54 1923 1944 22 1271 52814 52845 32 2487 98644 98668 25 55 1946 1987 42 1272 52834 52857 24 2488 98678 98704 27 56 1985 2051 67 1273 52858 52885 28 2489 98703 98718 16 57 2053 2082 30 1274 52887 52943 57 2490 98736 98754 19 58 2088 2104 17 1275 52945 52962 18 2491 98778 98794 17 59 2106 2125 20 1276 52971 53019 49 2492 98802 98821 20 60 2132 2207 76 1277 53011 53036 26 2493 98845 98876 32 61 2209 2234 26 1278 53053 53066 14 2494 98878 98900 23 62 2247 2261 15 1279 53092 53112 21 2495 98900 98972 73 63 2263 2286 24 1280 53124 53151 28 2496 98961 98976 16 64 2290 2306 17 1281 53161 53175 15 2497 98974 98998 25 65 2308 2329 22 1282 53184 53220 37 2498 99011 99029 19 66 2347 2391 45 1283 53222 53243 22 2499 99033 99065 33 67 2398 2431 34 1284 53245 53260 16 2500 99067 99107 41 68 2447 2468 22 1285 53278 53304 27 2501 99151 99186 36 69 2470 2555 86 1286 53311 53346 36 2502 99188 99219 32 70 2565 2579 15 1287 53364 53386 23 2503 99222 99245 24 712579 2592 14 1288 53388 53404 17 2504 99254 99276 23 72 2589 2605 17 1289 53417 53431 15 2505 99288 99312 25 73 2594 2657 64 1290 53449 53463 15 2506 99314 99338 25 74 2672 2687 16 1291 53465 53484 20 2507 99367 99430 64 75 2692 2705 14 1292 53514 53527 14 2508 99444 99491 48 76 2703 2721 19 1293 53552 53567 16 2509 99496 99554 59 77 2770 2824 55 1294 53570 53591 22 2510 99570 99585 16 78 2826 2841 16 1295 53618 53644 27 2511 99587 99618 32 79 2838 2851 14 1296 53645 53667 23 2512 99620 99669 50 80 2843 2889 47 1297 53669 53684 16 2513 99679 99710 32 81 2896 2930 35 1298 53714 53742 29 2514 99720 99748 29 82 2930 2967 38 1299 53744 53764 21 2515 99750 99763 14 83 2965 2988 24 1300 53818 53843 26 2516 99768 99805 38 84 2984 3028 45 1301 53845 53860 16 2517 99818 99841 24 85 3024 3080 57 1302 53875 53889 15 2518 99855 99879 25 86 3081 3135 55 1303 53961 53991 31 2519 99881 99900 20 87 3140 3176 37 1304 53991 54013 23 2520 99902 99932 31 88 3168 3189 22 1305 54015 54055 41 2521 9993499954 21 89 3197 3222 26 1306 54057 54081 25 2522 99959 100011 53 90 3212 3226 15 1307 54114 54135 22 2523 100011 100037 27 91 3221 3248 28 1308 54163 54178 16 2524 100057 100071 15 92 3243 3256 14 1309 54180 54193 14 2525 100073 100102 30 93 3250 3264 15 1310 54195 54254 60 2526 100104 100118 15 94 3266 3292 27 1311 54261 54290 30 2527 100131 100186 56 95 3326 3343 18 1312 54292 54307 16 2528 100188 100201 14 96 3345 3391 47 1313 54309 54327 19 2529 100194 100212 19 97 3400 3422 23 1314 54357 54372 16 2530 100214 100277 64 98 3424 3441 18 1315 54404 54420 17 2531 100279 100303 25 99 3434 3447 14 1316 54418 54439 22 2532 100309 100355 47 100 3443 3503 61 1317 54441 54466 26 2533 100349 100386 38 101 3495 3508 14 1318 54468 54512 45 2534 100379 100393 15 102 3505 3558 54 1319 54519 54532 14 2535 100388 100401 14 103 3589 3609 21 1320 54555 54572 18 2536 100403 100423 21 104 3611 3641 31 1321 54588 54601 14 2537 100452 100473 22 105 3662 3696 35 1322 54609 54633 25 2538 100508 100542 35106 3698 3719 22 1323 54644 54688 45 2539 100548 100580 33 107 3723 3790 68 1324 54690 54721 32 2540 100582 100612 31 108 3810 3854 45 1325 54723 54761 39 2541 100614 100652 39 109 3858 3873 16 1326 54786 54802 17 2542 100695 100714 20 110 3902 3968 67 1327 54819 54835 17 2543 100736 100749 14 111 3971 4009 39 1328 54837 54912 76 2544 100751 100790 40 112 4005 4018 14 1329 54924 54941 18 2545 100808 100842 35 113 4011 4030 20 1330 54999 55017 19 2546 100844 100860 17 114 4032 4077 46 1331 55019 55035 17 2547 100862 100930 69 115 4082 4114 33 1332 55060 55073 14 2548 100939 100953 15 116 4123 4140 18 1333 55075 55100 26 2549 100955 100971 17 117 4150 4164 15 1334 55129 55171 43 2550 100973 101003 31 118 4166 4183 18 1335 55173 55188 16 2551 101021 101048 28 119 4185 4243 59 1336 55190 55203 14 2552 101057 101093 37 120 4248 4268 21 1337 55210 55230 21 2553 101109 101148 40 121 4284 4313 30 1338 55233 55281 49 2554 101145 101189 45 122 4317 4348 32 1339 55276 55289 14 2555 101194 10120815 123 4364 4471 108 1340 55283 55320 38 2556 101210 101244 35 124 4473 4491 19 1341 55330 55379 50 2557 101256 101271 16 125 4494 4519 26 1342 55381 55423 43 2558 101277 101300 24 126 4521 4535 15 1343 55420 55441 22 2559 101310 101327 18 127 4545 4560 16 1344 55486 55502 17 2560 101329 101345 17 128 4567 4606 40 1345 55515 55533 19 2561 101374 101397 24 129 4616 4714 99 1346 55535 55553 19 2562 101409 101426 18 130 4725 4755 31 1347 55555 55569 15 2563 101453 101466 14 131 4757 4786 30 1348 55569 55588 20 2564 101474 101487 14 132 4788 4852 65 1349 55590 55611 22 2565 101481 101515 35 133 4856 4910 55 1350 55615 55663 49 2566 101518 101541 24 134 4912 4935 24 1351 55665 55678 14 2567 101542 101560 19 135 4937 4970 34 1352 55696 55713 18 2568 101554 101591 38 136 4972 5010 39 1353 55715 55738 24 2569 101593 101609 17 137 5058 5078 21 1354 55744 55774 31 2570 101635 101695 61 138 5080 5116 37 1355 55776 55794 19 2571 101707 101746 40 139 5110 5124 15 1356 55801 55823 23 2572 101748101763 16 140 5135 5166 32 1357 55862 55906 45 2573 101774 101810 37 141 5168 5201 34 1358 55920 55933 14 2574 101812 101828 17 142 5203 5247 45 1359 55922 55947 26 2575 101819 101835 17 143 5261 5276 16 1360 55974 55993 20 2576 101829 101842 14 144 5278 5293 16 1361 55990 56031 42 2577 101842 101855 14 145 5314 5330 17 1362 56045 56073 29 2578 101857 101878 22 146 5332 5382 51 1363 56082 56114 33 2579 101880 101943 64 147 5398 5414 17 1364 56117 56140 24 2580 101947 101981 35 148 5427 5456 30 1365 56183 56214 32 2581 101988 102009 22 149 5458 5471 14 1366 56218 56236 19 2582 102022 102066 45 150 5487 5500 14 1367 56261 56282 22 2583 102068 102084 17 151 5506 5545 40 1368 56311 56336 26 2584 102100 102113 14 152 5561 5577 17 1369 56331 56345 15 2585 102115 102130 16 153 5580 5617 38 1370 56338 56358 21 2586 102132 102145 14 154 5607 5620 14 1371 56369 56390 22 2587 102192 102241 50 155 5619 5642 24 1372 56391 56431 41 2588 102269 102285 17 156 5644 5683 40 1373 56433 56451 19 2589102312 102327 16 157 5685 5698 14 1374 56453 56473 21 2590 102357 102392 36 158 5713 5759 47 1375 56475 56498 24 2591 102407 102428 22 159 5756 5769 14 1376 56500 56546 47 2592 102430 102444 15 160 5784 5803 20 1377 56558 56581 24 2593 102460 102485 26 161 5801 5865 65 1378 56584 56597 14 2594 102487 102508 22 162 5873 5905 33 1379 56611 56647 37 2595 102532 102573 42 163 5907 5937 31 1380 56643 56657 15 2596 102595 102642 48 164 5939 5985 47 1381 56667 56691 25 2597 102653 102694 42 165 5987 6017 31 1382 56732 56759 28 2598 102701 102718 18 166 6016 6039 24 1383 56788 56805 18 2599 102720 102734 15 167 6028 6092 65 1384 56821 56845 25 2600 102736 102757 22 168 6102 6127 26 1385 56850 56882 33 2601 102799 102836 38 169 6127 6152 26 1386 56885 56906 22 2602 102847 102882 36 170 6151 6171 21 1387 56928 56942 15 2603 102890 102927 38 171 6178 6206 29 1388 56944 56959 16 2604 102938 102971 34 172 6217 6234 18 1389 56961 56975 15 2605 102982 103019 38 173 6224 6270 47 1390 56984 57002 192606 103014 103027 14 174 6272 6289 18 1391 57004 57041 38 2607 103027 103054 28 175 6291 6310 20 1392 57057 57082 26 2608 103065 103088 24 176 6312 6357 46 1393 57084 57122 39 2609 103090 103108 19 177 6367 6389 23 1394 57162 57222 61 2610 103098 103112 15 178 6396 6422 27 1395 57224 57246 23 2611 103117 103138 22 179 6440 6454 15 1396 57259 57284 26 2612 103152 103170 19 180 6456 6482 27 1397 57317 57332 16 2613 103174 103204 31 181 6484 6513 30 1398 57346 57369 24 2614 103206 103234 29 182 6505 6519 15 1399 57388 57423 36 2615 103240 103268 29 183 6518 6553 36 1400 57425 57440 16 2616 103286 103325 40 184 6552 6565 14 1401 57442 57455 14 2617 103327 103347 21 185 6557 6590 34 1402 57475 57492 18 2618 103349 103384 36 186 6596 6628 33 1403 57508 57522 15 2619 103386 103405 20 187 6640 6675 36 1404 57522 57546 25 2620 103422 103449 28 188 6686 6711 26 1405 57548 57576 29 2621 103451 103493 43 189 6714 6746 33 1406 57593 57634 42 2622 103495 103509 15 190 6781 6818 38 1407 57658 5767518 2623 103511 103560 50 191 6832 6885 54 1408 57687 57771 85 2624 103565 103582 18 192 6889 6912 24 1409 57786 57803 18 2625 103585 103607 23 193 6920 6938 19 1410 57801 57819 19 2626 103631 103645 15 194 6940 6960 21 1411 57830 57858 29 2627 103653 103684 32 195 6954 6976 23 1412 57889 57911 23 2628 103683 103696 14 196 6998 7033 36 1413 57926 57945 20 2629 103691 103733 43 197 7035 7061 27 1414 57947 57972 26 2630 103738 103762 25 198 7071 7143 73 1415 58009 58028 20 2631 103752 103765 14 199 7159 7214 56 1416 58030 58060 31 2632 103755 103768 14 200 7253 7266 14 1417 58063 58091 29 2633 103758 103771 14 201 7268 7281 14 1418 58124 58146 23 2634 103790 103814 25 202 7283 7328 46 1419 58147 58162 16 2635 103803 103816 14 203 7329 7343 15 1420 58163 58198 36 2636 103830 103865 36 204 7338 7355 18 1421 58214 58292 79 2637 103900 103923 24 205 7345 7374 30 1422 58292 58309 18 2638 103912 103933 22 206 7374 7387 14 1423 58336 58429 94 2639 103945 103964 20 207 7383 7396 14 1424 5843658457 22 2640 103990 104005 16 208 7389 7405 17 1425 58453 58501 49 2641 104024 104055 32 209 7399 7413 15 1426 58525 58553 29 2642 104058 104077 20 210 7420 7437 18 1427 58566 58579 14 2643 104086 104099 14 211 7427 7448 22 1428 58571 58584 14 2644 104095 104122 28 212 7450 7503 54 1429 58586 58601 16 2645 104124 104146 23 213 7495 7565 71 1430 58604 58630 27 2646 104148 104168 21 214 7561 7616 56 1431 58656 58682 27 2647 104162 104176 15 215 7618 7703 86 1432 58696 58713 18 2648 104173 104187 15 216 7717 7772 56 1433 58722 58744 23 2649 104201 104241 41 217 7776 7838 63 1434 58757 58771 15 2650 104234 104266 33 218 7852 7869 18 1435 58805 58979 175 2651 104268 104286 19 219 7882 7910 29 1436 58987 59073 87 2652 104288 104302 15 220 7919 7942 24 1437 59072 59123 52 2653 104304 104335 32 221 7944 7957 14 1438 59124 59150 27 2654 104340 104354 15 222 7959 7977 19 1439 59154 59234 81 2655 104356 104373 18 223 7979 7996 18 1440 59231 59276 46 2656 104375 104391 17 224 7998 8014 17 144159291 59413 123 2657 104393 104417 25 225 8030 8046 17 1442 59413 59458 46 2658 104426 104439 14 226 8059 8092 34 1443 59466 59511 46 2659 104448 104478 31 227 8100 8113 14 1444 59513 59533 21 2660 104480 104504 25 228 8115 8141 27 1445 59549 59764 216 2661 104519 104546 28 229 8143 8175 33 1446 59762 59825 64 2662 104549 104580 32 230 8179 8192 14 1447 59824 59907 84 2663 104604 104620 17 231 8187 8208 22 1448 59916 60004 89 2664 104620 104646 27 232 8205 8219 15 1449 60006 60030 25 2665 104654 104673 20 233 8210 8229 20 1450 60027 60040 14 2666 104675 104691 17 234 8231 8252 22 1451 60032 60100 69 2667 104689 104776 88 235 8254 8298 45 1452 60119 60188 70 2668 104829 104842 14 236 8302 8316 15 1453 60191 60227 37 2669 104838 104852 15 237 8306 8329 24 1454 60220 60287 68 2670 104934 104952 19 238 8331 8357 27 1455 60289 60314 26 2671 104956 104987 32 239 8400 8443 44 1456 60316 60554 239 2672 104993 105045 53 240 8443 8456 14 1457 60556 60575 20 2673 105041 105055 15 241 8445 8460 161458 60579 60593 15 2674 105047 105078 32 242 8472 8505 34 1459 60595 60638 44 2675 105090 105107 18 243 8494 8507 14 1460 60651 60690 40 2676 105101 105115 15 244 8554 8569 16 1461 60692 60724 33 2677 105109 105137 29 245 8571 8653 83 1462 60716 60799 84 2678 105149 105167 19 246 8659 8673 15 1463 60801 60872 72 2679 105163 105176 14 247 8675 8694 20 1464 60868 60881 14 2680 105185 105237 53 248 8696 8713 18 1465 60885 60912 28 2681 105230 105243 14 249 8736 8844 109 1466 60961 61009 49 2682 105233 105250 18 250 8847 8909 63 1467 61014 61042 29 2683 105260 105286 27 251 8915 8959 45 1468 61046 61059 14 2684 105288 105340 53 252 8961 8975 15 1469 61053 61066 14 2685 105345 105370 26 253 8993 9009 17 1470 61061 61084 24 2686 105372 105402 31 254 9024 9048 25 1471 61134 61164 31 2687 105441 105458 18 255 9050 9063 14 1472 61178 61199 22 2688 105460 105521 62 256 9089 9120 32 1473 61201 61229 29 2689 105526 105541 16 257 9127 9166 40 1474 61258 61284 27 2690 105543 105560 18 258 9191 924959 1475 61286 61304 19 2691 105562 105575 14 259 9257 9285 29 1476 61316 61332 17 2692 105582 105606 25 260 9288 9302 15 1477 61341 61354 14 2693 105616 105671 56 261 9331 9397 67 1478 61356 61383 28 2694 105677 105704 28 262 9399 9438 40 1479 61407 61440 34 2695 105703 105725 23 263 9437 9455 19 1480 61451 61468 18 2696 105746 105759 14 264 9483 9505 23 1481 61470 61497 28 2697 105750 105765 16 265 9507 9526 20 1482 61493 61506 14 2698 105776 105796 21 266 9583 9598 16 1483 61499 61529 31 2699 105798 105824 27 267 9600 9613 14 1484 61531 61558 28 2700 105827 105907 81 268 9628 9641 14 1485 61590 61615 26 2701 105924 105939 16 269 9653 9674 22 1486 61623 61640 18 2702 105941 105963 23 270 9676 9690 15 1487 61673 61877 205 2703 105990 106014 25 271 9745 9758 14 1488 61879 61898 20 2704 106017 106048 32 272 9752 9780 29 1489 61900 61941 42 2705 106039 106072 34 273 9796 9809 14 1490 61943 61962 20 2706 106061 106074 14 274 9811 9825 15 1491 61964 61983 20 2707 106073 106102 30 275 98329853 22 1492 62003 62017 15 2708 106092 106107 16 276 9877 9899 23 1493 62015 62080 66 2709 106114 106159 46 277 9901 9932 32 1494 62100 62124 25 2710 106161 106180 20 278 10000 10016 17 1495 62133 62146 14 2711 106197 106243 47 279 10029 10049 21 1496 62139 62175 37 2712 106237 106250 14 280 10051 10071 21 1497 62191 62237 47 2713 106243 106256 14 281 10089 10120 32 1498 62250 62270 21 2714 106247 106267 21 282 10111 10127 17 1499 62283 62316 34 2715 106273 106333 61 283 10122 10203 82 1500 62310 62358 49 2716 106335 106367 33 284 10211 10237 27 1501 62357 62397 41 2717 106369 106417 49 285 10239 10256 18 1502 62399 62413 15 2718 106419 106471 53 286 10258 10285 28 1503 62415 62470 56 2719 106486 106523 38 287 10287 10304 18 1504 62472 62501 30 2720 106525 106538 14 288 10306 10350 45 1505 62503 62541 39 2721 106552 106572 21 289 10352 10375 24 1506 62553 62609 57 2722 106584 106598 15 290 10381 10402 22 1507 62611 62656 46 2723 106609 106696 88 291 10412 10470 59 1508 62663 62690 282724 106698 106723 26 292 10474 10488 15 1509 62703 62735 33 2725 106725 106740 16 293 10508 10557 50 1510 62737 62759 23 2726 106743 106781 39 294 10565 10630 66 1511 62765 62789 25 2727 106783 106811 29 295 10632 10674 43 1512 62802 62816 15 2728 106826 106866 41 296 10698 10711 14 1513 62810 62824 15 2729 106875 106902 28 297 10701 10714 14 1514 62853 62868 16 2730 106916 106935 20 298 10704 10718 15 1515 62864 62878 15 2731 106942 106960 19 299 10720 10740 21 1516 62878 62907 30 2732 106991 107010 20 300 10742 10785 44 1517 62905 62937 33 2733 107019 107038 20 301 10786 10809 24 1518 62937 62951 15 2734 107040 107072 33 302 10811 10829 19 1519 62943 62956 14 2735 107079 107094 16 303 10832 10867 36 1520 62946 62960 15 2736 107087 107101 15 304 10869 10930 62 1521 62961 62988 28 2737 107090 107109 20 305 10932 10950 19 1522 62993 63006 14 2738 107113 107127 15 306 10959 10996 38 1523 63005 63019 15 2739 107129 107143 15 307 10998 11028 31 1524 63030 63049 20 2740 107154 107172 19308 11037 11077 41 1525 63057 63076 20 2741 107174 107198 25 309 11079 11105 27 1526 63073 63088 16 2742 107210 107226 17 310 11115 11132 18 1527 63078 63125 48 2743 107226 107239 14 311 11134 11154 21 1528 63128 63152 25 2744 107237 107274 38 312 11156 11196 41 1529 63154 63170 17 2745 107296 107356 61 313 11206 11239 34 1530 63172 63196 25 2746 107358 107381 24 314 11241 11255 15 1531 63185 63223 39 2747 107383 107415 33 315 11266 11287 22 1532 63225 63245 21 2748 107417 107433 17 316 11299 11329 31 1533 63236 63254 19 2749 107435 107455 21 317 11331 11352 22 1534 63245 63261 17 2750 107457 107508 52 318 11358 11403 46 1535 63263 63276 14 2751 107510 107525 16 319 11405 11432 28 1536 63280 63295 16 2752 107527 107546 20 320 11434 11480 47 1537 63292 63336 45 2753 107559 107573 15 321 11482 11535 54 1538 63344 63368 25 2754 107586 107617 32 322 11539 11573 35 1539 63369 63396 28 2755 107643 107689 47 323 11584 11732 149 1540 63385 63398 14 2756 107694 107716 23 324 11731 11763 33 154163395 63417 23 2757 107744 107792 49 325 11765 11782 18 1542 63433 63451 19 2758 107790 107832 43 326 11784 11813 30 1543 63440 63453 14 2759 107834 107860 27 327 11815 11829 15 1544 63454 63470 17 2760 107864 107896 33 328 11831 11852 22 1545 63472 63511 40 2761 107898 107912 15 329 11854 11871 18 1546 63513 63539 27 2762 107914 107953 40 330 11866 11895 30 1547 63547 63603 57 2763 107967 107992 26 331 11930 11943 14 1548 63625 63651 27 2764 107994 108008 15 332 11975 12007 33 1549 63676 63692 17 2765 108010 108038 29 333 11996 12012 17 1550 63730 63746 17 2766 108065 108084 20 334 12017 12040 24 1551 63759 63775 17 2767 108113 108215 103 335 12050 12083 34 1552 63779 63833 55 2768 108220 108249 30 336 12088 12111 24 1553 63844 63883 40 2769 108253 108281 29 337 12133 12151 19 1554 63889 63907 19 2770 108283 108304 22 338 12161 12174 14 1555 63910 63938 29 2771 108317 108359 43 339 12179 12225 47 1556 63943 63962 20 2772 108361 108375 15 340 12238 12256 19 1557 64004 64033 30 2773108386 108402 17 341 12265 12278 14 1558 64056 64087 32 2774 108421 108440 20 342 12296 12360 65 1559 64112 64132 21 2775 108538 108551 14 343 12362 12381 20 1560 64142 64158 17 2776 108561 108575 15 344 12384 12399 16 1561 64160 64191 32 2777 108577 108616 40 345 12400 12475 76 1562 64193 64209 17 2778 108618 108665 48 346 12487 12502 16 1563 64214 64227 14 2779 108677 108707 31 347 12504 12531 28 1564 64228 64241 14 2780 108735 108768 34 348 12533 12562 30 1565 64254 64278 25 2781 108762 108777 16 349 12564 12602 39 1566 64280 64298 19 2782 108780 108824 45 350 12627 12646 20 1567 64300 64338 39 2783 108842 108885 44 351 12655 12679 25 1568 64340 64355 16 2784 108907 108970 64 352 12681 12698 18 1569 64357 64380 24 2785 108983 109019 37 353 12700 12812 113 1570 64412 64434 23 2786 109021 109053 33 354 12828 12876 49 1571 64438 64456 19 2787 109055 109068 14 355 12877 12913 37 1572 64458 64488 31 2788 109070 109099 30 356 12932 12945 14 1573 64490 64517 28 2789 109097 109122 26 35712936 12967 32 1574 64519 64538 20 2790 109113 109132 20 358 12988 13002 15 1575 64552 64572 21 2791 109125 109165 41 359 12996 13009 14 1576 64585 64608 24 2792 109167 109181 15 360 13018 13035 18 1577 64625 64642 18 2793 109183 109200 18 361 13031 13049 19 1578 64631 64644 14 2794 109214 109248 35 362 13056 13093 38 1579 64644 64683 40 2795 109256 109277 22 363 13096 13126 31 1580 64703 64716 14 2796 109281 109298 18 364 13128 13142 15 1581 64736 64751 16 2797 109298 109311 14 365 13144 13193 50 1582 64759 64773 15 2798 109300 109318 19 366 13201 13221 21 1583 64775 64806 32 2799 109324 109374 51 367 13223 13280 58 1584 64815 64831 17 2800 109377 109397 21 368 13282 13298 17 1585 64845 64878 34 2801 109399 109437 39 369 13300 13315 16 1586 64880 64904 25 2802 109446 109461 16 370 13307 13320 14 1587 64915 64937 23 2803 109463 109476 14 371 13315 13331 17 1588 64948 64971 24 2804 109472 109485 14 372 13351 13411 61 1589 64973 64994 22 2805 109478 109514 37 373 13422 13437 16 159064996 65017 22 2806 109516 109540 25 374 13439 13456 18 1591 65019 65055 37 2807 109556 109588 33 375 13461 13483 23 1592 65062 65109 48 2808 109601 109644 44 376 13485 13541 57 1593 65111 65138 28 2809 109661 109681 21 377 13543 13560 18 1594 65140 65179 40 2810 109683 109709 27 378 13574 13606 33 1595 65181 65195 15 2811 109707 109737 31 379 13618 13646 29 1596 65210 65230 21 2812 109739 109754 16 380 13778 13801 24 1597 65232 65248 17 2813 109754 109768 15 381 13994 14009 16 1598 65271 65296 26 2814 109770 109798 29 382 14508 14521 14 1599 65298 65319 22 2815 109810 109829 20 383 15049 15067 19 1600 65321 65371 51 2816 109859 109877 19 384 15069 15090 22 1601 65391 65413 23 2817 109879 109934 56 385 15102 15139 38 1602 65415 65436 22 2818 109955 109975 21 386 15142 15180 39 1603 65436 65454 19 2819 109975 109988 14 387 15182 15205 24 1604 65477 65490 14 2820 109994 110096 103 388 15238 15252 15 1605 65492 65520 29 2821 110103 110129 27 389 15254 15277 24 1606 65522 65552 31 2822110131 110152 22 390 15292 15320 29 1607 65554 65579 26 2823 110153 110173 21 391 15322 15348 27 1608 65581 65594 14 2824 110175 110195 21 392 15343 15358 16 1609 65591 65606 16 2825 110192 110226 35 393 15362 15387 26 1610 65595 65616 22 2826 110297 110312 16 394 15399 15414 16 1611 65618 65632 15 2827 110301 110314 14 395 15416 15445 30 1612 65634 65657 24 2828 110308 110333 26 396 15459 15528 70 1613 65661 65716 56 2829 110335 110351 17 397 15537 15592 56 1614 65730 65747 18 2830 110353 110368 16 398 15610 15638 29 1615 65748 65807 60 2831 110376 110401 26 399 15640 15653 14 1616 65809 65829 21 2832 110418 110462 45 400 15655 15717 63 1617 65831 65844 14 2833 110464 110481 18 401 15719 15738 20 1618 65846 65859 14 2834 110531 110558 28 402 15757 15778 22 1619 65861 65891 31 2835 110571 110590 20 403 15783 15801 19 1620 65898 65920 23 2836 110599 110639 41 404 15818 15838 21 1621 65930 65963 34 2837 110630 110643 14 405 15835 15849 15 1622 65980 66060 81 2838 110641 110661 21 40615840 15857 18 1623 66069 66085 17 2839 110668 110681 14 407 15856 15898 43 1624 66095 66108 14 2840 110683 110709 27 408 15900 15916 17 1625 66110 66126 17 2841 110717 110798 82 409 15931 15972 42 1626 66139 66173 35 2842 110804 110849 46 410 15988 16028 41 1627 66175 66191 17 2843 110853 110890 38 411 16030 16075 46 1628 66204 66226 23 2844 110928 110966 39 412 16103 16164 62 1629 66224 66263 40 2845 110971 111003 33 413 16207 16243 37 1630 66265 66278 14 2846 111000 111013 14 414 16233 16246 14 1631 66280 66320 41 2847 111015 111033 19 415 16255 16329 75 1632 66322 66345 24 2848 111035 111050 16 416 16349 16376 28 1633 66355 66371 17 2849 111062 111094 33 417 16378 16404 27 1634 66375 66407 33 2850 111092 111105 14 418 16399 16419 21 1635 66411 66424 14 2851 111107 111140 34 419 16421 16461 41 1636 66421 66441 21 2852 111161 111203 43 420 16463 16479 17 1637 66440 66460 21 2853 111209 111223 15 421 16481 16503 23 1638 66463 66482 20 2854 111224 111280 57 422 16506 16579 74 163966484 66501 18 2855 111275 111290 16 423 16582 16620 39 1640 66509 66527 19 2856 111283 111303 21 424 16622 16698 77 1641 66534 66548 15 2857 111305 111320 16 425 16700 16716 17 1642 66556 66569 14 2858 111311 111347 37 426 16723 16771 49 1643 66562 66593 32 2859 111355 111368 14 427 16786 16816 31 1644 66606 66637 32 2860 111357 111371 15 428 16835 16864 30 1645 66639 66665 27 2861 111360 111381 22 429 16865 16878 14 1646 66674 66690 17 2862 111373 111421 49 430 16872 16888 17 1647 66692 66720 29 2863 111412 111426 15 431 16890 16906 17 1648 66722 66742 21 2864 111451 111468 18 432 16904 16938 35 1649 66758 66786 29 2865 111467 111480 14 433 16965 17052 88 1650 66787 66802 16 2866 111482 111496 15 434 17054 17069 16 1651 66812 66862 51 2867 111486 111500 15 435 17071 17085 15 1652 66864 66885 22 2868 111497 111510 14 436 17083 17098 16 1653 66940 66953 14 2869 111531 111564 34 437 17088 17111 24 1654 66982 66997 16 2870 111580 111606 27 438 17124 17138 15 1655 67024 67084 61 2871111616 111637 22 439 17140 17159 20 1656 67103 67118 16 2872 111658 111671 14 440 17181 17202 22 1657 67156 67185 30 2873 111674 111688 15 441 17202 17218 17 1658 67181 67195 15 2874 111692 111710 19 442 17229 17248 20 1659 67193 67206 14 2875 111712 111725 14 443 17250 17268 19 1660 67215 67229 15 2876 111727 111761 35 444 17332 17349 18 1661 67231 67271 41 2877 111781 111804 24 445 17363 17387 25 1662 67288 67301 14 2878 111811 111828 18 446 17389 17429 41 1663 67294 67345 52 2879 111831 111849 19 447 17450 17464 15 1664 67362 67379 18 2880 111856 111871 16 448 17482 17497 16 1665 67381 67397 17 2881 111901 111917 17 449 18104 18117 14 1666 67409 67448 40 2882 111919 111940 22 450 18418 18431 14 1667 67468 67481 14 2883 111942 111987 46 451 18613 18626 14 1668 67483 67510 28 2884 111984 112002 19 452 18620 18634 15 1669 67540 67561 22 2885 112004 112069 66 453 18707 18721 15 1670 67620 67640 21 2886 112070 112091 22 454 18841 18855 15 1671 67656 67672 17 2887 112093 112116 24 45518875 18889 15 1672 67674 67749 76 2888 112118 112132 15 456 19282 19295 14 1673 67751 67764 14 2889 112139 112170 32 457 19310 19323 14 1674 67783 67801 19 2890 112180 112196 17 458 19454 19467 14 1675 67803 67828 26 2891 112204 112223 20 459 19774 19792 19 1676 67830 67848 19 2892 112236 112283 48 460 19794 19864 71 1677 67850 67868 19 2893 112329 112343 15 461 19862 19890 29 1678 67877 67918 42 2894 112345 112383 39 462 19892 19918 27 1679 67933 67961 29 2895 112385 112401 17 463 19907 19931 25 1680 67963 67978 16 2896 112404 112423 20 464 19927 19942 16 1681 67998 68026 29 2897 112463 112477 15 465 19932 19971 40 1682 68028 68046 19 2898 112485 112547 63 466 19973 20011 39 1683 68048 68082 35 2899 112563 112581 19 467 20022 20063 42 1684 68084 68112 29 2900 112583 112597 15 468 20080 20093 14 1685 68114 68130 17 2901 112607 112638 32 469 20131 20144 14 1686 68129 68155 27 2902 112640 112664 25 470 20240 20253 14 1687 68170 68192 23 2903 112683 112721 39 471 20448 20463 16 168868194 68237 44 2904 112730 112759 30 472 20495 20508 14 1689 68239 68261 23 2905 112773 112811 39 473 20532 20545 14 1690 68272 68286 15 2906 112811 112825 15 474 20600 20613 14 1691 68290 68373 84 2907 112828 112862 35 475 20617 20630 14 1692 68375 68419 45 2908 112882 112912 31 476 20960 20977 18 1693 68442 68487 46 2909 112914 112967 54 477 21412 21428 17 1694 68489 68547 59 2910 112968 112982 15 478 21465 21479 15 1695 68549 68592 44 2911 112984 113016 33 479 21489 21508 20 1696 68599 68614 16 2912 113044 113064 21 480 21797 21812 16 1697 68617 68657 41 2913 113074 113097 24 481 22015 22030 16 1698 68659 68686 28 2914 113111 113153 43 482 22144 22157 14 1699 68688 68735 48 2915 113169 113194 26 483 22153 22167 15 1700 68732 68747 16 2916 113198 113212 15 484 22265 22278 14 1701 68749 68786 38 2917 113214 113230 17 485 23110 23123 14 1702 68788 68830 43 2918 113232 113263 32 486 23114 23133 20 1703 68837 68879 43 2919 113265 113284 20 487 23286 23303 18 1704 68882 68899 18 2920113306 113328 23 488 23364 23379 16 1705 68918 68942 25 2921 113330 113355 26 489 23478 23498 21 1706 68944 68968 25 2922 113357 113371 15 490 23544 23587 44 1707 68983 69007 25 2923 113404 113422 19 491 23589 23630 42 1708 69012 69027 16 2924 113421 113489 69 492 23658 23676 19 1709 69020 69064 45 2925 113533 113559 27 493 23678 23702 25 1710 69064 69077 14 2926 113561 113574 14 494 23704 23729 26 1711 69079 69114 36 2927 113595 113616 22 495 23731 23748 18 1712 69116 69196 81 2928 113648 113700 53 496 23740 23755 16 1713 69185 69198 14 2929 113702 113739 38 497 23744 23757 14 1714 69202 69219 18 2930 113762 113823 62 498 23750 23764 15 1715 69228 69246 19 2931 113825 113960 136 499 23767 23795 29 1716 69240 69282 43 2932 113962 114015 54 500 23802 23816 15 1717 69294 69317 24 2933 114017 114048 32 501 23818 23831 14 1718 69306 69324 19 2934 114045 114124 80 502 23855 23869 15 1719 69333 69346 14 2935 114151 114170 20 503 23906 23926 21 1720 69352 69366 15 2936 114182 114218 37 50423928 23942 15 1721 69387 69431 45 2937 114230 114270 41 505 23994 24007 14 1722 69433 69447 15 2938 114272 114292 21 506 24005 24018 14 1723 69452 69480 29 2939 114296 114339 44 507 24023 24056 34 1724 69482 69497 16 2940 114354 114433 80 508 24074 24088 15 1725 69491 69504 14 2941 114440 114457 18 509 24088 24104 17 1726 69511 69564 54 2942 114459 114484 26 510 24112 24163 52 1727 69566 69628 63 2943 114478 114536 59 511 24199 24212 14 1728 69628 69642 15 2944 114538 114559 22 512 24231 24244 14 1729 69659 69681 23 2945 114567 114592 26 513 24237 24252 16 1730 69684 69697 14 2946 114594 114610 17 514 24254 24267 14 1731 69719 69744 26 2947 114612 114652 41 515 24281 24325 45 1732 69746 69763 18 2948 114681 114752 72 516 24327 24353 27 1733 69765 69792 28 2949 114775 114805 31 517 24355 24374 20 1734 69801 69828 28 2950 114803 114816 14 518 24376 24399 24 1735 69853 69901 49 2951 114807 114821 15 519 24401 24416 16 1736 69933 69949 17 2952 114823 114847 25 520 24442 24489 48 173769951 69966 16 2953 114868 114912 45 521 24492 24506 15 1738 69968 69983 16 2954 114947 114961 15 522 24498 24511 14 1739 69988 70061 74 2955 114974 114997 24 523 24538 24556 19 1740 70083 70100 18 2956 115001 115015 15 524 24546 24562 17 1741 70110 70154 45 2957 115004 115017 14 525 24591 24618 28 1742 70161 70199 39 2958 115019 115069 51 526 24620 24633 14 1743 70202 70225 24 2959 115060 115073 14 527 24635 24650 16 1744 70231 70246 16 2960 115072 115085 14 528 24665 24681 17 1745 70269 70295 27 2961 115087 115100 14 529 24687 24706 20 1746 70292 70327 36 2962 115102 115124 23 530 24709 24729 21 1747 70331 70349 19 2963 115132 115151 20 531 24731 24752 22 1748 70351 70371 21 2964 115154 115168 15 532 24756 24771 16 1749 70381 70403 23 2965 115188 115208 21 533 24773 24788 16 1750 70405 70420 16 2966 115219 115256 38 534 24793 24821 29 1751 70422 70483 62 2967 115258 115283 26 535 24823 24854 32 1752 70496 70533 38 2968 115285 115300 16 536 24856 24870 15 1753 70535 70578 44 2969115331 115353 23 537 24873 24922 50 1754 70577 70639 63 2970 115355 115372 18 538 24933 24954 22 1755 70653 70667 15 2971 115380 115397 18 539 24965 24984 20 1756 70661 70674 14 2972 115399 115412 14 540 25019 25052 34 1757 70669 70695 27 2973 115426 115475 50 541 25054 25099 46 1758 70687 70705 19 2974 115496 115510 15 542 25112 25125 14 1759 70708 70744 37 2975 115521 115545 25 543 25133 25169 37 1760 70746 70764 19 2976 115555 115580 26 544 25171 25184 14 1761 70766 70779 14 2977 115582 115600 19 545 25186 25221 36 1762 70781 70832 52 2978 115602 115621 20 546 25236 25253 18 1763 70834 70851 18 2979 115653 115677 25 547 25246 25296 51 1764 70858 70887 30 2980 115692 115720 29 548 25298 25336 39 1765 70889 70902 14 2981 115722 115738 17 549 25332 25348 17 1766 70920 70933 14 2982 115769 115783 15 550 25349 25363 15 1767 70935 70964 30 2983 115792 115808 17 551 25388 25432 45 1768 70974 70987 14 2984 115819 115837 19 552 25439 25462 24 1769 71008 71028 21 2985 115846 115878 33 55325509 25523 15 1770 71030 71046 17 2986 115888 115901 14 554 25525 25547 23 1771 71048 71073 26 2987 115916 115932 17 555 25578 25593 16 1772 71075 71106 32 2988 115943 115956 14 556 25587 25601 15 1773 71108 71133 26 2989 115967 115993 27 557 25604 25617 14 1774 71137 71152 16 2990 115996 116014 19 558 25633 25655 23 1775 71153 71170 18 2991 116027 116045 19 559 25672 25716 45 1776 71179 71192 14 2992 116105 116127 23 560 25725 25738 14 1777 71197 71224 28 2993 116126 116139 14 561 25764 25800 37 1778 71235 71251 17 2994 116141 116158 18 562 25802 25828 27 1779 71253 71311 59 2995 116171 116186 16 563 25831 25846 16 1780 71310 71329 20 2996 116194 116208 15 564 25851 25872 22 1781 71330 71364 35 2997 116257 116279 23 565 25877 25904 28 1782 71366 71386 21 2998 116318 116373 56 566 25921 25946 26 1783 71388 71410 23 2999 116375 116437 63 567 25943 25970 28 1784 71412 71433 22 3000 116439 116454 16 568 25972 25986 15 1785 71448 71472 25 3001 116456 116496 41 569 26051 26064 14 178671475 71491 17 3002 116500 116532 33 570 26068 26086 19 1787 71491 71553 63 3003 116534 116554 21 571 26113 26137 25 1788 71555 71581 27 3004 116556 116573 18 572 26139 26159 21 1789 71583 71624 42 3005 116575 116592 18 573 26182 26197 16 1790 71634 71700 67 3006 116596 116615 20 574 26243 26296 54 1791 71706 71725 20 3007 116617 116650 34 575 26298 26313 16 1792 71732 71747 16 3008 116650 116664 15 576 26327 26350 24 1793 71789 71804 16 3009 116666 116694 29 577 26366 26385 20 1794 71810 71824 15 3010 116775 116792 18 578 26387 26404 18 1795 71819 71834 16 3011 116794 116811 18 579 26397 26415 19 1796 71839 71872 34 3012 116813 116838 26 580 26416 26453 38 1797 71876 71889 14 3013 116840 116872 33 581 26447 26461 15 1798 71886 71908 23 3014 116890 116911 22 582 26457 26471 15 1799 71910 71924 15 3015 116921 116948 28 583 26481 26498 18 1800 71985 71999 15 3016 116952 116988 37 584 26502 26525 24 1801 72000 72021 22 3017 116990 117006 17 585 26528 26562 35 1802 72023 72047 25 3018117008 117036 29 586 26564 26590 27 1803 72071 72158 88 3019 117059 117133 75 587 26590 26622 33 1804 72165 72192 28 3020 117187 117207 21 588 26624 26638 15 1805 72194 72234 41 3021 117204 117217 14 589 26687 26702 16 1806 72236 72255 20 3022 117209 117237 29 590 26706 26719 14 1807 72257 72281 25 3023 117239 117252 14 591 26717 26730 14 1808 72283 72299 17 3024 117255 117275 21 592 26729 26743 15 1809 72312 72329 18 3025 117277 117300 24 593 26767 26797 31 1810 72323 72336 14 3026 117337 117371 35 594 26796 26816 21 1811 72348 72395 48 3027 117373 117416 44 595 26831 26847 17 1812 72398 72411 14 3028 117418 117450 33 596 26837 26850 14 1813 72413 72455 43 3029 117456 117507 52 597 26877 26890 14 1814 72470 72503 34 3030 117518 117532 15 598 26900 26922 23 1815 72506 72541 36 3031 117534 117590 57 599 26911 26933 23 1816 72545 72558 14 3032 117582 117604 23 600 26933 26946 14 1817 72560 72586 27 3033 117593 117617 25 601 26938 26977 40 1818 72583 72597 15 3034 117621 117648 28 60226979 26992 14 1819 72588 72602 15 3035 117640 117662 23 603 26981 27017 37 1820 72611 72636 26 3036 117664 117688 25 604 27023 27041 19 1821 72638 72688 51 3037 117690 117711 22 605 27039 27055 17 1822 72696 72736 41 3038 117728 117743 16 606 27075 27121 47 1823 72738 72761 24 3039 117747 117781 35 607 27138 27153 16 1824 72774 72799 26 3040 117784 117801 18 608 27163 27266 104 1825 72801 72886 86 3041 117792 117822 31 609 27270 27293 24 1826 72888 72903 16 3042 117824 117842 19 610 27325 27358 34 1827 72928 72958 31 3043 117850 117869 20 611 27363 27408 46 1828 72962 72990 29 3044 117890 117940 51 612 27419 27448 30 1829 73001 73014 14 3045 117936 117968 33 613 27450 27469 20 1830 73017 73053 37 3046 117970 117990 21 614 27471 27498 28 1831 73055 73078 24 3047 117989 118034 46 615 27510 27523 14 1832 73077 73090 14 3048 118034 118057 24 616 27535 27562 28 1833 73088 73121 34 3049 118061 118083 23 617 28098 28119 22 1834 73124 73153 30 3050 118086 118122 37 618 28136 28155 20 183573147 73172 26 3051 118122 118182 61 619 28169 28197 29 1836 73164 73203 40 3052 118172 118186 15 620 28199 28212 14 1837 73218 73257 40 3053 118197 118211 15 621 28221 28244 24 1838 73260 73273 14 3054 118216 118275 60 622 28271 28285 15 1839 73268 73281 14 3055 118291 118316 26 623 28400 28414 15 1840 73278 73291 14 3056 118318 118354 37 624 28441 28476 36 1841 73298 73313 16 3057 118373 118388 16 625 28490 28533 44 1842 73451 73465 15 3058 118391 118405 15 626 28535 28562 28 1843 73459 73472 14 3059 118407 118423 17 627 28575 28600 26 1844 73512 73567 56 3060 118425 118456 32 628 28621 28634 14 1845 73569 73611 43 3061 118465 118492 28 629 28650 28663 14 1846 73614 73645 32 3062 118498 118521 24 630 28674 28687 14 1847 73661 73713 53 3063 118533 118551 19 631 28681 28699 19 1848 73712 73727 16 3064 118553 118581 29 632 28713 28730 18 1849 73716 73731 16 3065 118587 118617 31 633 28736 28761 26 1850 73735 73748 14 3066 118620 118679 60 634 28763 28811 49 1851 73741 73760 20 3067118687 118716 30 635 28821 28854 34 1852 73764 73782 19 3068 118731 118771 41 636 28856 28881 26 1853 73783 73801 19 3069 118779 118805 27 637 28883 28920 38 1854 73795 73829 35 3070 118816 118830 15 638 28922 28947 26 1855 73860 73873 14 3071 118832 118895 64 639 28979 29006 28 1856 73885 73904 20 3072 118910 119065 156 640 29008 29056 49 1857 73906 73919 14 3073 119067 119081 15 641 29078 29095 18 1858 73916 73945 30 3074 119095 119140 46 642 29098 29129 32 1859 73947 73961 15 3075 119170 119205 36 643 29122 29135 14 1860 73978 74018 41 3076 119210 119232 23 644 29131 29144 14 1861 74020 74046 27 3077 119230 119246 17 645 29144 29158 15 1862 74061 74082 22 3078 119236 119252 17 646 29160 29207 48 1863 74092 74158 67 3079 119255 119274 20 647 29209 29230 22 1864 74160 74177 18 3080 119271 119284 14 648 29234 29266 33 1865 74179 74209 31 3081 119290 119307 18 649 29268 29286 19 1866 74216 74245 30 3082 119320 119335 16 650 29301 29315 15 1867 74270 74287 18 3083 119357 119463 107 65129304 29323 20 1868 74289 74305 17 3084 119465 119483 19 652 29330 29352 23 1869 74307 74368 62 3085 119485 119535 51 653 29344 29358 15 1870 74369 74411 43 3086 119550 119571 22 654 29347 29365 19 1871 74416 74461 46 3087 119577 119608 32 655 29377 29402 26 1872 74463 74479 17 3088 119610 119646 37 656 29402 29422 21 1873 74506 74541 36 3089 119648 119688 41 657 29424 29445 22 1874 74543 74636 94 3090 119713 119752 40 658 29443 29457 15 1875 74647 74704 58 3091 119743 119784 42 659 29447 29460 14 1876 74745 74770 26 3092 119786 119800 15 660 29462 29475 14 1877 74789 74813 25 3093 119822 119836 15 661 29491 29512 22 1878 74815 74838 24 3094 119830 119847 18 662 29514 29551 38 1879 74850 74877 28 3095 119849 119900 52 663 29547 29560 14 1880 74891 74923 33 3096 119912 119925 14 664 29553 29620 68 1881 74925 74940 16 3097 119960 119982 23 665 29625 29700 76 1882 74952 74969 18 3098 119984 120013 30 666 29714 29745 32 1883 74979 75001 23 3099 120038 120054 17 667 29774 29805 32 188475037 75066 30 3100 120057 120090 34 668 29816 29847 32 1885 75068 75088 21 3101 120092 120134 43 669 29875 29892 18 1886 75097 75123 27 3102 120138 120154 17 670 29894 29908 15 1887 75131 75149 19 3103 120157 120189 33 671 29897 29910 14 1888 75152 75189 38 3104 120187 120200 14 672 29917 29938 22 1889 75210 75252 43 3105 120191 120211 21 673 29939 29952 14 1890 75254 75276 23 3106 120225 120239 15 674 29961 29976 16 1891 75288 75310 23 3107 120242 120267 26 675 29974 29987 14 1892 75338 75357 20 3108 120271 120301 31 676 29978 30001 24 1893 75359 75372 14 3109 120320 120340 21 677 30006 30023 18 1894 75376 75397 22 3110 120363 120406 44 678 30025 30039 15 1895 75405 75432 28 3111 120406 120421 16 679 30043 30107 65 1896 75440 75470 31 3112 120414 120468 55 680 30145 30158 14 1897 75482 75501 20 3113 120457 120470 14 681 30149 30166 18 1898 75503 75540 38 3114 120487 120518 32 682 30173 30228 56 1899 75544 75560 17 3115 120545 120563 19 683 30230 30250 21 1900 75562 75576 15 3116120567 120587 21 684 30251 30309 59 1901 75589 75610 22 3117 120589 120625 37 685 30321 30358 38 1902 75633 75646 14 3118 120619 120633 15 686 30359 30380 22 1903 75648 75679 32 3119 120650 120663 14 687 30382 30422 41 1904 75691 75709 19 3120 120676 120694 19 688 30428 30442 15 1905 75711 75724 14 3121 120703 120717 15 689 30455 30482 28 1906 75740 75764 25 3122 120721 120737 17 690 30484 30498 15 1907 75763 75776 14 3123 120755 120812 58 691 30516 30531 16 1908 75767 75790 24 3124 120816 120838 23 692 30533 30646 114 1909 75780 75794 15 3125 120843 120871 29 693 30654 30745 92 1910 75792 75808 17 3126 120873 120899 27 694 30745 30760 16 1911 75810 75829 20 3127 120903 120922 20 695 30752 30766 15 1912 75831 75863 33 3128 120933 120946 14 696 30788 30843 56 1913 75865 75880 16 3129 120936 120981 46 697 30845 30867 23 1914 75882 75922 41 3130 120983 121004 22 698 30869 30912 44 1915 75932 75998 67 3131 121006 121021 16 699 30906 30920 15 1916 76000 76026 27 3132 121023 121036 14 70030934 30951 18 1917 76028 76045 18 3133 121035 121061 27 701 30962 30984 23 1918 76046 76082 37 3134 121063 121079 17 702 30989 31002 14 1919 76098 76413 316 3135 121081 121097 17 703 31010 31033 24 1920 76420 76442 23 3136 121105 121134 30 704 31036 31062 27 1921 76456 76477 22 3137 121138 121156 19 705 31092 31106 15 1922 76484 76558 75 3138 121155 121168 14 706 31128 31166 39 1923 76573 76592 20 3139 121158 121174 17 707 31168 31182 15 1924 76608 76622 15 3140 121166 121189 24 708 31189 31203 15 1925 76627 76663 37 3141 121194 121208 15 709 31205 31218 14 1926 76665 76683 19 3142 121201 121218 18 710 31224 31253 30 1927 76685 76698 14 3143 121213 121237 25 711 31256 31272 17 1928 76702 76716 15 3144 121246 121271 26 712 31274 31292 19 1929 76725 76744 20 3145 121298 121314 17 713 31294 31322 29 1930 76745 76761 17 3146 121311 121324 14 714 31324 31353 30 1931 76780 76796 17 3147 121327 121351 25 715 31357 31370 14 1932 76798 76812 15 3148 121359 121388 30 716 31373 31399 27 193376814 76832 19 3149 121390 121419 30 717 31403 31426 24 1934 76834 76859 26 3150 121446 121462 17 718 31445 31460 16 1935 76871 76934 64 3151 121468 121487 20 719 31463 31483 21 1936 77012 77034 23 3152 121499 121515 17 720 31485 31501 17 1937 77039 77055 17 3153 121517 121543 27 721 31494 31508 15 1938 77081 77094 14 3154 121545 121564 20 722 31507 31529 23 1939 77121 77184 64 3155 121575 121597 23 723 31531 31565 35 1940 77186 77200 15 3156 121599 121617 19 724 31567 31615 49 1941 77202 77225 24 3157 121619 121662 44 725 31630 31665 36 1942 77227 77247 21 3158 121664 121681 18 726 31675 31691 17 1943 77261 77317 57 3159 121683 121700 18 727 31703 31721 19 1944 77327 77340 14 3160 121702 121751 50 728 31729 31769 41 1945 77342 77366 25 3161 121773 121788 16 729 31770 31790 21 1946 77377 77394 18 3162 121790 121805 16 730 31795 31813 19 1947 77396 77439 44 3163 121807 121834 28 731 31815 31835 21 1948 77453 77468 16 3164 121836 121857 22 732 31837 31865 29 1949 77462 77593 132 3165121859 121874 16 733 31876 31889 14 1950 77586 77599 14 3166 121877 121925 49 734 31920 31945 26 1951 77595 77641 47 3167 121923 121936 14 735 31962 31978 17 1952 77643 77728 86 3168 121928 121943 16 736 31983 32014 32 1953 77730 77768 39 3169 121962 121976 15 737 32029 32050 22 1954 77778 77816 39 3170 121978 121992 15 738 32058 32110 53 1955 77818 77835 18 3171 122004 122028 25 739 32129 32147 19 1956 77837 77855 19 3172 122030 122056 27 740 32166 32242 77 1957 77861 77876 16 3173 122046 122059 14 741 32244 32279 36 1958 77882 77898 17 3174 122052 122072 21 742 32296 32315 20 1959 77900 77924 25 3175 122080 122095 16 743 32334 32396 63 1960 77923 77936 14 3176 122099 122122 24 744 32398 32425 28 1961 77957 77970 14 3177 122143 122163 21 745 32427 32453 27 1962 77962 77985 24 3178 122169 122189 21 746 32459 32481 23 1963 77994 78022 29 3179 122258 122274 17 747 32475 32498 24 1964 78024 78056 33 3180 122289 122309 21 748 32490 32523 34 1965 78079 78128 50 3181 122311 122346 36 74932519 32534 16 1966 78132 78158 27 3182 122357 122395 39 750 32525 32547 23 1967 78173 78213 41 3183 122446 122468 23 751 32542 32555 14 1968 78224 78265 42 3184 122471 122489 19 752 32559 32572 14 1969 78275 78332 58 3185 122491 122512 22 753 32574 32587 14 1970 78334 78440 107 3186 122526 122541 16 754 32595 32618 24 1971 78442 78489 48 3187 122543 122557 15 755 32613 32626 14 1972 78491 78505 15 3188 122579 122592 14 756 32627 32649 23 1973 78501 78514 14 3189 122606 122653 48 757 32651 32664 14 1974 78507 78537 31 3190 122663 122690 28 758 32655 32689 35 1975 78557 78570 14 3191 122728 122742 15 759 32693 32719 27 1976 78562 78623 62 3192 122757 122770 14 760 32721 32750 30 1977 78625 78665 41 3193 122779 122840 62 761 32752 32778 27 1978 78668 78684 17 3194 122842 122857 16 762 32780 32795 16 1979 78686 78759 74 3195 122900 122923 24 763 32797 32847 51 1980 78761 78787 27 3196 122933 122955 23 764 32881 32894 14 1981 78793 78814 22 3197 122968 123042 75 765 32891 32904 14 198278816 78854 39 3198 123055 123076 22 766 32896 32911 16 1983 78847 78860 14 3199 123094 123108 15 767 32927 32972 46 1984 78874 78909 36 3200 123114 123134 21 768 32986 33017 32 1985 78917 78944 28 3201 123143 123160 18 769 33019 33036 18 1986 78956 78978 23 3202 123162 123180 19 770 33038 33096 59 1987 78991 79008 18 3203 123184 123198 15 771 33102 33123 22 1988 79003 79032 30 3204 123200 123235 36 772 33132 33145 14 1989 79026 79040 15 3205 123237 123321 85 773 33150 33163 14 1990 79044 79072 29 3206 123314 123329 16 774 33166 33199 34 1991 79098 79158 61 3207 123342 123360 19 775 33214 33260 47 1992 79162 79182 21 3208 123356 123389 34 776 33262 33292 31 1993 79184 79228 45 3209 123391 123410 20 777 33294 33307 14 1994 79221 79235 15 3210 123412 123453 42 778 33316 33351 36 1995 79230 79262 33 3211 123455 123485 31 779 33360 33402 43 1996 79287 79333 47 3212 123488 123503 16 780 33412 33425 14 1997 79356 79392 37 3213 123506 123524 19 781 33427 33442 16 1998 79441 79476 36 3214123526 123543 18 782 33439 33452 14 1999 79488 79522 35 3215 123545 123578 34 783 33443 33456 14 2000 79522 79539 18 3216 123598 123634 37 784 33460 33501 42 2001 79568 79583 16 3217 123654 123683 30 785 33503 33535 33 2002 79574 79601 28 3218 123685 123706 22 786 33542 33557 16 2003 79603 79618 16 3219 123710 123774 65 787 34168 34181 14 2004 79617 79639 23 3220 123803 123816 14 788 34370 34385 16 2005 79651 79683 33 3221 123818 123831 14 789 35422 35435 14 2006 79685 79724 40 3222 123896 123939 44 790 35627 35641 15 2007 79721 79736 16 3223 123941 123974 34 791 35685 35700 16 2008 79727 79782 56 3224 123976 124021 46 792 35837 35851 15 2009 79784 79812 29 3225 124026 124040 15 793 35849 35864 16 2010 79809 79834 26 3226 124042 124079 38 794 35866 35879 14 2011 79841 79861 21 3227 124091 124109 19 795 35974 35987 14 2012 79873 79923 51 3228 124158 124185 28 796 36009 36042 34 2013 79928 79948 21 3229 124238 124274 37 797 36044 36079 36 2014 79950 79986 37 3230 124319 124332 14 79836081 36097 17 2015 79993 80019 27 3231 124335 124373 39 799 36099 36120 22 2016 80019 80063 45 3232 124394 124412 19 800 36119 36133 15 2017 80071 80088 18 3233 124419 124445 27 801 36147 36163 17 2018 80114 80160 47 3234 124450 124470 21 802 36171 36200 30 2019 80154 80183 30 3235 124472 124493 22 803 36216 36241 26 2020 80185 80212 28 3236 124499 124520 22 804 36245 36274 30 2021 80214 80232 19 3237 124522 124561 40 805 36265 36283 19 2022 80240 80266 27 3238 124564 124595 32 806 36295 36348 54 2023 80293 80312 20 3239 124607 124649 43 807 36352 36389 38 2024 80344 80380 37 3240 124662 124729 68 808 36383 36400 18 2025 80382 80420 39 3241 124750 124767 18 809 36402 36419 18 2026 80410 80423 14 3242 124769 124793 25 810 36475 36520 46 2027 80417 80438 22 3243 124812 124828 17 811 36522 36539 18 2028 80440 80456 17 3244 124853 124906 54 812 36541 36626 86 2029 80467 80499 33 3245 124923 124948 26 813 36652 36672 21 2030 80501 80527 27 3246 124958 124986 29 814 36675 36705 31 203180532 80561 30 3247 125023 125042 20 815 36707 36746 40 2032 80563 80599 37 3248 125032 125046 15 816 36780 36808 29 2033 80604 80692 89 3249 125065 125083 19 817 36810 36823 14 2034 80702 80737 36 3250 125073 125091 19 818 36825 36901 77 2035 80739 80795 57 3251 125093 125107 15 819 36903 36922 20 2036 80796 80871 76 3252 125132 125149 18 820 36924 36982 59 2037 80873 80891 19 3253 125139 125154 16 821 36999 37030 32 2038 80925 80961 37 3254 125151 125200 50 822 37056 37083 28 2039 80963 80992 30 3255 125201 125274 74 823 37091 37135 45 2040 81009 81068 60 3256 125314 125329 16 824 37194 37221 28 2041 81070 81150 81 3257 125331 125370 40 825 37238 37277 40 2042 81156 81199 44 3258 125372 125386 15 826 37280 37294 15 2043 81201 81225 25 3259 125411 125431 21 827 37298 37315 18 2044 81237 81253 17 3260 125433 125462 30 828 37325 37350 26 2045 81255 81271 17 3261 125475 125562 88 829 37363 37383 21 2046 81292 81351 60 3262 125564 125589 26 830 37377 37394 18 2047 81353 81371 19 3263125605 125639 35 831 37384 37397 14 2048 81392 81422 31 3264 125641 125699 59 832 37390 37438 49 2049 81438 81483 46 3265 125719 125732 14 833 37456 37481 26 2050 81485 81503 19 3266 125737 125769 33 834 37478 37491 14 2051 81512 81526 15 3267 125815 125829 15 835 37481 37503 23 2052 81532 81554 23 3268 125834 125848 15 836 37506 37524 19 2053 81556 81593 38 3269 125850 125884 35 837 37526 37545 20 2054 81606 81664 59 3270 125899 125966 68 838 37540 37572 33 2055 81666 81698 33 3271 125967 125999 33 839 37574 37590 17 2056 81701 81720 20 3272 126026 126080 55 840 37601 37616 16 2057 81728 81776 49 3273 126097 126115 19 841 37621 37658 38 2058 81781 81810 30 3274 126130 126149 20 842 37673 37690 18 2059 81812 81847 36 3275 126151 126179 29 843 37703 37738 36 2060 81849 81893 45 3276 126186 126238 53 844 37740 37753 14 2061 81908 81934 27 3277 126241 126279 39 845 37764 37790 27 2062 81943 81964 22 3278 126275 126295 21 846 37800 37818 19 2063 81967 82034 68 3279 126297 126312 16 84737820 37850 31 2064 82036 82134 99 3280 126320 126363 44 848 37888 37909 22 2065 82136 82154 19 3281 126376 126395 20 849 37911 37972 62 2066 82176 82197 22 3282 126406 126419 14 850 37986 38014 29 2067 82199 82250 52 3283 126420 126442 23 851 38016 38032 17 2068 82252 82269 18 3284 126467 126501 35 852 38034 38053 20 2069 82271 82293 23 3285 126503 126538 36 853 38055 38073 19 2070 82300 82314 15 3286 126566 126580 15 854 38075 38090 16 2071 82329 82343 15 3287 126584 126597 14 855 38092 38128 37 2072 82344 82357 14 3288 126620 126653 34 856 38141 38167 27 2073 82378 82407 30 3289 126654 126694 41 857 38171 38194 24 2074 82406 82422 17 3290 126697 126715 19 858 38213 38240 28 2075 82421 82443 23 3291 126764 126777 14 859 38264 38286 23 2076 82446 82469 24 3292 126792 126828 37 860 38288 38370 83 2077 82490 82507 18 3293 126842 126862 21 861 38394 38420 27 2078 82502 82523 22 3294 126866 126879 14 862 38452 38467 16 2079 82547 82576 30 3295 126881 126897 17 863 38471 38487 17 208082590 82603 14 3296 126906 126925 20 864 38477 38490 14 2081 82628 82647 20 3297 126956 126987 32 865 38494 38507 14 2082 82650 82666 17 3298 126989 127023 35 866 38536 38556 21 2083 82669 82683 15 3299 127026 127135 110 867 38580 38593 14 2084 82685 82716 32 3300 127142 127174 33 868 38602 38618 17 2085 82715 82736 22 3301 127176 127191 16 869 38628 38654 27 2086 82760 82785 26 3302 127193 127217 25 870 38693 38709 17 2087 82778 82791 14 3303 127229 127253 25 871 38709 38722 14 2088 82780 82818 39 3304 127255 127280 26 872 38711 38725 15 2089 82811 82825 15 3305 127294 127394 101 873 38740 38756 17 2090 82821 82864 44 3306 127396 127415 20 874 38749 38769 21 2091 82883 82915 33 3307 127417 127478 62 875 38772 38797 26 2092 82919 82935 17 3308 127491 127504 14 876 38827 38846 20 2093 82930 82946 17 3309 127506 127530 25 877 38860 38883 24 2094 82937 82957 21 3310 127542 127566 25 878 38885 38905 21 2095 82959 82972 14 3311 127582 127628 47 879 38911 38931 21 2096 82974 83000 27 3312127654 127675 22 880 38933 38949 17 2097 83020 83036 17 3313 127681 127706 26 881 38962 39032 71 2098 83038 83088 51 3314 127706 127739 34 882 39034 39047 14 2099 83090 83115 26 3315 127769 127792 24 883 39049 39070 22 2100 83120 83140 21 3316 127808 127829 22 884 39075 39115 41 2101 83142 83155 14 3317 127839 127888 50 885 39127 39143 17 2102 83160 83186 27 3318 127900 127932 33 886 39148 39162 15 2103 83198 83215 18 3319 127943 127975 33 887 39164 39222 59 2104 83227 83246 20 3320 127988 128046 59 888 39218 39231 14 2105 83273 83339 67 3321 128048 128069 22 889 39224 39256 33 2106 83341 83385 45 3322 128068 128106 39 890 39265 39306 42 2107 83387 83400 14 3323 128105 128118 14 891 39297 39311 15 2108 83413 83426 14 3324 128121 128157 37 892 39308 39343 36 2109 83417 83449 33 3325 128159 128188 30 893 39345 39359 15 2110 83486 83520 35 3326 128190 128268 79 894 39361 39381 21 2111 83522 83565 44 3327 128279 128317 39 895 39370 39383 14 2112 83567 83581 15 3328 128321 128335 15 89639383 39399 17 2113 83576 83670 95 3329 128342 128368 27 897 39417 39469 53 2114 83681 83701 21 3330 128374 128446 73 898 39490 39503 14 2115 83703 83716 14 3331 128444 128540 97 899 39500 39522 23 2116 83733 83817 85 3332 128546 128586 41 900 39535 39549 15 2117 83817 83830 14 3333 128588 128640 53 901 39551 39611 61 2118 83832 83853 22 3334 128642 128674 33 902 39628 39647 20 2119 83855 83871 17 3335 128675 128879 205 903 39649 39690 42 2120 83886 83926 41 3336 128881 128936 56 904 39707 39759 53 2121 83958 83974 17 3337 128934 129000 67 905 39773 39797 25 2122 83976 83991 16 3338 129002 129060 59 906 39799 39858 60 2123 83993 84031 39 3339 129074 129100 27 907 39872 39928 57 2124 84033 84067 35 3340 129107 129123 17 908 39930 39969 40 2125 84069 84102 34 3341 129125 129163 39 909 39973 39997 25 2126 84104 84121 18 3342 129168 129230 63 910 39998 40013 16 2127 84143 84233 91 3343 129264 129277 14 911 40015 40064 50 2128 84249 84281 33 3344 129284 129318 35 912 40067 40108 42 212984283 84403 121 3345 129320 129346 27 913 40110 40140 31 2130 84404 84432 29 3346 129357 129391 35 914 40147 40163 17 2131 84431 84444 14 3347 129393 129420 28 915 40154 40179 26 2132 84434 84490 57 3348 129447 129485 39 916 40181 40196 16 2133 84503 84520 18 3349 129489 129504 16 917 40232 40282 51 2134 84522 84555 34 3350 129514 129540 27 918 40284 40307 24 2135 84557 84572 16 3351 129550 129563 14 919 40309 40368 60 2136 84574 84597 24 3352 129559 129595 37 920 40381 40399 19 2137 84607 84626 20 3353 129606 129627 22 921 40431 40471 41 2138 84650 84675 26 3354 129633 129681 49 922 40479 40493 15 2139 84677 84700 24 3355 129683 129697 15 923 40484 40522 39 2140 84721 84753 33 3356 129699 129716 18 924 40524 40544 21 2141 84755 84807 53 3357 129706 129738 33 925 40547 40561 15 2142 84809 84826 18 3358 129757 129790 34 926 40577 40594 18 2143 84831 84849 19 3359 129792 129820 29 927 40586 40599 14 2144 84879 84893 15 3360 129812 129846 35 928 40616 40631 16 2145 84895 84915 21 3361129851 129867 17 929 40634 40647 14 2146 84917 84961 45 3362 129869 129883 15 930 40674 40727 54 2147 85234 85247 14 3363 129885 129915 31 931 40738 40755 18 2148 85253 85267 15 3364 129917 129955 39 932 40749 40771 23 2149 85256 85351 96 3365 129957 130046 90 933 40780 40802 23 2150 85359 85374 16 3366 130042 130070 29 934 40811 40834 24 2151 85363 85376 14 3367 130110 130156 47 935 40847 40865 19 2152 85365 85381 17 3368 130158 130309 152 936 40861 40875 15 2153 85380 85414 35 3369 130311 130373 63 937 40869 40897 29 2154 85416 85454 39 3370 130375 130391 17 938 40899 40919 21 2155 85456 85484 29 3371 130407 130429 23 939 40921 40939 19 2156 85509 85545 37 3372 130439 130461 23 940 40942 40962 21 2157 85535 85550 16 3373 130475 130507 33 941 40967 40980 14 2158 85566 85584 19 3374 130512 130550 39 942 41008 41097 90 2159 85586 85610 25 3375 130552 130582 31 943 41099 41131 33 2160 85604 85627 24 3376 130584 130614 31 944 41133 41200 68 2161 85628 85665 38 3377 130616 130764 149 94541202 41223 22 2162 85698 85723 26 3378 130766 130869 104 946 41225 41242 18 2163 85713 85728 16 3379 130871 131021 151 947 41266 41279 14 2164 85722 85735 14 3380 131033 131051 19 948 41275 41298 24 2165 85770 85785 16 3381 131092 131105 14 949 41300 41321 22 2166 85800 85813 14 3382 131112 131188 77 950 41325 41360 36 2167 85875 85888 14 3383 131194 131237 44 951 41367 41388 22 2168 85950 85963 14 3384 131233 131247 15 952 41403 41421 19 2169 86097 86125 29 3385 131236 131287 52 953 41439 41462 24 2170 86127 86142 16 3386 131292 131307 16 954 41481 41496 16 2171 86175 86198 24 3387 131314 131333 20 955 41508 41523 16 2172 86226 86242 17 3388 131373 131386 14 956 41531 41550 20 2173 86237 86302 66 3389 131396 131417 22 957 41552 41590 39 2174 86308 86327 20 3390 131419 131439 21 958 41590 41603 14 2175 86321 86334 14 3391 131429 131458 30 959 41612 41662 51 2176 86329 86382 54 3392 131481 131499 19 960 41664 41688 25 2177 86384 86400 17 3393 131676 131689 14 961 41685 41698 14 217886403 86417 15 3394 131729 131743 15 962 41691 41716 26 2179 86414 86437 24 3395 131745 131764 20 963 41718 41764 47 2180 86439 86455 17 3396 131785 131807 23 964 41761 41776 16 2181 86461 86478 18 3397 131809 131875 67 965 41778 41809 32 2182 86473 86487 15 3398 131877 131953 77 966 41798 41811 14 2183 86480 86517 38 3399 131955 131980 26 967 41838 41866 29 2184 86517 86531 15 3400 132020 132068 49 968 41872 41893 22 2185 86565 86583 19 3401 132086 132108 23 969 41885 41898 14 2186 86600 86632 33 3402 132118 132138 21 970 41912 41925 14 2187 86634 86651 18 3403 132152 132183 32 971 41914 41930 17 2188 86653 86678 26 3404 132185 132205 21 972 41923 41942 20 2189 86697 86756 60 3405 132219 132232 14 973 41933 41956 24 2190 86782 86796 15 3406 132234 132252 19 974 41962 41978 17 2191 86786 86809 24 3407 132261 132291 31 975 41997 42012 16 2192 86811 86855 45 3408 132319 132337 19 976 42026 42042 17 2193 86857 86891 35 3409 132345 132363 19 977 42035 42048 14 2194 86894 86908 15 3410132365 132378 14 978 42037 42050 14 2195 86916 86933 18 3411 132414 132483 70 979 42048 42064 17 2196 86945 86959 15 3412 132504 132547 44 980 42056 42079 24 2197 86951 86965 15 3413 132549 132582 34 981 42081 42095 15 2198 86969 86990 22 3414 132584 132602 19 982 42096 42139 44 2199 87017 87057 41 3415 132616 132642 27 983 42141 42187 47 2200 87059 87073 15 3416 132643 132681 39 984 42190 42226 37 2201 87062 87076 15 3417 132685 132714 30 985 42232 42253 22 2202 87066 87089 24 3418 132736 132769 34 986 42255 42305 51 2203 87097 87121 25 3419 132771 132793 23 987 42307 42320 14 2204 87110 87134 25 3420 132809 132825 17 988 42347 42375 29 2205 87130 87155 26 3421 132827 132841 15 989 42389 42425 37 2206 87160 87194 35 3422 132861 132884 24 990 42427 42442 16 2207 87185 87198 14 3423 132882 132900 19 991 42452 42474 23 2208 87209 87260 52 3424 132899 132915 17 992 42482 42496 15 2209 87257 87270 14 3425 132917 132951 35 993 42495 42509 15 2210 87274 87287 14 3426 132940 132954 15 99442536 42550 15 2211 87276 87294 19 3427 132958 132983 26 995 42566 42580 15 2212 87294 87328 35 3428 132985 133031 47 996 42590 42612 23 2213 87317 87333 17 3429 133032 133051 20 997 42646 42678 33 2214 87336 87360 25 3430 133042 133060 19 998 42683 42723 41 2215 87368 87418 51 3431 133051 133071 21 999 42735 42750 16 2216 87441 87460 20 3432 133073 133087 15 1000 42752 42817 66 2217 87462 87487 26 3433 133083 133104 22 1001 42843 42873 31 2218 87489 87518 30 3434 133097 133110 14 1002 42890 42939 50 2219 87520 87539 20 3435 133131 133199 69 1003 42938 42989 52 2220 87542 87570 29 3436 133198 133222 25 1004 42991 43005 15 2221 87572 87601 30 3437 133233 133249 17 1005 43007 43020 14 2222 87603 87644 42 3438 133251 133284 34 1006 43036 43055 20 2223 87642 87750 109 3439 133327 133429 103 1007 43057 43102 46 2224 87756 87776 21 3440 133431 133596 166 1008 43113 43145 33 2225 87778 87803 26 3441 133588 133602 15 1009 43147 43180 34 2226 87803 87837 35 3442 133598 133611 14 1010 4320443221 18 2227 87872 87888 17 3443 133613 133628 16 1011 43221 43265 45 2228 87890 87917 28 3444 133628 133646 19 1012 43267 43296 30 2229 87949 87964 16 3445 133651 133670 20 1013 43311 43334 24 2230 87963 88008 46 3446 133666 133707 42 1014 43336 43361 26 2231 88010 88027 18 3447 133718 133742 25 1015 43371 43395 25 2232 88029 88046 18 3448 133743 133777 35 1016 43399 43423 25 2233 88048 88089 42 3449 133779 133794 16 1017 43425 43453 29 2234 88091 88108 18 3450 133821 133851 31 1018 43452 43468 17 2235 88110 88177 68 3451 133859 133880 22 1019 43470 43488 19 2236 88179 88192 14 3452 133890 133921 32 1020 43495 43522 28 2237 88194 88229 36 3453 133923 133974 52 1021 43525 43559 35 2238 88234 88259 26 3454 133982 133998 17 1022 43561 43584 24 2239 88261 88291 31 3455 134000 134036 37 1023 43590 43611 22 2240 88303 88328 26 3456 134065 134107 43 1024 43618 43650 33 2241 88328 88341 14 3457 134120 134173 54 1025 43670 43685 16 2242 88340 88354 15 3458 134165 134179 15 1026 43722 43774 532243 88356 88372 17 3459 134187 134200 14 1027 43776 43791 16 2244 88411 88446 36 3460 134207 134242 36 1028 43808 43835 28 2245 88448 88465 18 3461 134244 134258 15 1029 43835 43851 17 2246 88469 88511 43 3462 134260 134273 14 1030 43853 43868 16 2247 88518 88533 16 3463 134275 134299 25 1031 43923 43937 15 2248 88531 88557 27 3464 134314 134346 33 1032 43952 43987 36 2249 88547 88560 14 3465 134356 134371 16 1033 44011 44029 19 2250 88573 88593 21 3466 134365 134380 16 1034 44028 44070 43 2251 88597 88618 22 3467 134374 134420 47 1035 44072 44094 23 2252 88620 88690 71 3468 134445 134477 33 1036 44101 44130 30 2253 88692 88745 54 3469 134508 134523 16 1037 44137 44205 69 2254 88954 88973 20 3470 134531 134548 18 1038 44224 44244 21 2255 88988 89047 60 3471 134542 134555 14 1039 44246 44265 20 2256 89066 89091 26 3472 134568 134621 54 1040 44267 44318 52 2257 89098 89119 22 3473 134647 134667 21 1041 44316 44336 21 2258 89135 89149 15 3474 134679 134719 41 1042 44338 44359 22 225989151 89181 31 3475 134721 134824 104 1043 44361 44424 64 2260 89177 89193 17 3476 134826 134849 24 1044 44439 44474 36 2261 89223 89273 51 3477 134856 134869 14 1045 44476 44500 25 2262 89285 89300 16 3478 134877 134910 34 1046 44502 44519 18 2263 89315 89383 69 3479 134912 134966 55 1047 44539 44553 15 2264 89404 89442 39 3480 134960 134980 21 1048 44563 44578 16 2265 89444 89541 98 3481 134989 135012 24 1049 44585 44599 15 2266 89579 89639 61 3482 135014 135066 53 1050 44601 44617 17 2267 89660 89692 33 3483 135074 135093 20 1051 44640 44701 62 2268 89694 89741 48 3484 135108 135125 18 1052 44704 44723 20 2269 89773 89787 15 3485 135151 135260 110 1053 44741 44763 23 2270 89789 89817 29 3486 135264 135277 14 1054 44766 44846 81 2271 89826 89888 63 3487 135273 135310 38 1055 44870 44889 20 2272 89904 89922 19 3488 135321 135337 17 1056 44887 44905 19 2273 89937 89950 14 3489 135340 135365 26 1057 44920 44947 28 2274 89945 89958 14 3490 135360 135374 15 1058 44949 44966 18 2275 8995689974 19 3491 135364 135386 23 1059 44994 45022 29 2276 89971 89985 15 3492 135388 135430 43 1060 45042 45059 18 2277 89979 89992 14 3493 135432 135447 16 1061 45061 45087 27 2278 89984 90000 17 3494 135498 135521 24 1062 45116 45154 39 2279 89999 90014 16 3495 135519 135545 27 1063 45156 45182 27 2280 90017 90041 25 3496 135559 135622 64 1064 45183 45198 16 2281 90036 90049 14 3497 135624 135647 24 1065 45210 45243 34 2282 90077 90093 17 3498 135656 135673 18 1066 45245 45320 76 2283 90099 90128 30 3499 135675 135704 30 1067 45331 45367 37 2284 90130 90155 26 3500 135721 135742 22 1068 45380 45399 20 2285 90157 90200 44 3501 135753 135796 44 1069 45415 45428 14 2286 90225 90256 32 3502 135815 135858 44 1070 45421 45486 66 2287 90258 90293 36 3503 135860 135880 21 1071 45488 45545 58 2288 90305 90318 14 3504 135883 135915 33 1072 45556 45576 21 2289 90320 90352 33 3505 135922 135965 44 1073 45578 45597 20 2290 90356 90370 15 3506 135979 135993 15 1074 45603 45650 48 2291 90400 90421 223507 135995 136036 42 1075 45652 45665 14 2292 90423 90461 39 3508 136051 136065 15 1076 45675 45715 41 2293 90464 90507 44 3509 136108 136165 58 1077 45749 45763 15 2294 90509 90530 22 3510 136173 136190 18 1078 45804 45826 23 2295 90529 90542 14 3511 136192 136287 96 1079 45839 45861 23 2296 90531 90567 37 3512 136289 136303 15 1080 45878 45910 33 2297 90569 90612 44 3513 136317 136346 30 1081 45926 45954 29 2298 90614 90730 117 3514 136375 136415 41 1082 45956 45975 20 2299 90732 90758 27 3515 136429 136470 42 1083 45977 45997 21 2300 90760 90885 126 3516 136472 136496 25 1084 45999 46020 22 2301 90887 90918 32 3517 136498 136532 35 1085 46046 46063 18 2302 90920 90946 27 3518 136542 136565 24 1086 46065 46088 24 2303 90938 90955 18 3519 136643 136657 15 1087 46097 46118 22 2304 90960 90973 14 3520 136674 136701 28 1088 46120 46142 23 2305 90965 90981 17 3521 136704 136719 16 1089 46144 46160 17 2306 90973 91000 28 3522 136715 136728 14 1090 46162 46185 24 2307 90997 91011 15 3523136721 136737 17 1091 46204 46280 77 2308 91002 91019 18 3524 136737 136750 14 1092 46302 46326 25 2309 91059 91140 82 3525 136783 136810 28 1093 46328 46355 28 2310 91142 91157 16 3526 136824 136849 26 1094 46358 46377 20 2311 91157 91194 38 3527 136859 136896 38 1095 46379 46436 58 2312 91196 91231 36 3528 136898 136927 30 1096 46457 46471 15 2313 91233 91251 19 3529 136949 136983 35 1097 46473 46492 20 2314 91253 91274 22 3530 136985 137000 16 1098 46501 46541 41 2315 91296 91310 15 3531 137053 137071 19 1099 46543 46572 30 2316 91335 91367 33 3532 137077 137097 21 1100 46584 46626 43 2317 91406 91442 37 3533 137108 137164 57 1101 46655 46683 29 2318 91447 91477 31 3534 137166 137196 31 1102 46685 46702 18 2319 91489 91509 21 3535 137198 137221 24 1103 46704 46722 19 2320 91520 91621 102 3536 137223 137267 45 1104 46724 46763 40 2321 91623 91674 52 3537 137276 137359 84 1105 46784 46800 17 2322 91680 91703 24 3538 137360 137385 26 1106 46802 46827 26 2323 91715 91731 17 3539 137393137440 48 1107 46830 46867 38 2324 91733 91771 39 3540 137438 137496 59 1108 46869 46887 19 2325 91773 91788 16 3541 137498 137518 21 1109 46889 46920 32 2326 91790 91805 16 3542 137523 137536 14 1110 46922 46947 26 2327 91807 91823 17 3543 137539 137572 34 1111 46976 47009 34 2328 91825 91859 35 3544 137584 137612 29 1112 47011 47030 20 2329 91861 91900 40 3545 137614 137628 15 1113 47032 47064 33 2330 91907 91926 20 3546 137630 137644 15 1114 47066 47092 27 2331 91928 91943 16 3547 137646 137669 24 1115 47108 47130 23 2332 91950 91980 31 3548 137702 137727 26 1116 47132 47168 37 2333 91982 91996 15 3549 137731 137745 15 1117 47170 47199 30 2334 91998 92011 14 3550 137759 137772 14 1118 47201 47222 22 2335 92010 92027 18 3551 137784 137819 36 1119 47238 47277 40 2336 92027 92067 41 3552 137832 137858 27 1120 47296 47350 55 2337 92069 92126 58 3553 137861 137876 16 1121 47352 47391 40 2338 92128 92321 194 3554 137878 137900 23 1122 47416 47440 25 2339 92323 92540 218 3555 137909 13792517 1123 47452 47466 15 2340 92542 92558 17 3556 137924 137961 38 1124 47468 47523 56 2341 92566 92684 119 3557 137968 137981 14 1125 47522 47546 25 2342 92686 92726 41 3558 138011 138033 23 1126 47548 47567 20 2343 92728 92837 110 3559 138035 138077 43 1127 47569 47595 27 2344 92839 93032 194 3560 138079 138097 19 1128 47597 47634 38 2345 93034 93094 61 3561 138224 138238 15 1129 47657 47693 37 2346 93100 93209 110 3562 138232 138252 21 1130 47712 47731 20 2347 93211 93254 44 3563 138242 138256 15 1131 47749 47762 14 2348 93256 93323 68 3564 138255 138284 30 1132 47771 47825 55 2349 93325 93448 124 3565 138295 138326 32 1133 47827 47846 20 2350 93459 93477 19 3566 138328 138357 30 1134 47848 47872 25 2351 93475 93497 23 3567 138359 138389 31 1135 47874 47888 15 2352 93509 93530 22 3568 138403 138449 47 1136 47890 47909 20 2353 93532 93566 35 3569 138451 138492 42 1137 47911 47925 15 2354 93568 93601 34 3570 138500 138515 16 1138 47927 47952 26 2355 93606 93646 41 3571 138524 138548 251139 47961 47993 33 2356 93668 93716 49 3572 138555 138568 14 1140 48001 48016 16 2357 93718 93742 25 3573 138571 138589 19 1141 48051 48083 33 2358 93744 93788 45 3574 138589 138629 41 1142 48096 48158 63 2359 93790 93808 19 3575 138644 138680 37 1143 48158 48176 19 2360 93811 93832 22 3576 138697 138710 14 1144 48186 48201 16 2361 93874 93901 28 3577 138712 138729 18 1145 48213 48239 27 2362 93904 93986 83 3578 138744 138761 18 1146 48241 48256 16 2363 94021 94036 16 3579 138776 138801 26 1147 48258 48278 21 2364 94038 94079 42 3580 138860 138896 37 1148 48280 48339 60 2365 94073 94086 14 3581 138898 138923 26 1149 48341 48357 17 2366 94097 94116 20 3582 138925 138965 41 1150 48359 48377 19 2367 94118 94141 24 3583 138967 139008 42 1151 48379 48393 15 2368 94140 94219 80 3584 139010 139031 22 1152 48395 48488 94 2369 94242 94257 16 3585 139029 139043 15 1153 48492 48510 19 2370 94264 94335 72 3586 139034 139048 15 1154 48528 48549 22 2371 94337 94356 20 3587 139041 139056 16 115548550 48589 40 2372 94358 94378 21 3588 139055 139074 20 1156 48636 48658 23 2373 94373 94386 14 3589 139078 139094 17 1157 48683 48697 15 2374 94384 94403 20 3590 139084 139098 15 1158 48699 48762 64 2375 94405 94422 18 3591 139092 139116 25 1159 48762 48775 14 2376 94453 94497 45 3592 139133 139147 15 1160 48773 48832 60 2377 94497 94558 62 3593 139154 139173 20 1161 48873 48886 14 2378 94560 94605 46 3594 139175 139192 18 1162 48888 48914 27 2379 94630 94724 95 3595 139204 139229 26 1163 48916 48944 29 2380 94739 94752 14 3596 139231 139255 25 1164 48969 49008 40 2381 94755 94786 32 3597 139257 139270 14 1165 49010 49024 15 2382 94800 94815 16 3598 139272 139303 32 1166 49051 49110 60 2383 94872 94901 30 3599 139315 139335 21 1167 49116 49150 35 2384 94903 94953 51 3600 139337 139372 36 1168 49151 49184 34 2385 94955 95060 106 3601 139383 139397 15 1169 49187 49200 14 2386 95070 95085 16 3602 139399 139419 21 1170 49213 49230 18 2387 95093 95110 18 3603 139423 139437 15 1171 4923349247 15 2388 95135 95149 15 3604 139435 139492 58 1172 49267 49284 18 2389 95154 95168 15 3605 139501 139518 18 1173 49297 49310 14 2390 95170 95210 41 3606 139508 139521 14 1174 49317 49369 53 2391 95227 95257 31 3607 139571 139586 16 1175 49371 49435 65 2392 95302 95318 17 3608 139588 139622 35 1176 49444 49458 15 2393 95311 95356 46 3609 139636 139655 20 1177 49467 49500 34 2394 95359 95401 43 3610 139657 139673 17 1178 49510 49538 29 2395 95403 95453 51 3611 139685 139699 15 1179 49540 49559 20 2396 95450 95463 14 3612 139724 139795 72 1180 49561 49584 24 2397 95475 95491 17 3613 139796 139811 16 1181 49591 49626 36 2398 95503 95553 51 3614 139818 139834 17 1182 49628 49646 19 2399 95555 95569 15 3615 139836 139857 22 1183 49653 49737 85 2400 95583 95609 27 3616 139856 139869 14 1184 49787 49802 16 2401 95634 95668 35 3617 139859 139882 24 1185 49817 49835 19 2402 95718 95738 21 3618 139891 139920 30 1186 49841 49860 20 2403 95727 95740 14 3619 139930 139952 23 1187 49862 49883 222404 95836 95849 14 3620 139965 139980 16 1188 49885 49905 21 2405 95851 95872 22 3621 139982 140011 30 1189 49921 49950 30 2406 95874 95888 15 3622 140013 140031 19 1190 49961 49979 19 2407 95890 95910 21 3623 140047 140072 26 1191 49995 50051 57 2408 95912 95925 14 3624 140074 140099 26 1192 50053 50071 19 2409 95938 95969 32 3625 140101 140119 19 1193 50073 50088 16 2410 95973 95990 18 3626 140121 140135 15 1194 50132 50158 27 2411 95992 96066 75 3627 140144 140158 15 1195 50167 50183 17 2412 96073 96087 15 3628 140157 140183 27 1196 50201 50226 26 2413 96103 96120 18 3629 140185 140210 26 1197 50226 50239 14 2414 96122 96167 46 3630 140231 140262 32 1198 50259 50313 55 2415 96169 96182 14 3631 140258 140272 15 1199 50323 50341 19 2416 96183 96211 29 3632 140264 140288 25 1200 50343 50396 54 2417 96213 96234 22 3633 140290 140325 36 1201 50390 50403 14 2418 96246 96279 34 3634 140339 140364 26 1202 50398 50448 51 2419 96300 96334 35 3635 140369 140402 34 1203 50451 50483 33 242096358 96375 18 3636 140428 140451 24 1204 50489 50507 19 2421 96377 96398 22 3637 140453 140510 58 1205 50526 50548 23 2422 96424 96467 44 3638 140512 140541 30 1206 50550 50569 20 2423 96496 96518 23 3639 140556 140621 66 1207 50575 50602 28 2424 96520 96535 16 3640 140626 140651 26 1208 50606 50621 16 2425 96540 96566 27 3641 140653 140724 72 1209 50617 50630 14 2426 96572 96592 21 3642 140726 140789 64 1210 50623 50641 19 2427 96604 96646 43 3643 140802 140825 24 1211 50634 50647 14 2428 96642 96655 14 3644 140837 140861 25 1212 50644 50663 20 2429 96648 96667 20 3645 140863 140896 34 1213 50665 50684 20 2430 96681 96728 48 3646 140903 140927 25 1214 50705 50730 26 2431 96730 96781 52 3647 140958 140993 36 1215 50732 50763 32 2432 96804 96829 26 3648 141001 141014 14 1216 50766 50799 34 2433 96831 96879 49 3649 141022 141053 32 1217 50797 50823 27 In some embodiments, the oligonucleotide comprises a contiguous nucleotide sequence of 10 to 30 nucleotides in length with at least 90% complementarity, such as 100% complementarity, to a corresponding target nucleic acid region in SEQ ID NO: 1; wherein the target nucleic acid region is selected from the group consisting of regions B1 to B400 in Table 2. Table 2: Regions of sequence identity number 1 that were detected using the oligonucleotide of this invention Identity Sequence Region No. 1 Length Identity Sequence Region No. 1 Length Identity Sequence Region No. 1 Length To From To From To From B1 225 238 14 B134 60006 60029 24 B267 92908 92921 14 B2 1163 1178 16 B135 60033 60071 39 B268 92923 92941 19 B3 2526 2539 14 B136 60139 60171 33 B269 92965 92986 22 B4 2805 2820 16 B137 60193 60215 23 B270 92988 93002 15 B5 3027 3040 14 B138 60212 60225 14 B271 93044 93059 16 B6 3208 3222 15 B139 60231 60244 14 B272 93061 93076 16 B7 3212 3225 14 B140 60246 60265 20 B273 93105 93122 18 B8 3228 3241 14 B141 60267 60282 16 B274 93142 93209 68 B9 3243 3256 14 B142 60292 60309 18 B275 93227 93241 15 B10 3810 3854 45 B143 60348 60361 14 B276 93288 93305 18 B11 4664 4680 17 B144 60358 60429 72 B277 93325 93344 20 B12 5516 5529 14 B145 60427 60517 91 B278 93398 93412 15 B13 5657 5671 15 B146 60519 60545 27 B279 93572 93586 15 B14 5661 5676 16 B147 60557 60575 19 B280 94509 94522 14 B15 5964 5977 14 B148 60580 60593 14 B281 95720 95738 19 B16 6217 6234 18 B149 60595 60622 28 B282 9705097065 16 B17 6224 6237 14 B150 60675 60690 16 B283 97079 97098 20 B18 6408 6422 15 B151 60697 60713 17 B284 97127 97194 68 B19 7300 7313 14 B152 60727 60754 28 B285 97208 97230 23 B20 7399 7412 14 B153 60756 60799 44 B286 97232 97284 53 B21 7541 7564 24 B154 60801 60817 17 B287 97286 97311 26 B22 7626 7640 15 B155 60819 60855 37 B288 97313 97362 50 B23 7662 7694 33 B156 61423 61436 14 B289 97368 97383 16 B24 7791 7806 16 B157 61592 61605 14 B290 97426 97439 14 B25 7853 7868 16 B158 61624 61637 14 B291 98077 98090 14 B26 8206 8219 14 B159 61673 61713 41 B292 98227 98240 14 B27 8443 8456 14 B160 61715 61731 17 B293 98232 98255 24 B28 8739 8752 14 B161 61733 61752 20 B294 99151 99164 14 B29 9197 9212 16 B162 61769 61794 26 B295 99405 99418 14 B30 10189 10203 15 B163 61805 61825 21 B296 99570 99583 14 B31 10754 10768 15 B164 62101 62114 14 B297 99733 99748 16 B32 10758 10771 14 B165 62302 62315 14 B298 101829 101842 14 B33 11790 11803 14 B166 62436 62449 14 B299 101882 101895 14 B34 1187011883 14 B167 62664 62679 16 B300 101955 101968 14 B35 11993 12007 15 B168 62993 63006 14 B301 102202 102215 14 B36 B 11996 12011 16 B169 63098 63111 14 B302 103310 103325 16 B37 12017 12040 24 B170 63347 63367 21 B303 103653 103666 14 B38 12095 12108 14 B171 63371 63396 26 B304 103908 103923 16 B39 12345 12358 14 B172 63385 63398 14 B305 103912 103928 17 B40 12721 12734 14 B173 63526 63539 14 B306 103917 103933 17 B41 13372 13386 15 B174 65032 65045 14 B307 104971 104984 14 B42 13489 13505 17 B175 66556 66569 14 B308 105217 105230 14 B43 15576 15590 15 B176 67158 67183 26 B309 105233 105250 18 B44 15617 15632 16 B177 67181 67194 14 B310 105443 105457 15 B45 15840 15853 14 B178 68007 68021 15 B311 105544 105559 16 B46 16041 16054 14 B179 68644 68657 14 B312 106047 106071 25 B47 16207 16222 16 B180 69294 69317 24 B313 106061 106074 14 B48 16308 16321 14 B181 69306 69323 18 B314 106093 106107 15 B49 16349 16362 14 B182 69353 69366 14 B315 106114 106130 17 B50 16463 16479 17 B183 7049770511 15 B316 106243 106256 14 B51 16528 16542 15 B184 71600 71613 14 B317 106251 106264 14 B52 16543 16556 14 B185 71887 71905 19 B318 106840 106855 16 B53 20495 20508 14 B186 72259 72272 14 B319 108113 108130 18 B54 20617 20630 14 B187 72589 72602 14 B320 108325 108338 14 B55 20960 20977 18 B188 72783 72796 14 B321 108856 108869 14 B56 21465 21479 15 B189 73528 73541 14 B322 109109 109122 14 B57 21491 21508 18 B190 73783 73800 18 B323 109113 109127 15 B58 23479 23496 18 B191 74907 74920 14 B324 109116 109132 17 B59 23741 23755 15 B192 75965 75981 17 B325 110301 110314 14 B60 25236 25249 14 B193 75983 75998 16 B326 110315 110328 14 B61 25323 25336 14 B194 76004 76020 17 B327 110317 110330 14 B62 25447 25462 16 B195 76110 76166 57 B328 112528 112546 19 B63 25588 25601 14 B196 76186 76205 20 B329 112607 112620 14 B64 25853 25867 15 B197 76234 76253 20 B330 114775 114788 14 B65 25885 25898 14 B198 76261 76280 20 B331 116322 116335 14 B66 26280 26293 14 B199 76369 76382 14 B332 116968116981 14 B67 26388 26404 17 B200 77139 77152 14 B333 117788 117801 14 B68 26416 26450 35 B201 77409 77422 14 B334 118034 118057 24 B69 26687 26702 16 B202 77478 77524 47 B335 118230 118246 17 B70 26706 26719 14 B203 77526 77590 65 B336 118235 118248 14 B71 26783 26796 14 B204 77628 77641 14 B337 118870 118883 14 B72 27039 27052 14 B205 77688 77701 14 B338 119755 119784 30 B73 27251 27265 15 B206 78275 78308 34 B339 119786 119800 15 B74 28683 28698 16 B207 78310 78332 23 B340 120363 120406 44 B75 29302 29315 14 B208 78340 78356 17 B341 120504 120517 14 B76 29304 29317 14 B209 78358 78371 14 B342 121161 121174 14 B77 29308 29321 14 B210 78373 78395 23 B343 121330 121347 18 B78 29532 29545 14 B211 78397 78440 44 B344 121338 121351 14 B79 29974 29987 14 B212 78442 78455 14 B345 123417 123430 14 B80 30054 30068 15 B213 78475 78489 15 B346 123464 123481 18 B81 30267 30281 15 B214 78696 78709 14 B347 125026 125042 17 B82 30623 30638 16 B215 78847 78860 14 B348 127046 127071 26 B83 3062830641 14 B216 79493 79516 24 B349 127090 127103 14 B84 30814 30827 14 B217 79705 79718 14 B350 127311 127324 14 B85 30881 30894 14 B218 81009 81054 46 B351 127354 127367 14 B86 32459 32478 20 B219 81353 81367 15 B352 127363 127379 17 B87 37299 37315 17 B220 81970 81986 17 B353 127399 127412 14 B88 39083 39096 14 B221 81991 82006 16 B354 127863 127876 14 B89 39370 39383 14 B222 82042 82106 65 B355 128134 128148 15 B90 39659 39672 14 B223 82278 82291 14 B356 128280 128310 31 B91 40814 40831 18 B224 82716 82735 20 B357 128343 128368 26 B92 40851 40864 14 B225 84314 84328 15 B358 128444 128457 14 B93 41782 41795 14 B226 85628 85665 38 B359 128446 128469 24 B94 41873 41886 14 B227 86226 86239 14 B360 128498 128511 14 B95 42037 42050 14 B228 86237 86253 17 B361 128511 128524 14 B96 42048 42063 16 B229 86566 86579 14 B362 129892 129905 14 B97 42096 42116 21 B230 86945 86959 15 B363 130261 130283 23 B98 42959 42973 15 B231 87337 87358 22 B364 130375 130388 14 B99 43165 43178 14 B232 8766287675 14 B365 130415 130428 14 B100 45926 45939 14 B233 89424 89439 16 B366 130634 130650 17 B101 48163 48176 14 B234 89972 89985 14 B367 130667 130717 51 B102 52732 52745 14 B235 90782 90795 14 B368 130719 130764 46 B103 52984 53015 32 B236 90939 90953 15 B369 130783 130796 14 B104 54404 54420 17 B237 90942 90955 14 B370 130798 130820 23 B105 55294 55320 27 B238 90965 90981 17 B371 130840 130861 22 B106 55337 55350 14 B239 91101 91115 15 B372 130975 130994 20 B107 55420 55434 15 B240 92083 92096 14 B373 131112 131132 21 B108 55487 55501 15 B241 92164 92177 14 B374 131142 131161 20 B109 55623 55638 16 B242 92179 92192 14 B375 131233 131246 14 B110 56195 56214 20 B243 92194 92210 17 B376 131729 131743 15 B111 56584 56597 14 B244 92212 92236 25 B377 132754 132767 14 B112 57267 57282 16 B245 92245 92260 16 B378 132924 132937 14 B113 58126 58139 14 B246 92262 92302 41 B379 133174 133190 17 B114 58170 58183 14 B247 92304 92321 18 B380 133198 133212 15 B115 58295 58309 15 B248 92323 92366 44B381 133207 133222 16 B116 58658 58671 14 B249 92375 92389 15 B382 133476 133489 14 B117 58906 58921 16 B250 92392 92405 14 B383 133479 133492 14 B118 58988 59005 18 B251 92407 92426 20 B384 133491 133531 41 B119 59024 59045 22 B252 92442 92459 18 B385 133533 133550 18 B120 59191 59207 17 B253 92497 92516 20 B386 133555 133594 40 B121 59236 59251 16 B254 92578 92591 14 B387 134160 134173 14 B122 59298 59312 15 B255 92599 92612 14 B388 134165 134178 14 B123 59358 59378 21 B256 92614 92651 38 B389 134533 134546 14 B124 59400 59413 14 B257 92659 92684 26 B390 136724 136737 14 B125 59434 59447 14 B258 92686 92699 14 B391 137438 137463 26 B126 59589 59602 14 B259 92704 92726 23 B392 137878 137891 14 B127 59620 59642 23 B260 92731 92750 20 B393 138082 138097 16 B128 59718 59743 26 B261 92752 92774 23 B394 138233 138252 20 B129 59826 59841 16 B262 92780 92795 16 B395 138930 138943 14 B130 59843 59864 22 B263 92800 92813 14 B396 138947 138960 14 B131 59882 59906 25 B264 92839 92858 20 B397138950 138963 14 B132 59930 59958 29 B265 92860 92891 32 B398 139502 139518 17 B133 59959 60004 46 B266 92893 92906 14 B399 139508 139521 14 B400 140978 140991 14 In some configurations, the oligonucleotide or contiguous nucleotide sequence is complementary to a region (or subsequence) of a target nucleic acid, wherein the target nucleic acid region is selected from the group consisting of positions 1589-10889, 46089-53989, and 60789-62489 of SEQ ID NO:1. In one configuration, the oligonucleotide comprises a contiguous nucleotide sequence of 10 to 30 nucleotides in length with at least 90%, such as 100 complements of a target nucleic acid sequence at position 55319 of 141053 of sequence identity number 1. In one configuration, the oligonucleotide comprises a contiguous nucleotide sequence of 10 to 30 nucleotides in length with at least 90%, such as 100 complements of a target nucleic acid sequence at position 1 of 55,318 sequence identity number 1. In one configuration, the oligonucleotide comprises a contiguous nucleotide sequence of 10 to 30 nucleotides in length with at least 90% identity to a target nucleic acid subsequence selected from the group corresponding to positions 55319-76274, 77483-77573, 92157-93403 and 97056-97354 of SEQ ID NO: 1. In one configuration, the oligonucleotide comprises a contiguous nucleotide sequence of 10 to 30 nucleotides in length with at least 90% identity to a target nucleic acid subsequence selected from the group corresponding to positions 60821-60849, 77567-77583, 92323-92339 and 97156-97172 of SEQ ID NO: 1. In one configuration, the oligonucleotide comprises a contiguous nucleotide sequence of 10 to 30 nucleotides in length with at least 90% identity to a target nucleic acid subsequence selected from the group corresponding to positions 5240-5218 of SEQ ID NO: 1. In one configuration, the oligonucleotide comprises a contiguous nucleotide sequence of 10 to 30 nucleotides in length with at least 90% identity to a target nucleic acid subsequence selected from the group corresponding to positions 5782-5803 of SEQ ID NO: 1. In one configuration, the oligonucleotide comprises a contiguous nucleotide sequence of 10 to 30 nucleotides in length with at least 90% identity to a target nucleic acid subsequence selected from the group corresponding to positions 8139-8813 of SEQ ID NO: 1. In one configuration, the oligonucleotide comprises a contiguous nucleotide sequence of 10 to 30 nucleotides in length with at least 90% identity to a target nucleic acid subsequence selected from the group corresponding to positions 9250-9200 of SEQ ID NO:1. In one configuration, the oligonucleotide comprises a contiguous nucleotide sequence of 10 to 30 nucleotides in length with at least 90% identity to a target nucleic acid subsequence selected from the group corresponding to positions 11555-11505 of SEQ ID NO: 1. In one configuration, the oligonucleotide comprises a contiguous nucleotide sequence of 10 to 30 nucleotides in length with at least 90% identity to a target nucleic acid subsequence selected from the group corresponding to positions 13242-13223 of SEQ ID NO: 1. In one configuration, the oligonucleotide comprises a contiguous nucleotide sequence of 10 to 30 nucleotides in length with at least 90% identity to a target nucleic acid subsequence selected from the group corresponding to positions 15150-15100 of SEQ ID NO: 1. In one configuration, the oligonucleotide comprises a contiguous nucleotide sequence of 10 to 30 nucleotides in length with at least 90% identity to a target nucleic acid subsequence selected from the group corresponding to positions 15180-15113 of SEQ ID NO: 1. In one configuration, the oligonucleotide comprises a contiguous nucleotide sequence of 10 to 30 nucleotides in length with at least 90% identity to a target nucleic acid subsequence selected from the group corresponding to positions 29705-29635 of SEQ ID NO: 1. In one configuration, the oligonucleotide comprises a contiguous nucleotide sequence of 10 to 30 nucleotides in length with at least 90% identity to a target nucleic acid subsequence selected from the group corresponding to positions 30740-30590 of SEQ ID NO:1. In one configuration, the oligonucleotide comprises a contiguous nucleotide sequence of 10 to 30 nucleotides in length with at least 90% identity to a target nucleic acid subsequence selected from the group corresponding to positions 39855-39800 of SEQ ID NO:1. In one configuration, the oligonucleotide comprises a contiguous nucleotide sequence of 10 to 30 nucleotides in length with at least 90% identity to a target nucleic acid subsequence at positions 44460-44435 of SEQ ID NO:1. In one configuration, the oligonucleotide comprises a contiguous nucleotide sequence of 10 to 30 nucleotides in length with at least 90% identity to a target nucleic acid subsequence at positions 45270-45245 of SEQ ID NO:1. In one configuration, the oligonucleotide comprises a contiguous nucleotide sequence of 10 to 30 nucleotides in length with at least 90% identity to a target nucleic acid subsequence at positions 46430-46380 of SEQ ID NO:1. In one configuration, the oligonucleotide comprises a contiguous nucleotide sequence of 10 to 30 nucleotides in length with at least 90% identity to a target nucleic acid subsequence at positions 68940-68915 of SEQ ID NO:1. In some configurations, the oligonucleotide comprises or consists of a nucleotide length of 8 to 35, such as 10 to 30, such as 11 to 22, such as 12 to 18, such as 13 to 17 or 14 to 16 contiguous nucleotide lengths. In one configuration, the oligonucleotide comprises or consists of a nucleotide length of 15 to 20. In some embodiments, the oligonucleotide or contiguous nucleotide sequence thereof comprises or consists of 22 nucleotides or less, such as 20 nucleotides or less, such as 19 nucleotides or less, such as 14, 15, 16 or 17 nucleotides. It is understood that any range given herein also includes the final values. Accordingly, if an oligonucleotide comprises 10 to 30 nucleotides, both 10 and 30 nucleotides are included in the range. In some configurations, the oligonucleotide or its contiguous nucleotide sequence comprises or consists of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 contiguous nucleotides. In a preferred configuration, the oligonucleotide comprises or consists of 16, 17, 18 or 19 nucleotides. In some embodiments, the oligonucleotide or contiguous nucleotide sequence thereof comprises or consists of 10 to 30 nucleotides with at least 90% identity, preferably 100% identity, to a sequence selected from the group consisting of sequence identity numbers 4 to 150 (see motif sequences listed in Table 3 and in the Examples section). In some embodiments, the oligonucleotide or contiguous nucleotide sequence thereof comprises or consists of 10 to 30 nucleotides with at least 90% identity, preferably 100% identity, to a sequence selected from the group consisting of SEQ ID NOs: 4 to 818 (see motif sequences listed in Table 3 and in the Examples section). In some embodiments, the oligonucleotide or contiguous nucleotide sequence thereof comprises or consists of 10 to 30 nucleotides with at least 90% identity, preferably 100% identity, to a sequence selected from the group consisting of SEQ ID NOs: 4 to 678 (see motif sequences listed in Table 3 and in the Examples section). In some embodiments, the oligonucleotide or contiguous nucleotide sequence thereof comprises or consists of 10 to 30 nucleotides with at least 90% identity, preferably 100% identity, to a sequence selected from the group consisting of SEQ ID NO: 166, 167, 167 or 169 (see the motif sequence set forth in Table 3 and in the Examples section). In some embodiments, the oligonucleotide or contiguous nucleotide sequence thereof comprises or consists of 10 to 30 nucleotides with at least 90% identity, preferably 100% identity, to a sequence selected from the group consisting of SEQ ID NOs: 570, 571, 572, 679, 680, 681, 682, and 683 (see motif sequences set forth in Table 3 and in the Examples section). In some embodiments, the oligonucleotide or contiguous nucleotide sequence thereof comprises or consists of 10 to 30 nucleotides with at least 90% identity, preferably 100% identity, to a sequence selected from the group consisting of SEQ ID NOS: 346, 186, 187, 188, 573, 574, 575, 576, 572, 684, 685, 686, 687, 688, 689, 690, 691, 692, 963, 964, 965, and 696 (see motif sequences set forth in Table 3 and in the Examples section). In some embodiments, the oligonucleotide or contiguous nucleotide sequence thereof comprises or consists of 10 to 30 nucleotides with at least 90% identity, preferably 100% identity, to a sequence selected from the group consisting of SEQ ID NOS: 35, 199, 200, 201, 202, 203, 204, 205, 206, 207, 209 and 210 or SEQ ID NOS: 582, 583 and 584 (see motif sequences in Table 3 and in the Examples section). In some embodiments, the oligonucleotide or contiguous nucleotide sequence thereof comprises or consists of 10 to 30 nucleotides with at least 90% identity, preferably 100% identity, to a sequence selected from the group consisting of SEQ ID NOS: 226, 222, 223, 224, 225, 585, 586, 587, 588, 589, 698, 699, 700, 701, 702, 703, 704, 705, 706, 707, 708, 709, 710, 711, 712, 713, 714, 715, 716, 717, and 718 (see motif sequences set forth in Table 3 and in the Examples section). In some embodiments, the oligonucleotide or contiguous nucleotide sequence thereof comprises or consists of 10 to 30 nucleotides with at least 90% identity, preferably 100% identity, to a sequence selected from the group consisting of SEQ ID NOs: 236, 237, 238, 239, 240, and 590 (see motif sequences listed in Table 3 and in the Examples section). In some embodiments, the oligonucleotide or contiguous nucleotide sequence thereof comprises or consists of 10 to 30 nucleotides with at least 90% identity, preferably 100% identity, to a sequence selected from the group consisting of SEQ ID NOs: 241, 591, and 719 (see motif sequences listed in Table 3 and in the Examples section). In some embodiments, the oligonucleotide or contiguous nucleotide sequence thereof comprises or consists of 10 to 30 nucleotides with at least 90% identity, preferably 100% identity, to a sequence selected from the group consisting of SEQ ID NOs: 236, 237, 238, 239, 240, and 590 (see motif sequences listed in Table 3 and in the Examples section). In some embodiments, the oligonucleotide or contiguous nucleotide sequence thereof comprises or consists of 10 to 30 nucleotides with at least 90% identity, preferably 100% identity, to a sequence selected from the group consisting of SEQ ID NOS: 464, 47, 48, 285, 286, 287, 288, 289, 297, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 613, 614, 615, 616, 617, 618, 619, 620, 618, 619, 620, 621, 622, 623, 624, 625, 626,627, 628, 629, 630, 631, 632, 721, 722, 723, 724, 725, 726, 727, 728, 729, 730, 731, 732, 734, 735, 732, 734, 735, 736, 737, 738, 739, 740, 741, 742, 743, 744, 745, 746, 747, 748, 749, 750, 751, 752, 753, 754, 755, 756, 757, 758, 759, 760, 768, 759, 760, 761, 762, 763, 764, 765, 766, 767, 768, 769, 770, 771, 772, 773, 774, 775, 776, 777, 778, 779, 780, 781, 782, 783, 784, 785, 786, 784, 785, 786, 787, 788, 789, 790, 791, 792, 793, 794, 795, 796, 797, 798, 799, 800, 800, 800, 800, 801, 801, 802, 803, 804, 805, 806 and 807 (according to the motif sequence listed in Table 3 and in the Examples section)(Refer to). In some embodiments, the oligonucleotide or contiguous nucleotide sequence thereof comprises or consists of 10 to 30 nucleotides with at least 90% identity, preferably 100% identity, to a sequence selected from the group consisting of SEQ ID NOs: 331, 332, 638, 639, 640, 808, 809, 810, 811, 812, 813, 814, and 815 (see motif sequences in Table 3 and in the Examples section). In some embodiments, the oligonucleotide or contiguous nucleotide sequence thereof comprises or consists of 10 to 30 nucleotides with at least 90% identity, preferably 100% identity, to a sequence selected from the group consisting of SEQ ID NOS: 409, 410, 411, 642, 643, 644, 645, 646, 816, 818, and 818 (see motif sequences listed in Table 3 and in the Examples section). It is understood that the contiguous nucleobase sequences (motif sequences) can be modified, for example, to increase nuclease resistance and / or binding affinity to the target nucleic acid. Modifications are described in the Definitions section under the heading "Oligonucleotide Design". Table 3 provides preferred designs for each motif sequence. Oligonucleotide design Oligonucleotide design refers to a pattern of nucleoside sugar modifications in the oligonucleotide sequence. Oligonucleotides of the invention include sugar-modified nucleosides and may include DNA or RNA nucleosides. In some configurations, the oligonucleotide includes sugar-modified nucleosides of a DNA nucleoside. Inclusion of modified nucleosides in an oligonucleotide of the invention may increase the binding affinity of the oligonucleotide for the target nucleic acid. In such cases, the modified nucleosides may be referred to as affinity-enhancing modified nucleotides. In one configuration, the oligonucleotide comprises at least one modified nucleoside, such as at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, or at least 16 modified nucleosides. In one configuration, the oligonucleotide comprises 1 to 10 modified nucleosides, such as 2 to 9 modified nucleosides, 3 to 8 modified nucleosides, 4 to 7 modified nucleosides, 6 or 7 modified nucleosides. In some configurations, the at least one modified nucleoside is a locked nucleic acid (LNA), such as at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, or at least 8 modified LNA nucleosides. In other configurations, the modified nucleosides are LNA. In one configuration, the oligonucleotide of the invention may comprise modifications independently selected from these three types of modifications (sugar modified, nucleobase modified and internucleoside linkage modified) or a combination thereof. Preferably, the oligonucleotide comprises one or more sugar modified nucleosides such as 2' sugar modified nucleosides. Preferably, the oligonucleotide of the invention comprises one or more 2' sugar modified nucleosides selected from the group consisting of 2'-O-alkyl-RNA, 2'-O-methyl-RNA, 2'-alkoxy-RNA 2'-O-methoxyethyl-RNA, 2'-amino-DNA, 2'-fluoro-DNA, arabino nucleic acid (ANA), 2'-fluoro-ANA and LNA nucleosides. Even more preferably, the one or more modified nucleosides are LNA. In another configuration, the oligonucleotide comprises at least one modified nucleoside linkage. In a preferred configuration, the nucleoside linkages in the contiguous nucleotide sequence are internucleoside phosphorothioate or borate phosphate linkages. In some configurations, the oligonucleotide of the invention comprises at least one contiguous nucleotide that is a 2'-MOE-RNA, such as 2, 3, 4, 5, 6, 7, 8, 9, or 10 2'-MOE-RNA nucleoside units. In some configurations, at least one of said modified nucleotides is a 2'-fluoro DNA, such as 2, 3, 4, 5, 6, 7, 8, 9, or 10 2'-fluoro-DNA nucleoside units. In some configurations, the oligonucleotide of the invention comprises at least one LNA unit, such as 1, 2, 3, 4, 5, 6, 7, or 8 LNA units, such as 2 to 6 LNA units, such as 3 to 7 LNA units, 4 to 8 LNA units, or 3, 4, 5, 6, or 7 LNA units. In some configurations, the modified LNA nucleosides are nucleosides. In other configurations, the oligonucleotide comprises both beta-D-oxy-LNA and one or more of the following LNA units: thio-LNA, amino-LNA, oxy-LNA, and / or ENA in the beta-D or alpha-L configuration, or a combination thereof. In some configurations, all of the cytosine units of the LNA are 5-methylcytosine. In a preferred configuration, the oligonucleotide or contiguous nucleotide sequence has at least 1 LNA unit at the 5' end and at least 2 LNA units at the 3' end of the nucleotide sequence. In some configurations, the oligonucleotide of the invention comprises at least one LNA unit and at least one 2'-substituted modified nucleoside. In some embodiments of the invention, the oligonucleotide comprises both modified sugar nucleosides and DNA units. The oligonucleotide preferably comprises LNA and DNA units. Preferably, the total combination of LNA and DNA units is between 8 and 30, such as 10-25, preferably 12-22, such as 12-18, even more preferably 11-16. In some configurations, the oligonucleotide nucleotide sequence, such as a contiguous nucleotide sequence, comprises at least one or two LNA units and the remaining nucleotide units are DNA units. In some configurations, the oligonucleotide comprises only LNA nucleosides and natural nucleoside cores (such as RNA or DNA, with DNA nucleosides being more preferred), optionally with modified internucleoside linkages such as phosphatothioate. In one configuration of the invention, the oligonucleotide of the invention is capable of employing RNase H. Gapmer plan In a preferred configuration, the oligonucleotide of the invention has a gapmer design, also referred to as a "gapmer". In a gapmer design, the oligonucleotide comprises at least three structurally distinct regions, 5'-flank, gap and 3'-flank, FGF' in the 5 -> 3' direction. In this design, the flanking regions F and F' (also referred to as wing regions) comprise a continuous strand of modified nucleosides that are complementary to the target UBE3A nucleic acid, while the gap region, G, comprises a continuous strand of nucleotides that are capable of recruiting a nuclease, preferably an endonuclease such as RNase, e.g. RNase H, when the oligonucleotide is duplexed with the target nucleic acid. Nucleosides capable of recruiting nucleases, in particular RNase H, can be selected from the group consisting of DNA, alpha-L-oxy-LNA, 2'-Flouro-ANA and UNA. The F and F' regions, adjacent to the 5' and 3' ends of the G region, preferably comprise non-nuclease recruiting nucleosides (nucleosides with a 3' endo structure), more preferably one or more modified nucleosides enhancing binding affinity.In some configurations, the 3' flank comprises at least one LNA nucleoside, preferably at least 2 LNA nucleosides. In some configurations, the 5' flank comprises at least one LNA nucleoside. In some configurations, both the 5' and 3' flanking regions comprise an LNA nucleoside. In some configurations, all nucleosides in the flanking regions are LNA nucleoside cores. In other configurations, the flanking regions may comprise both LNA nucleoside cores and other nucleosides (mixed flanks) such as DNA nucleosides and / or non-LNA modified nucleosides such as 2' substituted nucleosides. In this case, the cleavage site is defined as an alternating sequence of at least 5 RNase H-extracted nucleosides (nucleosides with a 2'-terminal structure, preferably DNA) defined at the 5' and 3' ends with a nucleoside extension core, preferably LNA, such as beta-D-oxy-LNA. As a result, the nucleosides in the 5' region and the 3' region adjacent to the cleavage site, the modified nucleosides, absorb the greatest amount of nucleosides.In oligonucleotides with mixed margins where the sides include DNA, the 5' and 3' nucleosides are modified nucleosides. Area F The F region (5' flank or 5' wing) attached to the 5' end of the G region comprises, contains or consists of at least one modified nucleoside, such as at least 2, at least 3, at least 4, at least 5, at least 6, at least 7 modified nucleosides. In one configuration, the F region comprises, contains or consists of at least 1 to 7 modified nucleotides, such as 2 to 6 modified nucleotides, such as 2 to 5 modified nucleotides, such as 2 to 4 modified nucleotides, such as 1 to 3 modified nucleotides, such as 1, 2, 3 or 4 modified nucleotides. In another configuration, an additional nucleoside may be added to the 5' end of the F region, representing a D region preferably comprising 1, 2 or 3 nucleoside units, such as DNA nucleosides. Region D could serve as a biological linker (B), as defined in the definition of "linkers". In some configurations, the modified nucleosides have a 3' endo structure in the region. In some configurations, one or more of the modifying nucleosides in the F region are '2' modified nucleosides. In another configuration, one or more 2'-modified nucleosides in the F region are 2'-O-alkyl-RNA units, 2'-O-methyl-RNA units, 2'-amino-DNA units, 2'-amino-DNA units, 2'-fluoro-DNA units, 2'-alkoxy-RNA units, MOE units, LNA units, arabino nucleic acid (ANA) units, and 2'-fluoro-ANA units. In one embodiment of the invention, all of the modified nucleosides in the F region are LNA. In another embodiment, the LNA nucleosides in the F region are independently selected from the group consisting of oxy-LNA, thio-LNA, amino-LNA, cET and / or ENA in the beta-D or alpha-L configurations, or combinations thereof. In a preferred embodiment, the F region has at least one beta-D-oxy LNA unit, at the 5' end of the F region, of the modified nucleosides. Area G The region (cleft region) preferably comprises, contains or consists of at least 4, such as at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15 or at least 16 consecutive nucleosides capable of recruiting the aforementioned sequential nucleoside, in particular RNaseH. In another configuration of the region, the G region contains or consists of 5 to 12 or from 6 to 10 or 7 to 9, such as 8 consecutive nucleotide units capable of recruiting the aforementioned sequential nucleoside. Nucleoside units in the G region, which are capable of recruiting nucleosides in a configuration selected from the group consisting of DNA, alpha-L-LNA, C4' alkylated DNA (as described in PCT / EP2009 / 050349 and Vester et al., Bioorg. Med. Chem. Lett. 18 (2008) 2296 – 2300, both of which are incorporated herein by reference), arabinose-derived nucleosides such as ANA and 2'F-ANA (Mangos et al. 2003 J. AM. CHEM. SOC. 125, 654-661), UNA (unfolded nucleic acid) (as described in Fluiter et al., Mol. Biosyst., 2009, 10, 1039, which is incorporated herein by reference). UNA is an unfolded nucleic acid, usually in which the bond between C2 and C3 of the ribose has been removed, an unfolded "sugar" residue. In another configuration, at least one nucleoside unit in the G region is a DNA nucleoside unit, such as 1 to 16 DNA units, such as 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 DNA units, preferably from 2 to 13 DNA units, including 4 to 12 DNA units, more preferably from 5 to 11, or from 10 to 16, 11 to 15, or 12 to 14 DNA units. In some configurations, the G region is comprised of 100% DNA units. In some preferred configurations, the G region is most preferably comprised of 10, 11, 12, 13, 14, or 15 DNA units. In some other configurations, the G region may comprise a combination of DNA and other nucleosides capable of mediating RNase H cleavage. The G region may comprise at least 50% DNA, more preferably 60%, 70% or 80% DNA, and even more preferably 90% or 95% DNA. In some other configurations, at least one nucleoside unit in the G region is an alpha L-LNA nucleoside unit, such as at least one alpha L-LNA unit such as 2, 3, 4, 5, 6, 7, 8 or 9 alpha L LNA units. In another configuration, the G region comprises at least one alpha L-LNA unit or alpha L-oxy-LNA unit. In another configuration, the G region is a combination of DNA and alpha L-LNA nucleoside units. In some configurations, the length of the contiguous sequence in the G region may be longer, such as 15, 16, 17, 18, 19, or 20 nucleoside units. In some configurations, nucleosides in the G region have an endo '2 structure. Area F' The F' region (3' flank or 3' wing) attached to the 3' end of the G region comprises, contains or comprises at least one modified nucleoside, such as at least 2, at least 3, at least 4, at least 5, at least 6, at least 7 modified nucleosides. In one configuration the F' region comprises or comprises 1 to 7 modified nucleosides, including 2 to 6 modified nucleosides, including 2 to 4 modified nucleosides, including 1 to 3 modified nucleosides, such as 1, 2, 3 or 4 modified nucleosides. In another configuration, the additional nucleosides attached to the '3' endo of the F' region, represent a D' region, preferably containing 1, 2 or 3 nucleoside units, such as a DNA nucleoside. The D' region can serve as a biodegradable linker (B) as described in the "Linkers" section. In some configurations, the modified F' region nucleoside has a 3' endo structure. In some configurations, the modified nucleoside of the F' region is LNA. In some configurations, the modified nucleoside in the F' region is selected from 2'-O-alkyl-RNA units, 2'-O-methyl-RNA units, 2'-amino-DNA units, 2'-fluoro-DNA units, 2'-alkoxy-RNA units, MOE units, LNA units, arabino nucleic acid units, and 2'-fluoro-ANA units. In one embodiment of the invention, all of the modified nucleosides in region F' are LNA. In another embodiment, the LNA nucleosides in region F' are independently selected from the group consisting of oxy-LNA, thio-LNA, amino-LNA, cET and / or ENA in the beta-D or alpha-L configurations or combinations thereof. In a preferred embodiment, region F' has at least one beta-D-oxy LNA unit at the 3' end of the contiguous sequence. Area D and D' Region D and D' can be connected to the 5' end of region F or the 3' end of region F, respectively. The D and D' regions may independently comprise 1, 2, 3, 4 or 5 additional nucleotides which may be complementary or non-complementary to the target nucleic acid. In this regard, the oligonucleotide of the invention may, in some configurations, comprise a contiguous oligonucleotide sequence capable of modulating the target flanked at the 5' and / or 3' ends by other nucleotides. Such additional nucleotides may serve as a nuclease-compatible, biodegradable linker (see definition of linkers). In some configurations, the additional 5' and / or 3' nucleotides are linked by phosphodiester bonds and may be DNA or RNA. In other configurations, the additional 5' and / or 3' nucleotides are modified nucleotides which may be used, for example, to increase nuclease stability or to facilitate synthesis. In one configuration, the oligonucleotide of the invention comprises a D and / or D' region in addition to the contiguous nucleotide sequence. The gapmer oligonucleotide of this invention can be represented by the following formula: FG-F'; especially F1-7-G4-12-F'1-7 DFG-F'; specifically D1-3-F1-7-G4-12-F'1-7 FG-F'-D'; specifically F1-7-G4-12-F'1-7-D'1-3 DFG-F'-D'; specifically D1-3-F1-7-G4-12-F'1-7-D'1-3 The preferred number and types of nucleosides in the F, G and F', D and D' regions are described above. The design of the individual oligonucleotide may have a profound effect on the properties of the oligonucleotide in its use to interfere with UBE3A expression. In some configurations, the oligonucleotide is a gapmer comprising 14, 15, 16, 17, 18, 19 or 20 nucleotides in length, wherein each of the F and F' regions independently comprises 2, 3 or 4 modified nucleoside units complementary to a portion of the human long non-coding RNA SNHG14 that is antisense to UBE3A pre-mRNA (target nucleic acid) and the G region comprises 10, 11, 12, 13, 14 or 15 nucleoside residues, respectively, capable of attracting a nuclease reaction when duplexed with the target nucleic acid. In some configurations, the oligonucleotide is a gapmer in which each F and F' region independently comprises 2, 3, 4 or 5 modified nucleoside units such as 2'-O-methoxyethyl-ribose (2'-MOE) sugar-containing units or 2'-fluoro-deoxyribose sugar-containing nucleoside units and / or LNA units, and the G region comprises 9, 10, 11, 12, 13, 14 or 15 nucleoside units such as DNA units or other nuclease-recruiting nucleosides such as alpha-L-LNA or a mixture of DNA and nuclease-recruiting nucleosides. In another specific configuration, the oligonucleotide is a gapmer in which each F and F' region comprises two LNA units, and the G region comprises 10, 11, 12, 13, 14 or 15 nucleoside units, preferably DNA units. Specific gapmer designs of this nature include 2-10-2, 2-11-2, 2-12-2, 2-13-2, 2-14-2 and 2-15-2. In another specific configuration, the oligonucleotide is a gapmer in which each F and F' region independently comprises three LNA units, and the G region comprises 10, 11, 12, 13, 14 or 15 nucleoside units, preferably DNA units. Specific gapmer designs of this nature include 3-10-3, 3-11-3, 3-12-3, 3-13-3, 3-14-3 and 3-15-3. In another specific configuration, the oligonucleotide is a gapmer in which each F and F' region comprises four LNA units, and the G region comprises 10, 11, 12, 13, 14 or 15 nucleoside units, preferably DNA units. Specific gapmer designs of this nature include 4-10-4, 4-11-4, 4-12-4, 4-13-4, 4-14-4 and 4-15-4. Specific gapmer designs of this nature include FG-F' designs selected from a group consisting of a 10-nucleoside cleft and independently 1 to 4 nucleosides modified in the wings, including gapmers 1-10-1, 2-10-1, 1-10-2, 1-10-3, 3-10-1, 1-10-4, 4-10-1, 2-10-2, 2-10-3, 3-10-2, 2-10-4, 4-10-2, 3-10-3, 3-10-4, 4-10-3 and 4-10-4. Specific gapmer designs of this nature include FG-F' designs selected from a group consisting of a cleft with 11 nucleosides and independently 1 to 4 nucleosides modified in the wings, including gapmers 1-11-1, 2-11-1, 1-11-2, 1-11-3, 3-11-1, 1-11-4, 4-11-1, 2-11-2, 2- 11-3, 3-11-2, 2-11-4, 4-11-2, 3-11-3, 3-11-4, 4-11-3 and 4-11-4. Specific gapmer designs of this nature include FG-F' designs selected from a group consisting of a 12-nucleoside gap including gapmers 1-12-1, 2-12-1, 1-12-2, 1-12-3, 3-12-1, 1-12-4, 4-12-1, 2-12-2, 2- 12-3, 3-12-2, 2-12-4, 4-12-2, 3-12-3, 3-12-4, 4-12-3 and 4-12-4. Specific gapmer designs of this nature include FG-F' designs selected from a group consisting of a 13-nucleoside cleft and independently 1 to 4 nucleosides modified in the wings, including gapmers 1-13-1, 1-13-2, 1-13-3, 3-13-1, 1-13-4, 4-13-1, 2-13-1, 2-13-2, 2- 13-3, 3-13-2, 2-13-4, 4-13-2, 3-13-3, 3-13-4, 4-13-3, and 4-13-4. Specific gapmer designs of this nature include FG-F' designs selected from a group consisting of a 14-nucleoside cleft and independently 1 to 4 nucleosides modified in the wings, including gapmers 1-14-1, 1-14-2, 2-14-1, 1-14-3, 3-14-1, 1-14-4, 4-14-1, 2-14-2, 2- 14-3, 3-14-2, 2- 14-4, 4-14-2, 3-14-3, 3-14-4 and 4-14-3. Specific gapmer designs of this nature include FG-F' designs selected from a group consisting of a 15-nucleoside cleft and independently 1 to 4 nucleosides modified in the wings, including gapmers 1-15-1, 1-15-2, 2-15-1, 1-15-3, 3-15-1, 1-15-4, 4-15-1, 2-15-2, 2- 15-3, 3-15-2 2-15-4, 4-15-2, 3-15-3, 3-15-4 and 4-15-3. Specific gapmer designs of this nature include FG-F' designs selected from a group consisting of a 16-nucleoside cleft and independently 1 to 4 nucleosides modified in the wings, including gapmers 1-16-1, 16-16-2, 2-16-1, 1-15-3, 3-16-1, 16-16, 4-16-1, 2-16-2, 2-16-3, 3-16-2, 2-16-4, 4-16-2, 3-16-3, 3-16-4 and 4-16-3. In some configurations, the FG-F' scheme is selected from 2-10-4, 3-10-3, and 4-10-2. In some configurations, the FG-F' layout is selected from 2-11-4, 3-11-2, 3-11-3, and 4-11-2. In some configurations, the FG-F' layout is selected from 2-12-2, 2-12-3, 2-12-4, 3-12-2, 3-12-3, and 4-12-2. In some configurations, the FG-F' layout is selected from 2-13-2, 2-13-3, 2-13-4, 3-13-3, and 4-13-2. In some configurations, the FG-F' layout is selected from 2-14-2, 2-14-4, 3-14-3, and 4-14-2. In some configurations, the FG-F' scheme is selected from 2-15-2 and 2-16-2. In some configurations, the FG-F' scheme is selected from the schemes listed in Table 3. In all cases the FG-F' scheme may include a D and / or D' region, which may have 1, 2 or 3 nucleoside units, like DNA units. Preferably, the nucleosides in the F and F' regions are modified nucleosides, while the nucleosides in the G region are preferably unmodified nucleosides. In each embodiment, the preferred modified nuclease is LNA. In another configuration, all internucleoside linkages in the cleft in a gapmer are phosphothioate and / or boronophosphate linkages. In another configuration, all internucleoside linkages in the flanks (region F and F') in a gapmer are phosphothioate and / or boronophosphate linkages. In another preferred configuration, all linkages in region D and D' in the gapmer are phosphodiester linkages. For certain gapmers disclosed herein, when cytosine (C) residues are designated as 5-methyl-cytosine, in various configurations, one or more of the Cs present in the oligonucleotide may be unmodified C residues. Other designs of gapmers are disclosed in WO2004 / 046160, WO2007 / 146511 and are incorporated herein by reference. For certain embodiments of this invention, the oligonucleoside is selected from the group of oligonucleoside compounds in Table 3. For certain embodiments of the invention, the oligonucleoside is selected from the group of oligonucleoside compounds having CMP identity numbers: 1_4 to 2_150. For certain embodiments of the invention, the oligonucleotide is selected from the group of oligonucleotide compounds having CMP identity numbers: 1_4 to 1_678. For specific embodiments of the invention, the oligonucleotide is selected from the group of oligonucleotide compounds with CMP ID Nos. 1_4 to 1_818 (see oligonucleotide sequences listed in Table 3 in the Examples section). For certain embodiments of the invention, the oligonucleotide is selected from the group of oligonucleotide compounds having CMP identity number: 1_155 to 1_165. For certain embodiments of the invention, the oligonucleotide is selected from the group of oligonucleotide compounds with CMP identity numbers: 52_169, 50_169 or 56_169. For certain embodiments of this invention, the oligonucleotide is selected from the group of oligonucleotide compounds with CMP identity numbers: 1_172, 1_272, 7_572, 6_572, 5_572. For certain embodiments of the invention, the oligonucleoside is selected from the group of oligonucleoside compounds with CMP identity number: 1_175. For certain embodiments of the invention, the oligonucleoside is selected from the group of oligonucleoside compounds with CMP Identity Number: 1_178. For certain embodiments of the invention, the oligonucleotide is selected from the group of oligonucleotide compounds with CMP identity numbers: 8_573, 1_186 or 1_187. For certain embodiments of the invention, the oligonucleoside is selected from the group of oligonucleoside compounds with CMP Identity Number: 1_186. For certain embodiments of the invention, the oligonucleotide is selected from the group of oligonucleotide compounds with CMP identity numbers: 1_200, 1_204, 1_206, , 2_35 or , 1_209. For certain embodiments of the invention, the oligonucleotide is selected from the group of oligonucleotide compounds with CMP identity numbers: 1_585, 8_585, 9_586, 5_586, 8_586, 4_586 or 6_586. For certain embodiments of this invention, the oligonucleotide is selected from an oligonucleotide compound with CMP identity number: 1_233. For certain configurations of this invention, the oligonucleotide is selected to be an oligonucleotide with CMP identity number: 8_237 or 13_590. For certain configurations of this invention, the oligonucleotide is selected to be an oligonucleotide with the CMP identity number: 1_220. For certain embodiments of the invention, the oligonucleoside is selected from the group of oligonucleoside compounds having CMP identity numbers: 1_591, 2_592, 4_592, or 9_241. For certain embodiments of the invention, the oligonucleoside is selected from the group of oligonucleoside compounds having CMP identity numbers: 4_597, 4_598, 1_39, or 1_602. For certain configurations of this invention, the oligonucleotide is selected to be an oligonucleotide with CMP identity number: 1_39. For certain configurations of this invention, the oligonucleotide is selected to be an oligonucleotide with CMP identity number: 7_611. For certain embodiments of the invention, the oligonucleotide is selected to be an oligonucleotide with CMP identity number: 1_271 or 1_278. For certain embodiments of this invention, the oligonucleotide is selected from the group of oligonucleotide compounds with CMP identity numbers: 4_616, 2_621, 1_621, 3_622, 5_622, 4_622, 3_624, 5_624, 1_287, 6_625, 7_626, 8_626, 9_626, 1_48, 6_631, 1_631, 1_303, 6_304, or 10_304. For certain configurations of this invention, the oligonucleotide is selected to be an oligonucleotide with CMP identity number: 8_636. For certain embodiments of the invention, the oligonucleoside is selected from the group of oligonucleoside compounds having CMP identity numbers: 8_638, 5_639, 1_331, or 4_640. For certain embodiments of the invention, the oligonucleoside is selected from the group of oligonucleoside compounds having CMP identity numbers: 1_359, 1_361, 5_361, 1_362, or 5_641. For certain embodiments of the invention, the oligonucleoside is selected from the group of oligonucleoside compounds having CMP identity numbers: 1_378, 1_379, or 1_399. For certain embodiments of the invention, the oligonucleotide is selected from the group of oligonucleotide compounds having CMP identity numbers: 1_403, 1_405, 12_642, 13_642, 3_644 or 16_646. For certain configurations of this invention, the oligonucleotide is selected to be an oligonucleotide with CMP identity number: 1_85 or 5_424. For certain configurations of this invention, the oligonucleotide is selected to be an oligonucleotide with CMP identity number: 1_116. For certain configurations of this invention, the oligonucleotide is selected to be an oligonucleotide with CMP identity number: 1_123 or 1_124. For certain configurations of this invention, the oligonucleotide is selected to be an oligonucleotide with CMP identity number: 1_126. Manufacturing method In another aspect, the invention provides methods for producing oligonucleotides of the invention comprising reacting nucleotide units to form contiguous nucleotide units covalently linked to the oligonucleotide. Preferably, the method utilizes phosphoramidite chemistry (e.g., Caruthers et al, 1987, Methods in Enzymology vol. 154, pages 287-313). In another embodiment, the method also comprises reacting the contiguous nucleotide sequence with a conjugating moiety (ligand). In another aspect, a method for producing compounds of the invention is provided, comprising combining an oligonucleotide or conjugated oligonucleotide of the invention with a diluent, solvent, carrier, salt, and / or adjuvant. Pharmaceutical composition In another aspect, the invention provides pharmaceutical compositions comprising any of the above oligonucleotides and / or oligonucleotides and a pharmaceutically acceptable diluent, carrier, salt and / or adjuvant. A pharmaceutically acceptable diluent comprises phosphate buffered saline (PBS) and pharmaceutically acceptable salts including, but not limited to, sodium and potassium salts. WO 2007 / 031091 provides suitable and desirable examples of pharmaceutically acceptable diluents, carriers and adjuvants (incorporated herein by reference). Suitable dosage, formulations, routes of administration, compositions, dosage forms, combinations with other therapeutic agents, drug-like formulations are also provided in WO2007 / 031091. The oligonucleotides or oligonucleotide conjugates of this invention can be mixed with pharmaceutically acceptable active or inactive ingredients to prepare pharmaceutical compositions or formulations. The compositions and methods of formulating the pharmaceutical compositions depend on a number of criteria including, but not limited to, the route of administration, the extent of the disease, or the dosage to be administered. In some embodiments, the oligonucleotide or oligonucleotide conjugate of the invention is a prodrug. In particular, with respect to oligonucleotide conjugates, the conjugate molecule is cleaved from the oligonucleotide after the prodrug has reached its site of action, i.e., the target cell. Applications The oligonucleotides of the invention can be used as research reagents, for example, therapeutic and prophylactic reagents. In research, these oligonucleotides can be used to precisely synthesize UBE3A protein in cells (e.g., in vitro cell culture) and experimental animals, thereby facilitating functional analysis of the target or assessment of its usefulness as a target for therapeutic intervention. Target modulation occurs by attenuating or inhibiting the modulator gene or mRNA that produces the protein. For treatment, an animal or a human is selected that is suspected of having a disease or disorder that can be treated by modulating UBE3A expression. The invention provides methods of treating or preventing disease comprising administering a substantially therapeutic or prophylactic amount of an oligonucleotide, oligonucleotide conjugate, or pharmaceutical composition of the invention to a subject suffering from or susceptible to the disease. The invention also relates to an oligonucleotide, a compound or a conjugate as defined herein for use as a medicament. The oligonucleotide, oligonucleotide conjugate or pharmaceutical composition according to this invention is typically administered in an effective amount. The invention also relates to the use of an oligonucleotide or oligonucleotide conjugate of the invention for the manufacture of a medicament for the treatment of a disorder referred to herein, or for a method for the treatment of a disorder referred to herein. The disorder or disease, in this context, is associated with the expression of UBE3A. In some configurations, the disorder or disease is associated with a mutation in the maternal UBE3A gene. In some configurations, the target nucleic acid is a regulator of the paternal UBE3A gene. The methods of the invention are preferably used to treat or prevent diseases caused by abnormal levels and / or activity of UBE3A. The disease may be specifically caused by a reduction in the level and / or activity of the UBE3A protein. The invention also relates to the use of an oligonucleotide or oligonucleotide conjugate or a pharmaceutical composition as described herein for the manufacture of a medicament for treating abnormal UBE3A levels and / or activity, particularly low UBE3A levels and / or activity. In one embodiment, the invention relates to oligonucleotides or oligonucleotide conjugates or pharmaceutical compositions for use in the treatment of Engelman syndrome. Usage The oligonucleotides or pharmaceutical compositions of this invention can be administered topically (e.g., on the skin, inhaled, ocularly, or intrathecally), enterally (e.g., orally or via the gastrointestinal tract), or injectablely (e.g., intravenously, subcutaneously, intramuscularly, intraventricularly, intrathecally). In a preferred configuration, the oligonucleotide or pharmaceutical compositions of the invention are administered by intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular, intrathecal or intracranial injection or infusion, e.g. intracerebral or intraventricular. In one configuration, the oligonucleotide or active oligonucleotide conjugate is administered intracerebral or intraventricular. In another configuration, the oligonucleotide or active oligonucleotide conjugate is administered intracerebral or intraspinal. The invention also provides the use of an oligonucleotide or oligonucleotide conjugate of the invention as described for the manufacture of a medicament, wherein the medicament is in dosage form for intrathecal administration. The invention also provides the use of an oligonucleotide or oligonucleotide conjugate of the invention as described for the manufacture of a medicament, wherein the medicament is in dosage form for intracerebral or intrathecal administration. The invention also provides the use of an oligonucleotide or oligonucleotide conjugate of the invention as described for the manufacture of a medicament, wherein the medicament is in dosage form for intraventricular administration. Combination therapies In some configurations, the oligonucleotide or oligonucleotide conjugate or pharmaceutical compositions of the invention are for use in combination therapy with other therapeutic agents. The therapeutic agent can be, for example, an anticonvulsant drug. Configurations The following configurations for this invention can be used in conjunction with any other configuration described herein. 1. An antisense oligonucleotide comprising or consisting of a contiguous nucleotide sequence of 10 to 30 nucleotides in length that is capable of inducing expression of human paternal UBE3A, particularly in neuronal cells. 2. The oligonucleotide of embodiment 1, wherein the contiguous nucleotide sequence is at least 95% complementary to a portion of the human SNHG14 full-length non-coding RNA located downstream of position 25278410 to 25419462 on chromosome 15. 3. The oligonucleotide of embodiment 1 or 2, wherein the oligonucleotide is capable of hybridizing to a target nucleic acid of sequence identity number 1 with a ΔG° of less than -10 kcal. 4. The oligonucleotide of configuration 3-1, wherein the contiguous nucleotide sequence is at least 95%, such as 98%, such as 100% complementary to a target nucleic acid region having sequence identity number 1 and / or 2. 5. The oligonucleotide of configuration 3-1, wherein the contiguous nucleotide sequence is 100% complementary to a nucleic acid region of position 1 to 553138 of sequence identity number 1. 6. The oligonucleotide of configuration 4-1, wherein the contiguous nucleotide sequence is complementary to a target nucleic acid subsequence, wherein the subsequence is selected from the group consisting of the regions set forth in Table 1 or 2. 7. The oligonucleotide of configuration 4-1, wherein the contiguous nucleotide sequence is at least 98% complementary to a portion of a human SNHG14 full-length non-coding RNA that is antisense to UBE3A pre-mRNA. 8. The oligonucleotide of embodiment 4-1 or 7, wherein the oligonucleotide is capable of hybridizing to a target nucleic acid at positions 55319 to 141053 of SEQ ID NO: 1 with a ΔG° of less than -10 kcal. 9. The oligonucleotide of configuration 4-1 or 8-7, wherein the contiguous nucleotide sequence is 100% complementary to a nucleic acid region at positions 55319 to 141053 of SEQ ID NO:1. 10. An oligonucleotide of configuration 8-1, wherein the target nucleic acid is RNA. 11. The oligonucleotide of configuration 8-1, wherein the RNA is a long non-coding RNA. 12. The oligonucleotide of embodiment 8-1, wherein the contiguous nucleotide sequence comprises or consists of at least 10 contiguous nucleotides, in particular 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28 or 29 contiguous nucleotides. 13. The oligonucleotide of embodiment 12-1, wherein the contiguous nucleotide sequence comprises or consists of from 12 to 22 nucleotides. 14. The oligonucleotide of embodiment 13 wherein the contiguous nucleotide sequence comprises or consists of 15-20 nucleotides. 15. The oligonucleotide of embodiment 14-1, wherein the contiguous nucleotide sequence comprises or consists of from 10 to 35 nucleotides. 16. The oligonucleotide of embodiment 15 wherein the contiguous nucleotide sequence comprises or consists of from 15 to 24 nucleotides. 17. The oligonucleotide of embodiment 14-1, wherein the contiguous nucleotide sequence comprises or consists of from 17 to 22 nucleotides. 18. The oligonucleotide of configuration 17-1, wherein the oligonucleotide or contiguous nucleotide sequence is single-stranded. 19. The oligonucleotide of embodiment 18-1, wherein the contiguous nucleotide sequence is complementary to a target nucleic acid subsequence selected from the group consisting of the regions set forth in embodiments 1 or 2. 20. The oligonucleotide of embodiment 18-1, wherein the contiguous nucleotide sequence is complementary to the target nucleic acid subsequence selected from the group consisting of positions 1589-10889, 46089-53989, and 60789-62489 of SEQ ID NO:1. 21. The oligonucleotide of embodiment 18-1, wherein the contiguous nucleotide sequence is complementary to a target nucleic acid subsequence selected from the group consisting of positions 5218-5240 of SEQ ID NO:1. 22. The oligonucleotide of embodiment 18-1, wherein the contiguous nucleotide sequence is complementary to a target nucleic acid subsequence selected from the group consisting of positions 5782-5803 of SEQ ID NO:1. 23. The oligonucleotide of embodiment 18-1, wherein the contiguous nucleotide sequence is complementary to a target nucleic acid subsequence selected from the group consisting of positions 8113-8139 of SEQ ID NO:1. 24. The oligonucleotide of embodiment 18-1, wherein the contiguous nucleotide sequence is complementary to a target nucleic acid subsequence selected from the group consisting of positions 9200-9250 of SEQ ID NO:1. 25. The oligonucleotide of embodiment 18-1, wherein the contiguous nucleotide sequence is complementary to a target nucleic acid subsequence selected from the group consisting of positions 11505-11555 of SEQ ID NO:1. 26. The oligonucleotide of embodiment 18-1, wherein the contiguous nucleotide sequence is complementary to a target nucleic acid subsequence selected from the group consisting of positions 13223-13242 of SEQ ID NO:1. 27. The oligonucleotide of embodiment 18-1, wherein the contiguous nucleotide sequence is complementary to a target nucleic acid subsequence selected from the group consisting of positions 15100-15150 of SEQ ID NO:1. 28. The oligonucleotide of embodiment 18-1, wherein the contiguous nucleotide sequence is complementary to a target nucleic acid subsequence selected from the group consisting of positions 15113-15180 of SEQ ID NO:1. 29. The oligonucleotide of embodiment 18-1, wherein the contiguous nucleotide sequence is complementary to a target nucleic acid subsequence selected from the group consisting of positions 29635-29705 of SEQ ID NO:1. 30. The oligonucleotide of embodiment 18-1, wherein the contiguous nucleotide sequence is complementary to a target nucleic acid subsequence selected from the group consisting of positions 30590-30740 of SEQ ID NO:1. 31. The oligonucleotide of embodiment 18-1, wherein the contiguous nucleotide sequence is complementary to a target nucleic acid subsequence selected from the group consisting of positions 39800-39855 of SEQ ID NO:1. 32. The oligonucleotide of embodiment 18-1, wherein the contiguous nucleotide sequence is complementary to a target nucleic acid subsequence selected from the group consisting of positions 44435-44460 of SEQ ID NO:1. 33. The oligonucleotide of embodiment 18-1, wherein the contiguous nucleotide sequence is complementary to a target nucleic acid subsequence selected from the group consisting of positions 45245-45270 of SEQ ID NO:1. 34. The oligonucleotide of embodiment 18-1, wherein the contiguous nucleotide sequence is complementary to a target nucleic acid subsequence selected from the group consisting of positions 46380-46340 of SEQ ID NO:1. 35. The oligonucleotide of embodiment 18-1, wherein the contiguous nucleotide sequence is complementary to a target nucleic acid subsequence selected from the group consisting of positions 68915-68940 of SEQ ID NO:1. 36. The oligonucleotide of configuration 35-1, wherein the oligonucleotide is neither siRNA nor self-complementary. 37. The oligonucleotide of embodiment 36-1, wherein the contiguous nucleotide sequence comprises or consists of a sequence selected from the group consisting of sequence identity numbers 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 23, 24, 25, 26, 26, 27, 28, 29, 30, 31, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 44, 45, 45, 46, 47, 48, 49, 50, 51, 52, 53, 53, 54, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 79, 80, 81, 8283, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 95, 96, 96, 97, 98, 99, 100, 101, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 172, 173, 174, 175, 176, 177, 178, 179, 180,181، 182، 183، 184، 185، 186، 187، 188، 189، 190، 191، 192، 193، 194، 195، 196، 197، 198، 199، 200، 201، 202، 203، 204، 205، 206، 207، 208، 209، 210، 211، 212، 213، 21 2، 215، 216، 217، 218، 219، 220، 221، 222، 223، 224، 225، 226، 227، 228، 229، 230، 231، 232، 233، 234، 235، 236، 237، 238، 239، 242، 241، 242، 243، 244، 242، 243، 244، 245، 246، 247، 248، 249، 257، 258، 264، 265، 266، 267، 268، 269، 270، 271، 272، 273، 274، 275، 276، 277، 278، 279، 280، 281، 282، 283، 284، 285، 286، 287، 288، 289، 290، 291، 292، 293، 294، 292، 293، 294، 295، 296، 297، 298، 299، 300، 301، 302، 303، 304، 304، 305، 306، 307، 308، 309، 310، 311، 312، 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338، 339، 340، 341، 342، 343، 341، 342، 343، 344، 345، 346، 347، 348، 349، 350، 351، 352، 353، 354، 355، 356، 357، 358، 359، 360، 361، 362، 363، 364، 365، 366، 367، 368، 366، 367، 368، 369، 370، 371، 372، 373، 374، 375، 376، 377، 378، 379، 380، 381، 382، 383، 384،385، 386، 387، 388، 389، 390، 391، 392، 393، 391، 392، 393، 394، 395، 396، 397، 398، 399، 400، 401، 402، 403، 404، 405، 406، 407، 408، 409، 410، 411، 412، 41 3، 414، 415، 416، 417، 418، 416، 417، 418، 419، 420، 421، 422، 423، 424، 425، 426، 427، 428، 429، 430، 431، 432، 433، 434، 435، 436، 437، 438، 439، 440، 441، 442، 443، 441، 442، 443، 444، 445، 446، 447، 448، 449، 450، 451، 452، 453، 454، 455، 456، 457، 458، 459، 460، 461، 462، 463، 464، 465، 466، 467، 468، 466، 467، 468، 469، 470، 471، 472، 473، 474، 475، 476، 477، 478، 479، 480، 481، 482، 483، 484، 485، 486، 487، 488، 489، 490، 491، 492، 493، 491، 492، 493، 494، 495، 496، 497، 498، 499، 500، 501، 502، 503، 504، 505، 506، 507، 508، 509، 510، 511، 512، 513، 514، 515، 516، 517، 518، 516، 517، 518، 519، 520، 521، 522، 523، 524، 525، 526، 527، 528، 529، 530، 531، 532، 533، 534، 535، 536، 537، 538، 539، 540، 541، 542، 543، 544، 542، 543، 544، 545، 546، 547، 548، 549، 550، 551، 552، 553، 554، 555، 556، 557، 558، 559، 560، 561، 562، 563،564، 565، 566، 567، 568، 566، 567، 568، 569، 570، 571، 572، 573، 574، 575، 576، 577، 578، 579، 580، 581، 582، 583، 584، 585، 586، 587، 588، 589، 590، 591، 592، 593، 594، 592، 593، 594، 595، 596، 596، 597، 598، 599، 600، 601، 602، 603، 604، 605، 606، 607، 608، 609، 610، 611، 61 2، 613، 614، 615، 616، 617، 615، 616، 617، 618، 619، 620، 621، 622، 623، 624، 625، 626، 627، 628، 629، 630، 631، 632، 633، 634، 635، 636، 653، 653، 654، 655، 656، 657، 658، 659، 660، 661، 646، 644، 645، 646، 644، 645، 646، 647، 648، 649، 650، 651، 652، 662، 663، 664، 665، 666، 667، 668، 666، 667، 668، 669، 670، 671، 672، 673، 674، 675، 676، 677، 678، 679، 680، 681، 682، 683، 684، 685، 686، 687، 688، 689، 690، 691، 692، 693، 694، 695، 696، 697، 698، 699، 700، 702، 703، 704، 705، 706، 707، 708، 709، 710، 711، 712، 713، 714، 715، 716، 717، 718، 716، 717، 718، 719، 719، 720، 721، 722، 723، 724، 725، 726، 727، 728، 729، 730، 731، 732، 733، 734، 735، 736، 737، 738، 739، 740، 741، 742، 743، 744، 745، 746، 747، 748، 749،750, 751, 752, 754, 755, 756, 757, 758, 759, 760, 761, 762, 763, 764, 765, 766, 767, 768, 766, 767, 768, 769, 770, 772, 773, 774, 775, 776, 777, 778, 779, 780, 781, 782, 783, 784, 785, 786, 787, 788, 789, 790, 791, 792, 793, 794, 792, 793, 794, 795, 796, 797, 798, 799, 800, 801, 802, 803, 804, 805, 806, 807, 808, 809, 810, 811, 812, 813, 81 4, 815, 816, 817 and 818. 38. The oligonucleotide of configuration 36-1, wherein the contiguous nucleotide sequence comprises or consists of a sequence selected from the group consisting of SEQ ID NO: 166, 167, 167 or 169 (see the motif sequence set forth in Table 3 and in the Examples section). 39. The oligonucleotide of configuration 36-1, wherein the contiguous nucleotide sequence comprises or consists of a sequence selected from the group consisting of SEQ ID NOS: 570, 571, 572, 679, 680, 681, 682, and 683 (see the motif sequence set forth in Table 3 and in the Examples section). 40. The oligonucleotide of configuration 36-1, wherein the contiguous nucleotide sequence comprises or consists of a sequence selected from the group consisting of SEQ ID NOS: 570, 571, 572, 679, 680, 681, 682, and 683 (see the motif sequence set forth in Table 3 and in the Examples section). 41. An oligonucleotide of configuration 36-1, wherein the contiguous nucleotide sequence comprises or consists of a sequence selected from the group consisting of SEQ ID NOS: 35, 199 to 210 and SEQ ID NOS: 582 to 584 (see motif sequences in Table 3 and in the Examples section). 42. The oligonucleotide of configuration 36-1, wherein the contiguous nucleotide sequence comprises or consists of a sequence selected from the group consisting of SEQ ID NOS: 236, 237, 238, 239, 240 and 590 (see the motif sequence set forth in Table 3 and in the Examples section). 43. The oligonucleotide of configuration 36-1, wherein the contiguous nucleotide sequence comprises or consists of a sequence selected from the group consisting of SEQ ID NOS: 221 to 225 and SEQ ID NOS: 585 to 589 (see the motif sequences set forth in Table 3 and in the Examples section). 44. An oligonucleotide of configuration 36-1, wherein the contiguous nucleotide sequence comprises or consists of a sequence selected from the group consisting of SEQ ID NO: 241 or 591 (see the motif sequence set forth in Table 3 and in the Examples section). 45. The oligonucleotide of configuration 36-1, wherein the contiguous nucleotide sequence comprises or consists of a sequence selected from the group consisting of SEQ ID NOS: 46-48, 285 to 305 or SEQ ID NOS: 613 to 632 or SEQ ID NOS: 721 to 807 (see the motif sequences set forth in Table 3 and in the Examples section). 46. ​​The oligonucleotide of configuration 36-1, wherein the contiguous nucleotide sequence comprises or consists of a sequence selected from the group consisting of SEQ ID NOS: 331, 332, 638, 639, 640, 808, 809, 810, 811, 812, 813, 814 and 815 (see the motif sequences set forth in Table 3 and in the Examples section). 47. The oligonucleotide of configuration 36-1, wherein the contiguous nucleotide sequence comprises or consists of a sequence selected from the group consisting of SEQ ID NOS: 409 to 411 or SEQ ID NOS: 642 to 646 or SEQ ID NOS: 816 to 818 (see the motif sequences set forth in Table 3 and in the Examples section). 48. The oligonucleotide of configuration 47-1, wherein the contiguous nucleotide sequence has zero to three mismatches compared to the target nucleic acid to which it is complementary. 49. The oligonucleotide of configuration 48, wherein the contiguous nucleotide sequence has a mismatch compared to the target nucleic acid. 50. An oligonucleotide of configuration 48, wherein the contiguous nucleotide sequence has two mismatches compared to the target nucleic acid. 51. The oligonucleotide of configuration 48, wherein the contiguous nucleotide sequence is fully complementary to the target nucleic acid sequence. 52. Oligonucleotide of configuration 52-1, comprising one or more modified nucleosides. 53. An oligonucleotide of configuration 48, wherein one or more modified nucleosides is a modified nucleoside with high binding affinity. 54. The oligonucleotide of configuration 52 or 53, wherein one or more modified nucleosides is a 2' sugar modified nucleoside. 55. The oligonucleotide of configuration 54, wherein the one or more '2' sugar modified nucleosides are independently selected from the group consisting of 2'-O-alkyl-RNA, 2'-O-methyl-RNA, 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA, 2'-amino-DNA, 2'-fluoro-DNA, 2'-fluoro-ANA, and LNA nucleosides. 56. The oligonucleotide of configuration 54, wherein the one or more modified nucleosides are LNA nucleosides. 57. The oligonucleotide of configuration 56, wherein the modified nucleoside is oxy-LNA. 58. The oligonucleotide of configuration 57, wherein the modified nucleoside is beta-D-oxy-LNA. 59. The oligonucleotide of configuration 57, wherein the modified nucleoside is alpha-L-oxy-LNA. 60. An oligonucleotide of configuration 56, wherein the modified nucleoside is thio-LNA. 61. An oligonucleotide of configuration 56, wherein the modified nucleoside is amino-LNA. 62. An oligonucleotide of configuration 56, wherein the modified nucleoside is cET. 63. An oligonucleotide of configuration 56, wherein the modified nucleoside is ENA. 64. The oligonucleotide of configuration 56, wherein the modified LNA nucleoside is selected from the group consisting of beta-D-oxy-LNA, alpha-L-oxy-LNA, beta-D-amino-LNA, alpha-L-amino-LNA, beta-D-thio-LNA, alpha-L-thio-LNA, (S)cET, (R)cET beta-D-ENA and alpha-L-ENA. 65. The oligonucleotide of any of configurations 64-1, wherein the oligonucleotide comprises at least one modified internucleoside linkage. 66. The oligonucleotide of the configurations of 65, wherein the modified internucleoside linkage is nuclease resistant. 67. The oligonucleotide of configurations 65 or 66, wherein at least 50% of the internucleoside linkages within the contiguous nucleotide sequence are phosphorothioate internucleoside linkages or boronophosphate internucleoside linkages. 68. The oligonucleotide of configurations 65 or 66, wherein the internucleoside linkages within the contiguous nucleotide sequence are phosphorothioate internucleoside linkages. 69. The oligonucleotide of configurations 68-1, wherein the oligonucleotide is capable of recruiting RNase H. 70. The oligonucleotide of configuration 69, wherein the oligonucleotide is a gapmer. 71. The oligonucleotide of configurations 69 or 70 wherein the oligonucleotide is a gapmer of the formula 5'-FG-F'-3', wherein F and F' independently comprise or consist of 1-7 modified nucleosides and G is a region between 6 and 16 nucleosides capable of recruiting RNaseH. 72. The oligonucleotide of configuration 71 wherein the modified nucleoside is a 2' sugar modified nucleoside independently selected from the group consisting of 2'-O-alkyl-RNA, 2'-O-methyl-RNA, 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA, 2'-amino-DNA, 2'-fluoro-DNA, 2'-fluoro-ANA, and LNA nucleoside. 73. The oligonucleotide of configuration 71 or 72, wherein one or more modified nucleosides in the F and F' regions are LNA nucleosides. 74. The oligonucleotide of configuration 71 or 72, wherein all modified nucleosides in the F and F' regions are LNA nucleosides. 75. The oligonucleotide of configuration 74, wherein F and F' comprise LNA nucleosides. 76. An oligonucleotide of configuration 75-73, wherein all modified nucleosides in the F and F' regions are oxy-LNA nucleosides. 77. The oligonucleotide of configuration 73, wherein at least one F or F' region also comprises at least two 2'-sugar modified nucleosides independently selected from the group consisting of 2'-O-alkyl-RNA, 2'-O-methyl-RNA, 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA, 2'-amino-DNA, and 2'-fluoro-DNA. 78. An oligonucleotide of configuration 73-77, wherein the RNaseH-recruiting nucleosides in the G region are independently selected from DNA, alpha-L-LNA, C4' alkylated DNA and ANA, 2'F-ANA and UNA. 79. The oligonucleotide of configuration 78, wherein the nucleosides in the G region are DNA and / or alpha-L-LNA nucleosides. 80. The oligonucleotide of configuration 78 or 79, wherein the G region comprises at least 75% DNA nucleosides. 81. The oligonucleotide of configuration 80-1, wherein the oligonucleotide is capable of increasing UBE3A expression by at least 30% compared to control. 82. The oligonucleotide of configuration 81, wherein the level of SNHG14 transcript downstream of SNORD109B is reduced by at least 20% compared to a control. 83. The oligonucleotide of configuration 82-1, wherein the expression of SNORD115 is not significantly affected compared to a control. 84. The oligonucleotide of configuration 83-1, wherein the oligonucleotide is selected from CMP identity numbers 1_4 to 1_678. 85. The oligonucleotide of configuration 83-1, wherein the oligonucleotide is from the group comprising CMP identity number from the group comprising CMP identity number 4 _ 1 , 4 _ 2 , 5 _ 1 , 5 _ 2 , 6 _ 1 , 6 _ 2 , 7 _ 1 , 7 _ 2 , 8 _ 1 , 9 _ 1 , 10 _ 1 , 11 _ 1 , 11 _ 2 , 12 _ 1 , 12 _ 2 , 13 _ 1 , 13 _ 2 , 14 _ 1 , 15 _ 1 , 16 _ 1 , 17 _ 1 , 17 _ 2 , 18 _ 1 , 18 _ 2 , 19 _ 1 , 19 _ 2 , 20 _ 1 , 21 _ 1 , 22 _ 1 , 23 _ 1 , 23 _ 2 , 24 _ 1 , 25 _ 1 , 26 _ 1 , 26 _ 2 , 27 _ 1 , 28 _ 1 , 28 _ 2 , 29 _ 1 , 29 _ 2 , 30 _ 1 , 31 _ 1 , 31 _ 2 , 32 _ 1 , 33 _ 1 , 34 _ 1 , 34 _ 2 , 34 _ 3 , 34 _ 4 , 34 _ 5 , 34 _ 6 , 34 _ 7 , 35 _ 1 , 35 _ 2 , 36 _ 1 , 37 _ 1 , 38 _ 1 , 38 _ 2 , 38 _ 3 , 38 _ 4 , 38 _ 5 , 38 _ 6 , 39 _ 1 , 39 _ 2 , 39 _ 3 , 39 _ 4 , 39 _ 5 , 40 _ 1 , 40 _ 2 , 40 _ 3 , 40 _ 4 , 40 _ 5 , 40 _ 6 , 40 _ 7 , 40 _ 8 , 41 _ 1 , 42 _ 1 , 43 _ 1 , 44 _ 1 , 44 _ 2 , 45 _ 1 , 45 _ 2 , 46 _ 1 , 47 _ 1 , 48 _ 1 , 48 _ 2 , 48 _ 3 , 48 _ 4 , 48 _ 5 , 48 _ 6 , 48 _ 7 , 49 _ 1 , 50 _ 1 , 51 _ 1 , 52 _ 1 , 53 _ 1 , 53 _ 2 , 54 _ 1 , 54 _ 2 , 54 _ 3 , 55 _ 1 , 55 _ 2 , 56 _ 1 , 57 _ 1 , 58 _ 1 , 58 _ 2 , 58 _ 3 , 59 _ 1 , 59 _ 2 , 60 _ 1 , 60 _ 2 , 60 _ 3 ,61 _ 1 , 62 _ 1 , 63 _ 1 , 64 _ 1 , 64 _ 2 , 65 _ 1 , 66 _ 1 , 67 _ 1 , 68 _ 1 , 69 _ 1 , 69 _ 2 , 69 _ 3 , 70 _ 1 , 70 _ 2 , 70 _ 3 , 71 _ 1 , 72 _ 1 , 72 _ 2 , 73 _ 1 , 73 _ 2 , 73 _ 3 , 74 _ 1 , 74 _ 2 , 75 _ 1 , 75 _ 2 , 76 _ 1 , 77 _ 1 , 77 _ 2 , 77 _ 3 , 78 _ 1 , 79 _ 1 , 79 _ 2 , 79 _ 3 , 80 _ 1 , 80 _ 2 , 80 _ 3 , 81 _ 1 , 82 _ 1 , 82 _ 2 , 83 _ 1 , 83 _ 2 , 84 _ 1 , 84 _ 2 , 85 _ 1 , 85 _ 2 , 86 _ 1 , 87 _ 1 , 88 _ 1 , 88 _ 2 , 89 _ 1 , 90 _ 1 , 91 _ 1 , 92 _ 1 , 93 _ 1 , 94 _ 1 , 95 _ 1 , 95 _ 2 , 96 _ 1 , 96 _ 2 , 96 _ 3 , 97 _ 1 , 97 _ 2 , 97 _ 3 , 97 _ 4 , 98 _ 1 , 98 _ 2 , 98 _ 3 , 99 _ 1 , 99 _ 2 , 99 _ 3 , 99 _ 4 , 100 _ 1 , 100 _ 2 , 100 _ 3 , 101 _ 1 , 101 _ 2 , 101 _ 3 , 101 _ 4 , 102 _ 1 , 102 _ 2 , 102 _ 3 , 102 _ 4 , 103 _ 1 , 103 _ 2 , 103 _ 3 , 103 _ 4 , 104 _ 1 , 104 _ 2 , 104 _ 3 , 105 _ 1 , 105 _ 2 , 105 _ 3 , 105 _ 4 , 106 _ 1 , 106 _ 2 , 106 _ 3 , 106 _ 4 , 107 _ 1 , 107 _ 2 , 107 _ 3 , 107 _ 4 , 108 _ 1 , 108 _ 2 , 108 _ 3 , 108 _ 4 , 109 _ 1 , 109 _ 2 ,109 _ 3 , 109 _ 4 , 110 _ 1 , 110 _ 2 , 111 _ 1 , 111 _ 2 , 111 _ 3 , 112 _ 1 , 112 _ 2 , 113 _ 1 , 114 _ 1 , 115 _ 1 , 116 _ 1 , 117 _ 1 , 118 _ 1 , 119 _ 1 , 120 _ 1 , 120 _ 2 , 121 _ 1 , 122 _ 1 , 123 _ 1 , 124 _ 1 , 125 _ 1 , 126 _ 1 , 126 _ 2 , 127 _ 1 , 128 _ 1 , 128 _ 2 , 128 _ 3 , 128 _ 4 , 129 _ 1 , 129 _ 2 , 130 _ 1 , 131 _ 1 , 132 _ 1 , 132 _ 2 , 132 _ 3 , 133 _ 1 , 133 _ 2 , 133 _ 3 , 133 _ 4 , 134 _ 1 , 134 _ 2 , 135 _ 1 , 135 _ 2 , 136 _ 1 , 137 _ 1 , 138 _ 1 , 139 _ 1 , 140 _ 1 , 141 _ 1 , 142 _ 1 , 143 _ 1 , 144 _ 1 , 145 _ 1 , 145 _ 2 , 146 _ 1 , 146 _ 2 , 147 _ 1 , 148 _ 1 , 149 _ 1 , 150 _ 1 , 150 _ 2 , 151 _ 1 , 152 _ 1 , 153 _ 1 , 154 _ 1 , 155 _ 1 , 156 _ 1 , 157 _ 1 , 158 _ 1 , 159 _ 1 , 160 _ 1 , 161 _ 1 , 162 _ 1 , 163 _ 1 , 164 _ 1 , 165 _ 1 , 166 _ 1 , 167 _ 1 , 168 _ 1 , 169 _ 1 , 169 _ 10 , 169 _ 11 , 169 _ 12 , 169 _ 13 , 169 _ 14 , 169 _ 15 , 169 _ 16 , 169 _ 17 , 169 _ 18 , 169 _ 19 , 169 _ 2 , 169 _ 20 , 169 _ 21 , 169 _ 22 , 169 _ 23 , 169 _ 24 ,169 _ 25 , 169 _ 26 , 169 _ 27 , 169 _ 28 , 169 _ 29 , 169 _ 3 , 169 _ 30 , 169 _ 31 , 169 _ 32 , 169 _ 33 , 169 _ 34 , 169 _ 35 , 169 _ 36 , 169 _ 37 , 169 _ 38 , 169 _ 39 , 169 _ 4 , 169 _ 40 , 169 _ 41 , 169 _ 42 , 169 _ 43 , 169 _ 44 , 169 _ 45 , 169 _ 46 , 169 _ 47 , 169 _ 48 , 169 _ 49 , 169 _ 5 , 169 _ 50 , 169 _ 51 , 169 _ 52 , 169 _ 53 , 169 _ 54 , 169 _ 55 , 169 _ 56 , 169 _ 57 , 169 _ 6 , 169 _ 7 , 169 _ 8 , 169 _ 9 , 169 _ 58 , 169 _ 59 , 169 _ 60 , 169 _ 61 , 169 _ 62 , 170 _ 1 , 171 _ 1 , 172 _ 1 , 173 _ 1 , 174 _ 1 , 175 _ 1 , 176 _ 1 , 177 _ 1 , 178 _ 1 , 179 _ 1 , 180 _ 1 , 181 _ 1 , 182 _ 1 , 183 _ 1 , 184 _ 1 , 185 _ 1 , 186 _ 1 , 187 _ 1 , 188 _ 1 , 189 _ 1 , 190 _ 1 , 191 _ 1 , 192 _ 1 , 193 _ 1 , 194 _ 1 , 195 _ 1 , 196 _ 1 , 197 _ 1 , 198 _ 1 , 199 _ 1 , 200 _ 1 , 201 _ 1 , 202 _ 1 , 203 _ 1 , 204 _ 1 , 205 _ 1 , 206 _ 1 , 207 _ 1 , 208 _ 1 , 208 _ 2 , 208 _ 3 , 208 _ 4 , 208 _ 5 , 208 _ 6 , 208 _ 7 , 209 _ 1 , 209 _ 10 , 209 _ 2 , 209 _ 3 , 209 _ 4 , 209 _ 5 ,209 _ 6 , 209 _ 7 , 209 _ 8 , 209 _ 9 , 210 _ 1 , 211 _ 1 , 212 _ 1 , 213 _ 1 , 214 _ 1 , 215 _ 1 , 216 _ 1 , 217 _ 1 , 218 _ 1 , 219 _ 1 , 220 _ 1 , 221 _ 1 , 222 _ 1 , 223 _ 1 , 224 _ 1 , 225 _ 1 , 226 _ 1 , 227 _ 1 , 228 _ 1 , 229 _ 1 , 230 _ 1 , 231 _ 1 , 232 _ 1 , 233 _ 1 , 234 _ 1 , 235 _ 1 , 236 _ 1 , 236 _ 10 , 236 _ 11 , 236 _ 12 , 236 _ 13 , 236 _ 14 , 236 _ 15 , 236 _ 16 , 236 _ 2 , 236 _ 3 , 236 _ 4 , 236 _ 5 , 236 _ 6 , 236 _ 7 , 236 _ 8 , 236 _ 9 , 236 _ 17 , 236 _ 18 , 236 _ 19 , 236 _ 20 , 236 _ 21 , 237 _ 1 , 237 _ 10 , 237 _ 11 , 237 _ 12 , 237 _ 13 , 237 _ 14 , 237 _ 15 , 237 _ 16 , 237 _ 2 , 237 _ 3 , 237 _ 4 , 237 _ 5 , 237 _ 6 , 237 _ 7 , 237 _ 8 , 237 _ 9 , 237 _ 17 , 237 _ 18 , 237 _ 19 , 237 _ 20 , 237 _ 21 , 238 _ 1 , 239 _ 1 , 239 _ 10 , 239 _ 11 , 239 _ 12 , 239 _ 13 , 239 _ 14 , 239 _ 15 , 239 _ 16 , 239 _ 2 , 239 _ 3 , 239 _ 4 , 239 _ 5 , 239 _ 6 , 239 _ 7 , 239 _ 8 , 239 _ 9 , 239 _ 17 , 239 _ 18 , 239 _ 19 , 239 _ 20 , 239 _ 21 , 240 _ 1 , 241 _ 1 ,241 _ 10 , 241 _ 2 , 241 _ 3 , 241 _ 4 , 241 _ 5 , 241 _ 6 , 241 _ 7 , 241 _ 8 , 241 _ 9 , 241 _ 11 , 241 _ 12 , 241 _ 13 , 241 _ 14 , 241 _ 15 , 242 _ 1 , 243 _ 1 , 244 _ 1 , 244 _ 2 , 244 _ 3 , 244 _ 4 , 244 _ 5 , 245 _ 1 , 246 _ 1 , 247 _ 1 , 248 _ 1 , 249 _ 1 , 250 _ 1 , 251 _ 1 , 252 _ 1 , 253 _ 1 , 254 _ 1 , 255 _ 1 , 256 _ 1 , 257 _ 1 , 258 _ 1 , 259 _ 1 , 260 _ 1 , 261 _ 1 , 262 _ 1 , 263 _ 1 , 264 _ 1 , 265 _ 1 , 266 _ 1 , 267 _ 1 , 268 _ 1 , 269 _ 1 , 270 _ 1 , 271 _ 1 , 272 _ 1 , 273 _ 1 , 274 _ 1 , 275 _ 1 , 276 _ 1 , 277 _ 1 , 278 _ 1 , 279 _ 1 , 280 _ 1 , 281 _ 1 , 282 _ 1 , 283 _ 1 , 284 _ 1 , 285 _ 1 , 285 _ 2 , 285 _ 3 , 285 _ 4 , 285 _ 5 , 285 _ 6 , 285 _ 7 , 285 _ 8 , 285 _ 9 , 285 _ 10 , 285 _ 11 , 286 _ 1 , 287 _ 1 , 288 _ 1 , 289 _ 1 , 290 _ 1 , 291 _ 1 , 292 _ 1 , 293 _ 1 , 294 _ 1 , 295 _ 1 , 296 _ 1 , 297 _ 1 , 298 _ 1 , 299 _ 1 , 300 _ 1 , 301 _ 1 , 302 _ 1 , 303 _ 1 , 304 _ 1 , 304 _ 10 , 304 _ 2 , 304 _ 3 , 304 _ 4 , 304 _ 5 , 304 _ 6 , 304 _ 7 , 304 _ 8 ,304 _ 9 , 304 _ 11 , 304 _ 12 , 304 _ 13 , 304 _ 14 , 304 _ 15 , 305 _ 1 , 306 _ 1 , 307 _ 1 , 308 _ 1 , 309 _ 1 , 310 _ 1 , 311 _ 1 , 312 _ 1 , 313 _ 1 , 314 _ 1 , 315 _ 1 , 316 _ 1 , 317 _ 1 , 318 _ 1 , 319 _ 1 , 320 _ 1 , 321 _ 1 , 322 _ 1 , 323 _ 1 , 324 _ 1 , 325 _ 1 , 326 _ 1 , 327 _ 1 , 328 _ 1 , 329 _ 1 , 330 _ 1 , 331 _ 1 , 332 _ 1 , 333 _ 1 , 334 _ 1 , 335 _ 1 , 336 _ 1 , 337 _ 1 , 338 _ 1 , 339 _ 1 , 340 _ 1 , 341 _ 1 , 342 _ 1 , 343 _ 1 , 344 _ 1 , 345 _ 1 , 346 _ 1 , 347 _ 1 , 348 _ 1 , 349 _ 1 , 350 _ 1 , 351 _ 1 , 352 _ 1 , 353 _ 1 , 354 _ 1 , 355 _ 1 , 356 _ 1 , 357 _ 1 , 358 _ 1 , 359 _ 1 , 360 _ 1 , 361 _ 1 , 361 _ 10 , 361 _ 2 , 361 _ 3 , 361 _ 4 , 361 _ 5 , 361 _ 6 , 361 _ 7 , 361 _ 8 , 361 _ 9 , 362 _ 1 , 362 _ 10 , 362 _ 2 , 362 _ 3 , 362 _ 4 , 362 _ 5 , 362 _ 6 , 362 _ 7 , 362 _ 8 , 362 _ 9 , 363 _ 1 , 364 _ 1 , 365 _ 1 , 366 _ 1 , 367 _ 1 , 368 _ 1 , 369 _ 1 , 370 _ 1 , 371 _ 1 , 372 _ 1 , 373 _ 1 , 374 _ 1 , 375 _ 1 , 376 _ 1 , 377 _ 1 , 378 _ 1 , 379 _ 1 ,380 _ 1 , 381 _ 1 , 382 _ 1 , 383 _ 1 , 384 _ 1 , 385 _ 1 , 386 _ 1 , 387 _ 1 , 388 _ 1 , 389 _ 1 , 390 _ 1 , 391 _ 1 , 392 _ 1 , 393 _ 1 , 394 _ 1 , 395 _ 1 , 396 _ 1 , 397 _ 1 , 398 _ 1 , 399 _ 1 , 400 _ 1 , 401 _ 1 , 402 _ 1 , 403 _ 1 , 404 _ 1 , 405 _ 1 , 406 _ 1 , 407 _ 1 , 408 _ 1 , 409 _ 1 , 410 _ 1 , 411 _ 1 , 412 _ 1 , 413 _ 1 , 414 _ 1 , 415 _ 1 , 416 _ 1 , 417 _ 1 , 418 _ 1 , 419 _ 1 , 420 _ 1 , 421 _ 1 , 422 _ 1 , 423 _ 1 , 424 _ 1 , 425 _ 1 , 425 _ 10 , 425 _ 2 , 425 _ 3 , 425 _ 4 , 425 _ 5 , 425 _ 6 , 425 _ 7 , 425 _ 8 , 425 _ 9 , 426 _ 1 , 427 _ 1 , 428 _ 1 , 429 _ 1 , 430 _ 1 , 431 _ 1 , 432 _ 1 , 433 _ 1 , 434 _ 1 , 435 _ 1 , 436 _ 1 , 437 _ 1 , 438 _ 1 , 439 _ 1 , 440 _ 1 , 441 _ 1 , 442 _ 1 , 443 _ 1 , 444 _ 1 , 445 _ 1 , 446 _ 1 , 447 _ 1 , 448 _ 1 , 449 _ 1 , 450 _ 1 , 451 _ 1 , 452 _ 1 , 453 _ 1 , 454 _ 1 , 455 _ 1 , 456 _ 1 , 457 _ 1 , 458 _ 1 , 459 _ 1 , 460 _ 1 , 461 _ 1 , 462 _ 1 , 463 _ 1 , 464 _ 1 , 465 _ 1 , 466 _ 1 , 467 _ 1 , 468 _ 1 , 469 _ 1 , 470 _ 1 ,471 _ 1 , 472 _ 1 , 473 _ 1 , 474 _ 1 , 475 _ 1 , 476 _ 1 , 477 _ 1 , 478 _ 1 , 479 _ 1 , 480 _ 1 , 481 _ 1 , 482 _ 1 , 483 _ 1 , 484 _ 1 , 485 _ 1 , 486 _ 1 , 487 _ 1 , 488 _ 1 , 489 _ 1 , 490 _ 1 , 491 _ 1 , 492 _ 1 , 493 _ 1 , 494 _ 1 , 495 _ 1 , 496 _ 1 , 497 _ 1 , 498 _ 1 , 499 _ 1 , 500 _ 1 , 501 _ 1 , 502 _ 1 , 503 _ 1 , 504 _ 1 , 505 _ 1 , 506 _ 1 , 507 _ 1 , 508 _ 1 , 509 _ 1 , 510 _ 1 , 511 _ 1 , 512 _ 1 , 513 _ 1 , 514 _ 1 , 515 _ 1 , 516 _ 1 , 517 _ 1 , 518 _ 1 , 519 _ 1 , 520 _ 1 , 521 _ 1 , 522 _ 1 , 523 _ 1 , 524 _ 1 , 525 _ 1 , 526 _ 1 , 527 _ 1 , 528 _ 1 , 529 _ 1 , 530 _ 1 , 531 _ 1 , 532 _ 1 , 533 _ 1 , 534 _ 1 , 535 _ 1 , 536 _ 1 , 537 _ 1 , 538 _ 1 , 539 _ 1 , 540 _ 1 , 541 _ 1 , 542 _ 1 , 543 _ 1 , 544 _ 1 , 545 _ 1 , 546 _ 1 , 547 _ 1 , 548 _ 1 , 549 _ 1 , 550 _ 1 , 551 _ 1 , 552 _ 1 , 553 _ 1 , 554 _ 1 , 555 _ 1 , 556 _ 1 , 557 _ 1 , 558 _ 1 , 559 _ 1 , 560 _ 1 , 561 _ 1 , 562 _ 1 , 563 _ 1 , 564 _ 1 , 565 _ 1 , 566 _ 1 , 567 _ 1 , 568 _ 1 , 569 _ 1 , 570 _ 1 ,570 _ 2 , 570 _ 3 , 570 _ 4 , 570 _ 5 , 570 _ 6 , 570 _ 7 , 570 _ 8 , 570 _ 9 , 570 _ 10 , 570 _ 11 , 570 _ 12 , 570 _ 13 , 570 _ 14 , 571 _ 1 , 571 _ 2 , 571 _ 3 , 571 _ 4 , 571 _ 5 , 571 _ 6 , 571 _ 7 , 571 _ 8 , 571 _ 9 , 571 _ 10 , 571 _ 11 , 571 _ 12 , 571 _ 13 , 571 _ 14 , 572 _ 1 , 572 _ 2 , 572 _ 3 , 572 _ 4 , 572 _ 5 , 572 _ 6 , 572 _ 7 , 572 _ 8 , 572 _ 9 , 572 _ 10 , 572 _ 11 , 572 _ 12 , 572 _ 13 , 572 _ 14 , 573 _ 1 , 573 _ 2 , 573 _ 3 , 573 _ 4 , 573 _ 5 , 573 _ 6 , 573 _ 7 , 573 _ 8 , 573 _ 9 , 573 _ 10 , 573 _ 11 , 573 _ 12 , 573 _ 13 , 573 _ 14 , 574 _ 1 , 574 _ 2 , 574 _ 3 , 574 _ 4 , 574 _ 5 , 574 _ 6 , 574 _ 7 , 574 _ 8 , 574 _ 9 , 574 _ 10 , 574 _ 11 , 574 _ 12 , 574 _ 13 , 574 _ 14 , 575 _ 1 , 575 _ 2 , 575 _ 3 , 575 _ 4 , 575 _ 5 , 575 _ 6 , 575 _ 7 , 575 _ 8 , 575 _ 9 , 575 _ 10 , 575 _ 11 , 575 _ 12 , 575 _ 13 , 575 _ 14 , 576 _ 1 , 576 _ 2 , 576 _ 3 , 576 _ 4 , 576 _ 5 , 576 _ 6 , 576 _ 7 , 576 _ 8 , 576 _ 9 , 576 _ 10 , 576 _ 11 , 576 _ 12 , 576 _ 13 ,576 _ 14 , 577 _ 1 , 577 _ 2 , 577 _ 3 , 577 _ 4 , 577 _ 5 , 577 _ 6 , 577 _ 7 , 577 _ 8 , 577 _ 9 , 577 _ 10 , 577 _ 11 , 577 _ 12 , 577 _ 13 , 577 _ 14 , 578 _ 1 , 578 _ 2 , 578 _ 3 , 578 _ 4 , 578 _ 5 , 578 _ 6 , 578 _ 7 , 578 _ 8 , 578 _ 9 , 579 _ 1 , 579 _ 2 , 579 _ 3 , 579 _ 4 , 579 _ 5 , 579 _ 6 , 579 _ 7 , 579 _ 8 , 579 _ 9 , 580 _ 1 , 580 _ 2 , 580 _ 3 , 580 _ 4 , 580 _ 5 , 580 _ 6 , 580 _ 7 , 580 _ 8 , 580 _ 9 , 581 _ 1 , 581 _ 2 , 581 _ 3 , 581 _ 4 , 581 _ 5 , 581 _ 6 , 581 _ 7 , 581 _ 8 , 581 _ 9 , 582 _ 1 , 582 _ 2 , 582 _ 3 , 582 _ 4 , 582 _ 5 , 582 _ 6 , 582 _ 7 , 582 _ 8 , 582 _ 9 , 583 _ 1 , 583 _ 2 , 583 _ 3 , 583 _ 4 , 583 _ 5 , 583 _ 6 , 583 _ 7 , 583 _ 8 , 583 _ 9 , 584 _ 1 , 584 _ 2 , 584 _ 3 , 584 _ 4 , 584 _ 5 , 584 _ 6 , 584 _ 7 , 584 _ 8 , 585 _ 1 , 585 _ 2 , 585 _ 3 , 585 _ 4 , 585 _ 5 , 585 _ 6 , 585 _ 7 , 585 _ 8 , 585 _ 9 , 585 _ 10 , 585 _ 11 , 585 _ 12 , 585 _ 13 , 585 _ 14 , 586 _ 1 , 586 _ 2 , 586 _ 3 , 586 _ 4 , 586 _ 5 , 586 _ 6 , 586 _ 7 , 586 _ 8 ,586 _ 9 , 586 _ 10 , 586 _ 11 , 586 _ 12 , 586 _ 13 , 586 _ 14 , 587 _ 1 , 587 _ 2 , 587 _ 3 , 587 _ 4 , 587 _ 5 , 587 _ 6 , 587 _ 7 , 587 _ 8 , 587 _ 9 , 587 _ 10 , 587 _ 11 , 587 _ 12 , 587 _ 13 , 587 _ 14 , 588 _ 1 , 588 _ 2 , 588 _ 3 , 588 _ 4 , 588 _ 5 , 588 _ 6 , 588 _ 7 , 588 _ 8 , 588 _ 9 , 588 _ 10 , 588 _ 11 , 588 _ 12 , 588 _ 13 , 588 _ 14 , 589 _ 1 , 589 _ 2 , 589 _ 3 , 589 _ 4 , 589 _ 5 , 589 _ 6 , 589 _ 7 , 589 _ 8 , 589 _ 9 , 589 _ 10 , 589 _ 11 , 589 _ 12 , 589 _ 13 , 589 _ 14 , 590 _ 1 , 590 _ 10 , 590 _ 11 , 590 _ 12 , 590 _ 13 , 590 _ 14 , 590 _ 15 , 590 _ 2 , 590 _ 3 , 590 _ 4 , 590 _ 5 , 590 _ 6 , 590 _ 7 , 590 _ 8 , 590 _ 9 , 590 _ 16 , 590 _ 17 , 590 _ 18 , 590 _ 19 , 590 _ 20 , 591 _ 1 , 591 _ 2 , 592 _ 1 , 592 _ 2 , 592 _ 3 , 592 _ 4 , 592 _ 5 , 592 _ 6 , 592 _ 7 , 592 _ 8 , 592 _ 9 , 592 _ 10 , 592 _ 11 , 592 _ 12 , 592 _ 13 , 592 _ 14 , 593 _ 1 , 593 _ 2 , 593 _ 3 , 593 _ 4 , 594 _ 1 , 594 _ 2 , 594 _ 3 , 594 _ 4 , 595 _ 1 , 595 _ 2 , 595 _ 3 , 595 _ 4 ,596 _ 1 , 596 _ 2 , 596 _ 3 , 596 _ 4 , 597 _ 1 , 597 _ 2 , 597 _ 3 , 597 _ 4 , 598 _ 1 , 598 _ 2 , 598 _ 3 , 598 _ 4 , 599 _ 1 , 599 _ 2 , 599 _ 3 , 599 _ 4 , 600 _ 1 , 600 _ 2 , 600 _ 3 , 600 _ 4 , 601 _ 1 , 601 _ 2 , 601 _ 3 , 601 _ 4 , 602 _ 1 , 602 _ 2 , 602 _ 3 , 602 _ 4 , 603 _ 1 , 603 _ 2 , 603 _ 3 , 603 _ 4 , 604 _ 1 , 604 _ 2 , 604 _ 3 , 604 _ 4 , 605 _ 1 , 605 _ 2 , 605 _ 3 , 605 _ 4 , 606 _ 1 , 606 _ 2 , 606 _ 3 , 606 _ 4 , 607 _ 1 , 607 _ 2 , 607 _ 3 , 607 _ 4 , 608 _ 1 , 608 _ 2 , 608 _ 3 , 608 _ 4 , 608 _ 5 , 608 _ 6 , 608 _ 7 , 608 _ 8 , 608 _ 9 , 609 _ 1 , 609 _ 2 , 609 _ 3 , 609 _ 4 , 609 _ 5 , 609 _ 6 , 609 _ 7 , 609 _ 8 , 609 _ 9 , 610 _ 1 , 610 _ 2 , 610 _ 3 , 610 _ 4 , 610 _ 5 , 610 _ 6 , 610 _ 7 , 610 _ 8 , 610 _ 9 , 611 _ 1 , 611 _ 2 , 611 _ 3 , 611 _ 4 , 611 _ 5 , 611 _ 6 , 611 _ 7 , 611 _ 8 , 611 _ 9 , 612 _ 1 , 612 _ 2 , 612 _ 3 , 612 _ 4 , 612 _ 5 , 612 _ 6 , 612 _ 7 , 612 _ 8 , 612 _ 9 , 613 _ 1 , 613 _ 2 , 613 _ 3 , 613 _ 4 , 613 _ 5 , 613 _ 6 , 613 _ 7 ,613 _ 8 , 613 _ 9 , 613 _ 10 , 614 _ 1 , 614 _ 2 , 614 _ 3 , 614 _ 4 , 614 _ 5 , 614 _ 6 , 614 _ 7 , 614 _ 8 , 614 _ 9 , 614 _ 10 , 615 _ 1 , 615 _ 2 , 615 _ 3 , 615 _ 4 , 615 _ 5 , 615 _ 6 , 615 _ 7 , 615 _ 8 , 615 _ 9 , 615 _ 10 , 616 _ 1 , 616 _ 2 , 616 _ 3 , 616 _ 4 , 616 _ 5 , 616 _ 6 , 616 _ 7 , 616 _ 8 , 616 _ 9 , 616 _ 10 , 617 _ 1 , 617 _ 2 , 617 _ 3 , 617 _ 4 , 617 _ 5 , 617 _ 6 , 617 _ 7 , 617 _ 8 , 617 _ 9 , 617 _ 10 , 618 _ 1 , 618 _ 2 , 618 _ 3 , 618 _ 4 , 618 _ 5 , 618 _ 6 , 618 _ 7 , 618 _ 8 , 618 _ 9 , 618 _ 10 , 619 _ 1 , 619 _ 2 , 619 _ 3 , 619 _ 4 , 619 _ 5 , 619 _ 6 , 619 _ 7 , 619 _ 8 , 619 _ 9 , 619 _ 10 , 620 _ 1 , 620 _ 2 , 620 _ 3 , 620 _ 4 , 620 _ 5 , 620 _ 6 , 620 _ 7 , 620 _ 8 , 620 _ 9 , 620 _ 10 , 621 _ 1 , 621 _ 2 , 621 _ 3 , 621 _ 4 , 621 _ 5 , 621 _ 6 , 621 _ 7 , 621 _ 8 , 621 _ 9 , 621 _ 10 , 621 _ 11 , 622 _ 1 , 622 _ 2 , 622 _ 3 , 622 _ 4 , 622 _ 5 , 622 _ 6 , 622 _ 7 , 622 _ 8 , 622 _ 9 , 622 _ 10 , 623 _ 1 , 623 _ 2 , 623 _ 3 , 623 _ 4 , 623 _ 5 ,623 _ 6 , 623 _ 7 , 623 _ 8 , 623 _ 9 , 623 _ 10 , 624 _ 1 , 624 _ 2 , 624 _ 3 , 624 _ 4 , 624 _ 5 , 624 _ 6 , 624 _ 7 , 624 _ 8 , 624 _ 9 , 624 _ 10 , 625 _ 1 , 625 _ 2 , 625 _ 3 , 625 _ 4 , 625 _ 5 , 625 _ 6 , 625 _ 7 , 625 _ 8 , 625 _ 9 , 625 _ 10 , 625 _ 11 , 625 _ 12 , 625 _ 13 , 625 _ 14 , 626 _ 1 , 626 _ 2 , 626 _ 3 , 626 _ 4 , 626 _ 5 , 626 _ 6 , 626 _ 7 , 626 _ 8 , 626 _ 9 , 626 _ 10 , 626 _ 11 , 626 _ 12 , 626 _ 13 , 626 _ 14 , 627 _ 1 , 627 _ 2 , 627 _ 3 , 627 _ 4 , 627 _ 5 , 627 _ 6 , 627 _ 7 , 627 _ 8 , 627 _ 9 , 627 _ 10 , 627 _ 11 , 627 _ 12 , 627 _ 13 , 627 _ 14 , 628 _ 1 , 628 _ 2 , 628 _ 3 , 628 _ 4 , 628 _ 5 , 628 _ 6 , 628 _ 7 , 628 _ 8 , 628 _ 9 , 628 _ 10 , 628 _ 11 , 628 _ 12 , 628 _ 13 , 628 _ 14 , 629 _ 1 , 629 _ 10 , 629 _ 11 , 629 _ 2 , 629 _ 3 , 629 _ 4 , 629 _ 5 , 629 _ 6 , 629 _ 7 , 629 _ 8 , 629 _ 9 , 629 _ 12 , 629 _ 13 , 629 _ 14 , 629 _ 15 , 629 _ 16 , 630 _ 1 , 630 _ 2 , 630 _ 3 , 631 _ 1 , 631 _ 10 , 631 _ 2 , 631 _ 3 , 631 _ 4 , 631 _ 5 , 631 _ 6 ,631 _ 7 , 631 _ 8 , 631 _ 9 , 631 _ 11 , 631 _ 12 , 631 _ 13 , 631 _ 14 , 631 _ 15 , 632 _ 1 , 632 _ 2 , 632 _ 3 , 632 _ 4 , 632 _ 5 , 632 _ 6 , 632 _ 7 , 632 _ 8 , 632 _ 9 , 632 _ 10 , 632 _ 11 , 632 _ 12 , 632 _ 13 , 632 _ 14 , 633 _ 1 , 633 _ 2 , 633 _ 3 , 633 _ 4 , 633 _ 5 , 633 _ 6 , 633 _ 7 , 633 _ 8 , 633 _ 9 , 634 _ 1 , 634 _ 2 , 634 _ 3 , 634 _ 4 , 634 _ 5 , 634 _ 6 , 634 _ 7 , 634 _ 8 , 634 _ 9 , 635 _ 1 , 635 _ 2 , 635 _ 3 , 635 _ 4 , 635 _ 5 , 635 _ 6 , 635 _ 7 , 635 _ 8 , 635 _ 9 , 636 _ 1 , 636 _ 2 , 636 _ 3 , 636 _ 4 , 636 _ 5 , 636 _ 6 , 636 _ 7 , 636 _ 8 , 636 _ 9 , 637 _ 1 , 637 _ 2 , 637 _ 3 , 637 _ 4 , 637 _ 5 , 637 _ 6 , 637 _ 7 , 637 _ 8 , 637 _ 9 , 638 _ 1 , 638 _ 2 , 638 _ 3 , 638 _ 4 , 638 _ 5 , 638 _ 6 , 638 _ 7 , 638 _ 8 , 638 _ 9 , 638 _ 10 , 638 _ 11 , 638 _ 12 , 638 _ 13 , 638 _ 14 , 639 _ 1 , 639 _ 2 , 639 _ 3 , 639 _ 4 , 639 _ 5 , 639 _ 6 , 639 _ 7 , 639 _ 8 , 639 _ 9 , 639 _ 10 , 639 _ 11 , 639 _ 12 , 639 _ 13 , 639 _ 14 , 640 _ 1 , 640 _ 2 , 640 _ 3 ,640 _ 4 , 640 _ 5 , 640 _ 6 , 640 _ 7 , 640 _ 8 , 640 _ 9 , 640 _ 10 , 640 _ 11 , 640 _ 12 , 640 _ 13 , 640 _ 14 , 641 _ 1 , 641 _ 2 , 641 _ 3 , 641 _ 4 , 641 _ 5 , 641 _ 6 , 641 _ 7 , 641 _ 8 , 641 _ 9 , 642 _ 1 , 642 _ 10 , 642 _ 11 , 642 _ 12 , 642 _ 13 , 642 _ 14 , 642 _ 15 , 642 _ 16 , 642 _ 17 , 642 _ 2 , 642 _ 3 , 642 _ 4 , 642 _ 5 , 642 _ 6 , 642 _ 7 , 642 _ 8 , 642 _ 9 , 642 _ 18 , 642 _ 19 , 642 _ 20 , 642 _ 21 , 642 _ 22 , 643 _ 1 , 644 _ 1 , 644 _ 2 , 644 _ 3 , 644 _ 4 , 644 _ 5 , 644 _ 6 , 645 _ 1 , 645 _ 2 , 645 _ 3 , 645 _ 4 , 645 _ 5 , 645 _ 6 , 645 _ 7 , 645 _ 8 , 645 _ 9 , 645 _ 10 , 646 _ 1 , 646 _ 10 , 646 _ 11 , 646 _ 12 , 646 _ 13 , 646 _ 14 , 646 _ 15 , 646 _ 16 , 646 _ 17 , 646 _ 18 , 646 _ 19 , 646 _ 2 , 646 _ 3 , 646 _ 4 , 646 _ 5 , 646 _ 6 , 646 _ 7 , 646 _ 8 , 646 _ 9 , 646 _ 20 , 646 _ 21 , 646 _ 22 , 646 _ 23 , 646 _ 24 , 647 _ 1 , 648 _ 1 , 649 _ 1 , 650 _ 1 , 651 _ 1 , 652 _ 1 , 653 _ 1 , 654 _ 1 , 655 _ 1 , 656 _ 1 , 657 _ 1 , 658 _ 1 , 659 _ 1 ,660 _ 1 , 661 _ 1 , 662 _ 1 , 663 _ 1 , 664 _ 1 , 665 _ 1 , 666 _ 1 , 667 _ 1 , 668 _ 1 , 669 _ 1 , 670 _ 1 , 671 _ 1 , 672 _ 1 , 673 _ 1 , 674 _ 1 , 675 _ 1 , 676 _ 1 , 677 _ 1 , 678 _ 1 , 679 _ 1 , 679 _ 2 , 679 _ 3 , 679 _ 4 , 679 _ 5 , 680 _ 1 , 680 _ 2 , 680 _ 3 , 680 _ 4 , 680 _ 5 , 681 _ 1 , 681 _ 2 , 681 _ 3 , 681 _ 4 , 681 _ 5 , 682 _ 1 , 682 _ 2 , 682 _ 3 , 682 _ 4 , 682 _ 5 , 683 _ 1 , 683 _ 2 , 683 _ 3 , 683 _ 4 , 683 _ 5 , 684 _ 1 , 684 _ 2 , 684 _ 3 , 684 _ 4 , 684 _ 5 , 685 _ 1 , 685 _ 2 , 685 _ 3 , 685 _ 4 , 685 _ 5 , 686 _ 1 , 686 _ 2 , 686 _ 3 , 686 _ 4 , 686 _ 5 , 687 _ 1 , 687 _ 2 , 687 _ 3 , 687 _ 4 , 687 _ 5 , 688 _ 1 , 688 _ 2 , 688 _ 3 , 688 _ 4 , 688 _ 5 , 689 _ 1 , 689 _ 2 , 689 _ 3 , 689 _ 4 , 689 _ 5 , 690 _ 1 , 690 _ 2 , 690 _ 3 , 690 _ 4 , 690 _ 5 , 691 _ 1 , 691 _ 2 , 692 _ 1 , 692 _ 2 , 692 _ 3 , 692 _ 4 , 692 _ 5 , 693 _ 1 , 693 _ 2 , 693 _ 3 , 693 _ 4 , 693 _ 5 , 694 _ 1 , 694 _ 2 , 694 _ 3 , 694 _ 4 , 694 _ 5 , 695 _ 1 , 695 _ 2 , 695 _ 3 , 695 _ 4 ,695 _ 5 , 696 _ 1 , 696 _ 2 , 696 _ 3 , 696 _ 4 , 696 _ 5 , 697 _ 1 , 697 _ 2 , 697 _ 3 , 697 _ 4 , 697 _ 5 , 698 _ 1 , 698 _ 2 , 698 _ 3 , 698 _ 4 , 698 _ 5 , 699 _ 1 , 699 _ 2 , 699 _ 3 , 699 _ 4 , 699 _ 5 , 700 _ 1 , 700 _ 2 , 700 _ 3 , 700 _ 4 , 700 _ 5 , 701 _ 1 , 701 _ 2 , 701 _ 3 , 701 _ 4 , 701 _ 5 , 702 _ 1 , 702 _ 2 , 702 _ 3 , 702 _ 4 , 702 _ 5 , 703 _ 1 , 703 _ 2 , 703 _ 3 , 703 _ 4 , 703 _ 5 , 704 _ 1 , 704 _ 2 , 704 _ 3 , 704 _ 4 , 704 _ 5 , 705 _ 1 , 705 _ 2 , 705 _ 3 , 705 _ 4 , 705 _ 5 , 706 _ 1 , 706 _ 2 , 706 _ 3 , 706 _ 4 , 706 _ 5 , 707 _ 1 , 707 _ 2 , 707 _ 3 , 707 _ 4 , 707 _ 5 , 708 _ 1 , 708 _ 2 , 708 _ 3 , 708 _ 4 , 708 _ 5 , 709 _ 1 , 709 _ 2 , 709 _ 3 , 709 _ 4 , 709 _ 5 , 710 _ 1 , 710 _ 2 , 710 _ 3 , 710 _ 4 , 710 _ 5 , 711 _ 1 , 711 _ 2 , 711 _ 3 , 711 _ 4 , 711 _ 5 , 712 _ 1 , 712 _ 2 , 712 _ 3 , 712 _ 4 , 712 _ 5 , 713 _ 1 , 713 _ 2 , 713 _ 3 , 713 _ 4 , 713 _ 5 , 714 _ 1 , 714 _ 2 , 714 _ 3 , 714 _ 4 , 714 _ 5 , 715 _ 1 , 715 _ 2 , 715 _ 3 , 715 _ 4 ,715 _ 5 , 716 _ 1 , 716 _ 2 , 716 _ 3 , 716 _ 4 , 716 _ 5 , 717 _ 1 , 717 _ 2 , 717 _ 3 , 717 _ 4 , 717 _ 5 , 718 _ 1 , 718 _ 2 , 719 _ 1 , 719 _ 2 , 719 _ 3 , 719 _ 4 , 719 _ 5 , 720 _ 1 , 720 _ 2 , 720 _ 3 , 720 _ 4 , 720 _ 5 , 721 _ 1 , 721 _ 2 , 721 _ 3 , 721 _ 4 , 721 _ 5 , 722 _ 1 , 722 _ 2 , 722 _ 3 , 722 _ 4 , 722 _ 5 , 723 _ 1 , 723 _ 2 , 723 _ 3 , 723 _ 4 , 723 _ 5 , 724 _ 1 , 724 _ 2 , 724 _ 3 , 724 _ 4 , 724 _ 5 , 725 _ 1 , 725 _ 2 , 725 _ 3 , 725 _ 4 , 725 _ 5 , 726 _ 1 , 726 _ 2 , 726 _ 3 , 726 _ 4 , 726 _ 5 , 727 _ 1 , 727 _ 2 , 727 _ 3 , 727 _ 4 , 727 _ 5 , 728 _ 1 , 728 _ 2 , 728 _ 3 , 728 _ 4 , 728 _ 5 , 729 _ 1 , 729 _ 2 , 729 _ 3 , 729 _ 4 , 729 _ 5 , 730 _ 1 , 730 _ 2 , 730 _ 3 , 730 _ 4 , 730 _ 5 , 731 _ 1 , 731 _ 2 , 731 _ 3 , 731 _ 4 , 731 _ 5 , 732 _ 1 , 732 _ 2 , 732 _ 3 , 732 _ 4 , 732 _ 5 , 733 _ 1 , 733 _ 2 , 733 _ 3 , 733 _ 4 , 733 _ 5 , 734 _ 1 , 734 _ 2 , 734 _ 3 , 734 _ 4 , 734 _ 5 , 735 _ 1 , 735 _ 2 , 735 _ 3 , 735 _ 4 , 735 _ 5 , 736 _ 1 , 736 _ 2 ,736 _ 3 , 736 _ 4 , 736 _ 5 , 737 _ 1 , 737 _ 2 , 737 _ 3 , 737 _ 4 , 737 _ 5 , 738 _ 1 , 738 _ 2 , 738 _ 3 , 738 _ 4 , 738 _ 5 , 738 _ 6 , 739 _ 1 , 739 _ 2 , 739 _ 3 , 739 _ 4 , 739 _ 5 , 740 _ 1 , 740 _ 2 , 740 _ 3 , 740 _ 4 , 740 _ 5 , 741 _ 1 , 741 _ 2 , 741 _ 3 , 741 _ 4 , 741 _ 5 , 742 _ 1 , 742 _ 2 , 742 _ 3 , 743 _ 1 , 743 _ 2 , 743 _ 3 , 743 _ 4 , 743 _ 5 , 744 _ 1 , 744 _ 2 , 744 _ 3 , 744 _ 4 , 744 _ 5 , 745 _ 1 , 745 _ 2 , 745 _ 3 , 745 _ 4 , 745 _ 5 , 746 _ 1 , 746 _ 2 , 746 _ 3 , 747 _ 1 , 747 _ 2 , 747 _ 3 , 747 _ 4 , 747 _ 5 , 748 _ 1 , 748 _ 2 , 748 _ 3 , 748 _ 4 , 748 _ 5 , 749 _ 1 , 749 _ 2 , 749 _ 3 , 749 _ 4 , 749 _ 5 , 750 _ 1 , 750 _ 2 , 750 _ 3 , 750 _ 4 , 751 _ 1 , 751 _ 2 , 751 _ 3 , 751 _ 4 , 751 _ 5 , 752 _ 1 , 752 _ 2 , 752 _ 3 , 752 _ 4 , 752 _ 5 , 753 _ 1 , 753 _ 2 , 753 _ 3 , 753 _ 4 , 753 _ 5 , 754 _ 1 , 754 _ 2 , 754 _ 3 , 754 _ 4 , 754 _ 5 , 755 _ 1 , 755 _ 2 , 755 _ 3 , 755 _ 4 , 755 _ 5 , 756 _ 1 , 756 _ 2 , 756 _ 3 , 756 _ 4 , 756 _ 5 , 757 _ 1 ,757 _ 2 , 757 _ 3 , 757 _ 4 , 757 _ 5 , 758 _ 1 , 758 _ 2 , 758 _ 3 , 758 _ 4 , 758 _ 5 , 759 _ 1 , 759 _ 2 , 759 _ 3 , 759 _ 4 , 759 _ 5 , 760 _ 1 , 760 _ 2 , 760 _ 3 , 760 _ 4 , 760 _ 5 , 761 _ 1 , 761 _ 2 , 761 _ 3 , 761 _ 4 , 761 _ 5 , 762 _ 1 , 762 _ 2 , 762 _ 3 , 762 _ 4 , 762 _ 5 , 763 _ 1 , 763 _ 2 , 763 _ 3 , 763 _ 4 , 763 _ 5 , 764 _ 1 , 764 _ 2 , 764 _ 3 , 764 _ 4 , 764 _ 5 , 765 _ 1 , 765 _ 2 , 765 _ 3 , 765 _ 4 , 765 _ 5 , 766 _ 1 , 766 _ 2 , 766 _ 3 , 766 _ 4 , 766 _ 5 , 767 _ 1 , 767 _ 2 , 767 _ 3 , 767 _ 4 , 767 _ 5 , 768 _ 1 , 768 _ 2 , 768 _ 3 , 768 _ 4 , 768 _ 5 , 769 _ 1 , 769 _ 2 , 769 _ 3 , 769 _ 4 , 769 _ 5 , 770 _ 1 , 770 _ 2 , 770 _ 3 , 770 _ 4 , 770 _ 5 , 771 _ 1 , 771 _ 2 , 771 _ 3 , 771 _ 4 , 771 _ 5 , 772 _ 1 , 772 _ 2 , 772 _ 3 , 772 _ 4 , 772 _ 5 , 773 _ 1 , 773 _ 2 , 773 _ 3 , 773 _ 4 , 773 _ 5 , 774 _ 1 , 774 _ 2 , 774 _ 3 , 774 _ 4 , 774 _ 5 , 775 _ 1 , 775 _ 2 , 775 _ 3 , 775 _ 4 , 775 _ 5 , 776 _ 1 , 776 _ 2 , 776 _ 3 , 776 _ 4 , 776 _ 5 , 777 _ 1 ,777 _ 2 , 777 _ 3 , 777 _ 4 , 777 _ 5 , 778 _ 1 , 778 _ 2 , 778 _ 3 , 778 _ 4 , 778 _ 5 , 779 _ 1 , 779 _ 2 , 779 _ 3 , 779 _ 4 , 779 _ 5 , 780 _ 1 , 780 _ 2 , 780 _ 3 , 780 _ 4 , 780 _ 5 , 781 _ 1 , 782 _ 1 , 782 _ 2 , 782 _ 3 , 782 _ 4 , 782 _ 5 , 783 _ 1 , 783 _ 2 , 783 _ 3 , 783 _ 4 , 783 _ 5 , 784 _ 1 , 784 _ 2 , 784 _ 3 , 784 _ 4 , 784 _ 5 , 785 _ 1 , 786 _ 1 , 786 _ 2 , 786 _ 3 , 786 _ 4 , 786 _ 5 , 787 _ 1 , 787 _ 2 , 787 _ 3 , 787 _ 4 , 787 _ 5 , 788 _ 1 , 788 _ 2 , 788 _ 3 , 788 _ 4 , 788 _ 5 , 789 _ 1 , 789 _ 2 , 789 _ 3 , 789 _ 4 , 789 _ 5 , 790 _ 1 , 790 _ 2 , 790 _ 3 , 790 _ 4 , 790 _ 5 , 791 _ 1 , 791 _ 2 , 791 _ 3 , 791 _ 4 , 791 _ 5 , 792 _ 1 , 792 _ 2 , 792 _ 3 , 792 _ 4 , 792 _ 5 , 793 _ 1 , 793 _ 2 , 793 _ 3 , 793 _ 4 , 793 _ 5 , 794 _ 1 , 794 _ 2 , 794 _ 3 , 794 _ 4 , 794 _ 5 , 795 _ 1 , 795 _ 2 , 795 _ 3 , 795 _ 4 , 795 _ 5 , 796 _ 1 , 796 _ 2 , 796 _ 3 , 796 _ 4 , 796 _ 5 , 797 _ 1 , 797 _ 2 , 797 _ 3 , 797 _ 4 , 797 _ 5 , 798 _ 1 , 798 _ 2 , 798 _ 3 , 798 _ 4 ,798 _ 5 , 799 _ 1 , 799 _ 2 , 799 _ 3 , 799 _ 4 , 799 _ 5 , 800 _ 1 , 800 _ 2 , 800 _ 3 , 800 _ 4 , 800 _ 5 , 801 _ 1 , 801 _ 2 , 801 _ 3 , 801 _ 4 , 801 _ 5 , 802 _ 1 , 802 _ 2 , 802 _ 3 , 802 _ 4 , 802 _ 5 , 803 _ 1 , 803 _ 2 , 803 _ 3 , 803 _ 4 , 803 _ 5 , 804 _ 1 , 804 _ 2 , 804 _ 3 , 804 _ 4 , 804 _ 5 , 805 _ 1 , 805 _ 2 , 805 _ 3 , 805 _ 4 , 805 _ 5 , 806 _ 1 , 806 _ 2 , 806 _ 3 , 806 _ 4 , 806 _ 5 , 807 _ 1 , 807 _ 2 , 807 _ 3 , 807 _ 4 , 807 _ 5 , 808 _ 1 , 808 _ 2 , 808 _ 3 , 808 _ 4 , 808 _ 5 , 809 _ 1 , 809 _ 2 , 809 _ 3 , 809 _ 4 , 809 _ 5 , 810 _ 1 , 810 _ 2 , 810 _ 3 , 810 _ 4 , 810 _ 5 , 811 _ 1 , 811 _ 2 , 811 _ 3 , 811 _ 4 , 811 _ 5 , 812 _ 1 , 812 _ 2 , 812 _ 3 , 812 _ 4 , 812 _ 5 , 813 _ 1 , 813 _ 2 , 813 _ 3 , 813 _ 4 , 813 _ 5 , 814 _ 1 , 814 _ 2 , 814 _ 3 , 814 _ 4 , 814 _ 5 , 815 _ 1 , 815 _ 2 , 815 _ 3 , 815 _ 4 , 815 _ 5 , 816 _ 1 , 816 _ 2 , 816 _ 3 , 816 _ 4 , 816 _ 5 , 816 _ 6 , 817 _ 1 and 818 _ 1, It is selected. 86. The oligonucleotide of configuration 85, wherein the oligonucleotide is selected from CMP ID No.: 1_155 to 1_165. 87. The oligonucleotide of configuration 85, wherein the oligonucleotide is selected from CMP identity number: 52_169, 50_169 or 56_169. 88. The oligonucleotide of configuration 85, wherein the oligonucleotide is selected from CMP identity numbers: 1_172, 1_272, 7_572, 6_572, 5_572. 89. The oligonucleotide of configuration 85, wherein the oligonucleotide is selected from CMP identity number: 1_175. 90. The oligonucleotide of configuration 85, wherein the oligonucleotide is selected from CMP ID No.: 1_178. 91. The oligonucleotide of configuration 85, wherein the oligonucleotide is selected from CMP identity number: 8_573, 1_186 or 1_187. 92. The oligonucleotide of configuration 85, wherein the oligonucleotide is selected from CMP ID No.: 1_186. 93. The oligonucleotide of configuration 85, wherein the oligonucleotide is selected from CMP identity numbers: 1_200, 1_204, 1_206, , 2_35, or , 1_209. 94. The oligonucleotide of configuration 85, wherein the oligonucleotide is selected from CMP identity numbers: 1_585, 8_585, 9_586, , 5_586, 8_586, , 4_586, or , 6_586. 95. The oligonucleotide of configuration 85, wherein the oligonucleotide is selected from CMP identity number: 1_233. 96. The oligonucleotide of configuration 85, wherein the oligonucleotide is selected from CMP ID No.: 8_237 or 13_590. 97. The oligonucleotide of configuration 85, wherein the oligonucleotide is selected from CMP identity number: 1_220. 98. The oligonucleotide of configuration 85, wherein the oligonucleotide is selected from CMP identity numbers: 1_591, 2_592, 4_592, or 9_241. 99. The oligonucleotide of configuration 85, wherein the oligonucleotide is selected from CMP ID No.: 4_597, 4_598, 1_39, or 1_602. 100. The oligonucleotide of configuration 85, wherein the oligonucleotide is selected from CMP ID No.: 1_39. 101. The oligonucleotide of configuration 85, wherein the oligonucleotide is selected from CMP ID No.: 7_611. 102. The oligonucleotide of configuration 85, wherein the oligonucleotide is selected from CMP ID No.: 1_271 or 1_278. 103. The oligonucleotide of configuration 85, wherein the oligonucleotide is selected from CMP identity numbers: 4_616, 2_621, 1_621, 3_622, 5_622, 4_622, 3_624, 5_624, 1_287, 6_625, 7_626, 8_626 9_626, 1_48, 6_631, 1_631, 1_303, 6_304, or 10_304. 104. The oligonucleotide of configuration 85, wherein the oligonucleotide is selected from CMP ID No.: 8_636. 105. The oligonucleotide of configuration 85, wherein the oligonucleotide is selected from CMP ID No.: 8_638, 5_639, 1_331, or 4_640. 106. The oligonucleotide of configuration 85, wherein the oligonucleotide is selected from CMP ID No.: 1_359, 1_361, 5_361, 1_362, or 5_641. 107. The oligonucleotide of configuration 85, wherein the oligonucleotide is selected from CMP ID No.: 1_378, 1_379, or 1_399. 108. The oligonucleotide of configuration 85, wherein the oligonucleotide is selected from CMP ID No.: 1_403, 1_405, 12_642, 13_642, 3_644, or 16_646. 109. The oligonucleotide of configuration 85, wherein the oligonucleotide is selected from CMP ID No.: 1_85 or 5_424. 110. The oligonucleotide of configuration 85, wherein the oligonucleotide is selected from CMP ID No.: 1_116. 111. The oligonucleotide of configuration 85, wherein the oligonucleotide is selected from CMP identity number: 1_123 or 1_124. 112. The oligonucleotide of configuration 85, wherein the oligonucleotide is selected from CMP ID No.: 1_126. 113. A conjugate comprising an oligonucleotide according to any one of claims 1-112, and at least one conjugate half-molecule covalently attached to said oligonucleotide. 114. The conjugated oligonucleotide of configuration 113, wherein the conjugated moiety is selected from the group consisting of carbohydrates, cell surface receptor ligands, pharmaceuticals, hormones, lipophilic materials, polymers, proteins, peptides, toxins, vitamins, viral proteins, or combinations thereof. 115. The conjugated oligonucleotide of configuration 113 or 114, wherein the conjugated half-molecule is an antibody or antibody fragment. 116. The conjugated oligonucleotide of configuration 113, wherein the antibody or antibody fragment has affinity binding to the transferrin receptor. 117. Conjugated oligonucleotide of configuration 115-113, comprising a linker located between the oligonucleotide and the conjugated half-molecule. 118. The conjugated oligonucleotide of configuration 117, wherein the linker is a physiologically labile linker. 119. The conjugated oligonucleotide of configuration 118, wherein the physiologically labile linker is a nuclease-susceptible linker. 120. An oligonucleotide conjugate of configuration 118 or 119, wherein the oligonucleotide has the formula DFG-F' or FG-F'-D', wherein F, F', and G are as defined in configurations 80-73 and D or D' comprises 1, 2, or 3 DNA nucleosides with phosphorothioate internucleoside linkages. 121. Oligonucleotide conjugate of configuration 120-113, which exhibits better uptake into the brain of the conjugated oligonucleotide compared to an unconjugated oligonucleotide. 122. A pharmaceutical composition comprising an oligonucleotide of configuration 112-1 or a conjugate of configuration 121-113 and a pharmaceutically acceptable diluent, carrier, salt and / or adjuvant. 123. A method for producing an oligonucleotide of configuration 112-1 comprising reacting nucleotide units to thereby form covalently linked contiguous units present in the oligonucleotide. 124. The method of configuration 123, further comprising reacting the contiguous nucleotide sequence with a non-nucleotide conjugation half-molecule. 125. A method for producing the compound of configuration 122, comprising mixing the oligonucleotide with a pharmaceutically acceptable diluent, carrier, salt and / or adjuvant. 126. A method in vivo or in vitro for inducing UBE3A expression in a target cell wherein expression of paternal UBE3A is suppressed, said method comprising administering to said cell an oligonucleotide of any of configurations 112-1 or a conjugate of 121-113 or a pharmaceutical composition of configuration 122 in an amount effective to said cell. 127. The method of configuration 126, wherein the expression of UBE3A is increased by at least 40% compared to a control. 128. The method of configuration 126 or 127, wherein the level of SNHG14 transcript downstream of SNORD109B is reduced by at least 30% compared to a control. 129. The method of 128-126, wherein the target cell is a neuronal cell. 130. The method of configuration 129-126, wherein the expression of SNORD115 is not significantly affected compared to a control. 131. A method for treating or preventing a disease comprising administering a therapeutically or prophylactically effective amount of an oligonucleotide of configuration 112-1 or a conjugate of configuration 121-131 or a pharmaceutical composition of configuration 122 to a subject suffering from or susceptible to the disease. 132. An oligonucleotide of configuration 112-1 or a conjugate of configuration 121-131 or a pharmaceutical composition of configuration 122 for use as a medicament for treating or preventing a disease in a subject. 133. Use of an oligonucleotide of configuration 112-1 or a conjugate of configuration 121-131 for the preparation of a medicament for treating or preventing a disease in a subject. 134. The method, oligonucleotide or use of configurations 133-131, wherein the disease is associated with UBE3A activity in vivo. 135. The method, oligonucleotide or use of configurations 134-131, wherein the disease is associated with reduced UBE3A expression and / or reduced UBE3A activity in neuronal cells. 136. The method, oligonucleotide or use of configuration 135, wherein the reduced expression of UBE3A and / or reduced activity of UBE3A is due to mutations in the maternal allele of the UBE3A gene. 137. The method, oligonucleotide or use of configurations 136-134, wherein the expression of UBE3A is increased by at least 30%, or at least 50%, or at least 70%, or at least 90%, or at least 100%, or at least 150%, or at least 200%, compared to expression without the oligonucleotide of configuration 112-1 or a conjugate of configuration 121-113 or the pharmaceutical composition of configuration 122. 138. The method, oligonucleotide or use of configurations 137-131, wherein the disease is Engelman syndrome. 139. The method, oligonucleotide or use of configurations 137-131, wherein the subject is a mammal. 140. The method, oligonucleotide or use of embodiment 139, wherein the subject is human. 141. The method, oligonucleotide or use of embodiments 139 or 140, wherein the subject is an infant or an adolescent. Examples Materials and methods Table 3: List of oligonucleotides or contiguous nucleobase sequences complementary to SEQ ID NO:1 (motif sequences denoted by SEQ ID NO), oligonucleotide designs made from them, as well as specific oligonucleotide combinations (denoted by CMP identity numbers) designed based on the motif sequence. SEQ ID NO:1 Start Sequence Identity Number Motif Scheme Combination Identity Number CMP ΔG° Sequence Identity Number 1 Start 4 AACTTCATCAATATTTCCC 3 - 13 - 3 AACttcatcaatatttCCC 4 _ 1 - 23 , 36 1677 4 AACTTCATCAATATTTCCC 2 - 15 - 2 AActtcatcaatatttcCC 4 _ 2 - 19 , 60 1677 5 ACTTCATCAATATTTCCC 3 - 12 - 3 ACTtcatcaatatttCCC 5 _ 1 - 23 , 80 1677 5 ACTTCATCAATATTTCCC 2 - 14 - 2 ACttcatcaatatttcCC 5 _ 2 - 20 , 24 1677 6 CAACTTCATCAATATTTCCC 2 - 14 - 4 CAacttcatcaatattTCCC 6 _ 1 - 25 , 64 1677 6 CAACTTCATCAATATTTCCC 2 - 16 - 2 CAacttcatcaatatttcCC 6 _ 2 - 22 , 28 1677 7 CAACTTCATCAATATTTTCC 4 - 13 - 2 CAACttcatcaatatttCC 7 _ 1 - 21 , 47 1678 7 CAACTTCATCAATATTTTCC 2 - 15 - 2 CAacttcatcaatatttCC 7 _ 2 - 19 , 46 1678 8 CCAACTTCATCAATATTTCC 3 - 14 - 3 CCAacttcatcaatattTCC 8 _ 1 - 25 , 64 1678 9 CCCAACTTCATCAATATTTC 4 - 14 - 2 CCCAacttcatcaatattTC 9 _ 1 - 25 , 64 1679 10 ACCCAACTTCATCAATATTT 2 - 16 - 2 ACccaacttcatcaatatTT 10 _ 1 - 20 , 05 1680 11 CCCAACTTCATCAATATTT 4 - 13 - 2 CCCAacttcatcaatatTT 11 _ 1 - 23 ,96 1680 11 CCCAACTTCATCAATATTT 2 - 15 - 2 CCcaacttcatcaatatTT 11 _ 2 - 20 , 28 1680 12 ACCCAACTTCATCAATATT 4 - 13 - 2 ACCCaacttcatcaataTT 12 _ 1 - 23 , 64 1681 12 ACCCAACTTCATCAATATT 2 - 15 - 2 ACccaacttcatcaataTT 12 _ 2 - 19 , 18 1681 13 CCCAACTTCATCAATATT 4 - 12 - 2 CCCAacttcatcaataTT 13 _ 1 - 23 , 09 1681 13 CCCAACTTCATCAATATT 2 - 14 - 2 CCcaacttcatcaataTT 13 _ 2 - 19 , 41 1681 14 TACCCAACTTCATCAATAT 2 - 15 - 2 TAcccaacttcatcaatAT 14 _ 1 - 19 , 31 1682 15 TACCCAACTTCATCAATA 2 - 14 - 2 TAcccaacttcatcaaTA 15 _ 1 - 19 , 14 1683 16 TTACCCAACTTCATCAATA 2 - 15 - 2 TTacccaacttcatcaaTA 16 _ 1 - 19 , 74 1683 17 TTTACCCAACTTCATCAAT 4 - 13 - 2 TTTAcccaacttcatcaAT 17 _ 1 - 21 , 68 1684 17 TTTACCCAACTTCATCAAT 2 - 15 - 2 TTtacccaacttcatcaAT 17 _ 2 - 19 , 22 1684 18 ATACTTTACCCAACTTCAT 3 - 13 - 3 ATActttacccaacttCAT 18 _ 1 - 23 , 44 1688 18 ATACTTTACCCAACTTCAT 2 - 15 - 2 ATactttacccaacttcAT 18 _ 2 - 20 , 13 1688 19 TACTTTACCCAACTTCAT 3 - 12 - 3 TACtttacccaacttCAT 19 _ 1 - 22 ,78 1688 19 TACTTTACCCAACTTCAT 2 - 14 - 2 TActttacccaacttcAT 19 _ 2 - 19 , 30 1688 20 TTATACTTTACCCAACTTCA 2 - 16 - 2 TTatactttacccaacttCA 20 _ 1 - 21 , 40 1689 21 TCACTGTTCTGACTTT 3 - 10 - 3 TCActgttctgacTTT 21 _ 1 - 19 , 11 1712 22 TTCAATCTCTATCTCATCAT 2 - 16 - 2 TTcaatctctatctcatcAT 22 _ 1 - 19 , 42 4169 23 CTTCAATCTTCTATCTCATCA 4 - 14 - 2 CTTCaatctctatctcatCA 23 _ 1 - 24 , 21 4170 23 CTTCAATCTCTATTCTCATCA 2 - 16 - 2 CTtcaatctctatctcatCA 23 _ 2 - 22 , 04 4170 24 TTCAATCTCTATTCTCATCA 2 - 15 - 2 TTcaatctctatctcatCA 24 _ 1 - 19 , 44 4170 25 CTTCAATCTCTATCTCATC 2 - 15 - 2 CTtcaatctctatctcaTC 25 _ 1 - 19 , 87 4171 26 ACTTCAATCTCTATTCTCAT 3 - 13 - 3 ACTtcaatctctatctCAT 26 _ 1 - 22 , 36 4172 26 ACTTCAATCTCTATTCTCAT 2 - 15 - 2 ACttcaatctctatctcAT 26 _ 2 - 19 , 08 4172 27 CACTTCAATCTCTATTCTCAT 2 - 16 - 2 CActtcaatctcttcAT 27 _ 1 - 20 , 98 4172 28 ACTTCAATCTCTATCTCA 2 - 12 - 4 ACttcaatctctatCTCA 28 _ 1 - 21 , 96 4173 28 ACTTCAATCTCTATCTCA 2 - 14 - 2 ACttcaatctctatctCA 28 _ 2 - 19 ,10 4173 29 CACTTCAATCTCTATCTCA 2 - 13 - 4 CActtcaatctctatCTCA 29 _ 1 - 23 , 86 4173 29 CACTTCAATCTCTATCTCA 2 - 15 - 2 CActtcaatctctatctCA 29 _ 2 - 21 , 00 4173 30 ACACTTCAATCTCTATCTC 2 - 15 - 2 ACacttcaatctctatcTC 30 _ 1 - 19 , 38 4174 31 TACACTTCAATCTCTATCTC 2 - 14 - 4 TAcacttcaatctctaTCTC 31 _ 1 - 23 , 31 4174 31 TACACTTCAATCTCTATCTC 2 - 16 - 2 TAcacttcaatctctatcTC 31 _ 2 - 20 , 53 4174 32 TACACTTCAATCTCTATCT 4 - 13 - 2 TACActtcaatctctatCT 32 _ 1 - 22 , 34 4175 33 CTTTGTCTCTCTTTACT 2 - 13 - 2 CTttgtctctctttaCT 33 _ 1 - 19 , 36 4374 34 TATACCTTTCTTTAACCC 3 - 12 - 3 TATacctttctttaaCCC 34 _ 1 - 24 , 89 8118 34 TATACCTTTCTTTAACCC 2 - 14 - 2 TAtacctttctttaacCC 34 _ 2 - 20 , 83 8118 34 TATACCTTTCTTTAACCC 1 - 3 - 1 - 7 - 1 - 1 - 1 - 1 - 2 TataCctttcttTaAcCC 34 _ 3 - 21 , 63 8116 34 TATACCTTTCTTTAACCC 1 - 4 - 1 - 6 - 1 - 3 - 2 TatacCtttcttTaacCC 34 _ 4 - 21 , 31 8116 34 TATACCTTTCTTTAACCC 1 - 2 - 1 - 1 - 1 - 7 - 2 - 1 - 2 TatAcCtttctttAAcCC 34 _ 5 - 21 ,51 8116 34 TATACCTTTCTTTAACCC 2 - 3 - 1 - 7 - 1 - 2 - 2 TAtacCtttctttAacCC 34 _ 6 - 21 , 84 8116 34 TATACCTTTCTTTAACCC 2 - 13 - 3 TAtacctttctttaaCCC 34 _ 7 - 23 , 21 8116 35 TGTTTATACCCTTTCC 2 - 12 - 2 TGtttataccctttCC 35 _ 1 - 20 , 33 9212 35 TGTTTATACCCTTTCC 4 - 10 - 2 TGTTtataccctttCC 35 _ 2 - 22 , 69 9212 36 TCTCCTTTATGACTCC 2 - 10 - 4 TCtcctttatgaCTCC 36 _ 1 - 23 , 29 10839 37 CTTCTCCTTTATGACTC 2 - 13 - 2 CTtctcctttatgacTC 37 _ 1 - 19 , 26 10840 38 CCATTTATTTCCATTTATT 4 - 13 - 2 CCATttatttccatttaTT 38 _ 1 - 22 , 32 15567 38 CCATTTATTTCCATTTATT 2 - 15 - 2 CCatttatttccatttaTT 38 _ 2 - 19 , 61 15567 38 CCATTTATTTCCATTTATT 1 - 2 - 1 - 9 - 2 - 1 - 3 CcaTttatttccaTTtATT 38 _ 3 - 20 , 02 15567 38 CCATTTATTTCCATTTATT 1 - 1 - 1 - 1 - 1 - 8 - 1 - 1 - 1 - 1 - 2 CcAtTtatttccaTtTaTT 38 _ 4 - 18 , 95 15567 38 CCATTTATTTCCATTTATT 2 - 2 - 1 - 8 - 1 - 3 - 2 CCatTtatttccaTttaTT 38 _ 5 - 20 , 35 15567 38 CCATTTATTTCCATTTATT 1 - 2 - 3 - 6 - 1 - 3 - 3 CcaTTTatttccAtttATT 38 _ 6 - 20 ,87 15567 39 CTTTCCATTTATTTCCATTT 2 - 14 - 4 CTttccatttatttccATTT 39 _ 1 - 23 , 14 15570 39 CTTTCCATTTATTTCCATTT 1 - 13 - 1 - 1 - 1 - 1 - 2 CtttccatttatttCcAtTT 39 _ 2 - 20 , 96 15570 39 CTTTCCATTTATTTCCATTT 1 - 13 - 1 - 3 - 2 CtttccatttatttCcatTT 39 _ 3 - 20 , 91 15570 39 CTTTCCATTTATTTCCATTT 1 - 3 - 1 - 1 - 1 - 11 - 2 CtttCcAtttatttccatTT 39 _ 4 - 20 , 96 15570 39 CTTTCCATTTATTTCCATTT 1 - 1 - 1 - 3 - 1 - 9 - 1 - 1 - 2 CtTtccAtttatttccAtTT 39 _ 5 - 20 , 54 15570 40 TCTTTCCATTTATTTCCATT 2 - 14 - 4 TCtttccatttatttcCATT 40 _ 1 - 24 , 62 15571 40 TCTTTCCATTTATTTCCATT 2 - 13 - 1 - 1 - 3 TCtttccatttatttCcATT 40 _ 2 - 23 , 39 15571 40 TCTTTCCATTTATTTCCATT 2 - 13 - 1 - 2 - 2 TCtttccatttatttCcaTT 40 _ 3 - 22 , 53 15571 40 TCTTTCCATTTATTTCCATT 2 - 14 - 1 - 1 - 2 TCtttccatttatttcCaTT 40 _ 4 - 22 , 34 15571 40 TCTTTCCATTTATTTCCATT 2 - 3 - 1 - 11 - 3 TCtttCcatttatttccATT 40 _ 5 - 23 , 39 15571 40 TCTTTCCATTTATTTCCATT 2 - 4 - 1 - 10 - 3 TCtttcCatttatttccATT 40 _ 6 - 23 ,20 15571 40 TCTTTCCATTTATTTCCATT 2 - 3 - 1 - 12 - 2 TCtttCcatttatttccaTT 40 _ 7 - 22 , 53 15571 40 TCTTTCCATTTATTTCCATT 2 - 4 - 1 - 11 - 2 TCtttcCatttatttccaTT 40 _ 8 - 22 , 34 15571 41 ATTACCCATCCGTTCT 2 - 12 - 2 ATtacccatccgttCT 41 _ 1 - 21 , 15 21965 42 GCATTAGGCACATTACAT 3 - 12 - 3 GCAttaggcacattaCAT 42 _ 1 - 23 , 96 22211 43 ATTATTATTTAACCTTCCTA 2 - 16 - 2 ATtattatttaaccttccTA 43 _ 1 - 19 , 28 30451 44 ACATTATTATTTAACCTTCC 4 - 14 - 2 ACATtattatttaaccttCC 44 _ 1 - 22 , 84 30453 44 ACATTATTATTTAACCTTCC 2 - 16 - 2 ACattattatttaaccttCC 44 _ 2 - 20 , 13 30453 45 CATTATTATTTAACCTTCC 4 - 13 - 2 CATTattatttaaccttCC 45 _ 1 - 22 , 04 30453 45 CATTATTATTTAACCTTCC 2 - 15 - 2 CAttattatttaaccttCC 45 _ 2 - 19 , 55 30453 46 CCTCTGCTTATAACTTT 2 - 13 - 2 CCtctgcttataactTT 46 _ 1 - 19 , 15 30699 47 CTACTATACTTTCCTCT 2 - 11 - 4 CTactatactttcCTCT 47 _ 1 - 22 , 32 30711 48 GTTCTACTATACTTTCC 4 - 11 - 2 GTTCtactatactttCC 48 _ 1 - 21 ,69 30714 48 GTTCTACTATACTTTCC 2 - 13 - 2 GTtctactatactttCC 48 _ 2 - 19 , 21 30714 48 GTTCTACTATACTTTCC 1 - 2 - 1 - 7 - 2 - 2 - 2 GttCtactataCTttCC 48 _ 3 - 20 , 83 30712 48 GTTCTACTATACTTTCC 2 - 9 - 1 - 3 - 2 GTtctactataCtttCC 48 _ 4 - 20 , 20 30712 48 GTTCTACTATACTTTCC 1 - 2 - 1 - 9 - 1 - 1 - 2 GttCtactatactTtCC 48 _ 5 - 18 , 95 30712 48 GTTCTACTATACTTTCC 2 - 1 - 1 - 10 - 3 GTtCtactatacttTCC 48 _ 6 - 21 , 18 30712 48 GTTCTACTATACTTTCC 1 - 3 - 1 - 10 - 2 GttcTactatactttCC 48 _ 7 - 18 , 61 30712 49 CACCTGATAACAGACCCT 3 - 12 - 3 CACctgataacagacCCT 49 _ 1 - 26 , 38 36068 50 CACCTGATAACAGACC 3 - 10 - 3 CACctgataacagACC 50 _ 1 - 21 , 10 36070 51 CCCACCAAAGGATATATT 3 - 12 - 3 CCCaccaaaggatatATT 51 _ 1 - 23 , 47 37208 52 ACCAGCTACAGGAACCTC 3 - 12 - 3 ACCagctacaggaacCTC 52 _ 1 - 26 , 57 46132 53 CTATATCTCACTCCTATTT 4 - 13 - 2 CTATatctcactcctatTT 53 _ 1 - 23 , 07 48143 53 CTATATCTCACTCCTATTT 2 - 13 - 4 CTatatctcactcctATTT 53 _ 2 - 22 ,12 48143 54 CTATATCTCACTCCTATT 2 - 14 - 2 CTatatctcactcctaTT 54 _ 1 - 19 , 40 48144 54 CTATATCTCACTCCTATT 2 - 12 - 4 CTatatctcactccTATT 54 _ 2 - 22 , 28 48144 54 CTATATCTCACTCCTATT 3 - 12 - 3 CTAtatctcactcctATT 54 _ 3 - 21 , 44 48144 55 CTACTATATCTCACTCCTAT 2 - 16 - 2 CTactatatctcactcctAT 55 _ 1 - 22 , 00 48145 55 CTACTATATCTCACTCCTAT 2 - 14 - 4 CTactatatctcactcCTAT 55 _ 2 - 25, 54 48145 56 TACTATATCTCACTCCTAT 2 - 13 - 4 TActatatctcactcCTAT 56 _ 1 - 23 , 29 48145 57 CTACTATATCTCACTCCTA 2 - 15 - 2 CTactatatctcactccTA 57 _ 1 - 21 , 91 48146 58 TACTATATCTCACTCCTA 2 - 14 - 2 TActatatctcactccTA 58 _ 1 - 19 , 66 48146 58 TACTATATCTCACTCCTA 2 - 12 - 4 TActatatctcactCCTA 58 _ 2 - 23 , 59 48146 58 TACTATATCTCACTCCTA 3 - 12 - 3 TACTatatctcactCTA 58 _ 3 - 22 , 62 48146 59 CTACTATATCTCACTCCT 2 - 14 - 2 CTactatatctcactcCT 59 _ 1 - 21 , 25 48147 59 CTACTATATCTCACTCCT 4 - 12 - 2 CTACtatatctcactcCT 59 _ 2 - 23 , 87 48147 60 CTACTATATCTCACTCC 2 - 13 - 2 CTactatatctcactCC 60 _ 1 - 20 ,13 48148 60 CTACTATATCTCACTCC 2 - 11 - 4 CTactatatctcaCTCC 60 _ 2 - 23 , 00 48148 60 CTACTATATCTCACTCC 3 - 11 - 3 CTActatatctcacTCC 60 _ 3 - 22 , 56 48148 61 CCTACTATATCTCACTC 2 - 11 - 4 CCtactatatctcACTC 61 _ 1 - 21 , 93 48149 62 CTCCTACTATATCTCACTC 4 - 13 - 2 CTCCtactatatctcacTC 62 _ 1 - 25 , 69 48149 63 TCCTACTATATCTCACTC 3 - 12 - 3 TCCtactatatctcaCTC 63 _ 1 - 23 , 88 48149 64 CTCCTACTATATCTCACT 4 - 12 - 2 CTCCtactatatctcaCT 64 _ 1 - 24 , 87 48150 64 CTCCTACTATATCTCACT 3 - 12 - 3 CTCctactatatctcACT 64 _ 2 - 22 , 93 48150 65 TTTCCTCTCCTACTATATC 2 - 15 - 2 TTtcctctcctactataTC 65 _ 1 - 21 , 23 48155 66 ATCCATATCCTTTCCT 3 - 10 - 3 ATCcatatcctttCCT 66 _ 1 - 24 , 02 48168 67 CATCCATATCCTTTCCT 4 - 11 - 2 CATCcatatcctttcCT 67 _ 1 - 24 , 94 48168 68 ATCATCCATATCCTTTCC 4 - 12 - 2 ATCAtccatatcctttCC 68 _ 1 - 25 , 69 48169 69 CATCATCCATATCCTTTC 4 - 12 - 2 CATCatccatatccttTC 69 _ 1 - 23 , 32 48170 69 CATCATCCATATCCTTTC 2 - 14 - 2 CAtcatccatatccttTC 69 _ 2 - 20 ,72 48170 69 CATCATCCATATCCTTTC 2 - 12 - 4 CAtcatccatatccTTTC 69 _ 3 - 22 , 56 48170 70 TACATCATCCATATCCTTTC 2 - 16 - 2 TAcatcatccatatccttTC 70 _ 1 - 22 , 45 48170 70 TACATCATCCATATCCTTTC 4 - 14 - 2 TACAtcatccatatccttTC 70 _ 2 - 25 , 00 48170 70 TACATCATCCATATCCTTTC 2 - 14 - 4 TAcatcatccatatccTTTC 70 _ 3 - 24 , 29 48170 71 ACATCATCCATATCCTTT 3 - 12 - 3 ACAtcatccatatccTTT 71 _ 1 - 22 , 11 48171 72 CATCATCCATATCCTTT 2 - 13 - 2 CAtcatccatatcctTT 72 _ 1 - 19 , 04 48171 72 CATCATCCATATCCTTT 4 - 11 - 2 CATCatccatatcctTT 72 _ 2 - 21 , 64 48171 73 TACATCATCCATATCCTTT 2 - 15 - 2 TAcatcatccatatcctTT 73 _ 1 - 20 , 76 48171 73 TACATCATCCATATCCTTT 2 - 13 - 4 TAcatcatccatatcCTTT 73 _ 2 - 23 , 36 48171 73 TACATCATCCATATCCTTT 3 - 13 - 3 TACatcatccatatccTTT 73 _ 3 - 22 , 88 48171 74 ATACATCATCCATATCCTT 2 - 15 - 2 ATacatcatccatatccTT 74 _ 1 - 20 , 80 48172 74 ATACATCATCCATATCCTT 4 - 13 - 2 ATACatcatccatatccTT 74 _ 2 - 23 , 12 48172 75 TACATCATCCATATCCTT 2 - 14 - 2 TAcatcatccatatccTT 75 _ 1 - 19 ,97 48172 75 TACATCATCCATATCCTT 4 - 12 - 2 TACAtcatccatatccTT 75 _ 2 - 22 , 52 48172 76 TATACATCATCCATATCCTT 2 - 16 - 2 TAtacatcatccatatccTT 76 _ 1 - 21 , 36 48172 77 ATACATCATCCATATCCT 3 - 12 - 3 ATAcatcatccatatCCT 77 _ 1 - 24 , 15 48173 77 ATACATCATCCATATCCT 2 - 14 - 2 ATacatcatccatatcCT 77 _ 2 - 20 , 55 48173 77 ATACATCATCCATATCCT 2 - 13 - 3 ATacatcatccatatCCT 77 _ 3 - 22 , 92 48173 78 ATATACATCATCCATATCCT 2 - 16 - 2 ATatacatcatccatatcCT 78 _ 1 - 22 , 04 48173 79 TACATCATCCATATCCT 2 - 11 - 4 TAcatcatccataTCCT 79 _ 1 - 23 , 21 48173 79 TACATCATCCATATCCT 2 - 13 - 2 TAcatcatccatatcCT 79 _ 2 - 19 , 71 48173 79 TACATCATCCATATCCT 4 - 11 - 2 TACAtcatccatatcCT 79 _ 3 - 22 , 27 48173 80 TATACATCATCCATATCCT 2 - 15 - 2 TAtacatcatccatatcCT 80 _ 1 - 21 , 11 48173 80 TATACATCATCCATATCCT 3 - 13 - 3 TATacatcatccatatCCT 80 _ 2 - 25 , 15 48173 80 TATACATCATCCATATCCT 4 - 13 - 2 TATAcatcatccatatcCT 80 _ 3 - 24 , 01 48173 81 ATACATCATCCATATCC 3 - 11 - 3 ATAcatcatccataTCC 81 _ 1 - 21 ,79 48174 82 ATATACATCATCCATATCC 4 - 13 - 2 ATATacatcatccatatCC 82 _ 1 - 23 , 73 48174 82 ATATACATCATCCATATCC 2 - 15 - 2 ATatacatcatccatatCC 82 _ 2 - 20 , 93 48174 83 TATACATCATCCATATCC 2 - 14 - 2 TAtacatcatccatatCC 83 _ 1 - 20 , 00 48174 83 TATACATCATCCATATCC 4 - 12 - 2 TATAcatcatccatatCC 83 _ 2 - 22 , 90 48174 84 TATATACATCATCCATATCC 2 - 16 - 2 TAtatacatcatccatatCC 84 _ 1 - 21 , 49 48174 84 TATATACATCATCCATATCC 4 - 14 - 2 TATAtacatcatccatatCC 84 _ 2 - 24 , 29 48174 85 GCTTCATATTTCTCCA 2 - 12 - 2 GCttcatatttctcCA 85 _ 1 - 20 , 44 49345 85 GCTTCATATTTCTCCA 2 - 11 - 3 GCttcatatttctCCA 85 _ 2 - 22 , 81 49345 86 CATCTTGTTCTTTACCT 2 - 13 - 2 CAtcttgttctttacCT 86 _ 1 - 19 , 67 49581 87 TATATTCACCATTGCC 2 - 10 - 4 TAtattcaccatTGCC 87 _ 1 - 22 , 70 49724 88 CCTTATATTCACCATTG 2 - 13 - 2 CCttatattcaccatTG 88 _ 1 - 19 , 44 49726 88 CCTTATATTCACCATTG 2 - 11 - 4 CCttatattcaccATTG 88 _ 2 - 21 , 25 49726 89 CCTCCTTATATTCACC 4 - 10 - 2 CCTCcttatattcaCC 89 _ 1 - 24 ,64 49730 90 CCCTTCCTTTATTCAA 3 - 10 - 3 CCCttcctttattCAA 90 _ 1 - 23 , 86 50189 91 CCTTACTGTTAAATCCT 2 - 13 - 2 CCttactgttaaatcCT 91 _ 1 - 19 , 81 50475 92 CAGGCAGATAACCTCCAA 3 - 12 - 3 CAGgcagataacctcCAA 92 _ 1 - 25 , 31 52419 93 CAGCAGGCAGATAACCTC 3 - 12 - 3 CAGcaggcagataacCTC 93 _ 1 - 25 , 88 52422 94 CGAATCTTGACATACAGG 3 - 12 - 3 CGAatcttgacatacAGG 94 _ 1 - 21 , 47 53955 95 CTCATACTTGCTTTAAT 4 - 11 - 2 CTCAtacttgctttaAT 95 _ 1 - 19 , 10 60821 95 CTCATACTTGCTTTAAT 2 - 13 - 2 CTcatacttgctttaAT 95 _ 2 - 16 , 35 60821 96 ACATCTCATACTTGCTT 2 - 11 - 4 ACatctcatacttGCTT 96 _ 1 - 21 , 31 60825 96 ACATCTCATACTTGCTT 2 - 13 - 2 ACatctcatacttgcTT 96 _ 2 - 17 , 66 60825 96 ACATCTCATACTTGCTT 2 - 12 - 3 ACatctcatacttgCTT 96 _ 3 - 19 , 52 60825 97 ACATCTCATACTTGCT 2 - 10 - 4 ACatctcatactTGCT 97 _ 1 - 21 , 18 60826 97 ACATCTCATACTTGCT 2 - 12 - 2 ACatctcatacttgCT 97 _ 2 - 17 , 70 60826 97 ACATCTCATACTTGCT 2 - 11 - 3 ACatctcatacttGCT 97 _ 3 - 19 ,49 60826 97 ACATCTCATACTTGCT 4 - 10 - 2 ACATctcatacttgCT 97 _ 4 - 20 , 48 60826 98 TACATCTCATACTTGCT 2 - 11 - 4 TAcatctcatactTGCT 98 _ 1 - 22 , 33 60826 98 TACATCTCATACTTGCT 2 - 13 - 2 TAcatctcatacttgCT 98 _ 2 - 18 , 85 60826 98 TACATCTCATACTTGCT 4 - 11 - 2 TACAtctcatacttgCT 98 _ 3 - 21 , 40 60826 99 CCTACATCTCATACTTGC 3 - 12 - 3 CCTacatctcatactTGC 99 _ 1 - 26 , 29 60827 99 CCTACATCTCATACTTGC 2 - 14 - 2 CCtacatctcatacttGC 99 _ 2 - 22 , 98 60827 99 CCTACATCTCATACTTGC 2 - 13 - 3 CCtacatctcatactTGC 99 _ 3 - 24 , 67 60827 99 CCTACATCTCATACTTGC 2 - 12 - 4 CCtacatctcatacTTGC 99 _ 4 - 25 , 70 60827 100 CTACATCTCATACTTGC 3 - 11 - 3 CTAcatctcatactTGC 100 _ 1 - 22 , 33 60827 100 CTACATCTCATACTTGC 2 - 13 - 2 CTacatctcatacttGC 100 _ 2 - 19 , 41 60827 100 CTACATCTCATACTTGC 2 - 12 - 3 CTacatctcatactTGC 100 _ 3 - 21 , 10 60827 101 TACATCTCATACTTGC 3 - 10 - 3 TACatctcatactTGC 101 _ 1 - 19 , 94 60827 101 TACATCTCATACTTGC 2 - 12 - 2 TAcatctcatacttGC 101 _ 2 - 17 ,15 60827 101 TACATCTCATACTTGC 2 - 11 - 3 TAcatctcatactTGC 101 _ 3 - 18 , 85 60827 101 TACATCTCATACTTGC 4 - 10 - 2 TACAtctcatacttGC 101 _ 4 - 19 , 71 60827 102 CCTACATCTCATACTTG 4 - 11 - 2 CCTAcatctcatactTG 102 _ 1 - 22 , 52 60828 102 CCTACATCTCATACTTG 2 - 13 - 2 CCtacatctcatactTG 102 _ 2 - 19 , 67 60828 102 CCTACATCTCATACTTG 3 - 12 - 2 CCTacatctcatactTG 102 _ 3 - 21 , 29 60828 102 CCTACATCTCATACTTG 3 - 11 - 3 CCTacatctcatacTTG 102 _ 4 - 22 , 31 60828 103 ACCTACATCTCATACTT 3 - 11 - 3 ACCtacatctcataCTT 103 _ 1 - 21 , 93 60829 103 ACCTACATCTCATACTT 2 - 13 - 2 ACctacatctcatacTT 103 _ 2 - 17 , 76 60829 103 ACCTACATCTCATACTT 2 - 11 - 4 ACctacatctcatACTT 103 _ 3 - 20 , 03 60829 103 ACCTACATCTCATACTT 3 - 12 - 2 ACCtacatctcatacTT 103 _ 4 - 20 , 26 60829 104 CCTACATCTCATACTT 3 - 10 - 3 CCTacatctcataCTT 104 _ 1 - 21 , 50 60829 104 CCTACATCTCATACTT 2 - 12 - 2 CCtacatctcatacTT 104 _ 2 - 18 , 21 60829 104 CCTACATCTCATACTT 2 - 10 - 4 CCtacatctcatACTT 104 _ 3 - 20 ,48 60829 105 TACCTACATCTCATACTT 4 - 12 - 2 TACCtacatctcatacTT 105 _ 1 - 22 , 49 60829 105 TACCTACATCTCATACTT 2 - 14 - 2 TAcctacatctcatacTT 105 _ 2 - 18 , 81 60829 105 TACCTACATCTCATACTT 2 - 13 - 3 TAcctacatctcataCTT 105 _ 3 - 20 , 48 60829 105 TACCTACATCTCATACTT 2 - 12 - 4 TAcctacatctcatACTT 105 _ 4 - 21 , 08 60829 106 TTACCTACATCTCATACTT 3 - 13 - 3 TTAcctacatctcataCTT 106 _ 1 - 22 , 30 60829 106 TTACCTACATCTCATACTT 2 - 15 - 2 TTacctacatctcatacTT 106 _ 2 - 19 , 40 60829 106 TTACCTACATCTCATACTT 2 - 14 - 3 TTacctacatctcataCTT 106 _ 3 - 21 , 08 60829 106 TTACCTACATCTCATACTT 2 - 13 - 4 TTacctacatctcatACTT 106 _ 4 - 21 , 67 60829 107 ACCTACATCTCATACT 4 - 10 - 2 ACCTacatctcataCT 107 _ 1 - 21 , 72 60830 107 ACCTACATCTCATACT 2 - 12 - 2 ACctacatctcataCT 107 _ 2 - 17 , 61 60830 107 ACCTACATCTCATACT 3 - 11 - 2 ACCtacatctcataCT 107 _ 3 - 20 , 10 60830 107 ACCTACATCTCATACT 2 - 10 - 4 ACctacatctcaTACT 107 _ 4 - 20 , 11 60830 108 TACCTACATCTCATACT 4 - 11 - 2 TACCtacatctcataCT 108 _ 1 - 22 ,34 60830 108 TACCTACATCTCATACT 2 - 13 - 2 TAcctacatctcataCT 108 _ 2 - 18 , 66 60830 108 TACCTACATCTCATACT 3 - 12 - 2 TACctacatctcataCT 108 _ 3 - 19 , 85 60830 108 TACCTACATCTCATACT 3 - 11 - 3 TACctacatctcatACT 108 _ 4 - 20 , 44 60830 109 TTACCTACATCTCATACT 2 - 12 - 4 TTacctacatctcaTACT 109 _ 1 - 21 , 75 60830 109 TTACCTACATCTCATACT 2 - 14 - 2 TTacctacatctcataCT 109 _ 2 - 19 , 25 60830 109 TTACCTACATCTCATACT 3 - 13 - 2 TTAcctacatctcataCT 109 _ 3 - 20 , 48 60830 109 TTACCTACATCTCATACT 3 - 12 - 3 TTAcctacatctcatACT 109 _ 4 - 21 , 08 60830 110 TTACCTACATCTCATAC 3 - 11 - 3 TTAcctacatctcaTAC 110 _ 1 - 19 , 50 60831 110 TTACCTACATCTCATAC 2 - 13 - 2 TTacctacatctcatAC 110 _ 2 - 16 , 37 60831 111 GTTACCTACATCTCATA 2 - 11 - 4 GTtacctacatctCATA 111 _ 1 - 21 , 69 60832 111 GTTACCTACATCTCATA 2 - 13 - 2 GTtacctacatctcaTA 111 _ 2 - 18 , 74 60832 111 GTTACCTACATCTCATA 3 - 12 - 2 GTTacctacatctcaTA 111 _ 3 - 19 , 98 60832 112 GTTACCTACATCTCAT 3 - 10 - 3 GTTacctacatctCAT 112 _ 1 - 20 ,69 60833 112 GTTACCTACATCTCAT 2 - 12 - 2 GTtacctacatctcAT 112 _ 2 - 17 , 37 60833 113 ATATACCCAAAGGCACCT 3 - 12 - 3 ATAtacccaaaggcaCCT 113 _ 1 - 25 , 99 62200 114 TCTACTCATCCTTTAACTCA 2 - 14 - 4 TCtactcatcctttaaCTCA 114 _ 1 - 25 , 63 62251 115 CCTTAATCTGTATCACT 2 - 13 - 2 CCttaatctgtatcaCT 115 _ 1 - 19 , 58 62286 116 CCATACACAGCACATA 2 - 12 - 2 CCatacacagcacaTA 116 _ 1 - 19 , 04 62424 117 CTCCATACACAGCACAT 2 - 13 - 2 CTccatacacagcacAT 117 _ 1 - 20 , 08 62425 118 CAGAATAATTCTCCTCC 2 - 13 - 2 CAgaataattctcctCC 118 _ 1 - 19 , 86 62441 119 GTCCTACATATATACC 4 - 10 - 2 GTCCtacatatataCC 119 _ 1 - 22 , 09 66380 120 TGCTTCCTTACTAACC 4 - 10 - 2 TGCTtccttactaaCC 120 _ 1 - 23 , 93 66701 120 TGCTTCCTTACTAACC 2 - 12 - 2 TGcttccttactaaCC 120 _ 2 - 20 , 10 66701 121 CCCTTTGTAATCATCT 4 - 10 - 2 CCCTttgtaatcatCT 121 _ 1 - 23 , 44 66838 122 TCCCTTTGTAATCATCT 2 - 13 - 2 TCcctttgtaatcatCT 122 _ 1 - 19 , 97 66838 123 CTGCCATCAATACCAT 2 - 12 - 2 CTgccatcaataccAT 123 _ 1 - 19 ,14 68918 124 TCACTGCCATCAATACC 2 - 13 - 2 TCactgccatcaataCC 124 _ 1 - 21 , 35 68920 125 ATTCTTACTTTATTCCTCA 2 - 15 - 2 ATtcttactttattcctCA 125 _ 1 - 20 , 16 70033 126 TCACTTTCCAGATATCA 4 - 11 - 2 TCACtttccagatatCA 126 _ 1 - 21 , 61 77567 126 TCACTTTCCAGATATCA 2 - 13 - 2 TCactttccagatatCA 126 _ 2 - 18 , 65 77567 127 TCCTTCAAATTCCACATAC 3 - 13 - 3 TCCttcaaattccacaTAC 127 _ 1 - 24 , 09 82053 128 ACATGTCCCTTTATATT 4 - 11 - 2 ACATgtccctttataTT 128 _ 1 - 20 , 87 92323 128 ACATGTCCCTTTATATT 2 - 13 - 2 ACatgtccctttataTT 128 _ 2 - 17 , 66 92323 128 ACATGTCCCTTTATATT 3 - 12 - 2 ACAtgtccctttataTT 128 _ 3 - 19 , 13 92323 128 ACATGTCCCTTTATATT 3 - 11 - 3 ACAtgtccctttatATT 128 _ 4 - 20 , 03 92323 129 ACATGTCCCTTTATAT 3 - 10 - 3 ACAtgtccctttaTAT 129 _ 1 - 20 , 11 92324 129 ACATGTCCCTTTATAT 2 - 12 - 2 ACatgtccctttatAT 129 _ 2 - 16 , 74 92324 130 CCAAGAAAGGAGCAAGCT 3 - 12 - 3 CCAagaaaggagcaaGCT 130 _ 1 - 25 , 26 97146 131 TCCAAGAAAGGAGCAAGC 3 - 12 - 3 TCCaagaaaggagcaAGC 131 _ 1 - 24 ,12 97147 132 CTCATCCCTCCAAGAAA 4 - 11 - 2 CTCAtccctccaagaAA 132 _ 1 - 22 , 58 97156 132 CTCATCCCTCCAAGAAA 2 - 13 - 2 CTcatccctccaagaAA 132 _ 2 - 19 , 83 97156 132 CTCATCCCTCCAAGAAA 3 - 12 - 2 CTCatccctccaagaAA 132 _ 3 - 21 , 11 97156 133 TCATCCCTCCAAGAAA 4 - 10 - 2 TCATccctccaagaAA 133 _ 1 - 20 , 41 97156 133 TCATCCCTCCAAGAAA 2 - 12 - 2 TCatccctccaagaAA 133 _ 2 - 17 , 63 97156 133 TCATCCCTCCAAGAAA 3 - 11 - 2 TCAtccctccaagaAA 133 _ 3 - 19 , 09 97156 133 TCATCCCTCCAAGAAA 3 - 10 - 3 TCAtccctccaagAAA 133 _ 4 - 19 , 81 97156 134 CACCTCCCTATTACATAAA 4 - 13 - 2 CACCtccctattacataAA 134 _ 1 - 24 , 18 100018 134 CACCTCCCTATTACATAAA 2 - 15 - 2 CAcctccctattacataAA 134 _ 2 - 20 , 51 100018 135 CACCTCCCTATTACATAA 4 - 12 - 2 CACCtccctattacatAA 135 _ 1 - 23 , 75 100019 135 CACCTCCCTATTACATAA 2 - 14 - 2 CAcctccctattacatAA 135 _ 2 - 20 , 07 100019 136 CCTCCCTATTACATAA 2 - 12 - 2 CCtccctattacatAA 136 _ 1 - 18 , 40 100019 137 CTAAATCTTCCAATTCATA 2 - 15 - 2 CTaaatcttccaattcaTA 137 _ 1 - 18 ,12 106139 138 TATCCCTTGATTATCCT 2 - 13 - 2 TAtcccttgattatcCT 138 _ 1 - 20 , 68 109406 139 CCTCTTTGTCAAATACT 2 - 13 - 2 CCtctttgtcaaataCT 139 _ 1 - 19 , 30 110768 140 CAGCTTATTTACCTCTT 2 - 13 - 2 CAgcttatttacctcTT 140 _ 1 - 19 , 30 114828 141 ACTCTTTACCTCTAACACT 4 - 13 - 2 ACTCtttacctctaacaCT 141 _ 1 - 24 , 26 117468 142 TTACTCTTTACCTCTAACAC 3 - 14 - 3 TTActctttacctctaaCAC 142 _ 1 - 23 , 23 117469 143 CCAACCTAATACCTTAATA 2 - 15 - 2 CCaacctaataccttaaTA 143 _ 1 - 20 , 27 118639 144 TACCAACCTAATACCTTAA 2 - 15 - 2 TAccaacctaataccttAA 144 _ 1 - 18 , 32 118641 145 CCAATACCCACAAACC 3 - 10 - 3 CCAatacccacaaACC 145 _ 1 - 23 , 17 124162 145 CCAATACCCACAAACC 2 - 12 - 2 CCaatacccacaaaCC 145 _ 2 - 20 , 85 124162 146 CCATTATTCTACTTTGT 3 - 11 - 3 CCAttattctacttTGT 146 _ 1 - 21 , 79 125501 146 CCATTATTCTACTTTGT 2 - 13 - 2 CCattattctactttGT 146 _ 2 - 18 , 63 125501 147 CATTTCCTTATCTTCACA 2 - 14 - 2 CAtttccttatcttcaCA 147 _ 1 - 20 ,39 125529 148 TCATTTCCTTATCTTCACA 4 - 13 - 2 TCATttccttatcttcaCA 148 _ 1 - 24 , 13 125529 149 AATAATTCCTCATTTCCT 2 - 14 - 2 AAtaattcctcatttcCT 149 _ 1 - 18 , 01 125539 150 ACAATAATTCCTCATTTCC 3 - 13 - 3 ACAataattcctcattTCC 150 _ 1 - 22 , 71 125540 150 ACAATAATTCCTCATTTCC 2 - 15 - 2 ACaataattcctcatttCC 150 _ 2 - 20 , 23 125540 151 TATTGAACCAATTCTA 3 - 10 - 3 TATtgaaccaattCTA 151 _ 1 - 16 , 93 4806 152 CATATTGAACCAATTC 4 - 10 - 2 CATAttgaaccaatTC 152 _ 1 - 16 , 32 4808 153 TCATATTGAACCAATT 4 - 10 - 2 TCATattgaaccaaTT 153 _ 1 - 16 , 14 4809 154 CATCATATTGAACCAA 2 - 10 - 4 CAtcatattgaaCCAA 154 _ 1 - 17 , 65 4811 155 TCATCATATTGAACCA 3 - 10 - 3 TCAtcatattgaaCCA 155 _ 1 - 19 , 40 4812 156 CACAATCAACAACAAATA 4 - 12 - 2 CACAatcaacaacaaaTA 156 _ 1 - 16 , 16 4972 157 TACACAATCAACAACAAAT 4 - 13 - 2 TACAcaatcaacaacaaAT 157 _ 1 - 16 , 76 4973 158 CTGTACACAATCAACA 4 - 10 - 2 CTGTacacaatcaaCA 158 _ 1 - 19 , 05 4979 159 CACTAATAATTCACTTT 4 - 11 - 2 CACTaataattcactTT 159 _ 1 - 16 ,39 5058 160 CAACATTATTGACACT 2 - 10 - 4 CAacattattgaCACT 160 _ 1 - 17 , 17 5071 161 AAACTTTCCCAACATTAT 2 - 12 - 4 AAactttcccaacaTTAT 161 _ 1 - 18 , 69 5078 162 TCCTATATTCTCTTAAA 4 - 11 - 2 TCCTatattctcttaAA 162 _ 1 - 18 , 58 5094 163 TTTCCTATATTCTCTTA 4 - 11 - 2 TTTCctatattctctTA 163 _ 1 - 18 , 69 5096 164 CAAGTTTCCTATATTCT 4 - 11 - 2 CAAGtttcctatattCT 164 _ 1 - 19 , 97 5100 165 CAAGTTTCCTATATTC 4 - 10 - 2 CAAGtttcctatatTC 165 _ 1 - 17 , 47 5101 166 CATTCTATCTGCCAAA 2 - 10 - 4 CAttctatctgcCAAA 166 _ 1 - 18 , 36 5218 167 CCATTCTATCTGCCAAA 2 - 11 - 4 CCattctatctgcCAAA 167 _ 1 - 22 , 08 5218 168 TATAGCCATTCTATCT 4 - 10 - 2 TATAgccattctatCT 168 _ 1 - 20 , 63 5224 169 TTATAGCCATTCTATCT 4 - 11 - 2 TTATagccattctatCT 169 _ 1 - 20 , 82 5224 169 TTATAGCCATTCTATCT 1 - 10 - 3 - 1 - 2 TtatagccattCTAtCT 169 _ 2 - 20 , 51 5224 169 TTATAGCCATTCTATCT 2 - 9 - 1 - 2 - 3 TTatagccattCtaTCT 169 _ 3 - 20 , 12 5224 169 TTATAGCCATTCTATCT 1 - 1 - 1 - 8 - 2 - 1 - 3 TtAtagccattCTaTCT 169 _ 4 - 20 ,59 5224 169 TTATAGCCATTCTATCT 1 - 3 - 1 - 6 - 2 - 2 - 2 TtatAgccattCTatCT 169 _ 5 - 19 , 97 5224 169 TTATAGCCATTCTATCT 3 - 8 - 1 - 3 - 2 TTAtagccattCtatCT 169 _ 6 - 20 , 13 5224 169 TTATAGCCATTCTATCT 1 - 10 - 2 - 2 - 2 TtatagccattCTatCT 169 _ 7 - 19 , 37 5224 169 TTATAGCCATTCTATCT 2 - 9 - 1 - 1 - 4 TTAtagccattCtATCT 169 _ 8 - 21 , 02 5224 169 TTATAGCCATTCTATCT 1 - 1 - 1 - 8 - 1 - 1 - 4 TtAtagccattCtATCT 169 _ 9 - 19 , 88 5224 169 TTATAGCCATTCTATCT 1 - 2 - 1 - 7 - 1 - 1 - 4 TtaTagccattCtATCT 169 _ 10 - 20 , 65 5224 169 TTATAGCCATTCTATCT 1 - 3 - 1 - 6 - 1 - 1 - 4 TtatAgccattCtATCT 169 _ 11 - 20 , 38 5224 169 TTATAGCCATTCTATCT 1 - 10 - 1 - 1 - 4 TtatagccattCtATCT 169 _ 12 - 19 , 78 5224 169 TTATAGCCATTCTATCT 3 - 8 - 1 - 1 - 1 - 1 - 2 TTAtagccattCtAtCT 169 _ 13 - 20 , 22 5224 169 TTATAGCCATTCTATCT 2 - 1 - 1 - 7 - 1 - 1 - 1 - 1 - 2 TTaTagccattCtAtCT 169 _ 14 - 19 , 96 5224 169 TTATAGCCATTCTATCT 2 - 2 - 1 - 6 - 1 - 1 - 1 - 1 - 2 TTatAgccattCtAtCT 169 _ 15 - 19 ,69 5224 169 TTATAGCCATTCTATCT 2 - 9 - 1 - 1 - 1 - 1 - 2 TTATAGCCATTCtAtCT 169 _ 16 - 19 , 09 5224 169 TTATAGCCATTCTATCT 1 - 2 - 2 - 6 - 1 - 1 - 1 - 1 - 2 TtaTAgccattCtAtCT 169 _ 17 - 20 , 35 5224 169 TTATAGCCATTCTATCT 1 - 2 - 1 - 7 - 1 - 1 - 1 - 1 - 2 TtaTagccattCtAtCT 169 _ 18 - 18 , 72 5224 169 TTATAGCCATTCTATCT 1 - 3 - 1 - 6 - 1 - 1 - 1 - 1 - 2 TtatAgccattCtAtCT 169 _ 19 - 18 , 45 5224 169 TTATAGCCATTCTATCT 2 - 2 - 1 - 6 - 1 - 2 - 3 TTatAgccattCtaTCT 169 _ 20 - 20 , 71 5224 169 TTATAGCCATTCTATCT 1 - 1 - 2 - 7 - 1 - 2 - 3 TtATagccattCtaTCT 169 _ 21 - 20 , 65 5224 169 TTATAGCCATTCTATCT 1 - 1 - 1 - 1 - 6 - 1 - 2 - 3 TtAtAgccattCtaTCT 169 _ 22 - 19 , 57 5224 169 TTATAGCCATTCTATCT 1 - 1 - 1 - 8 - 1 - 2 - 3 TtAtagccattCtaTCT 169 _ 23 - 18 , 98 5224 169 TTATAGCCATTCTATCT 4 - 7 - 1 - 3 - 2 TTATagccattCtatCT 169 _ 24 - 21 , 80 5224 169 TTATAGCCATTCTATCT 3 - 1 - 1 - 6 - 1 - 3 - 2 TTAtAgccattCtatCT 169 _ 25 - 20 ,72 5224 169 TTATAGCCATTCTATCT 2 - 1 - 1 - 7 - 1 - 3 - 2 TTaTagccattCtatCT 169 _ 26 - 19 , 86 5224 169 TTATAGCCATTCTATCT 2 - 2 - 1 - 6 - 1 - 3 - 2 TTatAgccattCtatCT 169 _ 27 - 19 , 59 5224 169 TTATAGCCATTCTATCT 2 - 9 - 1 - 3 - 2 TTatagccattCtatCT 169 _ 28 - 18 , 99 5224 169 TTATAGCCATTCTATCT 1 - 1 - 3 - 6 - 1 - 3 - 2 TtATAgccattCtatCT 169 _ 29 - 21 , 16 5224 169 TTATAGCCATTCTATCT 1 - 1 - 2 - 7 - 1 - 3 - 2 TtATagccattCtatCT 169 _ 30 - 19 , 53 5224 169 TTATAGCCATTCTATCT 1 - 1 - 1 - 1 - 6 - 1 - 3 - 2 TtAtAgccattCtatCT 169 _ 31 - 18 , 45 5224 169 TTATAGCCATTCTATCT 1 - 2 - 2 - 6 - 1 - 3 - 2 TtaTAgccattCtatCT 169 _ 32 - 20 , 25 5224 169 TTATAGCCATTCTATCT 1 - 2 - 1 - 7 - 1 - 3 - 2 TtaTagccattCtatCT 169 _ 33 - 18 , 62 5224 169 TTATAGCCATTCTATCT 1 - 3 - 1 - 6 - 1 - 3 - 2 TtatAgccattCtatCT 169 _ 34 - 18 , 35 5224 169 TTATAGCCATTCTATCT 1 - 1 - 1 - 9 - 5 TtAtagccattcTATCT 169 _ 35 - 20 , 88 5224 169 TTATAGCCATTCTATCT 2 - 10 - 2 - 1 - 2 TTatagccattcTAtCT 169 _ 36 - 20 ,09 5224 169 TTATAGCCATTCTATCT 1 - 1 - 1 - 9 - 2 - 1 - 2 TtAtagccattcTAtCT 169 _ 37 - 18 , 95 5224 169 TTATAGCCATTCTATCT 1 - 2 - 1 - 8 - 2 - 1 - 2 TtaTagccattcTAtCT 169 _ 38 - 19 , 72 5224 169 TTATAGCCATTCTATCT 1 - 3 - 1 - 7 - 2 - 1 - 2 TtatAgccattcTAtCT 169 _ 39 - 19 , 44 5224 169 TTATAGCCATTCTATCT 1 - 11 - 2 - 1 - 2 TtatagccattcTAtCT 169 _ 40 - 18 , 85 5224 169 TTATAGCCATTCTATCT 3 - 9 - 1 - 1 - 3 TTAtagccattcTaTCT 169 _ 41 - 21 , 21 5224 169 TTATAGCCATTCTATCT 1 - 1 - 1 - 9 - 1 - 1 - 3 TtAtagccattcTaTCT 169 _ 42 - 18 , 94 5224 169 TTATAGCCATTCTATCT 3 - 9 - 1 - 2 - 2 TTAtagccattcTatCT 169 _ 43 - 20 , 09 5224 169 TTATAGCCATTCTATCT 1 - 2 - 1 - 8 - 1 - 2 - 2 TtaTagccattcTatCT 169 _ 44 - 18 , 58 5224 169 TTATAGCCATTCTATCT 1 - 3 - 1 - 7 - 1 - 2 - 2 TtatAgccattcTatCT 169 _ 45 ​​- 18 , 31 5224 169 TTATAGCCATTCTATCT 1 - 1 - 1 - 10 - 4 TtAtagccattctATCT 169 _ 46 - 18 , 90 5224 169 TTATAGCCATTCTATCT 3 - 10 - 1 - 1 - 2 TTAtagccattctAtCT 169 _ 47 - 19 ,24 5224 169 TTATAGCCATTCTATCT 2 - 11 - 1 - 1 - 2 TTAtagccattctAtCT 169 _ 48 - 18 , 11 5224 169 TTATAGCCATTCTATCT 1 - 2 - 2 - 8 - 1 - 1 - 2 TtaTAgccattctAtCT 169 _ 49 - 19 , 37 5224 169 TTATAGCCATTCTATCT 3 - 1 - 1 - 10 - 2 TTAtAgccattctatCT 169 _ 50 - 19 , 74 5224 169 TTATAGCCATTCTATCT 3 - 12 - 2 TTAtagccattctatCT 169 _ 51 - 19 , 15 5224 169 TTATAGCCATTCTATCT 2 - 1 - 2 - 10 - 2 TTaTAgccattctatCT 169 _ 52 - 20 , 51 5224 169 TTATAGCCATTCTATCT 2 - 1 - 1 - 11 - 2 TTaTagccattctatCT 169 _ 53 - 18 , 88 5224 169 TTATAGCCATTCTATCT 2 - 2 - 1 - 10 - 2 TTatAgccattctatCT 169 _ 54 - 18 , 61 5224 169 TTATAGCCATTCTATCT 2 - 13 - 2 TTatagccattctatCT 169 _ 55 - 18 , 02 5224 169 TTATAGCCATTCTATCT 1 - 1 - 3 - 10 - 2 TtATAgccattctatCT 169 _ 56 - 20 , 18 5224 169 TTATAGCCATTCTATCT 1 - 1 - 2 - 11 - 2 TtATagccattctatCT 169 _ 57 - 18 , 55 5224 169 TTATAGCCATTCTATCT 2 - 9 - 3 - 1 - 2 TTatagccattCTAtCT 169 _ 58 - 21 , 75 5224 169 TTATAGCCATTCTATCT 1 - 1 - 1 - 8 - 2 - 2 - 2 TtAtagccattCTatCT 169 _ 59 - 19 ,47 5224 169 TTATAGCCATTCTATCT 1 - 2 - 2 - 6 - 2 - 2 - 2 TtaTAgccattCTatCT 169 _ 60 - 21 , 87 5224 169 TTATAGCCATTCTATCT 1 - 1 - 3 - 6 - 1 - 1 - 1 - 1 - 2 TtATAgccattCtAtCT 169 _ 61 - 21 , 25 5224 169 TTATAGCCATTCTATCT 3 - 8 - 1 - 2 - 3 TTAtagccattCtaTCT 169 _ 62 - 21 , 25 5224 170 ATTTAAATTTCCAAACATT 2 - 13 - 4 ATttaaatttccaaaCATT 170 _ 1 - 16 , 82 5427 171 GCTAATTTAAATTTCC 4 - 10 - 2 GCTAatttaaatttCC 171 _ 1 - 18 , 50 5434 172 ATCAATATCTTCTCAC 3 - 10 - 3 ATCaatatcttctCAC 172 _ 1 - 17 , 10 5785 173 TATCAATATCTTCTCA 2 - 10 - 4 TAtcaatatcttCTCA 173 _ 1 - 17 , 55 5786 174 CTACAAATTCAATTTACT 2 - 12 - 4 CTacaaattcaattTACT 174 _ 1 - 17 , 38 6341 175 TCTTACTCTGACTTTCCA 2 - 14 - 2 TCttactctgactttcCA 175 _ 1 - 21 , 47 6694 176 TCTTACTCTGACTTTCC 2 - 12 - 3 TCttactctgacttTCC 176 _ 1 - 21 , 53 6695 177 AAATTTCCAAACCTTTC 2 - 11 - 4 AAatttccaaaccTTTC 177 _ 1 - 16 , 30 6958 178 CTTCTTGTTTATCCCAA 2 - 11 - 4 CTtcttgtttatcCCAA 178 _ 1 - 22 ,77 7159 179 TTCTTGTTTATCCCAA 2 - 10 - 4 TTcttgtttatcCCAA 179 _ 1 - 20 , 17 7159 180 ATGCTTCTAACTAACA 4 - 10 - 2 ATGCttctaactaaCA 180 _ 1 - 19 , 21 7720 181 CTTTAATGCTTCTAACT 4 - 11 - 2 CTTTaatgcttctaaCT 181 _ 1 - 18 , 49 7724 182 CCTTTAATGCTTCTAAC 2 - 11 - 4 CCtttaatgcttcTAAC 182 _ 1 - 20 , 06 7725 183 CTTTAATGCTTCTAAC 2 - 10 - 4 CTttaatgcttcTAAC 183 _ 1 - 16 , 07 7725 184 TTCCTTTAATGCTTCTA 4 - 11 - 2 TTCCtttaatgcttcTA 184 _ 1 - 21 , 59 7727 185 TATACCTTTCTTTAACCCT 2 - 15 - 2 TAtacctttctttaaccCT 185 _ 1 - 22 , 03 8117 186 ATACCTTTCTTTAACCC 4 - 11 - 2 ATACctttctttaacCC 186 _ 1 - 22 , 68 8118 187 TTATACCTTTCTTTAACC 4 - 12 - 2 TTATacctttctttaaCC 187 _ 1 - 21 , 52 8119 188 TTTATACCTTTCTTTAAC 2 - 12 - 4 TTtatacctttcttTAAC 188 _ 1 - 17 , 01 8120 189 TCAAGAATTCTCTCCTT 2 - 11 - 4 TCaagaattctctCCTT 189 _ 1 - 21 , 29 8571 190 TTCAAGAATTCTCTCC 2 - 10 - 4 TTcaagaattctCTCC 190 _ 1 - 19 , 38 8573 191 CTTCAAGAATTCTCTC 2 - 10 - 4 CTtcaagaattcTCTC 191 _ 1 - 18 ,00 8574 192 TCTTCAAGAATTCTCT 2 - 10 - 4 TCttcaagaattCTCT 192 _ 1 - 18 , 46 8575 193 ATCTTCAAGAATTCTC 3 - 10 - 3 ATCttcaagaattCTC 193 _ 1 - 17 , 04 8576 194 TTTCTTACTATCTTCA 4 - 10 - 2 TTTCttactatcttCA 194 _ 1 - 17 , 47 8585 195 CCTTTAGCATTTCTATT 2 - 11 - 4 CCtttagcatttcTATT 195 _ 1 - 21 , 72 8819 196 TCCTTTAGCATTTCTAT 3 - 11 - 3 TCCtttagcatttcTAT 196 _ 1 - 22 , 39 8820 197 GTTCTCTTTATTTCTTCT 2 - 12 - 4 GTtctctttatttcTTCT 197 _ 1 - 21 , 76 8887 198 TTTACTGTCAACTCCT 2 - 10 - 4 TTtactgtcaacTCCT 198 _ 1 - 20 , 83 9150 199 TTTCCAATGAATCTAT 2 - 10 - 4 TTtccaatgaatCTAT 199 _ 1 - 16 , 61 9201 200 CCTTTCCAATGAATCTA 2 - 11 - 4 CCtttccaatgaaTCTA 200 _ 1 - 22 , 34 9202 201 CTTTCCAATGAATCTA 2 - 10 - 4 CTttccaatgaaTCTA 201 _ 1 - 18 , 34 9202 202 CCTTTCCAATGAATCT 3 - 10 - 3 CCTttccaatgaaTCT 202 _ 1 - 21 , 30 9203 203 TTATACCCTTTCCAAT 2 - 10 - 4 TTataccctttcCAAT 203 _ 1 - 19 , 61 9209 204 GTTTATACCCTTTCCAA 3 - 11 - 3 GTTtataccctttcCAA 204 _ 1 - 21 ,88 9210 205 TTTATACCCTTTCCAA 2 - 10 - 4 TTtataccctttCCAA 205 _ 1 - 20 , 50 9210 206 GTTTATACCCTTTCCA 2 - 11 - 3 GTttataccctttCCA 206 _ 1 - 22 , 69 9211 207 TGTTTATACCCTTTCCA 3 - 12 - 2 TGTttataccctttcCA 207 _ 1 - 22 , 80 9211 208 ACTGTTTATACCCTTTCC 2 - 14 - 2 ACtgtttataccctttCC 208 _ 1 - 22 , 96 9212 208 ACTGTTTATACCCTTTCC 1 - 11 - 1 - 3 - 2 ActgtttataccCtttCC 208 _ 2 - 22 , 45 9212 208 ACTGTTTATACCCTTTCC 1 - 2 - 1 - 10 - 1 - 1 - 2 ActGtttataccctTtCC 208 _ 3 - 22 , 17 9212 208 ACTGTTTATACCCTTTCC 1 - 2 - 1 - 1 - 1 - 10 - 2 ActGtTtataccctttCC 208 _ 4 - 22 , 17 9212 208 ACTGTTTATACCCTTTCC 1 - 2 - 1 - 12 - 2 ActGtttataccctttCC 208 _ 5 - 21 , 87 9212 208 ACTGTTTATACCCTTTCC 1 - 3 - 1 - 11 - 2 ActgTttataccctttCC 208 _ 6 - 22 , 22 9212 208 ACTGTTTATACCCTTTCC 1 - 15 - 2 ActgtttataccctttCC 208 _ 7 - 21 , 56 9212 209 ACTGTTTATACCCTTTC 4 - 11 - 2 ACTGtttatacccttTC 209 _ 1 - 21 , 65 9213 209 ACTGTTTATACCCTTTC 1 - 11 - 1 - 2 - 2 ActgtttataccCttTC 209 _ 2 - 18 ,25 9213 209 ACTGTTTATACCCTTTC 1 - 1 - 1 - 8 - 1 - 1 - 1 - 1 - 2 AcTgtttatacCcTtTC 209 _ 3 - 19 , 56 9213 209 ACTGTTTATACCCTTTC 1 - 2 - 1 - 9 - 4 ActGtttatacccTTTC 209 _ 4 - 19 , 51 9213 209 ACTGTTTATACCCTTTC 1 - 3 - 1 - 6 - 1 - 2 - 3 ActgTttatacCctTTC 209 _ 5 - 19 , 51 9213 209 ACTGTTTATACCCTTTC 2 - 9 - 1 - 3 - 2 ACtgtttatacCcttTC 209 _ 6 - 19 , 43 9213 209 ACTGTTTATACCCTTTC 1 - 2 - 1 - 7 - 1 - 3 - 2 ActGtttatacCcttTC 209 _ 7 - 18 , 35 9213 209 ACTGTTTATACCCTTTC 1 - 3 - 1 - 8 - 1 - 1 - 2 ActgTttatacccTtTC 209 _ 8 - 18 , 53 9213 209 ACTGTTTATACCCTTTC 1 - 11 - 1 - 1 - 3 ActgtttataccCtTTC 209 _ 9 - 19 , 06 9213 209 ACTGTTTATACCCTTTC 2 - 10 - 1 - 2 - 2 ACtgtttataccCttTC 209 _ 10 - 19 , 64 9213 210 AACTGTTTATACCCTTT 4 - 11 - 2 AACTgtttataccctTT 210 _ 1 - 19 , 51 9214 211 TATGACTCCAATAATC 3 - 10 - 3 TATgactccaataATC 211 _ 1 - 16 , 57 10832 212 CTCCTTTATGACTCCAA 4 - 11 - 2 CTCCtttatgactccAA 212 _ 1 - 22 , 74 10837 213 CTCCTTTATGACTCCA 3 - 11 - 2 CTCctttatgactcCA 213 _ 1 - 21 ,50 10838 214 CCATTATTTCTTAAATA 4 - 11 - 2 CCATtatttcttaaaTA 214 _ 1 - 17 , 56 10877 215 ATTTCATATTACTAACTA 2 - 12 - 4 ATttcatattactaACTA 215 _ 1 - 16 , 64 11434 216 CATTTCATATTACTAACT 3 - 12 - 3 CATttcatattactaACT 216 _ 1 - 17 , 70 11435 217 TCATTTCATATTACTAAC 4 - 12 - 2 TCATttcatattactaAC 217 _ 1 - 16 , 72 11436 218 ATCATTTCATATTACTA 3 - 11 - 3 ATCatttcatattaCTA 218 _ 1 - 17 , 23 11438 219 TTATCATTTCATATTACT 4 - 12 - 2 TTATcatttcatattaCT 219 _ 1 - 17 , 77 11439 220 TGTACTTTCCTTTACCA 2 - 13 - 2 TGtactttcctttacCA 220 _ 1 - 20 , 37 11464 221 TATACACCATCATTATA 4 - 11 - 2 TATAcaccacattaTA 221 _ 1 - 18 , 48 11507 222 TTATACACCATCATTAT 3 - 11 - 3 TTAtacaccatcatTAT 222 _ 1 - 17 , 83 11508 223 TATTTATACACCATCAT 3 - 11 - 3 TATttacaccatCAT 223 _ 1 - 18, 54 11511 224 TTATTTATACACCATC 2 - 10 - 4 TTatttatacacCATC 224 _ 1 - 16 , 60 11513 225 AATTATTTATACACCAT 2 - 11 - 4 AAttatttatacaCCAT 225 _ 1 - 16 , 82 11514 226 CATGACACTTACATAA 3 - 10 - 3 CATgacacttacaTAA 226 _ 1 - 16 ,26 11736 227 AGTTCACTACTATTAC 3 - 10 - 3 AGTtcactactatTAC 227 _ 1 - 17 , 55 12361 228 ATAAGCTTACCTCATA 2 - 10 - 4 ATaagcttacctCATA 228 _ 1 - 19 , 32 12794 229 TATAAGCTTACCTCAT 3 - 10 - 3 TATaagcttacctCAT 229 _ 1 - 19 , 32 12795 230 ATATAAGCTTACCTCA 4 - 10 - 2 ATATaagcttacctCA 230 _ 1 - 19 , 32 12796 231 CTTCCCTTTGATAACAT 3 - 11 - 3 CTTccctttgataaCAT 231 _ 1 - 21 , 19 12894 232 TTCCCTTTGATAACAT 4 - 10 - 2 TTCCctttgataacAT 232 _ 1 - 19 , 27 12894 233 CCTTCCCTTTGATAACA 2 - 12 - 3 CCttccctttgataACA 233 _ 1 - 23 , 06 12895 234 CTTCCCTTTGATAACA 4 - 10 - 2 CTTCcctttgataaCA 234 _ 1 - 20 , 51 12895 235 CCTTCCCTTTGATAAC 3 - 11 - 2 CCTtccctttgataAC 235 _ 1 - 20 , 96 12896 236 TTGATTCAATTCCCTTA 2 - 11 - 4 TTgattcaattccCTTA 236 _ 1 - 20 , 48 13223 236 TTGATTCAATTCCCTTA 2 - 9 - 1 - 1 - 1 - 1 - 2 TTgattcaattCcCtTA 236 _ 2 - 19 , 54 13223 236 TTGATTCAATTCCCTTA 2 - 10 - 1 - 1 - 3 TTgattcaattcCcTTA 236 _ 3 - 19 , 59 13223 236 TTGATTCAATTCCCTTA 2 - 1 - 1 - 8 - 1 - 2 - 2 TTgAttcaattcCctTA 236 _ 4 - 19 ,06 13223 236 TTGATTCAATTCCCTTA 2 - 2 - 1 - 7 - 1 - 2 - 2 TTgaTtcaattcCctTA 236 _ 5 - 19 , 00 13223 236 TTGATTCAATTCCCTTA 2 - 9 - 1 - 3 - 2 TTgattcaattCcctTA 236 _ 6 - 18 , 65 13223 236 TTGATTCAATTCCCTTA 1 - 2 - 2 - 6 - 2 - 2 - 2 TtgATtcaattCCctTA 236 _ 7 - 21 , 37 13223 236 TTGATTCAATTCCCTTA 2 - 1 - 1 - 7 - 1 - 1 - 1 - 2 TTgAttcaattCcCtTA 236 _ 8 - 20 , 04 13223 236 TTGATTCAATTCCCTTA 1 - 1 - 2 - 7 - 1 - 1 - 1 - 1 - 2 TtGAttcaattCcCtTA 236 _ 9 - 20 , 10 13223 236 TTGATTCAATTCCCTTA 1 - 2 - 1 - 9 - 4 TtgAttcaattccCTTA 236 _ 10 - 19 , 67 13223 236 TTGATTCAATTCCCTTA 1 - 3 - 1 - 6 - 1 - 1 - 1 - 1 - 2 TtgaTtcaattCcCtTA 236 _ 11 - 18 , 67 13223 236 TTGATTCAATTCCCTTA 2 - 10 - 1 - 2 - 2 TTgattcaattcCctTA 236 _ 12 - 18 , 56 13223 236 TTGATTCAATTCCCTTA 1 - 2 - 2 - 7 - 2 - 1 - 2 TtgATtcaattcCCtTA 236 _ 13 - 21 , 49 13223 236 TTGATTCAATTCCCTTA 1 - 1 - 2 - 8 - 1 - 2 - 2 TtGAttcaattcCctTA 236 _ 14 - 19 , 13 13223 236 TTGATTCAATTCCCTTA 2 - 11 - 1 - 1 - 2 TTgattcaattccCtTA 236 _ 15 - 18 ,77 13223 236 TTGATTCAATTCCCTTA 1 - 1 - 1 - 1 - 1 - 8 - 1 - 1 - 2 TtGaTtcaattccCtTA 236 _ 16 - 18 , 07 13223 236 TTGATTCAATTCCCTTA 1 - 1 - 2 - 7 - 2 - 2 - 2 TtGAttcaattCCctTA 236 _ 17 - 21 , 50 13223 236 TTGATTCAATTCCCTTA 1 - 2 - 1 - 7 - 1 - 1 - 4 TtgAttcaattCcCTTA 236 _ 18 - 20 , 44 13223 236 TTGATTCAATTCCCTTA 3 - 8 - 1 - 1 - 1 - 1 - 2 TTGattcaattCcCtTA 236 _ 19 - 20 , 60 13223 236 TTGATTCAATTCCCTTA 2 - 2 - 1 - 6 - 1 - 3 - 2 TTgaTtcaattCcctTA 236 _ 20 - 19 , 09 13223 236 TTGATTCAATTCCCTTA 2 - 2 - 1 - 7 - 2 - 1 - 2 TTgaTtcaattcCCtTA 236 _ 21 - 21 , 49 13223 237 ATTGATTCAATTCCCTT 2 - 11 - 4 ATtgattcaattcCCTT 237 _ 1 - 21 , 28 13224 237 ATTGATTCAATTCCCTT 3 - 8 - 3 - 1 - 2 ATTgattcaatTCCcTT 237 _ 2 - 22 , 78 13224 237 ATTGATTCAATTCCCTT 1 - 1 - 1 - 8 - 3 - 1 - 2 AtTgattcaatTCCcTT 237 _ 3 - 21 , 02 13224 237 ATTGATTCAATTCCCTT 1 - 2 - 1 - 8 - 2 - 1 - 2 AttGattcaattCCcTT 237 _ 4 - 19 , 40 13224 237 ATTGATTCAATTCCCTT 1 - 3 - 1 - 7 - 2 - 1 - 2 AttgAttcaattCCcTT 237 _ 5 - 19 ,74 13224 237 ATTGATTCAATTCCCTT 1 - 2 - 1 - 7 - 2 - 1 - 3 AttGattcaatTCcCTT 237 _ 6 - 19 , 67 13224 237 ATTGATTCAATTCCCTT 2 - 2 - 1 - 7 - 1 - 1 - 3 ATtgAttcaattCcCTT 237 _ 7 - 20 , 27 13224 237 ATTGATTCAATTCCCTT 1 - 1 - 1 - 9 - 1 - 1 - 3 AtTgattcaattCcCTT 237 _ 8 - 19 , 32 13224 237 ATTGATTCAATTCCCTT 1 - 3 - 1 - 7 - 1 - 1 - 3 AttgAttcaattCcCTT 237 _ 9 - 19 , 02 13224 237 ATTGATTCAATTCCCTT 1 - 1 - 1 - 1 - 1 - 7 - 2 - 1 - 2 AtTgAttcaattCCcTT 237 _ 10 - 20 , 53 13224 237 ATTGATTCAATTCCCTT 1 - 2 - 2 - 7 - 2 - 1 - 2 AttGAttcaattCCcTT 237 _ 11 - 21 , 11 13224 237 ATTGATTCAATTCCCTT 1 - 2 - 1 - 8 - 1 - 1 - 3 AttGattcaattCcCTT 237 _ 12 - 18 , 68 13224 237 ATTGATTCAATTCCCTT 1 - 1 - 2 - 8 - 1 - 2 - 2 AtTGattcaattCccTT 237 _ 13 - 18 , 81 13224 237 ATTGATTCAATTCCCTT 3 - 10 - 1 - 1 - 2 ATTgattcaattcCcTT 237 _ 14 - 19 , 42 13224 237 ATTGATTCAATTCCCTT 1 - 1 - 2 - 9 - 4 AtTGattcaattcCCTT 237 _ 15 - 21 , 89 13224 237 ATTGATTCAATTCCCTT 2 - 2 - 1 - 8 - 1 - 1 - 2 ATtgAttcaattcCcTT 237 _ 16 - 18 ,61 13224 237 ATTGATTCAATTCCCTT 1 - 2 - 2 - 6 - 3 - 1 - 2 AttGAttcaatTCCcTT 237 _ 17 - 22 , 09 13224 237 ATTGATTCAATTCCCTT 1 - 1 - 1 - 8 - 2 - 1 - 3 AtTgattcaatTCcCTT 237 _ 18 - 20 , 30 13224 237 ATTGATTCAATTCCCTT 1 - 1 - 1 - 9 - 2 - 1 - 2 AtTgattcaattCCcTT 237 _ 19 - 20 , 03 13224 237 ATTGATTCAATTCCCTT 1 - 1 - 1 - 1 - 1 - 7 - 1 - 1 - 3 AtTgAttcaattCcCTT 237 _ 20 - 19 , 82 13224 237 ATTGATTCAATTCCCTT 3 - 1 - 1 - 8 - 1 - 1 - 2 ATTgAttcaattcCcTT 237 _ 21 - 19 , 92 13224 238 TTGATTCAATTCCCTT 2 - 10 - 4 TTgattcaattcCCTT 238 _ 1 - 20 , 52 13224 239 TATTGATTCAATTCCCT 2 - 11 - 4 TAttgattcaattCCCT 239 _ 1 - 22 , 82 13225 239 TATTGATTCAATTCCCT 3 - 9 - 2 - 1 - 2 TATtgattcaatTCcCT 239 _ 2 - 21 , 17 13225 239 TATTGATTCAATTCCCT 2 - 9 - 1 - 1 - 1 - 1 - 2 TAttgattcaaTtCcCT 239 _ 3 - 19 , 37 13225 239 TATTGATTCAATTCCCT 1 - 1 - 2 - 7 - 3 - 1 - 2 TaTTgattcaaTTCcCT 239 _ 4 - 21 , 49 13225 239 TATTGATTCAATTCCCT 1 - 3 - 1 - 6 - 3 - 1 - 2 TattGattcaaTTCcCT 239 _ 5 - 19 ,90 13225 239 TATTGATTCAATTCCCT 2 - 9 - 1 - 2 - 3 TAttgattcaaTtcCCT 239 _ 6 - 20 , 89 13225 239 TATTGATTCAATTCCCT 1 - 10 - 1 - 2 - 3 TattgattcaaTtcCCT 239 _ 7 - 19 , 76 13225 239 TATTGATTCAATTCCCT 1 - 1 - 1 - 1 - 1 - 8 - 1 - 1 - 2 TaTtGattcaattCcCT 239 _ 8 - 18 , 41 13225 239 TATTGATTCAATTCCCT 1 - 2 - 2 - 8 - 1 - 1 - 2 TatTGattcaattCcCT 239 _ 9 - 19 , 66 13225 239 TATTGATTCAATTCCCT 1 - 2 - 1 - 9 - 1 - 1 - 2 TatTgattcaattCcCT 239 _ 10 - 18 , 60 13225 239 TATTGATTCAATTCCCT 2 - 2 - 1 - 10 - 2 TAttGattcaattccCT 239 _ 11 - 18 , 33 13225 239 TATTGATTCAATTCCCT 1 - 12 - 4 TattgattcaattCCCT 239 _ 12 - 21 , 69 13225 239 TATTGATTCAATTCCCT 2 - 1 - 1 - 9 - 1 - 1 - 2 TAtTgattcaattCcCT 239 _ 13 - 19 , 73 13225 239 TATTGATTCAATTCCCT 2 - 12 - 3 TAttgattcaattcCCT 239 _ 14 - 20 , 45 13225 239 TATTGATTCAATTCCCT 1 - 2 - 1 - 10 - 3 TatTgattcaattcCCT 239 _ 15 - 20 , 11 13225 239 TATTGATTCAATTCCCT 1 - 1 - 3 - 10 - 2 TaTTGattcaattccCT 239 _ 16 - 19 ,84 13225 239 TATTGATTCAATTCCCT 1 - 1 - 1 - 1 - 1 - 6 - 3 - 1 - 2 TaTtGattcaaTTCcCT 239 _ 17 - 20 , 34 13225 239 TATTGATTCAATTCCCT 2 - 2 - 1 - 6 - 1 - 1 - 1 - 1 - 2 TAttGattcaaTtCcCT 239 _ 18 - 19 , 54 13225 239 TATTGATTCAATTCCCT 2 - 1 - 1 - 8 - 2 - 1 - 2 TAtTgattcaatTCcCT 239 _ 19 - 20 , 72 13225 239 TATTGATTCAATTCCCT 1 - 1 - 2 - 9 - 1 - 1 - 2 TaTTgattcaattCcCT 239 _ 20 - 19 , 55 13225 239 TATTGATTCAATTCCCT 2 - 1 - 1 - 10 - 3 TAtTgattcaattcCCT 239 _ 21 - 21 , 24 13225 240 TATTGATTCAATTCCC 3 - 10 - 3 TATtgattcaattCCC 240 _ 1 - 20 , 58 13226 241 GCACATTCTTTCTATAC 3 - 11 - 3 GCAcattctttctaTAC 241 _ 1 - 21 , 17 15115 241 GCACATTCTTTCTATAC 1 - 1 - 3 - 6 - 2 - 2 - 2 GcACAttctttCTatAC 241 _ 2 - 20 , 68 15115 241 GCACATTCTTTCTATAC 1 - 1 - 1 - 1 - 1 - 6 - 1 - 2 - 3 GcAcAttctttCtaTAC 241 _ 3 - 18 , 46 15115 241 GCACATTCTTTCTATAC 1 - 1 - 2 - 7 - 1 - 2 - 3 GcACattctttCtaTAC 241 _ 4 - 19 , 49 15115 241 GCACATTCTTTCTATAC 2 - 9 - 1 - 3 - 2 GCacattctttCtatAC 241 _ 5 - 18 ,68 15115 241 GCACATTCTTTCTATAC 1 - 1 - 3 - 8 - 4 GcACAttctttctATAC 241 _ 6 - 20 , 89 15115 241 GCACATTCTTTCTATAC 2 - 2 - 1 - 9 - 3 GCacAttctttctaTAC 241 _ 7 - 19 , 66 15115 241 GCACATTCTTTCTATAC 2 - 1 - 1 - 11 - 2 GCaCattctttctatAC 241 _ 8 - 18 , 39 15115 241 GCACATTCTTTCTATAC 1 - 1 - 3 - 9 - 3 GcACAttctttctaTAC 241 _ 9 - 19 , 98 15115 241 GCACATTCTTTCTATAC 3 - 12 - 2 GCAcattctttctatAC 241 _ 10 - 19 , 27 15115 241 GCACATTCTTTCTATAC 1 - 1 - 1 - 1 - 1 - 6 - 1 - 1 - 4 GcAcAttctttCtATAC 241 _ 11 - 19 , 36 15115 241 GCACATTCTTTCTATAC 3 - 8 - 1 - 1 - 1 - 1 - 2 GCAcattctttCtAtAC 241 _ 12 - 20 , 34 15115 241 GCACATTCTTTCTATAC 2 - 1 - 1 - 7 - 1 - 2 - 3 GCaCattctttCtaTAC 241 _ 13 - 21 , 27 15115 241 GCACATTCTTTCTATAC 1 - 2 - 2 - 8 - 4 GcaCAttctttctATAC 241 _ 14 - 20 , 33 15115 241 GCACATTCTTTCTATAC 1 - 1 - 3 - 10 - 2 GcACAttctttctatAC 241 _ 15 - 18 , 08 15115 242 GAATTTCAACTACTAT 2 - 10 - 4 GAatttcaactaCTAT 242 _ 1 - 16 ,13 15258 243 CCATTTATTTCCATTTAT 3 - 12 - 3 CCAtttatttccattTAT 243 _ 1 - 21 , 92 15568 244 TTTCCATTTATTTCCATTT 4 - 13 - 2 TTTCcatttatttccatTT 244 _ 1 - 20 , 93 15570 244 TTTCCATTTATTTCCATTT 1 - 4 - 1 - 7 - 1 - 1 - 4 TttccAtttatttCcATTT 244 _ 2 - 20 , 48 15570 244 TTTCCATTTATTTCCATTT 2 - 1 - 1 - 10 - 2 - 1 - 2 TTtCcatttatttcCAtTT 244 _ 3 - 21 , 47 15570 244 TTTCCATTTATTTCCATTT 1 - 2 - 1 - 1 - 1 - 7 - 1 - 3 - 2 TttCcAtttatttCcatTT 244 _ 4 - 19 , 43 15570 244 TTTCCATTTATTTCCATTT 2 - 2 - 2 - 11 - 2 TTtcCAtttatttccatTT 244 _ 5 - 20 , 70 15570 245 CTTTCCATTTATTTCCAT 3 - 12 - 3 CTTtccatttatttcCAT 245 _ 1 - 22 , 31 15572 246 TCTTTCCATTTATTTCCA 4 - 12 - 2 TCTTtccatttatttcCA 246 _ 1 - 22 , 74 15573 247 ATCTTTCCATTTATTTCC 3 - 12 - 3 ATCtttccatttattTCC 247 _ 1 - 22 , 85 15574 248 TTCCATGCAAACTTTA 4 - 10 - 2 TTCCatgcaaacttTA 248 _ 1 - 19 , 01 15722 249 CAGTTTAAATTCACAC 3 - 10 - 3 CAGtttaaattcaCAC 249 _ 1 - 16 , 68 16597 250 CTATTCCAGTTTAAAT 4 - 10 - 2 CTATtccagtttaaAT 250 _ 1 - 16 ,86 16603 251 TGCAAATACCTCTTCA 4 - 10 - 2 TGCAaatacctcttCA 251 _ 1 - 21 , 49 16730 252 CTAAATAGATTCCACT 2 - 10 - 4 CTaaatagattcCACT 252 _ 1 - 17 , 95 16849 253 TATTGATATTACTCT 2 - 10 - 4 TAttgatatttaCTCT 253 _ 1 - 16 , 32 17089 254 CCTTAGTATTACAATT 4 - 10 - 2 CCTTagtattacaaTT 254 _ 1 - 17 , 43 17401 255 CTATTCAATAAACTAAACA 4 - 13 - 2 CTATtcaataaactaaCA 255 _ 1 - 16, 45 24290 256 CAGCTATTCAATAAAC 4 - 10 - 2 CAGCtattccaataaAC 256 _ 1 - 16 , 94 24296 257 TATAGACCCAAACTAT 3 - 10 - 3 TATagacccaaacTAT 257 _ 1 - 18 , 15 24811 258 TAATCCATACATCTAT 2 - 11 - 4 TAatcctacatCTAT 258 _ 1 - 20 , 45 25032 259 ATAATCCCATACATCTA 3 - 11 - 3 ATAatcctacatCTA 259 _ 1 - 20 , 45 25033 260 ATCTCAACTACCATTT 4 - 10 - 2 ATCTcaactaccatTT 260 _ 1 - 18 , 14 25250 261 AATCTCAACTACCATT 4 - 10 - 2 AATCtcaactaccaTT 261 _ 1 - 16 , 76 25251 262 ACAACTTCTATCATAC 3 - 10 - 3 ACAacttctatcaTAC 262 _ 1 - 16 , 33 25718 263 GAACAACTTCTATCAT 2 - 10 - 4 GAacaacttctaTCAT 263 _ 1 - 16 ,94 25720 264 TGAACAACTTCTATCA 3 - 10 - 3 TGAacaacttctaTCA 264 _ 1 - 17 , 36 25721 265 TACACAAATACTTAAATCA 4 - 13 - 2 TACAcaaatacttaaatCA 265 _ 1 - 16 , 93 26331 266 TTAAGCTTTCACCTAT 2 - 10 - 4 TTaagctttcacCTAT 266 _ 1 - 19 , 36 27165 267 AAACTCTTGCATCTACT 2 - 13 - 2 AAactcttgcatctaCT 267 _ 1 - 16 , 65 27248 268 AAATTTCTCAACCTAAATTT 2 - 14 - 4 AAatttctcaacctaaATTT 268 _ 1 - 16 , 78 29330 269 CCAACATAGATCCTCT 2 - 10 - 4 CCaacatagatcCTCT 269 _ 1 - 22 , 49 29635 270 TCCAACATAGATCCTCT 2 - 11 - 4 TCcaacatagatcCTCT 270 _ 1 - 22 , 81 29635 271 CTCCAACATAGATCCTC 3 - 11 - 3 CTCcaacatagatcCTC 271 _ 1 - 22 , 81 29636 272 TCCAACATAGATCCTC 2 - 10 - 4 TCcaacatagatCCTC 272 _ 1 - 21 , 69 29636 273 CTCCAACATAGATCCT 3 - 10 - 3 CTCcaacatagatCCT 273 _ 1 - 22 , 68 29637 274 TCTCCAACATAGATCCT 4 - 11 - 2 TCTCcaacatagatcCT 274 _ 1 - 22 , 81 29637 275 ATTCTCAATTGCACTT 4 - 10 - 2 ATTCtcaattgcacTT 275 _ 1 - 17 , 90 29661 276 TATTCTCAATTGCACTT 4 - 11 - 2 TATTctcaattgcacTT 276 _ 1 - 18 ,54 29661 277 TCACCTAATAGCACCA 2 - 10 - 4 TCacctaatagcACCA 277 _ 1 - 21 , 99 29684 278 TTCACCTAATAGCACCA 2 - 11 - 4 TTcacctaataagcACCA 278 _ 1 - 22 , 53 29684 279 CATTATTATTTAACCTT 2 - 11 - 4 CAttattatttaaCCTT 279 _ 1 - 17 , 83 30455 280 ACATTATTATTTAACCT 3 - 11 - 3 ACAttattatttaaCCT 280 _ 1 - 18 , 05 30456 281 TACATTATTATTATTAACC 4 - 11 - 2 TACAtattatttaaCC 281 _ 1 - 16, 80 30457 282 CATTTACATTATTATTTAAC 2 - 14 - 4 CAtttacattattattTAAC 282 _ 1 - 16 , 44 30458 283 CTCATTTACATTATTATT 4 - 12 - 2 CTCAtttacattattaTT 283 _ 1 - 17 , 33 30462 284 TATCTCATTTACATTATT 4 - 12 - 2 TATCtcatttacattaTT 284 _ 1 - 17 , 62 30465 285 ATCATTCTCAACAATTA 4 - 11 - 2 ATCAttctcaacaatTA 285 _ 1 - 17 , 04 30601 285 ATCATTCTCAACAATTA 4 - 7 - 6 ATCAttctcaaCAATTA 285 _ 2 - 21 , 48 30601 285 ATCATTCTCAACAATTA 1 - 1 - 3 - 6 - 6 AtCATtctcaaCAATTA 285 _ 3 - 20 , 80 30601 285 ATCATTCTCAACAATTA 5 - 6 - 2 - 2 - 2 ATCATtctcaaCAatTA 285 _ 4 - 20 ,46 30601 285 ATCATTCTCAACAATTA 4 - 7 - 1 - 1 - 4 ATCAttctcaaCaATTA 285 _ 5 - 19 , 80 30601 285 ATCATTCTCAACAATTA 5 - 7 - 1 - 1 - 3 ATCATtctcaacAaTTA 285 _ 6 - 19 , 31 30601 285 ATCATTCTCAACAATTA 5 - 6 - 3 - 1 - 2 ATCATtctcaaCAAtTA 285 _ 7 - 20 , 97 30601 285 ATCATTCTCAACAATTA 4 - 7 - 2 - 1 - 3 ATCAttctcaaCAaTTA 285 _ 8 - 20 , 16 30601 285 ATCATTCTCAACAATTA 5 - 6 - 1 - 1 - 4 ATCATtctcaaCaATTA 285 _ 9 - 21 , 05 30601 285 ATCATTCTCAACAATTA 5 - 6 - 1 - 1 - 1 - 1 - 2 ATCATtctcaaCaAtTA 285 _ 10 - 19 , 29 30601 285 ATCATTCTCAACAATTA 1 - 1 - 3 - 7 - 5 AtCATtctcaacAATTA 285 _ 11 - 18 , 70 30601 286 AAGATCATTCTCAACA 4 - 10 - 2 AAGAtcattctcaaCA 286 _ 1 - 17 , 15 30605 287 TCTCAAAGATCATTCTC 3 - 11 - 3 TCTcaaagatcattCTC 287 _ 1 - 19 , 02 30609 288 TCTCAAAGATCATTCT 4 - 10 - 2 TCTCaaaagatcattCT 288 _ 1 - 17 , 81 30610 289 ACTTAATTATACTTCCC 4 - 10 - 2 ACTTaattatacttCC 289 _ 1 - 17 , 28 30667 290 TACACTTAATTATACTTC 2 - 12 - 4 TAcacttaattataCTTC 290 _ 1 - 16 ,87 30668 291 TTACACTTAATTATACTT 3 - 12 - 3 TTAcacttaattataCTT 291 _ 1 - 16 , 20 30669 292 TTTACACTTAATTATACT 2 - 12 - 4 TTtacacttaattaTACT 292 _ 1 - 16 , 23 30670 293 CTATTTAATTTACACTT 3 - 11 - 3 CTAtttaatttacaCTT 293 _ 1 - 16 , 26 30679 294 TATCTATTTAATTTACAC 3 - 12 - 3 TATctatttaatttaCAC 294 _ 1 - 16 , 06 30681 295 TTTATCTATTTAATTTACA 4 - 13 - 2 TTTAtctatttaatttaCA 295 _ 1 - 16 , 34 30682 296 CTCTGCTTATAACTTT 4 - 10 - 2 CTCTgcttataactTT 296 _ 1 - 18 , 51 30699 297 CCTCTGCTTATAACTT 3 - 10 - 3 CCTctgcttataaCTT 297 _ 1 - 21 , 29 30700 298 TCCTCTGCTTATAACTT 3 - 12 - 2 TCCtctgcttataacTT 298 _ 1 - 20 , 86 30700 299 TCCTCTGCTTATAACT 3 - 11 - 2 TCCtctgcttataaCT 299 _ 1 - 20 , 70 30701 300 TTCCTCTGCTTATAACT 3 - 12 - 2 TTCctctgctattaaCT 300 _ 1 - 20 , 03 30701 301 TTTCCTCTGCTTATAAC 4 - 11 - 2 TTTCctctgcttataAC 301 _ 1 - 19 , 20 30702 302 TACTATACTTTCCTCT 2 - 10 - 4 TActatactttcCTCT 302 _ 1 - 20 , 07 30711 303 TTCTACTACTATACTTTCC 4 - 10 - 2 TTCTactatactttCC 303 _ 1 - 19 ,55 30714 304 AGTTCTACTATACTTTC 4 - 11 - 2 AGTTctactatacttTC 304 _ 1 - 18 , 49 30715 304 AGTTCTACTATACTTTC 1 - 10 - 6 AgttctactatACTTTC 304 _ 2 - 18 , 76 30715 304 AGTTCTACTATACTTTC 1 - 1 - 2 - 7 - 1 - 1 - 4 AgTTctactatAcTTTC 304 _ 3 - 18 , 23 30715 304 AGTTCTACTATACTTTC 3 - 8 - 2 - 2 - 2 AGTtctactatACttTC 304 _ 4 - 19 , 19 30715 304 AGTTCTACTATACTTTC 2 - 2 - 1 - 6 - 1 - 1 - 4 AGttCtactatAcTTTC 304 _ 5 - 19 , 07 30715 304 AGTTCTACTATACTTTC 1 - 2 - 2 - 8 - 4 AgtTCtactatacTTTC 304 _ 6 - 18 , 46 30715 304 AGTTCTACTATACTTTC 3 - 10 - 1 - 1 - 2 AGTtctactatacTtTC 304 _ 7 - 18 , 12 30715 304 AGTTCTACTATACTTTC 3 - 11 - 3 AGTtctactatactTTC 304 _ 8 - 18 , 42 30715 304 AGTTCTACTATACTTTC 3 - 1 - 1 - 10 - 2 AGTtCtactatacttTC 304 _ 9 - 18 , 58 30715 304 AGTTCTACTATACTTTC 2 - 1 - 2 - 10 - 2 AGtTCtactatacttTC 304 _ 10 - 18 , 02 30715 304 AGTTCTACTATACTTTC 1 - 2 - 2 - 6 - 2 - 1 - 3 AgtTCtactatACtTTC 304 _ 11 - 19 , 02 30715 304 AGTTCTACTATACTTTC 2 - 1 - 2 - 6 - 1 - 3 - 2 AGtTCtactatActtTC 304 _ 12 - 18 ,22 30715 304 AGTTCTACTATACTTTC 2 - 2 - 1 - 7 - 2 - 1 - 2 AGttCtactataCTtTC 304 _ 13 - 19 , 22 30715 304 AGTTCTACTATACTTTC 3 - 1 - 1 - 7 - 1 - 1 - 3 AGTtCtactataCtTTC 304 _ 14 - 20 , 39 30715 304 AGTTCTACTATACTTTC 1 - 1 - 1 - 1 - 1 - 8 - 4 AgTtCtactatacTTTC 304 _ 15 - 18 , 13 30715 305 GTTCTACTATACTTTC 4 - 10 - 2 GTTCtactatacttTC 305 _ 1 - 17 , 48 30715 306 CATTATATTTAAACTATCA 4 - 13 - 2 CATTatatttaaactatCA 306 _ 1 - 16 , 93 31630 307 CACATTATATTTAAACTAT 2 - 13 - 4 CAcattatatttaaaCTAT 307 _ 1 - 17 , 11 31632 308 ACACATTATATTTAAACTA 3 - 13 - 3 ACAcattatatttaaaCTA 308 _ 1 - 17 , 09 31633 309 ACCACCTAAGACCTCAA 2 - 11 - 4 ACcacctaagaccTCAA 309 _ 1 - 22 , 49 32755 310 CCACCTAAGACCTCAA 2 - 10 - 4 CCacctaagaccTCAA 310 _ 1 - 22 , 63 32755 311 ACCACCTAAGACCTCA 2 - 11 - 3 ACcacctaagaccTCA 311 _ 1 - 21 , 74 32756 312 ACCTTAAGTAACATTT 4 - 10 - 2 ACCTtaagtaacatTT 312 _ 1 - 16 , 82 33366 313 CACCTTAAGTAACATT 4 - 10 - 2 CACCttaagtaacaTT 313 _ 1 - 18 ,05 33367 314 CCACCTTAAGTAACAT 3 - 10 - 3 CCAccttaagtaaCAT 314 _ 1 - 20 , 70 33368 315 ACCACCTTAAGTAACA 4 - 10 - 2 ACCAccttaagtaaCA 315 _ 1 - 20 , 68 33369 316 TTATTAACCACCTTAA 3 - 10 - 3 TTAttaaccacctTAA 316 _ 1 - 16 , 19 33375 317 CATTATTAACCACCTT 2 - 10 - 4 CAttattaaccaCCTT 317 _ 1 - 19 , 92 33377 318 ACATTATTAACCACCT 3 - 10 - 3 ACAttattaaccaCCT 318 _ 1 - 20 , 14 33378 319 ACCAATTATACTTACAA 3 - 11 - 3 ACCaattatacttaCAA 319 _ 1 - 17 , 16 36606 320 AACCAATTATACTTACA 4 - 11 - 2 AACCaattatacttaCA 320 _ 1 - 17 , 16 36607 321 CAAATACAGATTATCC 2 - 10 - 4 CAaatacagattATCC 321 _ 1 - 16 , 44 38092 322 TTTACATTCCCATCATC 2 - 11 - 4 TTtacattcccatCATC 322 _ 1 - 21 , 08 38297 323 CACACCTATTATATAAT 4 - 11 - 2 CACAcctattatataAT 323 _ 1 - 17 , 02 39173 324 TCACACCTATTATATAA 3 - 11 - 3 TCAcacctattataTAA 324 _ 1 - 17 , 02 39174 325 CTTCACACCTATTATATA 2 - 12 - 4 CTtcacacctattaTATA 325 _ 1 - 20 , 65 39175 326 ACTTCACACCTATTATAT 3 - 12 - 3 ACTtcacacctattaTAT 326 _ 1 - 20 ,46 39176 327 GCTCACACTAATTATT 2 - 10 - 4 GCtcacactaatTATT 327 _ 1 - 18 , 72 39228 328 ATGCTCACACTAATTA 4 - 10 - 2 ATGCtcacactaatTA 328 _ 1 - 19 , 38 39230 329 AATGCTCACACTAATT 4 - 10 - 2 AATGctcacactaaTT 329 _ 1 - 16 , 21 39231 330 AAACTGTACACCTACT 2 - 10 - 4 AAactgtacaccTACT 330 _ 1 - 17 , 99 39563 331 GTTTCCATCTACTATTA 2 - 11 - 4 GTttccatctactATTA 331 _ 1 - 19 , 78 39808 332 TTTCCATCTACTATTA 4 - 10 - 2 TTTCcatctactatTA 332 _ 1 - 17 , 25 39808 333 TGACATAACCATATAC 3 - 10 - 3 TGAcataaccataTAC 333 _ 1 - 16 , 63 39931 334 GCTCCCAAACAACTAA 2 - 12 - 2 GCtcccaaacaactAA 334 _ 1 - 17 , 55 41114 335 CCTCAATACTCTACTT 4 - 10 - 2 CCTCaatactctacTT 335 _ 1 - 20 , 30 41444 336 GACCTCAATACTCTACT 3 - 11 - 3 GACctcaatactctACT 336 _ 1 - 21 , 01 41445 337 GACCTCAATACTCTAC 4 - 10 - 2 GACCtcaatactctAC 337 _ 1 - 20 , 02 41446 338 TACTAAACATACACATA 4 - 11 - 2 TACTaaacatacacaTA 338 _ 1 - 16 , 12 41725 339 CTACTAAACATACACAT 3 - 11 - 3 CTActaaacatacaCAT 339 _ 1 - 17 ,31 41726 340 TTCTACTAAACATACAC 3 - 11 - 3 TTCtactaaacataCAC 340 _ 1 - 16 , 07 41728 341 TACCAATAGTTACCTT 2 - 10 - 4 TAccaatagttaCCTT 341 _ 1 - 20 , 03 42167 342 CTTACCAATAGTTACCT 3 - 11 - 3 CTTaccaatagttaCCT 342 _ 1 - 22 , 29 42168 343 TTACCAATAGTTACCT 3 - 10 - 3 TTAccaatagttaCCT 343 _ 1 - 20 , 03 42168 344 CTTACCAATAGTTACC 4 - 10 - 2 CTTAccaatagttaCC 344 _ 1 - 20 , 03 42169 345 TCTTACCAATAGTTACC 4 - 11 - 2 TCTTaccaatagttaCC 345 _ 1 - 21 , 30 42169 346 TCAAAGCACACCACCAC 2 - 12 - 3 TCaaagcacaccacCAC 346 _ 1 - 21 , 69 42287 347 ATTCAAAGCACACCACC 2 - 12 - 3 ATtcaaagcacaccACC 347 _ 1 - 21 , 00 42289 348 AGACTAATCCTCTTAA 3 - 10 - 3 AGActaatcctctTAA 348 _ 1 - 17 , 72 43452 349 TAGACTAATCCTCTTA 4 - 10 - 2 TAGActaatcctctTA 349 _ 1 - 19 , 20 43453 350 CCCATTTCTAACATTTAC 3 - 12 - 3 CCCatttctaacattTAC 350 _ 1 - 22 , 93 43562 351 ACCCATTTCTAACATT 4 - 10 - 2 ACCCatttctaacaTT 351 _ 1 - 20 , 64 43565 352 AACCCATTTCTAACAT 4 - 10 - 2 AACCcatttctaacAT 352 _ 1 - 18 ,25 43566 353 CCTCAACTTCACCAAT 2 - 10 - 4 CCtcaacttcacCAAT 353 _ 1 - 21 , 73 43634 354 ACTGATTTCCTTAAAC 4 - 10 - 2 ACTGatttccttaaAC 354 _ 1 - 16 , 67 44180 355 CACTGATTTCCTTAAAC 4 - 11 - 2 CACTgatttccttaaAC 355 _ 1 - 18 , 91 44180 356 CCACTGATTTCCTTAAA 4 - 11 - 2 CCACtgatttccttaAA 356 _ 1 - 20 , 91 44181 357 ACCACTGATTTCCTTA 2 - 10 - 4 ACcactgatttcCTTA 357 _ 1 - 20 , 98 44183 358 CACCACTGATTTCCTT 3 - 10 - 3 CACcactgatttcCTT 358 _ 1 - 22 , 04 44184 359 CTCTGCAATACACCAA 2 - 10 - 4 CTctgcaatacaCCAA 359 _ 1 - 20 , 90 44439 360 ACTCTGCAATACACCA 3 - 10 - 3 ACTctgcaatacaCCA 360 _ 1 - 22 , 19 44440 361 TACTCTGCAATACACCA 2 - 11 - 4 TActctgcaatacACCA 361 _ 1 - 22 , 32 44440 361 TACTCTGCAATACACCA 1 - 1 - 1 - 10 - 1 - 1 - 2 TaCtctgcaatacAcCA 361 _ 2 - 19 , 29 44440 361 TACTCTGCAATACACCA 1 - 3 - 1 - 8 - 1 - 1 - 2 TactCtgcaatacAcCA 361 _ 3 - 19 , 28 44440 361 TACTCTGCAATACACCA 1 - 10 - 1 - 3 - 2 TactctgcaatAcacCA 361 _ 4 - 18 ,35 44440 361 TACTCTGCAATACACCA 2 - 10 - 2 - 1 - 2 TActctgcaataCAcCA 361 _ 5 - 21 , 63 44440 361 TACTCTGCAATACACCA 1 - 13 - 3 TactctgcaatacaCCA 361 _ 6 - 20 , 54 44440 361 TACTCTGCAATACACCA 2 - 10 - 1 - 2 - 2 TActctgcaataCacCA 361 _ 7 - 20 , 06 44440 361 TACTCTGCAATACACCA 1 - 1 - 1 - 12 - 2 TaCtctgcaatacacCA 361 _ 8 - 19 , 14 44440 361 TACTCTGCAATACACCA 1 - 2 - 2 - 10 - 2 TacTCtgcaatacacCA 361 _ 9 - 20 , 33 44440 361 TACTCTGCAATACACCA 1 - 3 - 1 - 10 - 2 TactCtgcaatacacCA 361 _ 10 - 19 , 13 44440 362 TACTCTGCAATACACC 2 - 10 - 4 TActctgcaataCACC 362 _ 1 - 21 , 12 44441 362 TACTCTGCAATACACC 1 - 1 - 1 - 11 - 2 TaCtctgcaatacaCC 362 _ 2 - 18 , 23 44441 362 TACTCTGCAATACACC 1 - 1 - 1 - 10 - 3 TaCtctgcaatacACC 362 _ 3 - 18 , 78 44441 362 TACTCTGCAATACACC 1 - 3 - 1 - 7 - 4 TactCtgcaataCACC 362 _ 4 - 20 , 87 44441 362 TACTCTGCAATACACC 3 - 11 - 2 TACtctgcaatacaCC 362 _ 5 - 19 , 86 44441 362 TACTCTGCAATACACC 2 - 2 - 1 - 9 - 2 TActCtgcaatacaCC 362 _ 6 - 19 ,44 44441 362 TACTCTGCAATACACC 2 - 12 - 2 TActctgcaatacaCC 362 _ 7 - 18 , 47 44441 362 TACTCTGCAATACACC 1 - 2 - 2 - 9 - 2 TacTCtgcaatacaCC 362 _ 8 - 19 , 42 44441 362 TACTCTGCAATACACC 2 - 1 - 2 - 9 - 2 TAcTCtgcaatacaCC 362 _ 9 - 20 , 64 44441 362 TACTCTGCAATACACC 1 - 3 - 1 - 9 - 2 TactCtgcaatacaCC 362 _ 10 - 18 , 22 44441 363 TTACTCTGCAATACACC 2 - 11 - 4 TTactctgcaataCACC 363 _ 1 - 21 , 71 44441 364 TTACTCTGCAATACAC 3 - 10 - 3 TTActctgcaataCAC 364 _ 1 - 17 , 75 44442 365 TTTACTCTGCAATACAC 3 - 11 - 3 TTTactctgcaataCAC 365 _ 1 - 18 , 34 44442 366 CTTTACTCTGCAATACA 2 - 11 - 4 CTttactctgcaaTACA 366 _ 1 - 20 , 23 44443 367 TTTACTCTGCAATACA 2 - 10 - 4 TTtactctgcaaTACA 367 _ 1 - 17 , 56 44443 368 GACCACACTTTCTACCA 2 - 13 - 2 GAccacactttctacCA 368 _ 1 - 21 , 72 44477 369 GACCACACTTTCTACC 2 - 12 - 2 GAccacactttctaCC 369 _ 1 - 20 , 81 44478 370 AAGAAACACCCTTCCA 2 - 10 - 4 AAgaaacaccctTCCA 370 _ 1 - 21 , 48 44776 371 ATCTGCTACATATTCTT 4 - 11 - 2 ATCTgctacatattcTT 371 _ 1 - 19 ,88 45216 372 ATCTGCTACATATTCT 4 - 10 - 2 ATCTgctacatattCT 372 _ 1 - 19 , 71 45217 373 CATCTGCTACATATTCT 4 - 11 - 2 CATCtgctacatattCT 373 _ 1 - 21 , 32 45217 374 CATCTGCTACATATTC 4 - 10 - 2 CATCtgctacatatTC 374 _ 1 - 18 , 82 45218 375 TTCAACCCTAATCACT 4 - 10 - 2 TTCAaccctaatcaCT 375 _ 1 - 19 , 99 45246 376 ATTCAACCCTAATCAC 2 - 10 - 4 ATtcaaccctaaTCAC 376 _ 1 - 18 , 67 45247 377 CATTCAACCCTAATCA 3 - 10 - 3 CATtcaaccctaaTCA 377 _ 1 - 19 , 93 45248 378 GCATTCAACCCTAATCA 3 - 12 - 2 GCAttcaaccctaatCA 378 _ 1 - 22 , 56 45248 379 AGCATTCAACCCTAATC 4 - 11 - 2 AGCAttcaaccctaaTC 379 _ 1 - 22 , 98 45249 380 GCATTCAACCCTAATC 4 - 10 - 2 GCATtcaaccctaaTC 380 _ 1 - 21 , 63 45249 381 AGCATTCAACCCTAAT 4 - 10 - 2 AGCAttcaaccctaAT 381 _ 1 - 21 , 62 45250 382 CAGCATTCAACCCTAAT 3 - 12 - 2 CAGcattcaaccctaAT 382 _ 1 - 21 , 12 45250 383 TTAAATCCAGCATTCA 3 - 10 - 3 TTAaatccagcatTCA 383 _ 1 - 18 , 08 45258 384 CTCCATATTTAAATCC 4 - 10 - 2 CTCCatatttaaatCC 384 _ 1 - 20 ,02 45266 385 GCTCCATATTTAAATCC 4 - 11 - 2 GCTCcatatttaaatCC 385 _ 1 - 22 , 84 45266 386 GCTCCATATTTAAATC 4 - 10 - 2 GCTCcatatttaaaTC 386 _ 1 - 18 , 78 45267 387 AGCTCCATATTTAAAT 4 - 10 - 2 AGCTccatatttaaAT 387 _ 1 - 18 , 62 45268 388 TAAGCTCCATATTTAA 3 - 10 - 3 TAAgctccatattTAA 388 _ 1 - 16 , 08 45270 389 CCTAAGCTCCATATTTA 3 - 11 - 3 CCTaagctccatatTTA 389 _ 1 - 22 , 65 45271 390 CTAAGCTCCATATTTA 4 - 10 - 2 CTAAgctccatattTA 390 _ 1 - 18 , 81 45271 391 CCTAAGCTCCATATTT 4 - 10 - 2 CCTAagctccatatTT 391 _ 1 - 21 , 57 45272 392 TCTACCCTAAATTCCC 2 - 11 - 3 TCtaccctaaattCCC 392 _ 1 - 23 , 00 45560 393 CACATCTTGTATACAA 3 - 10 - 3 CACatcttgtataCAA 393 _ 1 - 16 , 65 45627 394 ACACATCTTGTATACA 4 - 10 - 2 ACACatcttgtataCA 394 _ 1 - 17 , 95 45628 395 CTACACATCTTGTATAC 3 - 11 - 3 CTAcacatcttgtaTAC 395 _ 1 - 19 , 13 45629 396 TACACATCTTGTATAC 3 - 10 - 3 TACacatcttgtaTAC 396 _ 1 - 16 , 73 45629 397 CTTGACTACACATCTT 3 - 10 - 3 CTTgactacacatCTT 397 _ 1 - 18 ,89 45635 398 CTCTACAACAGTCCCA 3 - 11 - 2 CTCtacaacagtccCA 398 _ 1 - 22 , 06 45709 399 TCTCTACAACAGTCCCA 2 - 13 - 2 TCtctacaacagtccCA 399 _ 1 - 21 , 70 45709 400 ATAACATTACTCTTAACA 3 - 12 - 3 ATAacattactcttaACA 400 _ 1 - 17 , 03 46215 401 TTTGACATTCCATCTCC 2 - 12 - 3 TTtgacattccatcTCC 401 _ 1 - 21 , 62 46256 402 CTTTGACATTCCATCTC 2 - 11 - 4 CTttgacattccaTCTC 402 _ 1 - 21 , 88 46257 403 TCTTTGACATTCCATCTC 4 - 12 - 2 TCTTtgacattccatcTC 403 _ 1 - 22 , 41 46257 404 TTTGACATTCCATCTC 3 - 10 - 3 TTTgacattccatCTC 404 _ 1 - 19 , 40 46257 405 ATCTTTGACATTCCATC 2 - 11 - 4 ATctttgacattcCATC 405 _ 1 - 20 , 53 46259 406 TATCTTTGACATTCCAT 2 - 11 - 4 TAtctttgacattCCAT 406 _ 1 - 21 , 32 46260 407 TACTATCTTTGACATTC 4 - 11 - 2 TACTatctttgacatTC 407 _ 1 - 18 , 39 46263 408 TACTATCTTTGACATT 4 - 10 - 2 TACTatctttgacaTT 408 _ 1 - 16 , 84 46264 409 CTGTATACACCATCCC 2 - 12 - 2 CTgtatacaccatcCC 409 _ 1 - 21 , 84 46392 410 TCTGTATACACCATCC 4 - 10 - 2 TCTGtatacaccatCC 410 _ 1 - 22 ,73 46393 411 TTTCTGACTCCCTATCC 2 - 13 - 2 TTtctgactccctatCC 411 _ 1 - 22 , 48 46420 412 CCTATGTTAATACTTTC 4 - 11 - 2 CCTAtgttaatacttTC 412 _ 1 - 19 , 53 46505 413 CTATGTTAATACTTTC 4 - 10 - 2 CTATgttaatacttTC 413 _ 1 - 16 , 09 46505 414 CCTATGTTAATACTTT 4 - 10 - 2 CCTAtgttaatactTT 414 _ 1 - 17 , 85 46506 415 TCCTATGTTAATACTT 3 - 10 - 3 TCCtatgttaataCTT 415 _ 1 - 18 , 47 46507 416 ATCCTATGTTAATACT 4 - 10 - 2 ATCCtatgttaataCT 416 _ 1 - 18 , 71 46508 417 ATTTCATTAAGTCACCC 3 - 11 - 3 ATTtcattaagtcaCCC 417 _ 1 - 22 , 16 47364 418 ATTTCATTAAGTCACC 2 - 10 - 4 ATttcattaagtCACC 418 _ 1 - 18 , 79 47365 419 CTCTCCTCAAGATCAAC 3 - 11 - 3 CTCtcctcaagatcAAC 419 _ 1 - 20 , 29 48110 420 CTCTCCTCAAGATCAA 3 - 10 - 3 CTCtcctcaagatCAA 420 _ 1 - 20 , 33 48111 421 CCATACAGTATATACA 4 - 10 - 2 CCATacagtatataCA 421 _ 1 - 19 , 53 48186 422 CAACTATTATCTTCTT 2 - 10 - 4 CAactattatctTCTT 422 _ 1 - 16 , 38 48221 423 ACAACTATTATCTTCT 3 - 10 - 3 ACAactattatctTCT 423 _ 1 - 16 ,60 48222 424 TTGCTTCCAATTTATTT 4 - 11 - 2 TTGCttccaatttatTT 424 _ 1 - 19 , 93 50282 425 ATCTCATGACCACCTAA 3 - 11 - 3 ATCtcatgaccaccTAA 425 _ 1 - 21 , 74 51241 425 ATCTCATGACCACCTAA 1 - 1 - 1 - 9 - 2 - 1 - 2 AtCtcatgaccaCCtAA 425 _ 2 - 21 , 11 51241 425 ATCTCATGACCACCTAA 1 - 1 - 1 - 8 - 1 - 2 - 3 AtCtcatgaccAccTAA 425 _ 3 - 19 , 96 51241 425 ATCTCATGACCACCTAA 1 - 12 - 4 AtctcatgaccacCTAA 425 _ 4 - 20 , 40 51241 425 ATCTCATGACCACCTAA 3 - 10 - 1 - 1 - 2 ATCtcatgaccacCtAA 425 _ 5 - 20 , 66 51241 425 ATCTCATGACCACCTAA 1 - 1 - 1 - 10 - 1 - 1 - 2 AtCtcatgaccacCtAA 425 _ 6 - 18 , 72 51241 425 ATCTCATGACCACCTAA 1 - 1 - 1 - 9 - 1 - 1 - 3 AtCtcatgaccaCcTAA 425 _ 7 - 20 , 59 51241 425 ATCTCATGACCACCTAA 1 - 2 - 2 - 7 - 1 - 1 - 3 AtcTCatgaccaCcTAA 425 _ 8 - 21 , 48 51241 425 ATCTCATGACCACCTAA 1 - 3 - 1 - 8 - 4 AtctCatgaccacCTAA 425 _ 9 - 21 , 07 51241 425 ATCTCATGACCACCTAA 1 - 1 - 3 - 8 - 1 - 1 - 2 AtCTCatgaccacCtAA 425 _ 10 - 21 ,27 51241 426 TCTCATGACCACCTAA 2 - 10 - 4 TCtcatgaccacCTAA 426 _ 1 - 21 , 25 51241 427 ATCTCATGACCACCTA 3 - 10 - 3 ATCtcatgaccacCTA 427 _ 1 - 22 , 56 51242 428 TATCTCATGACCACCTA 2 - 12 - 3 TAtctcatgaccacCTA 428 _ 1 - 21 , 88 51242 429 TTTATCTCATGACCACC 2 - 11 - 4 TTtatctcatgacCACC 429 _ 1 - 22 , 37 51244 430 TTTATCTCATGACCAC 2 - 10 - 4 TTtatctcatgaCCAC 430 _ 1 - 19 , 56 51245 431 ATTCTTACCGTCTTTA 4 - 10 - 2 ATTCttaccgtcttTA 431 _ 1 - 19 , 52 51358 432 TATTCTTACCGTCTTTA 3 - 11 - 3 TATtcttaccgtctTTA 432 _ 1 - 20 , 10 51358 433 TATTCTTACCGTCTTT 2 - 10 - 4 TAttcttaccgtCTTT 433 _ 1 - 19 , 30 51359 434 TTATTCTTACCGTCTTT 2 - 11 - 4 TTattcttaccgtCTTT 434 _ 1 - 19 , 99 51359 435 ATCTGATCTCACACAT 3 - 10 - 3 ATCtgatctcacaCAT 435 _ 1 - 19 , 62 51438 436 CATCTGATCTCACACAT 4 - 11 - 2 CATCtgatctcacacAT 436 _ 1 - 20 , 82 51438 437 ACTTCCAGATTTCTACA 2 - 11 - 4 ACttccagatttcTACA 437 _ 1 - 21 , 44 51953 438 TTTATGTTTACTTCAT 3 - 10 - 3 TTTatgtttacttCAT 438 _ 1 - 16 ,05 52150 439 TAAAGATCCCATCACTC 3 - 11 - 3 TAAagatcccatcaCTC 439 _ 1 - 20 , 31 52549 440 TAAAGATCCCATCACT 4 - 10 - 2 TAAAgatcccatcaCT 440 _ 1 - 18 , 82 52550 441 CCTAAAGATCCCATCAC 2 - 12 - 3 CCtaaagatcccatCAC 441 _ 1 - 22 , 32 52551 442 ATCATCAGTTACATCA 4 - 10 - 2 ATCAtcagttacatCA 442 _ 1 - 18 , 64 52579 443 ACTCTCACTGTAACTTT 4 - 11 - 2 ACTCtcactgtaactTT 443 _ 1 - 19 , 76 53012 444 AACTCTCACTGTAACTT 3 - 11 - 3 AACtctcactgtaaCTT 444 _ 1 - 18 , 53 53013 445 ACTCTCACTGTAACTT 3 - 10 - 3 ACTctcactgtaaCTT 445 _ 1 - 19 , 04 53013 446 AACTCTCACTGTAACT 4 - 10 - 2 AACTctcactgtaaCT 446 _ 1 - 17 , 97 53014 447 CAACTCTCACTGTAACT 4 - 11 - 2 CAACtctcactgtaaCT 447 _ 1 - 20 , 01 53014 448 CCTTTCATTAACATTTA 3 - 11 - 3 CCTttcattaacatTTA 448 _ 1 - 19 , 03 54198 449 TTCCTTTCATTAACATTT 4 - 12 - 2 TTCCtttcattaacatTT 449 _ 1 - 19 , 92 54199 450 TAATCCTATTCCAACT 3 - 10 - 3 TAAtcctattccaACT 450 _ 1 - 18 , 05 54232 451 CTAATCCTATTCCAAC 2 - 10 - 4 CTaatcctattcCAAC 451 _ 1 - 18 ,65 54233 452 CTCTAATCCTATTCCA 3 - 10 - 3 CTCtaatcctattCCA 452 _ 1 - 22 , 58 54235 453 TCTCTAATCCTATTCC 4 - 10 - 2 TCTCtaatcctattCC 453 _ 1 - 21 , 78 54236 454 T...

Claims

Claim 1. An antisense oligonucleotide wherein the oligonucleotide is the oligonucleotide compound TTAcActtaattatactTCC (Compound ID No. 7_626) wherein uppercase letters represent beta-D-oxy LNA nucleosides, lowercase letters represent DNA nucleosides, all LNA Cs are 5-methylcytosine, and all internucleoside linkages are phosphorothioate internucleoside linkages.

2. A pharmaceutical composition comprising the oligonucleotide of claim 1 and a pharmaceutically acceptable diluent, solvent, carrier, salt and / or adjuvant.

3. The pharmaceutical composition according to claim 2, wherein the pharmaceutically acceptable diluent comprises phosphate buffered saline (PBS).

4. The pharmaceutical composition according to claim 2 or 3, wherein the pharmaceutically acceptable salt is a sodium salt.

5. The pharmaceutical composition according to claim 2 or 3, wherein the pharmaceutically acceptable salt is a potassium salt.

6. An antisense oligonucleotide according to claim 1 or a pharmaceutical composition according to any one of claims 2 to 5 for use as a medicament.

7. An in vivo or ex vivo method for inducing UBE3A expression in a target cell wherein expression of paternal UBE3A is suppressed, said method comprising administering to said cell an effective amount of an oligonucleotide of claim 1 or a pharmaceutical composition according to any one of claims 2 to 5.

8. The method according to claim 7, wherein the expression of UBE3A is increased by at least 40% compared to a control.

9. The method according to claim 7 or 8, wherein the transcription level of the SNHG14 downstream SNORD109B is reduced by at least 30% compared to a control.

10. The method according to any one of claims 7 to 9, wherein the target cell is a neuronal cell.

11. The method of any one of claims 17 to 10, wherein the expression of SNORD115 is not significantly affected compared to a control.

12. The oligonucleotide of claim 1 or the pharmaceutical composition of any one of claims 2 to 5 for use in the treatment of Engelman syndrome.

13. A pharmaceutically acceptable salt of the antisense oligonucleotide of claim 1.

14. A pharmaceutically acceptable sodium salt of the antisense oligonucleotide of claim 1.

15. A pharmaceutically acceptable potassium salt of the antisense oligonucleotide of claim 1.

Images