Small Nucleotide Interfering Drugs (SIOLIGO) for the Treatment of Cole-Carpenter Syndrome (CCS)
Patent Information
- Application Number
- IT102024000012964
- Authority / Receiving Office
- IT · IT
- Patent Type
- Patents
- Current Assignee / Owner
- Filing Date
- 2024-06-06
- Publication Date
- 2026-07-01
- Estimated Expiration
- 2044-06-06
AI Technical Summary
Current treatments for Cole-Carpenter syndrome (CCS), a genetic disorder causing brittle bones and frequent fractures, are inadequate in effectively targeting the underlying genetic mutation in the P4HB gene, leading to uncontrolled expression of the mutated PDIA1 protein.
Development of small interfering nucleotides (siOligos) specifically designed to target and reduce the expression of the mutated P4HB gene, utilizing nucleotide sequences that are complementary to the mutation site and optionally incorporating nucleotide mismatches for enhanced specificity, along with chemical modifications for stability and delivery, such as 2'-OMe and LNA derivatives, to selectively silence the mutated PDIA1 protein.
The siOligos effectively reduce the expression of the mutated PDIA1 protein more than the wild-type, offering a targeted therapeutic approach to treat CCS by enhancing the stability and efficacy of the siRNA molecules in vivo.
Description
SMALL INTERFERING NUCLEOTIDES (siOligo) FOR THE TREATMENT OF Cole-Carpenter Syndrome (CCS) The present invention relates to small interfering nucleotides (siOligos), or their derivatives or precursors, complementary to the region that includes a mutation 5 point in the mRNA of the mutated human P4HB gene, where the said mutation is the A1178G point mutation causing the amino acid substitution Tyrosine (Y) with the amino acid Cysteine (C), in position 393 in the protein it encodes (P4HB- Y393C) which causes Cole-Carpenter syndrome (CCS) in humans, as well as pharmaceutical compositions that include them and their use as a medicine, and 10 in particular in the treatment of CCS. STATE OF THE ART Cole-Carpenter syndrome (CCS), discovered in 1987, especially affects the 15 bones, which become brittle and fracture many times. One of the genes whose mutation is responsible for CCS, known as P4HB, was identified in 2015. This gene encodes the β-subunit of prolyl4-hydroxylase, a multifunctional enzyme that is a member of the protein sulfide isomerase (PDI) family. CCS is a rare genetic disease that mainly affects the bones, which become fragile. 20 and fractures several times. It was discovered in 1987 and affected individuals present fractures non-traumatic, frontal bossing, micrognathia, ocular proptosis, hydrocephalus communicating and craniosynostosis. Furthermore, patients with CCS present skeletal deformities associated with so-called "popcorn epiphyses" in the long bones; genetically, CCS presents a heredity 25 autosomal dominant with a prevalence <1:1,000,000. The heterozygous mutation p.Y393C in the P4HB gene causes CCS, leading to an amino acid substitution between tyrosine and cysteine in the protein chain. This gene encodes the β subunit of prolyl 4-hydroxylase, a multifunctional enzyme belonging to the Protein 4 family Disulfide Isomerase (PDI), designated PDIA1. PDIA1 is the most abundant protein in the 30 Endoplasmic Reticulum (ER) and is involved in the formation of disulfide bridges in nascent polypeptide chains, playing a central role in the formation and protein folding. Furthermore, this enzyme is involved in the hydroxylation of prolyl residues of procollagen 1 and acts as a chaperone, inhibiting aggregation of misfolded proteins. For these reasons, the global deletion of PDI is 35 embryologically lethal. Interestingly, the PDIA1 enzyme is widely expressed in organisms and has been linked to many other common medical conditions, including diseases cardiovascular, neurological and metabolic. In fact, PDIA1 is involved in regulation of the renal receptor for angiotensin II type 1 (AT1) in the kidney and is 5 also involved in the secretion of proinsulin by pancreatic β cells. To date, there are no studies demonstrating how the PDIA1Y393C mutation induces CCS affects skeletal and non-skeletal tissues and the disease does not has a cure. Due to its rare and neglected genetic nature, CCS has no cure. Patients become 10 adults in poor health and presenting symptoms such as: low height, poor bone density, numerous fractures, early closure of the sutures of the skull, ocular protrusion, hydrocephalus, facial deformations. It is therefore extremely important to develop therapies that can restore functions normal cells. 15 Small interfering nucleotides (siOligo) are short single-stranded oligonucleotides or double that can be used to regulate gene transcription and interfere, therefore, with the expression of the molecules they encode. siOligos can include various types of small nucleic acid sequences, such as single-stranded oligonucleotides, double-stranded oligonucleotides, oligonucleotides 20 antisense (ASOs), microRNAs (miRNAs) and small interfering RNAs (siRNAs). RNA interference is a mechanism that regulates gene expression at the post-transduction level. Small interfering RNAs (siRNAs) are a class of double-stranded RNA molecules. filament, between 19 and 21 nucleotides long, which have the ability to reduce the expression of genes in an extremely specific way. These are small sequences of 25 RNAs used in the laboratory to modify the function of cells, which have revolutionized cell biology by enabling previously unimaginable manipulations precluded. There remains therefore the need to find and then supply an effective product in treatment of Cole-Carpenter syndrome (CCS). SUMMARY OF THE INVENTION Small interfering oligonucleotides (siOligos) are small nucleotide sequences complementary to specific messenger RNA (mRNA) sequences, which induce them degradation resulting in reduced gene expression. The sequences of 35 siOligo can therefore be designed and potentially adapted to any type of target mRNA. - 3 - SIB B5859R The authors of the present invention have surprisingly found that some siOligo molecules, which maintain shared characteristics, can be used for the treatment of CCS, for which no cure has yet been identified. The data reported in this description show that, in the absence of such characteristics 5 shared, yesOligo also very similar, I am not able to selectively mute the mutated mRNA. The Authors provide, in this description, siOligo capable of bind, the mRNA of the P4HB gene carrying the point mutation A1178G, which causes the replacement of the amino acid Tyrosine (Y) with the amino acid Cysteine (C), in position 393 in humans (P4HB-Y393C), of which preferred forms are shown in Table 1. 10 The efficacy tests, carried out on stable cellular models carrying the human mutation of the P4HB gene, and in particular HEK293 cells transfected with a vector carrying the wild-type (P4HB-WT) or mutated (P4HB-Y393C) human construct associated with GFP (Green Fluorescence Protein) sequence, they showed how different sequences including shared characteristics, were able to selectively reduce 15 the expression of GFP mRNA associated with the mutated form of the P4HB gene, while the GFP transcript associated with the wild-type form remains unchanged (Figure 6B,F,I,J,K) while very similar sequences, but which did not include such features, nevertheless By reducing the amount of mutated protein, they showed less selectivity. In order to provide in vivo data, siOligos corresponding to those were created 20 for human use, comprising the same shared characteristics, and have been tested successfully in mouse models of CCS carrying the amino acid substitution Y395C, homologous to the human Y393C, as a proof of concept (see examples). The syOligos of the invention present in some cases the addition of a mismatch nucleotide relative to the corresponding target sequence of the mutant P4HB mRNA, 25 in order to increase its specificity against the mutated mRNA without affecting the expression of the wild-type (normal) one. Therefore, they are the object of the present invention a siOligo, its derivative or precursor, complementary to the region that includes 30 the point mutation A1178G in the mutated human P4HB gene, having a sequence nucleotide sequence of 15 to 25 nucleotides, wherein said nucleotide sequence comprises up to 17 nucleotides downstream or upstream of said mutation, and wherein said siOligo reduces the expression of the protein encoded by the said mutated human gene but not of its wild type form, - 4 - SIB B5859R a pharmaceutical composition comprising one or more syOligo or a derivative thereof or precursor according to any of the embodiments described herein, and a pharmaceutically acceptable excipient and / or carrier, a kit for evaluating the effectiveness of a therapy that includes the 5 administration of a siOligo according to the present invention or of a composition pharmaceutical according to the present invention, comprising a siOligo according to a any of the embodiments described herein, and a diagnostic agent. GLOSSARY 10 In this description, the term “siOligo” refers to a small interfering oligonucleotide. The term “small interfering RNAs (siRNAs)” in the invention refers to sequences of double strand (duplex), of which the first is called "guide" (or antisense) and the second "passenger" (or sense). The guide strand (antisense) is the one 15 complementary to the target RNA that is to be inhibited, silenced, or degraded. Since the sequence of the passenger strand is complementary to the leading strand, for all the siRNAs of the invention indicated in this application are reported only the guide strand sequence. The siRNAs of the invention have a sequence comprising or consisting of a fragment composed of 15 to 25 nucleotides, e.g. 16, 20 17, 18, 19, 20, 21, 22, 23, 25 or 25 nucleotides containing the point mutation. siRNAs or their derivatives can be used as their precursors in vivo. According to the present invention, the point mutation A1178G causes the replacement of the amino acid Tyrosine (Y) with the amino acid Cysteine (C), in position 393 in humans (P4HB-Y393C). 25 In this description, the term "derivatives" or "chemical derivatives" refers to siOligo subjected to specific chemical modifications, such as the substitution of one or more nucleotides or the addition of chemical groups, in order to improve stability, specificity or activity of the siOligos themselves. In the present invention, the term “precursors” refers to shRNA (short 30 hairpin RNA). As an example, siRNAs can be replaced by the corresponding shRNA (short hairpin RNA), particularly in gene therapy. As is known to a person skilled in the art, shRNAs are short sequences or transcripts of RNA, which consist of a double-stranded structure formed by the coupling of two complementary sequences of about 15-29 nucleotides each, normally 19-25 or 15- 35 20, connected by a loop of about 2-10 nucleotides, for example 4-9 or 5-6 nucleotides. When introduced and expressed in the cell, the transcripts that form the shRNA - 5 - SIB B5859R are processed by the DICER enzyme complex, which, by cutting the sequence ring, converts, directly in the cell, the shRNAs into the corresponding siRNAs. These the latter will perform their function of silencing or reducing the target gene. Therefore, in the context of gene therapy, the siRNAs of the invention 5 can be replaced by the corresponding shRNAs. In this description, the mutated human P4HB gene with point mutation A1178G is the gene with genbank ID: NM_000918.4. The identification number refers to that of the gene in the GENBANK database updated to April 2025.In this invention with the expression “complementary to the region that includes the 10 A1178G point mutation in the mutated human P4HB gene” means a nucleotide sequence that matches complementarily to the portion of the gene human P4HB mutant containing the specific A1178G mutation, as defined in nucleotide sequences provided. In this description, the expression “downstream of said mutation” means 15 refers to the portion of the nucleotide sequence located after the position of the mutation in the gene, as described in the sections on the localization of the mutation. In this description, the expression “upstream of said mutation” refers to the portion of nucleotide sequence located prior to the position of the 20 mutation in the gene, as clarified in the description of the nucleotide sequences and of their disposition with respect to mutation. In this description, the term “nucleotide mismatch” means a discrepancy in the sequence of nucleotides between two strands of DNA or RNA, where a nucleotide in one strand does not match correctly with its complement 25 in the other strand. In this description with the expression “the effectiveness ratio of said siOligo in the reduce the expression of the mutated human P4HB gene compared to the non-mutated gene is greater than 1.30” means that siOligo is more effective in reducing the expression of the mutated P4HB gene compared to the non-mutated gene, as demonstrated in efficacy tests 30 described. DETAILED DESCRIPTION OF THE FIGURES 35 Figure 1. Generation of the mouse model of Cole Carpenter syndrome (CCS). (A) Schematic of the Ph4b allele recombined in heterozygosity. (B) Schematic of the vector of - 6 - SIB B5859R targeting SY23.5 TV2. (C) Southern blot analysis in embryonic stem cell clones (ES) to confirm homologous recombination with the P4hb locus. The 9.9 kb signal represents the correctly recombined (mutated) allele. (D) Genotyping of the CCS mouse model. Double bands indicate animals that are germline transmitters. 5 of the mutated P4hb allele. (E) Sanger sequencing used to detect the mutation Y395C (A>G) in exon 9 of the P4hb gene. (F) External appearance of WT and CCS mice generated. (G) Body weight of mice. Images are representative and data in (G) are the mean ± SD of 3 animals per group. Statistical analysis: Student's t-test. Figure 2. Analysis of bone phenotype in CCS mice by micro-tomography 10 computed tomography (μCT). μCT analysis was performed on tibiae explanted from WT mice. and 1-month-old CCS, males and females separately. The analysis allowed us to evaluate (A) the volume fraction (BV / TV%), (B) the thickness (Tb.Th), (C) the number (Tb.N) and (D) the separation (Tb.Sp) of the trabecular bone and (E) the bone volume cortical. The analysis was conducted on 5 mice per group per condition and the statistics are 15 was performed using the Student t-test. Figure 3. Analysis of type 1 collagen in vivo and in vitro. (A) Expression analysis Collagen 1 gene expression was performed on femurs isolated from 1-month-old WT and CCS mice using specific primers. Gene expression was normalized using the Murine Gapdh. “Rel. Expression”: Relative Expression. (B) Analysis of PINP1 levels 20 was performed by ELISA on sera collected from 1 month old WT and CCS mice age. Primary osteoblasts were isolated from 8-day-old wild-type (WT) and Coleus mice. Carpenter (CCS), stimulated to produce collagen by adding ascorbic acid to the culture medium at a concentration of 50 μM for 72 hours and the proteins extracted using RIPA buffer. (C) Western blot for type 1 collagen. Quantification is 25 was performed for (D) the mature form of collagen 1 and (E) pro-collagen 1 by densitometric analysis of the bands obtained in the Western blot. The expression of collagen was normalized using Ponceau. The data and figures are representative of 3 crops or 3-5 animals per condition and statistics were performed using the Student t-test. 30 Figure 4. Generation of Cole Carpenter cell models. (A) HEK293 cells were transfected with the plasmid for the WT (P4HB-WT) and mutated (P4HB- Y393C) of the P4HB gene carrying the EGFP tag. GFP expression was used to monitor transfection by (B) immunofluorescence and (C) Real time PCR. Figure 5. Screening of primers for PCR detection of the mutated allele 35 murine (Y395C). (A) Representative image of the agarose gel showing the presence of signal only in the HT (mutated) lane and not in the WT lane. The mGAPDH is - 7 - SIB B5859R has been used to normalize gene expression and to demonstrate the presence of Template cDNA in all analyzed samples. (B) Sequencing electropherogram Sanger to detect the Y395C mutation (A>G). (C) Alignment between sequences obtained (P4HB SEQ) and the wild type (P4HB WT) present in the NCBI database. 5 Figure 6. In vitro screening of P4HB-Y393C siRNA sequences. HEK293 cells were transfected with wild-type (P4HBWT)- or mutated (P4HBY393C)-associated vectors to the GFP reporter gene and treated for 48 hours with 100 nM of specific siRNA P4HBY393C or with vehicle only (Dharmafect). GFP mRNA expression was assessed by real-time RT-PCR, using primer pairs specific for GFP. The data 10 represent the mean+sd of 3 (AD) or 2 (EL) independent experiments, normalized with the GAPDH (Student's t-test). “Rel. Expression”: Relative Expression. The figure shows the effectiveness ratio of different siRNAs in reducing protein expression mutated compared to WT, as can be seen, for siRNAs having SEQ ID 1, 2, 3, 4, 6, 9, 10 and 11 this ratio is greater than 1. In particular, the siRNAs having SEQ ID 2 and 9 15 show an effectiveness ratio greater than 5. Figure 7. Dose response experiment of P4HB-Y393C siRNA sequences #2, 9, Y393C 10. HEK293 cells transfected with mutated vector (P4HB ) associated with the gene GFP reporters are treated for 48 hours with 50, 100 and 200 nM of specific siRNA Y393C P4HB or vehicle alone (Dharmafect). GFP mRNA expression was 20 evaluated by real-time RT-PCR, using GFP-specific primer pairs. The data represent the mean + sd of 3 independent experiments, normalized with GAPDH (Student's t-test). The results show that 100 nM is the dose that gives the maximum in vitro effect. “Rel. Expression”: Relative Expression. Figure 8. Analysis of the effect of P4HB-Y393C siRNA pool #2, 9, 10. HEK293 cells Y393C 25 transfected with mutated vector (P4HB) associated with the GFP reporter gene are Y393C treated for 48 hours with 10 nM of the indicated and specific P4HB siRNA pool or only with vehicle (Dharmafect). GFP mRNA expression was assessed by real time RT-PCR, using GFP-specific primer pairs. The data represent the mean+sd of 3 independent experiments, normalized with GAPDH (t-test 30 Student). The results show that siRNAs #2, 9 and 10 are effective even when administered in combination (in pool). “Rel. Expression”: Relative Expression. DESCRIPTION OF THE SEQUENCES 35 siRNA sequence for the human P4HB-Y393C gene. bold = mutated nucleotide; underlined = nucleotide mismatch to increase specificity - 8 - SIB B5859R SEQ ID Sequence (5' → 3') NO. 1 CGUCUUUGUGGAGUUCUGU 2 CGUCUUUGUGGUGUUCUGU 3 CGUCUUUGUGGAGAUCUGU 4 CGUCUUUGUGGAGUUCAGU 5 UGUGCCCCAUGGUGUGGUC 6 AGUGCCCCAUGGUGUGGUC 7 UGUGGCGCCAUGGUGUGGUC 8 UGUGCCGCAUGGUGUGGUC 9 GGAGUUCUGUGCCCCAUGG 10 GGAGUUCUGUGGCCCAUGG 11 GGAGUUCUGUGCCGCAUGG 12 GGAGUUCUGUGCCCCAAGG 13 GGUGUUCUGUGCCCCAUGG 14 GGAGUUCUGUGCCCCAUGG 15 GGAGUUCUGGGCCCCAUGG 16 GGACUUCUGUGCCCCAUGG 17 GGAGUUCUGUGCCCCAUAG 18 GGAGUUCUGUGCCCCUUGG 19 CGAGUUCUGUGCCCCAUGG 20 GAAGUUCUGUGCCCCAUGG 21 GUGGAGUUCUGUGCCCUAU 22 UGUGGAGUUCUGUGCCCUA 23 UGUGCAGUUCUGUGCCCCA siRNA sequence for the murine P4hb-Y395C gene. Bold = mutated nucleotide; underlined = nucleotide mismatch to increase specificity. SEQ ID Sequence (5' → 3') NO. 24 CGUGUUUGUUGAAUUCUGC 25 CGUGUUUGUUGUAUUCUGC 26 CGUGUUUGUUGAAAUCUGC 27 CGUGUUUGUUGAAUUCAGC - 9 - SIB B5859R 28 UGCGCCCCUUGGUGUGGUC 29 AGCGCCCCUUGGUGUGGUC 30 UGCGCGCCUUGGUGUGGUC 31 UGCGCCGCUUGGUGUGGUC 32 UGAAUUCUGCGCCCCUUGG 33 UGAAUUCUGCGGCCCUUGG 34 UGAAUUCUGCGCCGCUUGG 35 UGAAUUCUGCGCCCCUAGG siOligo sequence for the human P4HB-Y393C gene. Bold = mutated nucleotide; sottolineato = nucleotide mismatch per aumentare la specificità SEQ ID Sequenza (5’ → 3’) NO. 36 CGTCTTTGTGGAGTTCTGT 37 CGTCTTTGTGGTGTTCTGT 38 CGTCTTTGTGGAGATCTGT 39 CGTCTTTGTGGAGTTCAGT 40 TGTGCCCCATGGTGTGGTC 41 AGTGCCCCATGGTGTGGTC 42 TGTGCGCCATGGTGTGGTC 43 TGTGCCGCATGGTGTGGTC 44 GGAGTTCTGTGCCCCATGG 45 GGAGTTCTGTGGCCCATGG 46 GGAGTTCTGTGCCGCATGG 47 GGAGTTCTGTGCCCCAAGG 48 GGTGTTCTGTGCCCCATGG 49 GGAGTTCTGTGCCCCATGG 50 GGAGTTCTGGGCCCCATGG 51 GGACTTCTGTGCCCCATGG 52 GGAGTTCTGTGCCCCATAG 53 GGAGTTCTGTGCCCCTTGG 54 CGAGTTCTGTGCCCCATGG 55 GAAGTTCTGTGCCCCATGG 56 GTGGAGTTCTGTGCCCTAT - 10 - SIB B5859R 57 TGTGGAGTTCTGTGCCCTA 58 TGTGCAGTTCTGTGCCCCA siOligo sequence for the murine P4hb-Y395C gene. Bold = mutated nucleotide; underlined = nucleotide mismatch to increase specificity. SEQ ID Sequence (5' → 3') NO. 59 CGTGTTTGTTGAATTCTGC 60 CGTGTTTGTTGTATTCTGC 61 CGTGTTTGTTGAAATCTGC 62 CGTGTTTGTTGAATTCAGC 63 TGGCGCCCCTTGGTGTGGTC 64 AGCGCCCCTTGGTGTGGTC 65 TGGCGCGCCTTGGTGTGGTC 66 TGGCGCCGCTTGGTGTGGTC 67 TGAATTCTGCGCCCCTTGG 68 TGAATTCTGCGGCCCTTGG 69 TGAATTCTGCGCCGCTTGG 70 TGAATTCTGCGCCCCTAGG DETAILED DESCRIPTION It is known that the mRNA of the human P4HB gene can include the point mutation A1178G, which causes the substitution of the amino acid Tyrosine (Y) with the amino acid Cysteine (C), at position 393 in humans (P4HB-Y393C), pathogenic in CCS, and 10 encodes the β-subunit of prolyl 4-hydroxylase, a multifunctional enzyme belonging to to the Protein Disulfide Isomerase (PDI) family, called PDIA1. This mutation corresponds to the mutation in the corresponding murine P4hb gene Y395C. The present invention relates to a siOligo, a derivative or precursor thereof, 15 complementary to the region encompassing the point mutation A1178G in the gene human mutated P4HB (NM_011032.3), having a nucleotide sequence from 15 to 25 nucleotides, where said nucleotide sequence comprises up to 17 nucleotides downstream or upstream of said mutation, and in which said siOligo reduces the expression of the protein encoded by the said mutated human gene but not its wild type form. In one embodiment, said siOligo is an siRNA, a single-nucleotide oligonucleotide strand, a double-stranded oligonucleotide, an antisense oligonucleotide (ASO), a miRNA, preferably called siOligo is a siRNA. In order to further increase the selectivity and / or specificity of the siOligo 5 of the invention towards the mutated mRNA, the siOligo sequence may comprise one or more non-complementary nucleotides (mismatches) to the said mutated RNA sequence. Various siOligo showed significantly higher specificity for the mutated mRNA compared to WT (wild-type) mRNA (Figure 6). In one embodiment, said sequence comprises at least one mismatch 10 nucleotides relative to the said region of the mutated human P4HB gene containing the said mutation, in which said at least one nucleotide mismatch is up to 7 nucleotides downstream of said mutation and / or at least 5 nucleotides upstream of said mutation. In other words, reading the nucleotide sequence from 5' to 3', the nucleotide mismatch is place 1, 2, 3, 4, 5, 6, or 7 nucleotides downstream of said mutation, and / or 5, 6, 7, 8, 9, 10, 11, 15 12, 13, 14, 15, 16 or 17 nucleotides upstream of said mutation. The sIoligos of the invention are selected for their ability to bind selectively to the mRNA transcribed from the mutated allelic forms of the P4HB gene, reducing or eliminating the expression of the mutated PDIA1 protein. Thanks to their silencing selectivity of the mutated gene, their effectiveness in reducing expression is greater for the 20 mutated protein than for the normal protein. Therefore, they present an efficacy ratio PDIA1 mutated / PDIA1 normal greater than one. Furthermore, in order to increase the stability of the same siOligo products and improve the efficiency of the effect produced, one or more nucleotides that form the sequence of siOligo can be chemically modified to obtain siOligo derivatives 25 of the invention. All derivatives described below are therefore included in the scope of protection of the present question. First, the siOligo sequence can be equipped with a sequence protruding 3' terminal dTdT or dAdT. The latter, in addition to providing stability and 30 improve efficiency, induces siRNA oligomerization to mimic the DNA (sticky siRNA). Sticky siRNAs can therefore be associated with usual reagents that ensure efficient distribution of siRNA in vivo and decrease the ability to provoke immune responses mediated by pro-inflammatory cytokines and interferon: for example the product jetPEI® which is a linear derivative of 35 polyethyleneimine supplied by PolyPlus Transfection. - 12 - SIB B5859R Other derivatives that improve the stability of the inventive siOligos in duplex form are the 2'-alkoxy (C1, C2, C3, C4) derivatives, for example the 2'-methoxy- derivatives, (ie 2'- OMe derivatives) (Denise M Kenski, Gabor Butora, Aarron T Willingham, Abby J Cooper, Wenlang Fu, Ning Qi, Ferdie Soriano, Ian W Davies and W Michael Flanagan. “siRNA- 5 optimized Modifications for Enhanced In Vivo Activity.” Molecular Therapy Nucleic Acids (2012) 1, e5; doi:10.1038 / mtna.2011.4). 2'-OMe-derivatives, normally present in rRNA and tRNAs, are non-toxic derivatives of the siOligo of the invention, wherein the -OMe group is inserted at the 2' position of the ribose nucleus in the sense helix or anti-sense or in both. 10 The 2'-fluoro (i.e. 2'-F)-derivatives (Denise M. Kenski et al above) are also compatible with the function performed by the siOligo of the invention and increase the stability of the Duplex against degradation by cleases. The incorporation of fluoride in the 2' position of the ribose core maintains the activity of siOligo both in vitro and in vivo, increasing their stability. The combined use of 2'-F in pyrimidine nucleotides with 2'- 15 OMe in purine nucleotides results in a duplex siOligo of extreme stability in serum and greatly improved effectiveness. 2'-O-(2-methoxyethyl) RNA (MOE-RNA) derivatives (Mark A. Behlke. “Chemical Modification of siRNAs for In Vivo Use”. Oligonucleotides 18:305–320 (2008)) can equally be used to increase the stability of the siOligo of the invention. 20 MOE groups are often used in anti-sense oligonucleotides to confer to the oligonucleotide with high resistance to nucleases and to increase the Tm. Other derivatives of siOligo, with improved function and stability, suitable for this purpose invention are the 2'-O-benzyl derivatives and the 2'-O-methyl-4-pyridine derivatives (see Denise 25 M. Kenski et al above), 2'-amino (2'-NH), 2'-aminoethyl (2'-AE), 2'-guanidinopropyl (2'-GP). Particularly interesting for the purposes of this invention, due to their stability, are the LNAs (locked nucleic acids) derivatives of siOligo (see Mark A. Behlke above). As well known to the expert, these derivatives are characterized by a methylene bridge between the 30 2'-O and 4'-C positions of ribose. The methylene bridge blocks the saccharide unit in the 3'-endo configuration, thus offering a significant increase in Tm and resistance to nucleases. In one embodiment of the invention, the siOligos or their derivatives, may be 35 used in the form of their precursors in vivo. These are also the subject of the present invention. - 13 - SIB B5859R As an example, considering siRNAs, these can be replaced by corresponding shRNA (short hairpin RNA), particularly in the field of therapy gene. As well known to the expert, shRNAs are short RNA sequences or transcripts consisting of a double helix structure formed by the pairing of two sequences 5 complementary ones of about 15-29 nucleotides each, normally 19-25 or 15-20, linked by a loop of about 2-10 nucleotides, for example 4-9 or 5-6 nucleotides. When introduced and expressed in the cell, the transcripts that form the shRNAs are processed by the complex DICER enzyme which cuts the loop sequence and converts it directly into cell the shRNAs into the corresponding siRNAs. These will then perform their function of 10 silencing or knockdown of the target gene. Therefore, in the context of gene therapy, The siRNAs of the invention can be replaced by the corresponding shRNAs. All the above-described derivatives and precursors are included in the embodiments of the present invention. In one embodiment, said siOligo has a sequence chosen from 37, 41, 44, 45, 15 46, 48, 49, 50,51, 52, 53, 54, 55, 56, 57, 58. When siOligos are siRNAs, they have a sequence chosen from SEQ ID NO. 2, 6, 9, 10, 11, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23. Nucleotide synthesis methods for the preparation of short RNA sequences are known to the expert and described in the state of the art. The siRNAs of the invention have been 20 products by chemical synthesis, and are represented by duplexes of small oligonucleotides. These are made up of 19 ribonucleotides with 2 "overhangs" of deoxyribonucleotides at the 3' end. Post-synthesis, the siRNAs were subjected to following purification processes: • Removal of salts by precipitation with ethanol or using columns 25 C-type chromatographic 18 • Removal of the 2'-ACE group present in the RNA bases • Association with the antisense sequence (synthesized in a separate reaction). • Purification 1: The siRNA duplex is purified by gel electrophoresis acrylamide · Purification 2: the siRNA duplex, obtained by the above step 30 described, is further purified by liquid exchange chromatography ionic (HPLC) • Purification 3: the siRNA duplex, obtained through the step described above, is subjected to counter-ion exchange (Na+), desalted, sterilized by filtration and tested for the presence of endotoxins. 35 The object of the present invention is also a pharmaceutical composition comprising one or more siOligo or a derivative or precursor thereof according to any - 14 - SIB B5859R of the embodiments described herein, and an excipient and / or carrier pharmaceutically acceptable. The pharmaceutical composition of the present invention may therefore comprise also combinations of siOligo of the present invention, which can be 5 administered sequentially or concomitantly. The sylligos of the invention, their chemical derivatives and / or precursors can be administered systemically or locally. Pharmaceutical compositions suitable for administration of the syOligo of the invention or their chemical derivatives are compositions containing a pharmaceutically effective amount of siOligo, of its 10 derivative or its precursor, in a suitable essentially liquid excipient. Such compositions are in the form of solutions, suspensions or emulsions. It can therefore be any pharmaceutical excipient suitable for such applications may be used. As excipients suitable are physiological solutions for parenteral use, hydroalcoholic solutions, solutions glycol, water / oil or oil / water emulsions, liposome or exosome emulsions / suspensions, 15 oily solutions, micellar suspensions, vesicles or complexes with PEI (polyethyleneimine) or complexes with atelocollagen, all containing the usual additives pharmaceuticals, diluents, stabilizers and pH regulators to physiological values. The administration of the siOligo of the invention, its derivatives or precursors, can occur parenterally, for example intravenous administration, 20 intraperitoneal, intramuscular, intradermal, subcutaneous, intraosseous, intracartilaginous, intraarticular. Alternatively, administration can be administered orally, through pills, tablets, dissolving formulations buccal or sublingual, capsules, softgels, films, powders, granules; by oral route rectal or vaginal, through suppositories or ovules; by inhalation, e.g. intrabronchial. 25 Local administration can be done through any suitable formulation for local application, e.g. by topical application or direct application on or in the tissues to be treated, or through local administration of a precursor of siOligo and in situ production of the siOligo of the invention. Compositions based on exosomes, liposomes, vesicles, micelles containing siOligo or their precursors are useful for 30 achieve both a systemic and local effect. To obtain a local effect, the syOligos of the invention or their derivatives or precursors can be administered through viral or non-viral vectors, or through DNA encoding siRNAs, or as isolated (naked) RNA (Pelled et al., 2010 Tissue Engineering: Part B, Volume 16, No.1, 13-20) or through matrices or plants 35 biocompatible three-dimensional ones, based, for example, on fibrinogen and thrombin polymers and localized at the point of application. In a specific embodiment, the siOligo - 15 - SIB B5859R or their derivatives or precursors are bound or associated or complexed with usual reagents which ensure effective in vivo distribution of the siOligo, for example polyethylenimine (PEI) or its derivatives, such as polyethylenimine-polyethylene glycol-N - acetylgalactosamine (PEI-PEG-GAL), or the polyethylenimine complex 5-polyethylene glycol-tri-N-acetylgalactosamine (PEI-PEG-triGAL). In one form of specific embodiment of the invention, the siRNAs are linked to the jetPEI® product, which is a linear derivative of polyethyleneimine supplied by PolyPlus Transfection. Alternatively, considering the siRNAs of the invention, these can be administered locally as part of gene therapy in the form of their 10 precursor shRNA. For example, an shRNA, or the DNA that encodes an shRNA, can be transferred into a mammalian cell, using, for example, a plasmid suitable or an adenoviral vector as described by Egermann et al., Human Gene Ther. May 2006; 17(5):507-17. shRNAs expressed and processed by the cell itself produce the corresponding siRNAs capable of silencing the target gene. 15 In an alternative form of in vivo administration to vectors, siOligos can be transferred into a cell by electroporation, ultrasound, transfection mediated by cationic liposomes, microinjection, electropulsation. In another form alternative for local administration, the syroligos of the invention, their derivatives or precursors, can be bound, adsorbed, immobilized even through binding 20 covalent to a matrix capable of releasing the genetic material (matrix activated by the gene (GAM)) as described by Luginbuehl et al., 2004, Eur J Pharm Biopharm 58: 197-208, and then implanted in the area of interest as described by Fang et al., 1996 (Proc Natl Acad Sci USA 93, 5753). Transfection agents, although not necessary, can nevertheless be used to 25 enhance siOligo internalization in osteoclasts. Suitable transfection agents for the present invention are: lipofectamine, Amaxa nucleofection Nucleofector®. In one embodiment, the siOligo or a derivative or precursor thereof according to the present invention, or the pharmaceutical composition according to the present invention, 30 are for use as a medicine. In particular, the siOligo or the composition pharmaceutical are for use in the treatment of a disease or disorder caused by the A1178G mutation in the mRNA of the mutated human P4HB gene. The disease or disorder caused by the A1178G mutation in the mRNA of the human gene mutated P4HB is Cole Carpenter Syndrome (CCS). 35 The object of the present invention is also a kit for evaluating the effectiveness of a therapy against Cole Carpenter Syndrome by administering a - 16 - SIB B5859R siOligo according to the present invention or of a pharmaceutical composition according to the present invention, said kit comprising a siOligo according to any of the embodiments described herein, and at least one diagnostic agent. In one embodiment, said diagnostic agent comprises the protein 5 green fluorescent protein (GFP), and at least one forward primer for shape detection P4HB gene mutation having a sequence selected from SEQ IDs 78, 79, 80, 81, 82 and 83 and at least one specific reverse primer for the detection of the mutated form of the gene P4HB having a sequence selected between SEQ ID 84 and 85. Finally, in jurisdictions where it is not excluded from patentability, the subject of this 10 invention is also a method of treating a disease or disorder caused from the A1178G mutation in the mRNA of the mutated human P4HB gene, and in particular in which disease is Cole Carpenter Syndrome (CCS), which includes the administration of a siOligo or a pharmaceutical composition of this invention. 15 Throughout the description and claims, the term “including” may be replaced with the expression “consisting of”. In any part of the description and claims the term siOligo may be replaced by siRNA. In compliance with Art. 170bis paragraph 2 of the CPI and in accordance with Art. 21 paragraph 2 of the 20 Regulation implementing the CPI adopted with Ministerial Decree 13.1.2010 n.33, it is declared that: the material of animal / vegetable origin, in particular primary osteoblasts isolated from murine model of CCS and HEK293 cells, which are the basis of the invention which is the subject of the the above mentioned question comes from the internal animal facility respectively university regarding the murine model and the laboratory's cell biobank for 25 regarding HEK293 cells. The mice were commissioned to the company PolyGene transgenetics (Rumlang, Switzerland). As regards the cells isolated from the murine model, it is declared that the above mentioned cells were obtained following the authorizations issued by the Ministry of Health for the use of animal models for experimental purposes (Auth. No.: 321 / 2020-PR, n° 30 691 / 2023-PR. In compliance with Art. 170bis paragraph 4 CPI, it is declared that: with reference to biological material, containing microorganisms or organisms genetically modified, the subject of or used in this application have been compliance with the obligations arising from national or community regulations, and in particular, 35 from the provisions of paragraph 6 of the legislative decrees of 12 April 2001 n. 206 and 8 July 2003 n. 224, regarding these changes. - 17 - SIB B5859R EXAMPLES The mouse model of CCS carrying the amino acid substitution Y395C, homologous to the human Y393C, was generated in collaboration with POLYGENE. 5 Considering that the pathology has an autosomal dominant inheritance, the murine model It was generated by introducing the heterozygous mutation Y395C into the locus of P4hb gene using a knock-in strategy and using a cassette for neomycin flanked by FRT sites (Figure 1A). 10 In short, to modify the P4hb gene locus, the SY23.5 TV2 targeting vector (Figure 1B) was electroporated into embryonic stem cells (ES cells) derived from C57Bl / 6 and selected for resistance to geneticin. To confirm the correct homologous recombination, Southern blot analysis was performed using DNA digested with the restriction enzyme BstEII. Hybridization results showed a 15 signal of 8.0 kb for the wild-type (WT) allele and a signal of 9.9 kb for the allele correctly recombined (mutated) (Figure 1C). The selected ES cells were injected into blastocysts derived from C57Bl / 6 mice and then transferred into CD-1 foster mice. Subsequently, the generated chimeras were mated with Flp deleter females for excision of the neomycin house. The excised F1 offspring were mated 20 for germline transmission of the recombinant (mutated) P4hb allele, verified subsequently by genotyping. Mice 1010, 1011 and 1015 were found to be heterozygous (HT) for the Y395C mutation (Figure 1D). To confirm the presence of the Y395C mutation in exon 9, the region surrounding the mutation was amplified and the PCR product was sequenced. Sequencing analysis confirmed the 25 presence of the Y395C mutation in heterozygous state (Figure 1E). Finally, an evaluation preliminary analysis of the first generation of mice revealed no obvious changes in the body length (Figure 1F) along with unchanged body weight (Figure 1G). Subsequently, a bone phenotype analysis was performed to evaluate whether the 30 generated model recapitulating human pathology. For analysis, the following were selected: one-month-old mice, male and female, given the pediatric nature of the pathology and the the fact that the treatment will be carried out on growing animals. The results obtained show the presence of marked osteopenia (reduction in bone mass) in the CCS mice compared to their WT counterparts. In fact, analyses conducted using micro- 35 computed tomography (μCT) scans showed a significant reduction in levels - 18 - SIB B5859R of bone mass both at the trabecular level (Figure 2 AD) and at the cortical level (Figure 2E) in both 1-month-old male and female CSS mice. Subsequent analyses revealed reduced expression of type 1 collagen in the bone tissue of CCS mice (Figure 3A) associated with reduced deposition of 5 same by osteoblasts (cells responsible for the formation of bone tissue) as demonstrated by decreased serum levels of PINP1 (procollagen type I N-terminal propeptide) in CSS mice compared to WT mice (Figure 3B). Similar data were obtained from bone cells (osteoblasts) isolated from the CCS mouse, where a reduction in collagen 1 production associated with an accumulation of pro-collagen 1 10 (immature form of collagen) (Figure 3C-E). In general, the animal model of CCS created by the inventors recapitulates the traits pathological features of Cole-Carpenter syndrome, characterized by a marked osteopenia associated with an alteration of the biosynthesis of type 1 collagen. mouse model was used for in vivo testing. Generation of Cole Carpenter cell models and characterization. In addition to the primary bone cells we isolated from the CCS mouse, we stable cell models carrying the human mutation of the P4HB gene were also generated, through cell transfection and subsequent antibiotic selection. In particular, they are 20 HEK293 cells transfected with a vector carrying the human construct were used wild-type (P4HB-WT) or mutated (P4HB-Y393C) associated with the GFP (Green Fluorescence Protein) (Figure 4A) The analyses conducted showed that both cell lines generated were positive for GFP both from the protein point of view, by immunofluorescence assays 25 (Figure 4B), which from the point of view of gene expression (Figure 4C). These cellular models have been used to screen siRNA sequences specific for human mutation (Table 1 – SEQ ID 1-12). Design of specific primers for the detection of mutated P4HB mRNA. 30 CCS is caused by the Y393C mutation of the P4HB gene expressed in heterozygosity. This means that the P4HB gene has a normal allele (WT) and a mutated one that represents the target of our therapeutic approach. In order to monitor expression of mutated P4HB mRNA in both mouse (Y395C) and human (Y393), primers have been designed that can complement in a 35 specifies the mutated P4HB mRNA by discriminating it from the WT one (Table 3 and 4). - 19 - SIB B5859R Table 3. List of primers for PCR detection of the mutated allele murine (Y395C). Sequence Name SEQ ID NO. mP4hb Y395C Fw1 cgtgtttgttgaattctgcgccc 71 mP4hb Y395C Fw2 aattctgcgccccttggtgt 72 mP4hb Y395C Fw3 tgttgaattctgcgcccctt 73 mP4hb Y395C Fw4 cgtgtttgttgaattctgcg 74 mP4hb Y395C Fw5 gtttgttgaattctgcgccc 75 mP4hb Y395C Fw6 tgtttgttgaattctgcgccc 76 mP4hb Y395C Rv1 actttgacagcttccacctc 77 Table 4. List of primers for PCR detection of the mutated allele 5 human (Y393C). Sequence Name SEQ ID NO. hP4HB Y393C Fw1 ggagttctgtgccccatggt 78 hP4HB Y393C Fw2 aacgtctttgtggagttctg 79 hP4HB Y393C Fw3 gtgccccatggtgtggtcac 80 hP4HB Y393C Fw4 acgtctttgtggagttctgt 81 hP4HB Y393C Fw5 cgtctttgtggagttctgtg 82 hP4HB Y393C Fw6 cgtctttgtggagttctgtg 83 hP4HB Y393C Rv1 ttggcagtcgagtccatctt 84 hP4HB Y393C Rv2 tctggctcctctgcttcttc 85 For primers directed against the murine form of the P4HB gene, some sequences capable of specifically complementing the mutated mRNA (Y395C) 10 discriminating it from the WT one (Figure 5A). The specificity of these sequences was also confirmed by sequencing analysis, which confirmed that the primers selected amplified only the mutated form of P4hb and not the WT one (Figure 5B- C). 15 Screening of siRNA sequences for the P4HB-Y393C gene. The siRNAs for the mutated form of the P4HB gene (P4HB-Y393C siRNAs) listed in Table 1 were tested in vitro in human HEK293 cells transfected with a vector carrying the wild-type (P4HB-WT) or mutated (P4HB-Y393C) construct associated with the GFP (Green Fluorescence Protein) sequence. The test results show that the siRNA sequences SEQ ID NO. 2, 6, 9, 10 and 11 were able to reduce the expression of GFP mRNA associated with the mutated form of the 5 P4HB gene, while the GFP transcript associated with the wild-type form remains unchanged (Figure 6B,F,I,J,K). The other siRNAs tested were ineffective (Figure 6E,G,H) or non-specific for the mutated form of the P4HB gene (Figure 6A,C,D,L) under the conditions used for the test. As evident from the results, the laboratory tests performed gave positive results, 10 allowing to identify the sequences to be used in subsequent analyses preclinical.
Claims
CLAIMS 1. siOligo, a derivative or precursor thereof, complementary to the region encompassing the point mutation A1178G in the mutated human P4HB gene, having a nucleotide sequence of 15 to 25 nucleotides, wherein said nucleotide sequence comprises up to 17 nucleotides downstream or upstream of said mutation, and wherein said siOligo reduces the expression of the protein encoded by said mutated human gene but not of its wild type form.
2. siOligo or its derivatives or precursors according to claim 1, wherein said siOligo is an siRNA, a single-stranded oligonucleotide, a double-stranded oligonucleotide, an antisense oligonucleotide (ASO) or a miRNA.
3. siOligo or its derivatives or precursors according to any of claims 1 or 2, wherein said sequence comprises at least one nucleotide mismatch with respect to said region of the mutated human P4HB gene comprising said mutation, wherein said at least one nucleotide mismatch is up to 7 nucleotides downstream of said mutation and / or at least 5 nucleotides upstream of said mutation.
4. siOligo or a derivative or precursor thereof according to any of claims 1 to 3, wherein the efficacy ratio of said siOligo in reducing the expression of the mutated human P4HB gene relative to the non-mutated gene is greater than one.
5. siOligo or a derivative or precursor thereof according to any of claims 1 to 4, wherein said derivative is a siOligo comprising one or more chemically modified nucleotides.
6. Derivative according to claim 5 wherein said one or more chemically modified nucleotides are selected from the group comprising: 2'-alkoxy derivatives, 2'-methoxy derivatives, 2'-ethoxy derivatives, 2'-fluoro derivatives, 2'-O-(2-methoxyethyl) derivatives, 2'-O-benzyl derivatives, 2'-O-methyl-4-pyridinyl derivatives, 2'-amino derivatives, 2'-aminoethyl derivatives, 2'-guanidinopropyl derivatives or LNA derivatives.
7. siOligo or a derivative or precursor thereof according to any of claims 1 to 6, wherein said siOligo has a sequence selected from SEQ ID NO. 37, 41, 44, 45, 46, 48, 49, 50,51, 52, 53, 54, 55, 56, 57, 58. -22SIB B5859R 8. siOligo or a derivative or precursor thereof according to claim 7, wherein said siOligo is an siRNA having a sequence selected from SEQ ID NO. 2, 6, 9, 10, 11, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 9. Pharmaceutical composition comprising one or more siOligos or a derivative or precursor thereof according to any of claims 1 to 8 and a pharmaceutically acceptable excipient and / or carrier.
10. Pharmaceutical composition according to claim 9, in a form suitable for administration by the intravenous, intraperitoneal, intramuscular, intradermal, subcutaneous, intraosseous, intracartilaginous, intraarticular, oral, oral with buccal dissolution, oral with sublingual dissolution, rectal, vaginal, intrabronchial routes, by inhalation or by administration by electroporation, ultrasound-induced poration, cationic liposome-mediated transfection, microinjection, electropulsation or through viral or non-viral vectors, or through the DNA encoding the siOligo or as isolated (naked) RNA or through three-dimensional, biocompatible matrices or implants.
11. siOligo or a derivative or precursor thereof according to any of claims 1 to 8, or the pharmaceutical composition according to claim 9 or 10, for use as a medicament.
12. siOligo or the pharmaceutical composition for use according to claim 11, for use in the treatment of a disease or disorder caused by the A1178G mutation in the mRNA of the mutated human P4HB gene.
13. siOligo or the pharmaceutical composition for use according to claim 12, wherein said disease or disorder is Cole Carpenter Syndrome (CCS).
14. Kit for evaluating the efficacy of a therapy against Cole Carpenter Syndrome by administering a siOligo according to any of claims 1 to 8 or a pharmaceutical composition according to any of claims 9 or 10, said kit comprising a siOligo according to any of claims 1 to 8 and at least one diagnostic agent. -23SIB B5859R 15. Kit according to claim 14, wherein said diagnostic agent comprises green fluorescent protein (GFP) and at least one forward primer specific for the detection of the mutated form of the P4HB gene having a sequence selected from SEQ IDs 78, 79, 80, 81, 82 and 83 and at least one reverse primer specific for the detection of the mutated form of the P4HB gene having a sequence selected from SEQ IDs 84 and 85.