METHOD FOR THE PRODUCTION OF POLYHYDROXYALKANOATES

IT202400015682B1Active Publication Date: 2026-07-20EGGPLANT SRL
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
IT102024000015682
Authority / Receiving Office
IT · IT
Patent Type
Patents
Current Assignee / Owner
Filing Date
2024-07-08
Publication Date
2026-07-20
Estimated Expiration
2044-07-08
Patent Text Reader
Need to check novelty before this filing date? Find Prior Art

Description

“Method for the production of polyhydroxyalkanoates” OBJECT OF THE INVENTION The present invention relates to a method for producing polyhydroxyalkanoates (PHAs) in a bacterial strain containing the phaCAB operon and in the presence of low-protein, low-lactose dairy wastewater. The method of the present invention can be used in a medium to large scale industrial process for the production of PHA, preferably PHB. STATE OF THE ART It is now impossible to ignore the growing demand to replace plastics derived from non-renewable fossil fuels and petrochemicals with new, innovative materials within the plastics consumer goods supply chain. Plastics, which are used daily for numerous applications, in addition to being produced from unsustainable and progressively deteriorating raw materials, become increasingly difficult and complex to manage at the end of their useful life. Just think of consumer goods used daily, such as food packaging, disposable plastic utensils like forks, plates, and cups, or even plastic bags or film used for packaging goods. All of the examples mentioned above fulfill their intended functions flawlessly, even though they are immediately discarded after their intended use.This vicious cycle of “mass production - single-use waste” has become an automatic feature of modern society. While undoubtedly providing short-term benefits and convenience, it also has disastrous environmental side effects due to the long degradation times of conventional plastic, sometimes exceeding 1000 years. Over the last 60 years, global plastic production has grown from approximately 0.5 million LGES / P2463IT Bird & Bird -2 million tons in 1950 to more than 260 million tons today, and continues to steadily increase every year. The family of bioplastics known as polyhydroxyalkanoates (PHAs), a group of polymers with properties similar to fossil-based plastics, appears to be an excellent and viable choice for a sustainable future with reduced CO2 emissions. Within this class of polymers is polyhydroxybutyrate (PHB), a natural biodegradable thermoplastic polyester considered a potential and valid substitute for synthetic polymers in many applications due to its excellent qualities. PHB is naturally produced as a reserve energy material within microorganisms and bacteria and accumulates as intracellular granules that function both as a carbon reserve and an energy source. It is then extracted, processed, and manufactured, typically in the form of pellets or granules. This production process makes it a biological and biodegradable plastic, thus perfectly suited to meeting new market demands. PHB is produced in nature by the Cupriavidus necator (formerly Ralstonia eutropha) strain H16 (DSM428) (Pohlman et al. Nature Biotechnology, 2007 and Little et al. Microbiology Vol. 8, no. 37, pp. 1-2, 2019) and is accumulated as intracellular granules. The genetic information required for the production of the PHB polymer consists of three genes organized in an operon (phaCAB) that encodes three genes: PHA synthase (phaC), 3-ketothiolase (phaA), and acetoacetyl-CoA reductase (phaB). The phaCAB operon has been described in the model organism C. necator H16, for which the complete genome sequence is available. PHA-producing bacteria can utilize a wide variety of organic molecules as substrates, primarily sugars, alcohols, and organic acids. Selecting specific substrates or adding co-substrates (precursors) is the preferred strategy. LGES / P2463IT Bird & Bird -3 of primary relevance to improve process productivity and to enable the production of copolymers and / or increase the fraction of the second monomer within a copolymer. In particular, bacterial strains engineered with the phaCAB operon are able to produce numerous types of PHA polymers when grown in the presence of substrates supplemented with specific monomer precursors. These can be simple compounds, such as organic acids, alcohols, hydrocarbons, amino acids, salts or fatty acid salts, or substrates containing such compounds, such as substrates derived from agricultural crops, such as sugarcane, sugar beet, corn, cassava, rice straw, or rice bran; woody substrates containing lignocellulose; substrates derived from the food industry, such as dairy products, fruit juices, sweets, and sugar; vegetable oils (palm, coconut, etc.), used cooking oils, animal fats, organic waste, wash water and wastewater from agricultural production, drinking water, urban wastewater, or by-products of other productions such as glycerol. Bontip (Bontip et al. Frontiers in Bioengineering and Biotechnology, Vol. 9, pp. 1-18; 2021) describes the exploitation of the phaCAB operon produced by C. necator H16 to construct an Escherichia coli strain engineered for high-efficiency PHB production using a cold-shock-inducible promoter (cSPHA promoter). This system is easily used on a laboratory scale, but difficult to implement on a medium or large industrial scale due to the costs associated with using cooling systems. In line with the circular economy production and consumption model (Di Bartolo et al., Polymers 13, p.1-26; 2021), several studies have been published aimed at producing PHB efficiently and at low cost using appropriately engineered bacteria (e.g. E. coli). LGES / P2463IT -4Bird & Bird In particular, genetic information encoding PHB from C. necator H16 or Alcaligenes latus (Azoidromonas lata) strain H1 (DSM1123) was inserted into the engineered strains grown in the presence of low-cost biomass (e.g. whey, starch, wastewater, etc.) as a substrate for the metabolism of the recombinant strains. In the study published by Ahn et al. Applied and Environmental Microbiology, Vol. 66, No. 8, pp. 3624-3627; 2020), the E. coli lac+ strain CGSC4401 (also referred to as DSM9037 in the DSM collection) engineered with a plasmid containing the phaCAB operon of Alcaligenes latus, was tested for the efficiency of PHB production in a high-lactose whey solution (280 g / liter), using a fedbatch fermentation process. Similarly, Lee et al. in 1997 (Biotechnology Letters, Vol. 19 No. 1, p. 10331035; 1997) published a study regarding the production of PHB in nine recombinant E.coli strains (including CGSC4401) containing the phaCAB operon of Alcaligenes eutrophus and using solutions containing bovine milk powder at different concentrations (from 10 to 70 g / liter) as a substrate for metabolism. The main disadvantages of using such plasmid-engineered strains that utilize inducible operons and lactose-rich substrates are the high costs and the limited possibility of industrialising the process on a large scale. In particular, the methods used to date have the problem of being particularly expensive and of producing polymeric products with low yields or with elasticity and ductility characteristics that are not optimal for their industrial use. There is therefore a clear need to develop new recombinant strains that are capable of producing PHAs at high concentrations and high yields when grown on dairy substrates in small-, medium- and large-scale industrial processes. LGES / P2463IT Bird & Bird -5 DETAILED DESCRIPTION OF THE INVENTION The inventors surprisingly observed that by growing an E. coli strain containing the Cupriavidus necator phaCAB operon in a growth medium derived from dairy wastewater with a low protein and lactose content, it was possible to obtain a greater accumulation of PHB in the engineered strain and therefore a greater production of PHB, compared to strains grown on raw, non-deproteinized dairy substrates. This result was observed in particular using wastewater with a low protein content and a specific protein-to-lactose ratio. The inventors have in fact observed an increase in the yield of PHB obtained by growing the engineered bacterial strain in a mixture coming from dairy waste characterized by a lactose to protein ratio lower than 50:1, compared to the yield obtained using as a substrate a crude pasteurized liquid matrix, which is a residue from the production of dairy products (for example the scotta obtained from the residue of pasteurized ricotta production). This production is similar to the yield obtained by growing the engineered strains under optimal growth conditions, where a glucose-containing, protein-free substrate is used (such as LB, Luria-Bertani, or other commercial laboratory media), conditions that cannot be used for industrial-scale PHB production because they are too expensive. An object of the present invention is therefore a method for producing a polyhydroxyalkanoate (PHA) in a bacterial strain genetically modified with a vector containing the phaCAB operon and grown in the presence of dairy waste having a lactose:protein ratio of less than 50:1. Preferably the lactose:protein ratio is less than 100:1, more preferably it is less than 150:1. LGES / P2463IT Bird & Bird - 6 Secondo un aspetto preferito detto ceppo batterico è scelto tra Acidovorax, Acinetobacter, Actinobacillus, Actinomiceti, Aeromonas, Alcaligenes, Allochromatium, Anabaena, Aphanothece, Aquaspirillum, Asticcaulus, Axobacter, Azomonas, Aureobasidium, Azoidromonas, Azospirillum, Azotobacter, Bacillo, Beggiatoa, Beijerinckia, Beneckea, Brachymonas, Bradyrhizobium, Burkholderia, Caryophanon, Caulobacter, Chloroflexus, Chlorogloea, Chromatium, Chromobacterium, Clostridium, Defluviicoccus, Comamonas, Corynebacterium, Cupriavidus, Cyanobacterium, Derxia, Delftia, Ectothiorhodospira, Erwinia, Escherichia coli, Ferrobacillus, Gamphospheria, Gloeocapsa, Gloeothece, Haemophilus, Halobacterium, Haloarcula, Haloferax, Halomonas, Haloquadratum, Haloterrigena, Hydrogenophaga, Hyphomicrobium, Klebsiella (ricombinante), Lamprocystis, Lampropedia, Leptothrix, Legionella, Methanomonas, Methylobacterium, Methylomonas, Methylosinus, Methylocystis, Methylovibrio, Micrococcus, Microcoleus, Microcystis,Microlunatus, Microvoleus, Moraxella, Mycoplana, Nitrobacter, Nitrococcus, Nocardia, Nostoc, Oceanospirillum, Oscillatoria, Paracoccus, Paucispirillum, Pedomicrobium, Photobacterium, Protomonas, Pseudomonas, Ralstonia, Rhizobium, Rhodobacter, Rhodococcus, Rhodopseudomonas, Rhodospirillum, Rubrivivax, Saccharophagus, Shinorhizobium, Sphaerotilus, Spirillum, Spirulina, Staphylococcus, Stella, Streptomyces, Synechococcus, Syntrophomonas, Thiobacillus, Thiocapse, Thiococcus, Thiocystis, Thiodictyon, Thiopedia, Thiosphaera, Variovorax, Vibrio, Wautersia (now Cupriavidus), Xanthobacter and Zoogloea., Preferably said bacterial strain is a strain of Escherichia coli (E. coli). According to a further preferred aspect said vector is a plasmid pGEX (Novagene), pUC18, pGEM-T Vector (Promega), pHSG298 (Takara), pHSG396 (Takara), pCold (Takara) or any vector with Lac+ promoter. In particular, the pGEX expression vector allows the transcription of the LGES / P2463IT -7 Bird & Bird nucleotide sequence cloned downstream of the Lac promoter, using the inducer IPTG (isopropyl-PD1-thiogalactopyranoside), a non-metabolizable analogue of allolactose. Preferably, said dairy wastewater has a protein content of between 0.7 g / L and 0.05 g / L, preferably between 0.35 g / L and 0.1 g / L, more preferably approximately 0.25 g / L. Preferably, such dairy wastewater has a lactose content of less than 50 g / L, preferably less than 40 g / L. Preferably, said dairy wastewater is wastewater coming from the industrial processing of milk for the production of butter, cheese and derivatives, more preferably said dairy wastewater is subjected to pasteurization or sterilization. According to a further preferred aspect said polyhydroxyalkanoate is selected from PHB, or polymers obtained from at least one monomer selected from the group consisting of 2-hydroxybutyrate, lactic acid, 3-hydroxybutyrate (3HB), 3-hydroxypropionate (3HP), 3-hydroxyvalerate (3HV), 3-hydroxyhexanoate (3HH), 3-hydroxyheptanoate (3HHep), 3-hydroxyoctanoate (3HO), 3-hydroxynonanoate (3HN), 3-hydroxydecanoate (3HD), 3-hydroxyundecanoate (HUD), 3-hydroxydodecanoate (3HDd), 4-hydroxybutyrate (4HB), 4-hydroxyvalerate (4HV), 5-hydroxyvalerate (5HV) and 6-hydroxyhexanoate (6HH) and combinations thereof, preferably said polyhydroxyalkanoate is PHB and its copolymers, more preferably is PHB. According to a preferred embodiment, said polymers are produced by the method of the present invention using, in addition to the dairy substrate, monomeric precursors selected from organic acids such as acrylic acid, propionic acid, butyric acid, valeric acid, levulinic acid, acetic acid, lauric acid, hexanoic acid, heptanoic acid, octanoic acid, nonanoic acid, decanoic acid, oleic acid, myristic acid, undecanoic acid, LGES / P2463IT -8Bird & Bird dodecanoic or tetradecanoic acid; alcohols, selected from methanol and pentanol, methane; amino acids, selected from valine, cysteine, cystine, methionine, isoleucine, leucine, tyrosine, tryptophan, phenylalanine, arginine, lysine, proline, and histidine; and salts, selected from sodium gluconate, sodium butyrate, sodium hexanoate, and fatty acid salts. In preferred embodiments, culture conditions include aerobic or substantially aerobic growth or maintenance conditions. Exemplary aerobic conditions for fermentation processes are described herein in the examples but are not intended to be limiting of the present invention. Each of these conditions can be used with non-naturally occurring microbial organisms as well as other aerobic conditions well known in the art. Culture conditions may include, for example, liquid culture procedures as well as fermentation, batch or feed-batch, continuous, and other small-, medium-, and large-scale culture procedures. According to a preferred aspect, the method according to the present invention is characterized by the following steps: a) inoculation of the bacterial strain in a percentage between 30 and 1% v / v; b) incubation for at least 10 hours at a temperature between 27-40°C, with shaking between 50-1500 rpm; aeration by diffusion in a flask, between 0.5-3 vvm in a bioreactor; c) maintaining the pH of the crop at a value of 5-8; d) recovery of cellular biomass by extraction and purification of polyhydroxyalkanoate granules. Preferably the method according to the present invention is characterised by the following steps: a) I inoculate the bacterial strain in a percentage between 15 and 2% LGES / P2463IT -9Bird & Bird v / v, preferably a percentage of 4%; b) incubation for at least 24 hours at a temperature between 30-37°C, more preferably 37°C, with shaking between 100-500 rpm; aeration by diffusion in a flask, between 1-2 vvm in a bioreactor; c) maintaining the pH of the crop at a value of 6-7; d) extraction and purification of polyhydroxyalkanoate granules. DEFINITIONS "Scotta" is the liquid matrix that remains from cheesemaking whey (e.g., from ricotta production) following the acid-thermal precipitation of whey proteins. It contains primarily lactose, proteins, and mineral salts in an aqueous solution. The “scotta concentrate” is one of the fractions obtained through a separation process based on a membrane filtration system, aimed at recovering different fractions to be used in different valorization processes. As used herein, a vector is a replicon, such as a plasmid, phage, or cosmid, into which another DNA segment can be inserted to induce replication of the inserted segment. Vectors may be expression vectors. As used herein, an expression vector is a vector that includes one or more expression control sequences. In this invention, the term “vvm” has the following meaning: the first v stands for volume of air (e.g., liter); the second v stands for unit of culture liquid (e.g., liter); 'm' stands for unit of time (e.g., minute). For example, 1 vvm (l / l / m) means that in 1 minute, 1 liter of air passes through 1 liter of liquid. LGES / P2463IT -10Bird & Bird EXAMPLES Example 1. Production of the engineered strain EP001 Verification of the amplificability of the phaCAB operon A strain of Cupriavidus necator H16, a PHA producer, was purchased. This is a model organism for PHA producers whose complete genome sequence is published (Garet T. Little, Microbiol Resour Announce. 2019. 12; 8 (37)). Specific oligonucleotides for the amplification of the phaCAB operon were then designed and purchased (genomic sequence with Accession Number AM260479.1). More specifically, the CNF1 (forward primer) and CNR1 (reverse primer) oligonucleotides are nucleotide sequences complementary to the genomic regions upstream of the putative phaCAB promoter and downstream of the same operon, respectively. The CNF2 (forward primer) oligonucleotide includes the nucleotide sequence of the region immediately downstream of the putative phaCAB operon promoter. PCR reactions with the CNF1 / CNR1 and CNF2 / CNR1 oligonucleotide pairs yielded amplification products of the same size as expected. In particular, nucleotide amplification reactions using the oligonucleotide pairs CNF1 / CNR1 and CNF2 / CNR1 produced amplicons of 4906 bp and 4361 bp, respectively, consistent with the sizes expected from the nucleotide sequence deposited under accession number AM260479.1. The oligonucleotides used to amplify the phaCAB operon of Cupriavidus necator H16 are the following: - Primer CNF1: AAGTACCTTGCCGACATCTATGCG (SEQ ID NO. 1) - Primer CNR1: CCCAACAAGGCACTAAGAAAAGCG (SEQ ID NO. 2) - Primer CNF2: CTGACGATTCCCAGGTTTCTCCGG (SEQ ID NO. 3) LGES / P2463IT - 11 Bird & Bird The nucleotide sequences of the oligonucleotides used for the amplification of the operonephaCAB (from the start codon ATG of the phaC gene to the stop codon TGA of the phaB gene) and the subsequent cloning of the amplified product into the pGEX vector (using the BamHI and Xhol restriction sites) are as follows: - pGEX-FWl: GGCCCCTG GGATCC CCGGAAATGGCGACCGGCAA (SEQ ID NO. 4); - pGEX-RVl: GCACTCGACTCGAGTCAGCCCATATGCAGG (SEQ ID NO. 5) Cloning of the phaCAB amplicon into the pGEX-6P-1 expression vector For cloning of the phaCAB amplicon, pGEX-6P-1 (Novagen Sigma) was chosen as the expression vector, which contains the inducible Lac+ promoter. The phaCAB operon amplicon was cloned into pGEX-6P-1 in the 5'-phaCAB-3' direction, using the BamHI and Xhol sites present in the specifically designed pGEX-FW1 and pGEX-REV1 oligonucleotides described above, respectively. Two plasmid constructs (pBA134 and pBA135) were obtained, each initially propagated in the laboratory strain E. coli JM83 and subsequently in a lac+ E. coli strain as the final recipient strain to test PHB production and its use for the valorization of industrial dairy waste (rich in lactose) and the production of bioplastics. The obtained engineered strain (EP001) was tested in expression assays for PHB production in different dairy substrates. phaCAB expression assays in EP001 In order to verify, on a laboratory scale and in small volumes (25ml), the production of PHB in the EP001 strain, two staining systems with fluorescent dyes were used, as reported in the literature: LGES / P2463IT - 12Bird & Bird 1) vital staining with Nile Red on solid medium (Spickermann P. et al. Arch. Microbiol. (1999) 171: 73-80) thanks to which it is possible to grow the bacteria (37°C) on solid nutrient medium added with Nile Red (Cf 0.5ug / ml) and distinguish the PHA-producing bacteria from the non-producing ones by means of the different coloration of the colonies. The PHB-producing bacteria form red colonies when exposed to UV. 2) fluorescence microscopy after staining of cells with Nile Blue A (Legat A. et al. Appl. Microbiol. Biotechnol (2010) 87: 1119-1127)) thanks to which it is possible to have an indirect indication of the intracellular accumulation of PHA through fluorescent signals observable under the fluorescence microscope. The method involves the preparation of a slide on which a sample (approximately 20pl) of a saturated bacterial culture grown in rich medium (Luria Bertani medium was used without and with the addition of the IPTG expression inducer Cf 0.5mM was subsequently heat-fixed and stained with 0.1% Nile Blue A. The production of PHB in the EP001 strain was verified through fluorescence microscopy. PHB accumulation was also confirmed in strain EP001. For this purpose, saturated bacterial cultures were established in flasks containing 25 ml of Nutrient Broth (OXOID) and grown at 37°C for 24 and 48 hours. It was observed that the 48-hour culture showed a significantly reduced number of fluorescent signals compared to the 24-hour culture, suggesting likely consumption of the reserve polymer previously accumulated in the cytoplasm. The results obtained confirm that the phaCAB operon in the pGEX construct is expressed in the EP001 strain engineered in our laboratories. Example 2. Evaluation of PHB production by strain EP001 in deproteinated and non-deproteinated dairy substrates. LGES / P2463IT - 13 Bird & Bird The engineered strain for PHB production (EP001) was employed in a series of fermentation trials on different types of dairy wastewater in order to verify the potential production of bioplastic (PHB). Materials and methods 2.1 Substrates The substrates used are represented by scotta and a scotta “concentrate” coming from the wastewater collected from some Apulian dairies. The "scotta" is the liquid residue left over from ricotta production following the acid-thermal precipitation of whey proteins. It contains primarily lactose, proteins, and mineral salts in an aqueous solution. The scotta “concentrate” is one of the fractions obtained through a separation process based on a membrane filtration system, aimed at recovering different fractions to be used in different valorization processes. 2.1.1 Heat-treated substrates Pasteurized substrates. An initial set of experimental tests involved inoculating the starter and evaluating the biomass and PHB accumulation in scotta (S) and scotta concentrate (C) heat-treated at 60°C for 30 minutes (SP and CP). The starter was also inoculated into pasteurized substrates supplemented (SP+ and CDP+) with Trace Solution (TS) and Mineral Medium (MM), the compositions of which are reported in Tables 1 and 2, respectively. Table 1. Composition and concentrations of Trace Solution (TS) components (Wang, F. and Lee, SY (1997) Applied and Environmental Microbiology, 63(9), pp. 37033706. doi.org / 10.1128 / aem.63.9.3703-3706.1997. Zafar, Mohd. et al. (2012) 'Optimization of polyhydroxybutyrate (PHB) production by Azohydromonas lata MTCC 2311 by using genetic algorithm based on artificial neural network and response surface methodology', Biocatalysis and Agricultural Biotechnology, 1(1), LGES / P2463IT - 14Bird & Bird pp. 70-79. Table 1. Components Concentrations (g / L) Trace Solution (TS) FeSO4 x 7H2O 20 h3bo4 0.30 CoC12 x 6H2O 0.20 ZnSO4 x 7H2O 0.03 MnCl2 x 4H2O 0.03 (NH4)6Mo7O24 x 4H2O 0.03 NiSO4 x 7H2O 0.03 CuSO4 x 5H2O 0.01 Composition and component concentrations Minerai Medium (MM) ( Sharma, V., 5 Misra, S. and Kumar Srivastava, A. (2017) 'Developing a green and sustainable process for enhanced PHB production by Azohydromonas australica Biocatalysis and Agricultural Biotechnology, 10, pp. 122-129. doi.org / 10.1016 / j.bcab.2017.02.014). Table 2. Soil Components Concentrations (g / L) Mineral Medium Lactose 25 MgSO4 x 7H2O 0.30 CaCl2 0.01 Na2HPO4 9.0 (NH4)2SO4 3.0 kh2po4 4.0 LGES / P2463IT - 15 Bird & Bird Citric acid 0.10 Yeast extract 0.15 Trace element solution 1 ml / L The goal of pasteurization is to destroy the contaminating microbiota, allowing the inoculated starter to thrive. At the end of the heat treatment, before inoculation, the substrates were centrifuged (Hermle LaborTechnik Z 327 K centrifuge) at 4°C, 12,000 rpm for 15 minutes. The pellet (consisting primarily of denatured proteins) was discarded, while the supernatant was used to set up the experiments. The protein content of the supernatant obtained from the pasteurized protein is approximately 0.33 g / L. Sterilized substrates. Subsequently, biomass and PHB accumulation were evaluated in scotta and scotta concentrate heat-treated at 121°C for 15 minutes. The sterilized substrates were used as is (SS and CDS) and supplemented (SS+ and CDS+) with TS and MM. The goal of sterilization is to destroy contaminating microbiota and allow significant precipitation of residual proteins present in the substrates (determined using the Bradford method before and after treatment, as well as for pasteurization). At the end of the heat treatment, before inoculation, the substrates were centrifuged (Hermle LaborTechnik Z 327 K centrifuge) at 4°C, 12,000 rpm for 15 minutes. The pellet was discarded, while the supernatant was used for testing. The supernatant from the sterilized pellet had a protein content of approximately 0.012 g / L and a lactose content of approximately 36 g / L. 2.1.2 Effect of organic nitrogen concentration In order to check the growth of the microorganism (biomass) and the accumulation of PHB LGES / P2463IT -16Bird & Bird in the presence of variable concentrations of organic nitrogenous substances in the substrate, substrates with intermediate concentrations were obtained compared to pasteurized scotta (0.33 g / L of protein) and sterilized scotta (0.012 g / L of protein). In particular, the substrates with intermediate concentrations were obtained by mixing pasteurized and sterilized scotta as reported in Table 3. Table 3. Composition and protein concentration of the substrates obtained by mixing pasteurized and sterilized scotta. (%) SP+:(%) SS+ Protein g / L Mixture I 25:75 0.09±0.02 Mixture II 50:50 0.17±0.05 Mixture III 75:25 0.25±0.02 2.2 Propagation of the microorganism The culture of the engineered strain EP001 as described above was revitalized by resuspension and subsequent incubation for 24 h at 37°C in Luria Bertani (LB) medium, pH 7.0, having the following composition (g / L): Tryptone 10, Yeast extract 5, NaCl 10, supplemented with ampicillin (100 μg / ml) and glucose (20 g / L). The medium was sterilized at 121°C for 15 minutes before use. The inoculation (both in the routine propagation phases in the soil and for the experimental tests on substrates) was carried out at 4% v / v upon reaching the exponential phase (16-18 h of incubation). To ensure the aerobic conditions necessary for the growth of the microorganism, the soil and substrates were kept under constant agitation (200 rpm). 2.3 Test conditions LGES / P2463IT -17Bird & Bird The experimental plan included the preparation of a series of fermentation setups aimed at monitoring and optimizing the production process of PHB in scotta and scotta concentrate by E. coli EP001. It is emphasized that a preliminary series of tests have led to the definition of the following common conditions: a) batches of 200 ml per thesis, placed in 500 ml Pyrex glass Erlenmeyer flasks; b) 4% (v / v) inoculations; c) fermentation time of 72 hours, at a temperature of 37°C; d) pH correction to 7.00, carried out every 3 hours with 3M NaOH. Each experiment was set up inside 500 ml Pyrex glass Erlenmeyer flasks. The bacterial culture was inoculated at 4% v / v. Fermentations were conducted in an orbital shaking incubator (Argo Lab model, SKI4) at 200 rpm, at a constant temperature of 37 °C. For each condition, an antibiotic (cycloheximide 0.10 g / L) was added to inhibit the growth of contaminating yeasts (Table 4). LGES / P2463IT - 18 Bird & Bird Table 4. List of tested conditions and fermentation parameters. Inoculum or Supplement. t (h) pH T (OC) Agitation (rpm) Lactase Enzyme Conc. Lactose (g / L) Conc. Protein (g / L) Luria Bertnni 4% -Amp 100ug / ml -Glucose 20g / L 72 7 37 200 - - - Pasteurized concentrate 4% cycloheximide 0.10 g / L 72 7 37 200 - 125±0.25 7.20±0.12 Diluted pasteurized concentrate 4% cycloheximide 0.10 g / L 72 7 37 200 - 25±0.10 1.44±0.10 Pasteurized scotta 4% cycloheximide 0.10 g / L 72 7 37 200 - 36±0.12 0.33±0.10 Mixture I 4% cycloheximide 0.10 g / L 72 7 37 200 - 36±0.12 0.09±0.02 Mixture II 4% cycloheximide 0.10 g / L 72 7 37 200 - 36±0.12 0.17±0.05 Mixture III 4% cycloheximide 0.10 g / L 72 7 37 200 - 36±0.12 0.25±0.02 2.4 Recovery and determination of dry weight At the end of the fermentation, the bacterial cells were recovered from the liquid substrate by centrifugation at 12,000 rpm for 15 minutes at 4°C. The cell pellet was resuspended and washed twice with a NaCl solution. LGES / P2463IT -19Bird & Bird at 0.9% to remove any residual impurities. The washing process removes substances present in the culture liquid (salts, nutrients, etc.) that could alter the final dry weight or dissolve in the extraction solvent, reducing the purity of the polymer. After washing, a new centrifuge was performed at 12,000 rpm for 15 minutes at 4°C. The recovered cellular biomass was then oven-dried at 60°C for at least 24 hours. This operating temperature, in addition to ensuring the evaporation of any moisture present, protects the polymer from microbial or enzymatic degradation. The drying process allows for accurate measurement of the dry weight. The dried cell pellet was weighed using a precision analytical balance (Sartorius). Determining the dry weight provides a quantitative measure of the cellular biomass obtained from the fermentation process. This parameter is of fundamental importance for evaluating bacterial growth performance under different experimental conditions. 2.5 Extraction and purification of bioplastic The extraction of PHB granules contained in bacterial cells first involves cell lysis, followed by the separation of the biopolymer from the rest of the cellular components. In particular, the protocol reported in Wang et al. (Bioprocess and Biosystems Engineering 35 (9), p. 1591-1607) was used for the extraction and purification of PHB from dry E. coli biomass. To achieve complete cell lysis, the dried biomass was resuspended in a solution of 12% v / v sodium hypochlorite (NaOCl, Sigma Aldrich) and chloroform (CHCl3, VWR Chemicals): 12.5 ml of chloroform and 12.5 ml of 12% sodium hypochlorite per gram of dried cell biomass. To achieve complete solubilization, the mixture was kept in a water bath at 30°C for 90 min, and LGES / P2463IT -20Bird & Bird vortex regularly. Lysis of the bacterial cells allows the biopolymer to pass into the organic phase (chloroform). The solutions, placed in 50 ml Falcon tubes, were centrifuged (5,000 rpm, 15 min, 4°C), resulting in three distinct phases: a top layer of hypochlorite, an intermediate disk of cellular material, and a denser bottom layer of chloroform containing the bioplastic. The organic phase containing PHB was recovered with a glass Pasteur pipette, taking care not to remove the cellular material constituting the disk at the interface between the phases, and centrifuged again (5,000 rpm, 15 min, 4°C) to remove any residual impurities. The pellet, corresponding to the crude PHB, was recovered with chloroform and subjected to a purification process with ethanol (Sigma Aldrich), added in a quantity equal to 10 times the volume of chloroform used for each individual sample. After centrifugation at 12,000 rpm for 15 min at 4°C, the pellet, corresponding to the purified PHA, was recovered and left under a fume hood to volatilize any excess solvent, then weighed (Gibertini balance). The polymer yield (%) was calculated as [PHA (mg / L) / CDM (mg / L)] x 100. 3. Results Optical density at 600 nm (OD600), microscopic observations, and pH were monitored regularly throughout the experiments, while biomass dry weight and PHB were measured at the end of the experiment. pH was maintained at 7.00 ± 0.02 by correction with 3M (or 5M) NaOH. Table 6. Data relating to the cell pellet (Dry Cell Weight) of E. coli EP001 and PHB synthesized during incubation at 30°C for 72 h in pasteurized Scotta (SP) and Scotta Concentrate, Pasteurized Scotta Concentrate subjected to dilution of the LGES / P2463IT -21 Bird & Bird lactose (CPD) and in substrates having intermediate concentrations of organic nitrogenous substances compared to pasteurized scotta (SP, 0.33 g / L of proteins) and sterilized scotta (SS, 0.12 g / L of proteins). Dry cell weight g / L PHB g / L Yield (PHB / DCW) LB l,06±0,10 0,73±0,05 68,9%±0,18 Pasteurized Concentrate (CP+) 3,25±0,12 0,09±0,10 2,8%±0,16 Pasteurized Diluted Concentrate (CDP+) l,08±0,08 0,15±0,12 13,8%±0,10 Pasteurized Scotta (SP+) l,39±0,10 0,32±0,09 23%±0,12 Mix I l,17±0,12 0,56±0,11 47,9 %±0,20 Mix II l,14±0,18 0,54±0.15 47.4%±0.18 Mixture III l.3±0.15 0.68±0.12 52.3 %±0.12 From the analysis of the data reported in Table 6, it is evident that the E. coli EP001 strain is able to grow and synthesize PHB in both scotta and scotta concentrate. Comparing the CP+ and CDP substrates, it is clear that at reduced concentrations of lactose and protein, an increase in the amount of PHB synthesized is observed, 10 which is equal to 0.15 g / L in the diluted substrate with lactose reduction (CDP+), in which the lactose concentration was reduced from 124.5 g / L to 25 g / L, almost double the amount found in the undiluted substrate (CP+). In order to verify the growth of the microorganism (biomass) and the accumulation of PHB at variable concentrations of organic nitrogenous substances in the substrate, 15 substrates at intermediate concentrations were obtained, the mixtures, compared to scotta LGES / P2463IT -22Bird & Bird pasteurized (0.33 g / L protein) and sterilized scotta (0.12 g / L protein). From the analysis of the results obtained, confirmed by multiple replicates, it is clear that an increase in PHB yield is obtained with the decrease in the protein and lactose concentration present in the substrate and with a ratio of lactose to the 5 proteins lower than 50:1. It is noted in particular that the highest levels of PHB production are obtained in soils having a lactose to protein ratio lower than 100:1, preferably lower than 150:1. In fact, it is observed that with the reduction of the protein content in the mixture (from mixture I to mixture III), and therefore with the reduction of the lactose:protein ratio, there is an increase in the synthesis of PHB, with a yield of PHB produced equal to approximately 50% of the biomass, which is close to the yield obtained in laboratory LB medium (free of proteins and lactose) of 68.9%.

Claims

CLAIMS 1. A method for producing a polyhydroxyalkanoate (PHA) in a bacterial strain genetically modified with a vector containing the phaCAB operon and grown in the presence of dairy wastewater having a lactose:protein ratio of less than 50:

1.

2. A method according to claim 1 characterized in that said lactose:protein ratio is less than 100:1, more preferably less than 150:

1.

3. Metodo secondo ognuna delle rivendicazioni 1 o 2, caratterizzato dal fatto che detto ceppo batterico è scelto tra Acidovorax, Acinetobacter, Actinobacillus, Actinomiceti, Aeromonas, Alcaligenes, Allochromatium, Anabaena, Aphanothece, Aquaspirillum, Asticcaulus, Axobacter, Azomonas, Aureobasidium, Azoidromonas, Azospirillum, Azotobacter, Bacillo, Beggiatoa, Beijerinckia, Beneckea, Brachymonas, Bradyrhizobium, Burkholderia, Caryophanon, Caulobacter, Chloroflexus, Chlorogloea, Chromatium, Chromobacterium, Clostridium, Defluviicoccus, Comamonas, Corynebacterium, Cupriavidus, Cyanobacterium, Derxia, Delftia, Ectothiorhodospira, Erwinia, Escherichia coli, Ferrobacillus, Gamphospheria, Gloeocapsa, Gloeothece, Haemophilus, Halobacterium, Haloarcula, Haloferax, Halomonas, Haloquadratum, Haloterrigena, Hydrogenophaga, Hyphomicrobium, Klebsiella (ricombinante), Lamprocystis, Lampropedia, Leptothrix, Legionella, Methanomonas, Methylobacterium, Methylomonas, Methylosinus, Methylocystis,Methylovibrio, Micrococcus, Microcoleus, Microcystis, Microlunatus, Microvoleus, Moraxella, Mycoplana, Nitrobacter, Nitrococcus, Nocardia, Nostoc, Oceanospirillum, Oscillatoria, Paracoccus, Paucispirillum, Pedomicrobium, Photobacterium, Protomonas, Pseudomonas, Ralstonia, Rhizobium, Rhodobacter, Rhodococcus, Rhodopseudomonas, Rhodospirillum, Rubrivivax, Saccharophagus, Shinorhizobium, Sphaerotilus, Spirillum, Spirulina, Staphylococcus, Stella, Streptomyces, Synechococcus, Syntrophomonas, Thiobacillus, Thiocapse, LGES / P2463IT -24Bird & Bird Thiococcus, Thiocystis, Thiodictyon, Thiopedia, Thiosphaera, Variovorax, Vibrio, Wautersia (now Cupriavidus), Xanthobacter and Zoogloea, preferably said bacterial strain is a strain of E. coli., 4. A method according to any of the preceding claims, characterized in that said vector is a plasmid of the type pGEX, pUC18, pGEM-T, pHSG298, pHSG396, pCold or any vector with a Lac+ promoter.

5. Method according to any of the preceding claims, characterized in that said dairy wastewater has a protein content between 0.7g / L and 0.05 g / L, preferably between 0.35 g / L and 0.1 g / L, more preferably approximately 0.25 g / L.

6. Method according to any of the preceding claims, characterised in that said dairy wastewater has a lactose content of less than 50 g / L, preferably less than 40 g / L.

7. Method according to each of the preceding claims, characterised in that said dairy waste is waste coming from the industrial processing of milk for the production of butter, cheese and derivatives, more preferably said dairy waste is subjected to pasteurisation or sterilisation.

8. Method according to any of the preceding claims, characterized in that said polyhydroxyalkanoate is selected from PHB or polymers obtained from at least one monomer selected from the group consisting of 2-hydroxybutyrate, lactic acid, 3-hydroxybutyrate (3HB), 3-hydroxypropionate (3HP), 3-hydroxyvalerate (3HV), 3-hydroxyhexanoate (3HH), 3-hydroxyheptanoate (3HHep), 3-hydroxyoctanoate (3HO), 3-hydroxynonanoate (3HN), 3-hydroxydecanoate (3HD), 3-hydroxyundecanoate (HUD), 3-hydroxydodecanoate (3HDd), 4-hydroxybutyrate (4HB), 4-hydroxyvalerate (4HV), 5-hydroxyvalerate (5HV) and 6-hydroxyhexanoate (6HH) and combinations thereof, preferably said polyhydroxyalkanoate is PHB or polymers thereof, more preferably it is PHB.

9. A method according to any of the preceding claims, characterised by LGES / P2463IT - 25 - Bird & Bird comprising the following steps: a) inoculation of the bacterial strain in a percentage between 30 and 1% v / v; b) incubation for at least 10 hours at a temperature between 27-40° C, with shaking between 50-1500 rpm; aeration by diffusion in a flask, between 0.5-3 vvm in a bioreactor; c) maintenance of the culture pH at a value of 5-8; d) recovery of the cellular biomass by extraction and purification of the polyhydroxyalkanoate granules.

10. A method according to any of the preceding claims, characterized by comprising the following steps: e) inoculating the bacterial strain in a percentage between 15 and 2% v / v, preferably a percentage of 4%; f) incubation for at least 24 hours at a temperature between 30-37° C, more preferably 37° C, with shaking between 100-500 rpm; aeration by diffusion in a flask, between 1-2 vvm in a bioreactor; g) maintaining the pH of the culture at a value of 6-7; h) extraction and purification of the polyhydroxyalkanoate granules.