Methods and compositions for increasing homologous recombination repair

Abstract

This specification provides combinations comprising a CRISPR / Cas system, a CtBP interacting protein, and a 53BP1 inhibitor for use in enhancing homologous recombination repair of CRISPR / Cas-mediated cleavage of target DNA by exogenous donor nucleic acids. Methods for using such combinations to create targeted gene modifications within cells by homologous recombination repair of CRISPR / Cas-mediated cleavage at target genomic loci within cells are also provided.

Description

[Technical Field]

[0001] (Cross-reference of related applications) This application claims the interests of U.S. Application No. 63 / 511,361, filed on 30 June 2023, which is incorporated herein by reference in its entirety for all purposes.

[0002] (Reference to sequence listings submitted as XML files via EFS WEB) The sequence listing described in file 614575SEQLIST.xml is 76,084 kilobytes in size, was created on June 27, 2024, and is incorporated herein by reference. [Background technology]

[0003] The development of CRISPR / Cas technology provides an efficient approach to introducing site-directed modifications into mammalian genomes, offering significant potential for the study and treatment of a wide range of genetic diseases. Currently, the most widely used CRISPR system in genome engineering utilizes a single guide RNA (sgRNA) and CRISPR-associated endonuclease (Cas9) to generate double-strand breaks (DSBs) at target sequences. Two major DSB repair pathways in mammalian cells are (i) error-prone non-homologous end joining (NHEJ) and (ii) faithful homologous recombination repair (HDR), the latter being limited to the S and G2 phases of the cell cycle and dependent on the availability of repair templates containing the modifications to be introduced. Methods to enhance HDR would be useful in providing better and more efficient ways to perform precise genome editing. [Overview of the Initiative] [Means for solving the problem]

[0004] This specification provides combinations comprising a CRISPR / Cas system, a CtBP interacting protein, and a 53BP1 inhibitor for use in enhancing homologous recombination repair of CRISPR / Cas-mediated cleavage of target DNA by exogenous donor nucleic acids. Methods for using such combinations to create targeted gene modifications within cells by homologous recombination repair of CRISPR / Cas-mediated cleavage at target genomic loci within cells are also provided.

[0005] In one embodiment, a method is provided for producing targeted gene modifications by homologous recombination repair at a target genomic locus within a cell. Some such methods involve providing a cell with (a) a clustered equispaced short palindromic repeat (CRISPR)-associated (Cas) protein or a nucleic acid encoding a Cas protein; (b) a guide RNA or one or more DNAs encoding a guide RNA, wherein the guide RNA comprises one or more adapter-binding elements to which an adapter protein can specifically bind, and the guide RNA forms a complex with the Cas protein and is guided to a guide RNA target sequence at a target genomic locus; and (c) a fusion protein or a nucleic acid encoding a fusion protein, wherein the fusion protein is a CtBP-interacting protein (CtIP) fused to the adapter protein. The procedure involves administering an exogenous donor nucleic acid comprising (d) a fusion protein or nucleic acid encoding a fusion protein, (e) a 53BP1 inhibitor (i53) protein or nucleic acid encoding an i53 protein, and (f) an exogenous donor nucleic acid comprising a 5' homology arm that hybridizes to the 5' target sequence of the target genomic locus and a 3' homology arm that hybridizes to the 3' target sequence of the target genomic locus, wherein optionally, the 5' homology arm and the 3' homology arm are adjacent to the inserted nucleic acid, wherein the Cas protein and guide RNA form a complex, the Cas protein cleaves the guide RNA target sequence to produce a double-strand break, and the exogenous donor nucleic acid recombinates with the target genomic locus via homologous recombination repair to produce a targeted gene modification.

[0006] In some such methods, the Cas protein is administered to cells in protein form, and optionally, the Cas protein is contained in lipid nanoparticles. In some such methods, the nucleic acid encoding the Cas protein is administered to cells, and the nucleic acid encoding the Cas protein contains the RNA encoding the Cas protein, and optionally, the RNA encoding the Cas protein is contained in lipid nanoparticles. In some such methods, the nucleic acid encoding the Cas protein is administered to cells, and the nucleic acid encoding the Cas protein contains the DNA encoding the Cas protein, and optionally, the DNA encoding the Cas protein is contained in a viral vector, and optionally, the viral vector is a recombinant adeno-associated virus (AAV) vector. In some such methods, the Cas protein is the Cas9 protein. In some such methods, the Cas9 protein is the Streptococcus pyogenes Cas9 protein, the Campylobacter jejuni Cas9 protein, or the Staphylococcus aureus Cas9 protein, and optionally, the Cas9 protein is the Streptococcus pyogenes Cas9 protein.

[0007] In some such methods, the guide RNA is administered in RNA form, and optionally, the guide RNA is contained in lipid nanoparticles. In some such methods, one or more DNAs encoding the guide RNA are administered to cells, and optionally, one or more DNAs encoding the guide RNA are contained in a viral vector, and optionally, the viral vector is a recombinant AAV vector. In some such methods, the guide RNA contains two adapter-binding elements to which an adapter protein can specifically bind. In some such methods, the first adapter-binding element is located in the first loop of the guide RNA, and the second adapter-binding element is located in the second loop of the guide RNA. In some such methods, the guide RNA is a single guide RNA containing a CRISPR RNA (crRNA) moiety fused to a transactivated CRISPR RNA (tracrRNA) moiety, where the first loop is a tetraloop corresponding to residues 13-16 of SEQ ID NOs. 11, 13, 15, or 16, and the second loop is a stemloop 2 corresponding to residues 53-56 of SEQ ID NOs. 11, 13, 15, or 16. In some such methods, the adapter binding element includes the sequence described in SEQ ID NO: 19 or 20. In some such methods, the guide RNA includes the sequence described in SEQ ID NO: 21, 22, 23, 24, 25, or 26.

[0008] In some such methods, the fusion protein is administered to cells in protein form, and optionally, the fusion protein is contained in lipid nanoparticles. In some such methods, the nucleic acid encoding the fusion protein is administered to cells, and the nucleic acid encoding the fusion protein comprises RNA encoding the fusion protein, and optionally, the RNA encoding the fusion protein is contained in lipid nanoparticles. In some such methods, the nucleic acid encoding the fusion protein is administered to cells, and the nucleic acid encoding the fusion protein comprises DNA encoding the fusion protein, and optionally, the DNA encoding the fusion protein is contained in a viral vector, and optionally, the viral vector is a recombinant AAV vector. In some such methods, the adapter protein comprises the MS2 coat protein or a functional fragment or variant thereof. In some such methods, the adapter protein contains a sequence that is at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence described in Sequence ID No. 32. In some such methods, the adapter protein is encoded by a sequence that is at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence described in SEQ ID NO: 33. In some such methods, the CtIP protein contains a sequence that is at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence described in SEQ ID NO: 34. In some such methods, the CtIP protein is encoded by a sequence that is at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence described in SEQ ID NO: 36. In some such methods, the fusion protein contains a sequence that is at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence described in SEQ ID NO: 30. In some such methods, the fusion protein is encoded by a sequence that is at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence described in SEQ ID NO: 31.

[0009] In some such methods, the i53 protein is administered to cells in protein form, and optionally, the i53 protein is contained in lipid nanoparticles. In some such methods, the nucleic acid encoding the i53 protein is administered to cells, and the nucleic acid encoding the i53 protein contains the RNA messenger RNA encoding the i53 protein, and optionally, the RNA encoding the i53 protein is contained in lipid nanoparticles. In some such methods, the nucleic acid encoding the i53 protein is administered to cells, and the nucleic acid encoding the i53 protein contains the DNA encoding the i53 protein, and optionally, the DNA encoding the i53 protein is contained in a viral vector, and optionally, the viral vector is a recombinant AAV vector. In some such methods, the i53 protein contains a sequence that is at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence described in Sequence ID No. 40 or 42. In some such ways, the i53 protein is encoded by a sequence that is at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence described in SEQ ID NO: 41 or 43.

[0010] In some such methods, the exogenous donor nucleic acid contains an insertion nucleic acid. In some such methods, the exogenous donor nucleic acid is in a viral vector. In some such methods, the viral vector is a recombinant AAV vector. In some such methods, the exogenous donor nucleic acid is a large targeted vector (LTVEC) where (a) the LTVEC is at least 10 kb, (b) the sum of the 5' and 3' homology arms of the LTVEC is at least 10 kb, (c) the LTVEC is about 50 kb to about 300 kb, or (d) the sum of the 5' and 3' homology arms of the LTVEC is about 10 kb to about 200 kb.

[0011] In some such methods, the nucleic acid encoding the fusion protein is administered to cells, and the nucleic acid encoding the fusion protein includes RNA encoding the fusion protein; the nucleic acid encoding the i53 protein is administered to cells, and the nucleic acid encoding the i53 protein includes RNA encoding the i53 protein; and the RNA encoding the fusion protein and the RNA encoding the i53 protein are located in lipid nanoparticles. In some such methods, the guide RNA includes two adapter binding elements to which the adapter protein can specifically bind, the first adapter binding element being in the first loop of the guide RNA, and the second adapter binding element being in the second loop of the guide RNA; the adapter protein includes the MS2 coat protein or a functional fragment or variant thereof; the nucleic acid encoding the fusion protein is administered to cells, and the nucleic acid encoding the fusion protein includes RNA encoding the fusion protein; the nucleic acid encoding the i53 protein is administered to cells, and the nucleic acid encoding the i53 protein includes RNA encoding the i53 protein; and the RNA encoding the fusion protein and the RNA encoding the i53 protein are located in lipid nanoparticles.

[0012] In some such methods, the guide RNA comprises two adapter-binding elements to which an adapter protein can specifically bind, the first adapter-binding element being in a first loop of the guide RNA and the second adapter-binding element being in a second loop of the guide RNA, the adapter protein comprising the MS2 coat protein or a functional fragment or variant thereof, the nucleic acid encoding the Cas protein being administered to the cells and comprising the RNA encoding the Cas protein, the nucleic acid encoding the fusion protein being administered to the cells and comprising the RNA encoding the fusion protein, the nucleic acid encoding the i53 protein being administered to the cells and comprising the RNA encoding the i53 protein, the RNA encoding the Cas protein, the RNA encoding the fusion protein, and the RNA encoding the i53 protein being in lipid nanoparticles, one or more DNAs encoding the guide RNA being administered to the cells, and one or more DNAs encoding the guide RNA and exogenous donor nucleic acids being in a recombinant AAV vector.

[0013] In some such methods, the guide RNA comprises two adapter-binding elements to which the adapter protein can specifically bind, the first adapter-binding element being in the first loop of the guide RNA and the second adapter-binding element being in the second loop of the guide RNA, the adapter protein comprising the MS2 coat protein or a functional fragment or variant thereof, the nucleic acid encoding the Cas protein being administered to the cell and comprising the RNA encoding the Cas protein, the nucleic acid encoding the fusion protein being administered to the cell and comprising the RNA encoding the fusion protein, the nucleic acid encoding the i53 protein being administered to the cell and comprising the RNA encoding the i53 protein, the guide RNA being administered to the cell in RNA form, the RNA encoding the Cas protein, the RNA encoding the fusion protein, the RNA encoding the i53 protein, and the guide RNA being contained in lipid nanoparticles, and the exogenous donor nucleic acid being contained in a recombinant AAV vector.

[0014] In some such ways, the cells are mammalian cells. In some such ways, the cells are rodent cells. In some such ways, the cells are mouse cells or rat cells. In some such ways, the cells are mouse cells. In some such ways, the cells are human cells. In some such ways, the cells are in vitro. In some such ways, the cells are in vivo.

[0015] In another embodiment, compositions or combinations are provided. Some such compositions or combinations include (a) a clustered equispaced short palindromic repeat (CRISPR)-associated (Cas) protein or nucleic acid encoding a Cas protein; (b) a guide RNA or one or more DNAs encoding a guide RNA, wherein the guide RNA comprises one or more adapter-binding elements to which an adapter protein can specifically bind, and the guide RNA forms a complex with the Cas protein and is guided to a guide RNA target sequence at a target genomic locus; and (c) a fusion protein or fusion protein The fusion protein comprises (d) a nucleic acid encoding a protein, wherein the fusion protein includes a CtBP interacting protein (CtIP) fused to an adapter protein, and (e) an exogenous donor nucleic acid comprising a 5' homology arm that hybridizes to a 5' target sequence of the target genomic locus and a 3' homology arm that hybridizes to a 3' target sequence of the target genomic locus, wherein optionally, the 5' homology arm and the 3' homology arm are adjacent to the inserted nucleic acid.

[0016] In some such compositions or combinations, the composition or combination comprises a Cas protein in the form of a protein, and optionally, the Cas protein is contained in lipid nanoparticles. In some such compositions or combinations, the composition or combination comprises a nucleic acid encoding a Cas protein, and the nucleic acid encoding a Cas protein comprises RNA encoding a Cas protein, and optionally, the RNA encoding a Cas protein is contained in lipid nanoparticles. In some such compositions or combinations, the composition or combination comprises a nucleic acid encoding a Cas protein, and the nucleic acid encoding a Cas protein comprises DNA encoding a Cas protein, and optionally, the DNA encoding a Cas protein is contained in a viral vector, and optionally, the viral vector is a recombinant adeno-associated virus (AAV) vector. In some such compositions or combinations, the Cas protein is a Cas9 protein. In some such compositions or combinations, the Cas9 protein is Streptococcus pyogenes Cas9 protein, Campylobacter jejuni Cas9 protein, or Staphylococcus aureus Cas9 protein, and optionally, the Cas9 protein is Streptococcus pyogenes Cas9 protein.

[0017] In some such compositions or combinations, the composition or combination comprises a guide RNA in the form of RNA, and optionally, the guide RNA is in lipid nanoparticles. In some such compositions or combinations, the composition or combination comprises one or more DNAs encoding the guide RNA, and optionally, the one or more DNAs encoding the guide RNA are in a viral vector, and optionally, the viral vector is a recombinant AAV vector. In some such compositions or combinations, the guide RNA comprises two adapter binding elements to which an adapter protein can specifically bind. In some such compositions or combinations, the first adapter binding element is within the first loop of the guide RNA, and the second adapter binding element is within the second loop of the guide RNA. In some such compositions or combinations, the guide RNA is a single guide RNA comprising a CRISPR RNA (crRNA) portion fused to a trans-activating CRISPR RNA (tracrRNA) portion, the first loop is a tetraloop corresponding to residues 13-16 of SEQ ID NO: 11, 13, 15, or 16, and the second loop is a stem loop 2 corresponding to residues 53-56 of SEQ ID NO: 11, 13, 15, or 16. In some such compositions or combinations, the adapter binding element comprises the sequence set forth in SEQ ID NO: 19 or 20. In some such compositions or combinations, the guide RNA comprises the sequence set forth in SEQ ID NO: 21, 22, 23, 24, 25, or 26.

[0018] In some such compositions or combinations, the composition or combination comprises a fusion protein in the form of a protein, and optionally the fusion protein is contained in lipid nanoparticles. In some such compositions or combinations, the composition or combination comprises a nucleic acid encoding the fusion protein, and the nucleic acid encoding the fusion protein comprises RNA encoding the fusion protein, and optionally the RNA encoding the fusion protein is contained in lipid nanoparticles. In some such compositions or combinations, the composition or combination comprises a nucleic acid encoding the fusion protein, and the nucleic acid encoding the fusion protein comprises DNA encoding the fusion protein, and optionally the DNA encoding the fusion protein is contained in a viral vector, and optionally the viral vector is a recombinant AAV vector. In some such compositions or combinations, the adapter protein comprises an MS2 coat protein or a functional fragment or variant thereof. In some such compositions or combinations, the adapter protein comprises a sequence that is at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence described in SEQ ID NO: 32. In some such compositions or combinations, the adapter protein is encoded by a sequence that is at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence described in SEQ ID NO: 33. In some such compositions or combinations, the CtIP protein contains a sequence that is at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence described in SEQ ID NO: 34. In some such compositions or combinations, the CtIP protein is encoded by a sequence that is at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence described in SEQ ID NO: 36. In some such compositions or combinations, the fusion protein contains a sequence that is at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence described in SEQ ID NO: 30. In some such compositions or combinations, the fusion protein is encoded by a sequence that is at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence described in SEQ ID NO: 31.

[0019] In some such compositions or combinations, the composition or combination comprises the p53 protein in the form of a protein, and optionally, the p53 protein is in lipid nanoparticles. In some such compositions or combinations, the composition or combination comprises a nucleic acid encoding the p53 protein, and the nucleic acid encoding the p53 protein comprises an RNA messenger RNA encoding the p53 protein, and optionally, the RNA encoding the p53 protein is in lipid nanoparticles. In some such compositions or combinations, the composition or combination comprises a nucleic acid encoding the p53 protein, and the nucleic acid encoding the p53 protein comprises a DNA encoding the p53 protein, and optionally, the DNA encoding the p53 protein is in a viral vector, and optionally, the viral vector is a recombinant AAV vector. In some such compositions or combinations, the p53 protein comprises a sequence that is at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence set forth in SEQ ID NO: 40 or 42. In some such compositions or combinations, the p53 protein is encoded by a sequence that is at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence set forth in SEQ ID NO: 41 or 43.

[0020] In some such compositions or combinations, the exogenous donor nucleic acid comprises an inserted nucleic acid. In some such compositions or combinations, the exogenous donor nucleic acid is in a viral vector. In some such compositions or combinations, the viral vector is a recombinant AAV vector. In some such compositions or combinations, the exogenous donor nucleic acid is a large targeting vector (LTVEC), and (a) the LTVEC is at least 10 kb, (b) the total of the 5' and 3' homology arms of the LTVEC is at least 10 kb, (c) the LTVEC is from about 50 kb to about 300 kb, or (d) the total of the 5' and 3' homology arms of the LTVEC is from about 10 kb to about 200 kb.

[0021] In some such compositions or combinations, the composition or combination comprises a nucleic acid encoding a fusion protein, the nucleic acid encoding the fusion protein comprises RNA encoding the fusion protein, the composition or combination comprises a nucleic acid encoding an i53 protein, the nucleic acid encoding the i53 protein comprises RNA encoding the i53 protein, and the RNA encoding the fusion protein and the RNA encoding the i53 protein are contained in lipid nanoparticles. In some such compositions or combinations, the guide RNA comprises two adapter binding elements to which an adapter protein can specifically bind, the first adapter binding element being in a first loop of the guide RNA, the second adapter binding element being in a second loop of the guide RNA, the adapter protein comprising an MS2 coat protein or a functional fragment or variant thereof, the composition or combination comprises a nucleic acid encoding a fusion protein, the nucleic acid encoding the fusion protein comprises RNA encoding the fusion protein, the composition or combination comprises a nucleic acid encoding an i53 protein, the nucleic acid encoding the i53 protein comprises RNA encoding the i53 protein, and the RNA encoding the fusion protein and the RNA encoding the i53 protein are contained in lipid nanoparticles.

[0022] In some such compositions or combinations, the guide RNA comprises two adapter-binding elements to which an adapter protein can specifically bind, the first adapter-binding element being in a first loop of the guide RNA and the second adapter-binding element being in a second loop of the guide RNA, the adapter protein comprising an MS2 coat protein or a functional fragment or variant thereof, the composition or combination comprising a nucleic acid encoding a Cas protein, the nucleic acid encoding the Cas protein comprising RNA encoding the Cas protein, the composition or combination comprising a nucleic acid encoding a fusion protein, the nucleic acid encoding the fusion protein comprising RNA encoding the fusion protein, the composition or combination comprising a nucleic acid encoding an i53 protein, the nucleic acid encoding the i53 protein comprising RNA encoding the i53 protein, the RNA encoding the Cas protein, the RNA encoding the fusion protein, and the RNA encoding the i53 protein are in lipid nanoparticles, the composition or combination comprises one or more DNAs encoding the guide RNA, the one or more DNAs encoding the guide RNA and the exogenous donor nucleic acid are in a recombinant AAV vector.

[0023] In some such compositions or combinations, the guide RNA comprises two adapter-binding elements to which an adapter protein can specifically bind, the first adapter-binding element being in a first loop of the guide RNA and the second adapter-binding element being in a second loop of the guide RNA, the adapter protein comprising the MS2 coat protein or a functional fragment or variant thereof, the composition or combination comprising a nucleic acid encoding the Cas protein, the nucleic acid encoding the Cas protein comprising the RNA encoding the Cas protein, the composition or combination comprising a nucleic acid encoding the fusion protein, the nucleic acid encoding the fusion protein comprising the RNA encoding the fusion protein, the composition or combination comprising a nucleic acid encoding the i53 protein, the nucleic acid encoding the i53 protein comprising the RNA encoding the i53 protein, the composition or combination comprising a guide RNA in RNA form, the RNA encoding the Cas protein, the RNA encoding the fusion protein, the RNA encoding the i53 protein, and the guide RNA are in lipid nanoparticles, and the exogenous donor nucleic acid is in a recombinant AAV vector. [Brief explanation of the drawing]

[0024] [Figure 1] A schematic diagram of the insertion of a CRISPR-mediated homologous recombination repair (HDR) reporter targeting the LMNA gene is shown. In this assay, the coding sequence of the mClover fluorescent protein is designed to be incorporated into the 5' end of the lamin A (LMNA) gene by HDR. The expression and clear localization of the resulting mClover-LMNA fusion protein can then be visualized and quantified by microscopy. An AAV2 vector (AAVsgLMNA+mClover) expressing LMNA-targeting sgRNA (sgLMNA) and containing an mClover sequence adjacent to the appropriate homology arm (HA) was used as the HDR donor template. The donor template is adjacent to the sgLMNA recognition sequence, enabling linearization of the donor during intracellular sgLMNA expression. [Figure 2A]Figure 1 shows the evaluation of baseline HDR in Cas9-expressing HEK293 cells with increased MOI of the AAV2 HDR template using the assay shown. Figure 2A shows mClover and Hoechst staining to assess the percentage of mClover-LMNA-positive cells. Figure 2B shows HDR efficiency as measured by the percentage of mClover-LMNA-positive cells. Figure 2C shows data from negative controls, including the use of donor templates co-treated with mirin or without homologous arms. [Figure 2B] Figure 1 shows the evaluation of baseline HDR in Cas9-expressing HEK293 cells with increased MOI of the AAV2 HDR template using the assay shown. Figure 2A shows mClover and Hoechst staining to assess the percentage of mClover-LMNA-positive cells. Figure 2B shows HDR efficiency as measured by the percentage of mClover-LMNA-positive cells. Figure 2C shows data from negative controls, including the use of donor templates co-treated with mirin or without homologous arms. [Figure 2C] Figure 1 shows the evaluation of baseline HDR in Cas9-expressing HEK293 cells with increased MOI of the AAV2 HDR template using the assay shown. Figure 2A shows mClover and Hoechst staining to assess the percentage of mClover-LMNA-positive cells. Figure 2B shows HDR efficiency as measured by the percentage of mClover-LMNA-positive cells. Figure 2C shows data from negative controls, including the use of donor templates co-treated with mirin or without homologous arms. [Figure 3A]This report describes a screening of potential HDR boosting factors for selectively supporting HDR repair at CRISPR / Cas9-mediated double-strand breaks in Cas9-expressing HEK293 cells. Figure 3A shows a schematic diagram for recruiting potential HDR boosting factors to Cas9 cleavage sites using an MS2 tagging approach. In this approach, the sgRNA scaffold sequence is modified to include the MS2 phage aptamer (sgRNA2.0), and the HDR boosting protein is fused to the MS2 coat protein (MS2) for interaction with sgRNA2.0. Figure 3B shows the effect on HDR efficiency, measured by the percentage of MClover-LMNA-positive cells using the assay shown in Figure 1. [Figure 3B] This report describes a screening of potential HDR boosting factors for selectively supporting HDR repair at CRISPR / Cas9-mediated double-strand breaks in Cas9-expressing HEK293 cells. Figure 3A shows a schematic diagram for recruiting potential HDR boosting factors to Cas9 cleavage sites using an MS2 tagging approach. In this approach, the sgRNA scaffold sequence is modified to include the MS2 phage aptamer (sgRNA2.0), and the HDR boosting protein is fused to the MS2 coat protein (MS2) for interaction with sgRNA2.0. Figure 3B shows the effect on HDR efficiency, measured by the percentage of MClover-LMNA-positive cells using the assay shown in Figure 1. [Figure 4A]The effect of MS2-CtIP mRNA on HDR efficiency in Cas9-expressing HEK293 cells when the amount of LNP-packaged MS2-CtIP mRNA is increased demonstrates that CtIP-mediated DNA end excision promotes cellular commitment to HDR. Figure 4A shows mClover and Hoechst staining to assess the percentage of mClover-LMNA-positive cells. Figure 4B shows HDR efficiency as measured by the percentage of mClover-LMNA-positive cells, as well as the percentage of cells with undesirable insertions / deletions (indels) caused by repair via non-homologous end joining. All "HR efficiency" plots show absolute %mCLOVER cells from three experimental replicates. The boxes extend from the 25th to the 75th percentile. The line in the middle of the box is plotted at the median. "+" is plotted at the mean. Whiskers go down to the minimum and up to the maximum. To ensure consistency, all microscopic images were obtained from the same replicate experiment (one of three replicate experiments), and the mCLOVER% for each condition is shown in the lower right corner of each image. Figure 4C shows the effect of using sgRNA (2.0) containing an MS2-binding loop or sgRNA (REG) not containing an MS2-binding loop on the HDR efficiency of MS2-CtIP. [Figure 4B]The effect of MS2-CtIP mRNA on HDR efficiency in Cas9-expressing HEK293 cells when the amount of LNP-packaged MS2-CtIP mRNA is increased demonstrates that CtIP-mediated DNA end excision promotes cellular commitment to HDR. Figure 4A shows mClover and Hoechst staining to assess the percentage of mClover-LMNA-positive cells. Figure 4B shows HDR efficiency as measured by the percentage of mClover-LMNA-positive cells, as well as the percentage of cells with undesirable insertions / deletions (indels) caused by repair via non-homologous end joining. All "HR efficiency" plots show absolute %mCLOVER cells from three experimental replicates. The boxes extend from the 25th to the 75th percentile. The line in the middle of the box is plotted at the median. "+" is plotted at the mean. Whiskers go down to the minimum and up to the maximum. To ensure consistency, all microscopic images were obtained from the same replicate experiment (one of three replicate experiments), and the mCLOVER% for each condition is shown in the lower right corner of each image. Figure 4C shows the effect of using sgRNA (2.0) containing an MS2-binding loop or sgRNA (REG) not containing an MS2-binding loop on the HDR efficiency of MS2-CtIP. [Figure 4C]The effect of MS2-CtIP mRNA on HDR efficiency in Cas9-expressing HEK293 cells when the amount of LNP-packaged MS2-CtIP mRNA is increased demonstrates that CtIP-mediated DNA end excision promotes cellular commitment to HDR. Figure 4A shows mClover and Hoechst staining to assess the percentage of mClover-LMNA-positive cells. Figure 4B shows HDR efficiency as measured by the percentage of mClover-LMNA-positive cells, as well as the percentage of cells with undesirable insertions / deletions (indels) caused by repair via non-homologous end joining. All "HR efficiency" plots show absolute %mCLOVER cells from three experimental replicates. The boxes extend from the 25th to the 75th percentile. The line in the middle of the box is plotted at the median. "+" is plotted at the mean. Whiskers go down to the minimum and up to the maximum. To ensure consistency, all microscopic images were obtained from the same replicate experiment (one of three replicate experiments), and the mCLOVER% for each condition is shown in the lower right corner of each image. Figure 4C shows the effect of using sgRNA (2.0) containing an MS2-binding loop or sgRNA (REG) not containing an MS2-binding loop on the HDR efficiency of MS2-CtIP. [Figure 5] This paper compares the HDR efficiency, as measured by the percentage of MClover-LMNA-positive cells, when MS2-CtIP plasmid delivery or MS2-CtIP mRNA LNP delivery is used in Cas9-expressing HEK293 cells. [Figure 6A]The effect of i53 mRNA on HDR efficiency in Cas9-expressing HEK293 cells when the amount of i53 mRNA packaged in LNPs is increased is demonstrated, showing that 53BP1 inhibition provides a resection-promoting environment at double-strand breaks, further enhancing HDR. Figure 6A shows mClover and Hoechst staining to assess the percentage of mClover-LMNA-positive cells. Figure 6B shows HDR efficiency as measured by the percentage of mClover-LMNA-positive cells, as well as the percentage of cells with undesirable insertions / deletions (indels) caused by repair via non-homologous end joining. All "HR efficiency" plots show absolute % mCLOVER cells from three experimental replicates. The boxes extend from the 25th to the 75th percentile. The line in the middle of the box is plotted at the median. "+" is plotted at the mean. Whiskers go down to the minimum and up to the maximum. To ensure consistency, all microscope images were obtained from the same replicate experiment (one of three replicate experiments), and the mCLOVER% for each condition is shown in the lower right corner of each image. [Figure 6B]The effect of i53 mRNA on HDR efficiency in Cas9-expressing HEK293 cells when the amount of i53 mRNA packaged in LNPs is increased is demonstrated, showing that 53BP1 inhibition provides a resection-promoting environment at double-strand breaks, further enhancing HDR. Figure 6A shows mClover and Hoechst staining to assess the percentage of mClover-LMNA-positive cells. Figure 6B shows HDR efficiency as measured by the percentage of mClover-LMNA-positive cells, as well as the percentage of cells with undesirable insertions / deletions (indels) caused by repair via non-homologous end joining. All "HR efficiency" plots show absolute % mCLOVER cells from three experimental replicates. The boxes extend from the 25th to the 75th percentile. The line in the middle of the box is plotted at the median. "+" is plotted at the mean. Whiskers go down to the minimum and up to the maximum. To ensure consistency, all microscope images were obtained from the same replicate experiment (one of three replicate experiments), and the mCLOVER% for each condition is shown in the lower right corner of each image. [Figure 7] This study demonstrates the combined effect of MS2-CtIP and i53 on enhancing HDR efficiency in Cas9-expressing HEK293 cells, showing that co-expression of i53 and MS2-CtIP significantly increases CRISPR-stimulated HDR. All “HR efficiency” plots show absolute %mCLOVER cells from three experimental replicates. The boxes extend from the 25th to the 75th percentile. The line in the center of the box is plotted at the median. “+” is plotted at the mean. Whiskers descend to the minimum and ascend to the maximum. To ensure consistency, all microscopic images were taken from the same replicate experiment (one of three replicates), and the mCLOVER% for each condition is shown in the lower right corner of each image. [Figure 8] This demonstrates the combined effect of MS2-CtIP and i53 on HDR efficiency in Cas9-expressing HEK293 cells versus the effect of the DNA-PKcs inhibitor AZD7648. [Figure 9A]This study demonstrates the combined effects of MS2-CtIP and i53 on HDR efficiency in HEK293 cells with escalating doses of AAVsgLMNA+mClover. We used LNP boosters encapsulating two LNPs, Cas9, MS2-CtIP, and i53 mRNA, as well as LNP baselines encapsulating Cas9 and mCherry mRNA. In Figure 9A, the LNPs were transfected into HEK293 cells transduced with AAVsgLMNA+mClover at different MOIs. In Figure 9B, the experiment was repeated using guide RNAs targeting the C-terminuses of two other genes, HMGA1 and SEC61B. [Figure 9B] This study demonstrates the combined effects of MS2-CtIP and i53 on HDR efficiency in HEK293 cells with escalating doses of AAVsgLMNA+mClover. We used LNP boosters encapsulating two LNPs, Cas9, MS2-CtIP, and i53 mRNA, as well as LNP baselines encapsulating Cas9 and mCherry mRNA. In Figure 9A, the LNPs were transfected into HEK293 cells transduced with AAVsgLMNA+mClover at different MOIs. In Figure 9B, the experiment was repeated using guide RNAs targeting the C-terminuses of two other genes, HMGA1 and SEC61B. [Figure 10] This study demonstrates the combined effect of MS2-CtIP and i53 on HDR efficiency in Cas9-expressing HEK293 cells, particularly in the context of non-viral donor delivery, specifically linear closed-end dsDNA (dsDNAmClover-LMNA) containing an mClover coding sequence adjacent to the LMNA HA sequence described above, delivered by electroporation along with a plasmid encoding sgLMNA2.0. [Figure 11]This paper demonstrates the combined effect of MS2-CtIP and i53 on HDR efficiency in Cas9-expressing HEK293 cells, particularly in the context of non-viral donor delivery, especially linear closed-end dsDNA (dsDNAmClover-LMNA) containing an mClover coding sequence adjacent to the LMNA HA sequence described above, delivered by electroporation along with sgLMNA2.0 delivered in RNA form. [Modes for carrying out the invention]

[0025] definition As used interchangeably herein, the terms “protein,” “polypeptide,” and “peptide” include polymeric forms of amino acids of any length, including encoded and non-coding amino acids, as well as chemically or biochemically modified or derivatized amino acids. These terms also include modified polymers, such as polypeptides having a modified peptide backbone. The term “domain” refers to any portion of a protein or polypeptide having a specific function or structure.

[0026] As used interchangeably herein, the terms “nucleic acid” and “polynucleotide” include polymeric forms of nucleotides of any length, including ribonucleotides, deoxyribonucleotides, or analogues or modified versions thereof. These include single-stranded, double-stranded, and multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, and polymers containing purine bases, pyrimidine bases, or other natural, chemically modified, biochemically modified, unnatural, or derivatized nucleotide bases.

[0027] The terms “expression vector,” “expression construct,” or “expression cassette” refer to recombinant nucleic acids containing a desired coding sequence operably ligated to appropriate nucleic acid sequences required for the expression of the operably ligated coding sequence in a particular host cell or organism. Nucleic acid sequences required for expression in prokaryotes typically include promoters, operators (optional), ribosome binding sites, and other sequences. Eukaryotic cells are generally known to utilize promoters, enhancers (transcriptional enhancers), termination, and polyadenylation signals, and some elements may be deleted and others added without sacrificing necessary expression.

[0028] The term "viral vector" refers to recombinant nucleic acids that contain at least one element of viral origin and that are sufficient or permissible for packaging into a viral vector particle. Vectors and / or particles can be used to transfer DNA, RNA, or other nucleic acids into cells, either ex vivo or in vivo. Many forms of viral vectors are known.

[0029] With respect to proteins, nucleic acids, and cells, the term “isolated” typically includes proteins, nucleic acids, and cells that are relatively purified with respect to other cells or biological components that may be present in situ, and includes substantially pure preparations of proteins, nucleic acids, or cells. The term “isolated” may also include proteins and nucleic acids that have no naturally occurring counterparts, or proteins or nucleic acids that are chemically synthesized and therefore not substantially contaminated by other proteins or nucleic acids. The term “isolated” may also include proteins, nucleic acids, or cells that have been separated or purified from most other cellular components or biological components that naturally accompany them (e.g., other cellular proteins, nucleic acids, or cellular or extracellular components).

[0030] The term "wild-type" includes entities that possess the structure and / or activity found in a normal state or context (as opposed to variants such as diseased or altered genes). Wild-type genes and polypeptides often exist in multiple different forms (e.g., alleles).

[0031] The term "endogenous sequence" refers to a nucleic acid sequence that is naturally present within a cell or animal. For example, an animal's endogenous Rosa26 sequence refers to a naturally occurring Rosa26 sequence at the Rosa26 locus of the animal.

[0032] Exogenous molecules or sequences include those that are not normally present in a cell in their original form, or those that are introduced into a cell from an external source. Normal presence includes presence related to specific developmental stages and environmental conditions of the cell. Exogenous molecules or sequences may include, for example, mutated versions of corresponding endogenous sequences within a cell, such as humanized versions of endogenous sequences, or sequences that are intracellular but in a different form (i.e., not within a chromosome) corresponding to endogenous sequences. In contrast, endogenous molecules or sequences include those that are normally present in a particular cell, at a particular developmental stage, and under specific environmental conditions.

[0033] When used in the context of nucleic acids or proteins, the term “heterogeneous” indicates that the nucleic acid or protein contains at least two segments that do not naturally exist together within the same molecule. For example, when used in relation to a nucleic acid segment or a protein segment, the term “heterogeneous” indicates that the nucleic acid or protein contains two or more subsequences that are not found in nature in the same relationship (e.g., bound together). As an example, a “heterogeneous” region of a nucleic acid vector is a segment of nucleic acid that is not found in nature in association with another molecule, and is located within or bound to another nucleic acid molecule. For example, a heterogeneous region of a nucleic acid vector may include a coding sequence adjacent to a heterogeneous promoter that is not found in association with a naturally occurring coding sequence. Similarly, a “heterogeneous” region of a protein is a segment of amino acids that is located within or bound to another peptide molecule that is not found in association with another peptide molecule in nature (e.g., a fusion protein or tagged protein). Similarly, nucleic acids or proteins may contain heterogeneous labeling, heterogeneous secretion, or heterogeneous localization sequences.

[0034] "Codon optimization" is a process that utilizes codon degeneracy, as indicated by the diversity of three-base-pair codon combinations that specify amino acids, to modify nucleic acid sequences for enhanced expression in a particular host cell, generally by replacing at least one codon in the natural sequence with a codon that is more or most frequently used in the host cell's gene, while maintaining the natural amino acid sequence. For example, a nucleic acid encoding a protein can be modified to replace a codon that is more frequently used in a given prokaryotic or eukaryotic cell, including bacterial cells, yeast cells, human cells, non-human cells, mammalian cells, rodent cells, mouse cells, rat cells, hamster cells, or any other host cell, compared to a naturally occurring nucleic acid sequence. Codon usage tables are readily available, for example, in "codon usage databases." These tables can be applied in various ways. See Nakamura et al. (2000) Nucleic Acids Research 28:292, which is incorporated herein by reference in its entirety for all purposes. Computer algorithms for codon optimization of specific sequences for expression in a particular host are also available (see, for example, Gene Forge).

[0035] The term “locus” refers to a specific location on a chromosome in the genome of an organism, such as a gene (or significant sequence), DNA sequence, polypeptide coding sequence, or position. For example, “Rosa26 locus” may refer to a specific location of the Rosa26 gene, the Rosa26 DNA sequence, or the Rosa26 location on a chromosome in the genome of an organism identified as containing such a sequence. “Rosa26 locus” may include regulatory elements of the Rosa26 gene, such as enhancers, promoters, 5' and / or 3' untranslated regions (UTRs), or combinations thereof.

[0036] The term “gene” refers to a DNA sequence in a chromosome that, in its natural state, may contain at least one coding region and at least one non-coding region. Just as a gene corresponds to a full-length RNA (including the 5' and 3' untranslated sequences), the DNA sequence in a chromosome that codes for a product (e.g., non-limitingly, an RNA product and / or a polypeptide product) may include a coding region interrupted by non-coding introns, as well as sequences located adjacent to both the 5' and 3' coding regions. Furthermore, other non-coding sequences, including regulatory sequences (e.g., non-limitingly, promoters, enhancers, and transcription factor binding sites), polyadenylation signals, intra-sequence ribosome entry sites, silencers, insulating sequences, and matrix-binding regions may also be present in the gene. These sequences may be located in close proximity (e.g., non-limitingly, within 10 kb) or at a distance from the gene’s coding region, and they may affect the level or rate of gene transcription and translation.

[0037] A “promoter” is a regulatory region of DNA that typically contains a TATA box that can instruct RNA polymerase II to initiate RNA synthesis at an appropriate transcription start site for a particular polynucleotide sequence. Promoters may additionally include other regions that affect the transcription initiation rate. The promoter sequences disclosed herein regulate the transcription of operablely linked polynucleotides. Promoters may be active in one or more cell types disclosed herein (e.g., eukaryotic cells, non-human mammalian cells, human cells, rodent cells, pluripotent cells, one-cell stage embryos, differentiated cells, or combinations thereof). Promoters may be, for example, constitutively active promoters, conditional promoters, inductive promoters, temporally restricted promoters (e.g., developmentally regulated promoters), or spatially restricted promoters (e.g., cell-specific or tissue-specific promoters). Examples of promoters can be found, for example, in International Publication WO2013 / 176772, which is incorporated herein by reference in its entirety for all purposes.

[0038] Constitutive promoters are those that are active in all tissues or in specific tissues at all developmental stages. Examples of constitutive promoters include human cytomegalovirus immediate early (hCMV), mouse cytomegalovirus immediate early (mCMV), human elongation factor 1 alpha (hEF1α), mouse elongation factor 1 alpha (mEF1α), mouse phosphoglycerate kinase (PGK), chicken beta actin hybrid (CAG or CBh), SV40 early, and beta-2 tubulin promoters.

[0039] Examples of inductive promoters include chemically regulated promoters and physically regulated promoters. Chemically regulated promoters include, for example, alcohol-regulated promoters (e.g., alcohol dehydrogenase (alcA) gene promoters), tetracycline-regulated promoters (e.g., tetracycline-responsive promoters, tetracycline operator sequences (tetO), tet-On promoters, or tet-Off promoters), steroid-regulated promoters (e.g., rat glucocorticoid receptor, estrogen receptor promoters, or ecdysone receptor promoters), or metal-regulated promoters (e.g., metalloprotein promoters). Physically regulated promoters include, for example, temperature-regulated promoters (e.g., heat shock promoters) and light-regulated promoters (e.g., photo-inducible promoters or photo-inhibiting promoters).

[0040] Tissue-specific promoters can be, for example, neuron-specific promoters, glial-specific promoters, or muscle-specific promoters.

[0041] Examples of developmentally regulated promoters include those that are active only during the embryonic stage of development or only in adult cells.

[0042] "Operatable linkage" or "to be operable-linked" means the parallel arrangement of two or more components (e.g., a promoter and another sequence element) such that both components function normally and that at least one of the components may mediate a function affecting at least one of the other components. For example, if a promoter controls the level of transcription of a coding sequence in the presence or absence of one or more transcription regulators, the promoter can be operable-linked to a coding sequence. An operable linkage may include such sequences being in close proximity to each other or acting in trans (e.g., a regulatory element may act apart to control the transcription of a coding sequence).

[0043] The methods and compositions provided herein utilize a variety of different components. Some of the components described may have active variants and fragments. The term "functional" refers to the inherent ability of a protein or nucleic acid (or its fragments or variants) to exhibit biological activity or function. The biological function of a functional fragment or variant is the same as, or may actually be modified compared to, the original molecule (e.g., with respect to their specificity, selectivity, or efficacy), but retains the basic biological function of the molecule.

[0044] The term "mutant" refers to a nucleotide sequence that differs (for example, by just one nucleotide) from the most common sequence in a population, or a protein sequence that differs (for example, by just one amino acid) from the most common sequence in a population.

[0045] The term "fragment," when referring to proteins, means a protein that is shorter or has fewer amino acids than a full-length protein. The term "fragment," when referring to nucleic acids, means a nucleic acid that is shorter or has fewer nucleotides than a full-length nucleic acid. A fragment may, for example, when referring to a protein fragment, be an N-terminal fragment (i.e., removal of part of the C-terminus of a protein), a C-terminal fragment (i.e., removal of part of the N-terminus of a protein), or an internal fragment (i.e., removal of part of both the N-terminus and C-terminus of a protein). A fragment may, for example, when referring to a nucleic acid fragment, be a 5' fragment (i.e., removal of part of the 3' end of a nucleic acid), a 3' fragment (i.e., removal of part of the 5' end of a nucleic acid), or an internal fragment (i.e., removal of part of both the 5' end and 3' end of a nucleic acid).

[0046] In the context of two polynucleotide or polypeptide sequences, "sequence identity" or "identity" refers to the residues in two sequences that are identical when aligned for maximum match within a particular comparison window. When using a percentage of sequence identity for proteins, non-identical residue positions are often differed by conserved amino acid substitutions, in which an amino acid residue is replaced by another amino acid residue with similar chemical properties (e.g., charge or hydrophobicity) and therefore does not alter the functional properties of the molecule. If sequences differ by a conserved substitution, the sequence identity percentage can be adjusted upward to compensate for the conservative nature of the substitution. Sequences differing by such a conservative substitution are said to have "sequence similarity" or "similarity." Means for making this adjustment are well known. Typically, this involves scoring the conservative substitution as a partial mismatch rather than a complete mismatch, thereby increasing the sequence identity percentage. Thus, for example, if identical amino acids are given a score of 1 and non-conservative substitutions are given a score of 0, a conservative substitution might be given a score between 0 and 1. The scoring of conservative substitutions is calculated, for example, by the program PC / GENE((Intelligenetics, Mountain View, California).

[0047] The "percentage of sequence identity" includes a value determined by comparing two optimally aligned sequences (the maximum number of perfectly matching residues) across a comparison window, where the portion of the polynucleotide sequence in the comparison window may contain additions or deletions (i.e., gaps) when compared to a reference sequence (without additions or deletions) for the optimal alignment of the two sequences. The percentage is calculated by determining the number of positions where identical nucleic acid bases or amino acid residues occur in both sequences to obtain the number of matching positions, dividing the number of matching positions by the total number of positions in the comparison window, and multiplying the result by 100 to obtain the percentage of sequence identity. Unless otherwise specified (e.g., if the shorter sequence contains a concatenated non-homologous sequence), the comparison window is the total length of the shorter of the two sequences being compared.

[0048] Unless otherwise specified, sequence identity / similarity values ​​include values ​​obtained using GAP version 10 with the following parameters: 50 GAP weights and 3 length weights, and % identity and % similarity of nucleotide sequences using the nwsgapdna.cmp scoring matrix; 8 GAP weights and 2 length weights, and % identity and % similarity of amino acid sequences using the BLOSUM62 scoring matrix; or any equivalent program. "Equivalent program" includes any sequence comparison program that, for any two sequences in question, produces alignments having identical nucleotide or amino acid residue matches and identical sequence identity percentages when compared to the corresponding alignments produced by GAP version 10.

[0049] The term "conservative amino acid substitution" refers to the substitution of an amino acid that is normally present in a sequence with a different amino acid of similar size, charge, or polarity. Examples of conservative substitutions include the substitution of a nonpolar (hydrophobic) residue, such as isoleucine, valine, or leucine, with another nonpolar residue. Similarly, examples of conservative substitutions include the substitution of one polar (hydrophilic) residue with another, such as between arginine and lysine, glutamine and asparagine, or glycine and serine. Additional examples of conservative substitutions include the substitution of a basic residue, such as lysine, arginine, or histidine, with another, or the substitution of an acidic residue, such as aspartic acid or glutamic acid, with another acidic residue. Examples of non-conservative substitutions include substitutions of nonpolar (hydrophobic) amino acid residues, such as isoleucine, valine, leucine, alanine, or methionine, with polar (hydrophilic) residues, such as cysteine, glutamine, glutamic acid, or lysine, and / or substitutions of polar residues with nonpolar residues. A typical classification of amino acids is summarized below.

[0050] [Table 1]

[0051] "Homologous" sequences (e.g., nucleic acid sequences) include sequences that are identical or substantially similar to a known reference sequence, such as those that are at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a known reference sequence. Homologous sequences may include, for example, orthologous and paralogous sequences. For example, homologous genes typically derive from a common ancestral DNA sequence through either a speciation event (orthologous gene) or a gene duplication event (paralogous gene). "Orthologous" genes include genes in various species that evolved from a common ancestral gene through speciation. Orthologs typically retain the same function over time. "Paralogous" genes include genes that are related by duplication within the genome. Paralogs may evolve new functions over time.

[0052] The term "in vitro" includes artificial environments and processes or reactions occurring within artificial environments (e.g., test tubes or isolated cells or cell lines). The term "in vivo" includes natural environments (e.g., cells, organisms or bodies) and processes or reactions occurring within natural environments. The term "ex vivo" includes cells removed from the body of an individual and processes or reactions occurring within such cells.

[0053] A composition or method that “comprising” or “including” one or more of the enumerated elements may include other elements not specifically enumerated. For example, a composition that “comprises” or “includes” protein may contain protein alone or in combination with other components. The transitional phrase “essentially from” means that the scope of the claims is to be interpreted as encompassing the specific elements enumerated in the claims and elements that do not substantially affect the basic and novel characteristics of the claimed invention. Therefore, the term “essentially from” as used in the claims of the present invention is not intended to be interpreted as equivalent to “including.”

[0054] "Optional" or "optional" means that the event or situation described after it may or may not occur, and that the description includes examples of when the event or situation may occur and examples of when it may not occur.

[0055] Specifying a range of values ​​includes all integers within or defining that range, and all subranges defined by integers within that range. For example, 5-10 nucleotides is understood as 5, 6, 7, 8, 9, or 10 nucleotides, while 5-10% is understood to include all possible values ​​up to 5% and 10%.

[0056] At least 17 nucleotides out of a 20-nucleotide sequence are understood to include 17, 18, 19, or 20 nucleotides in the given sequence, thereby providing an upper limit even if one is not specifically provided, as is clearly understood. Similarly, up to 3 nucleotides are understood to include 0, 1, 2, or 3 nucleotides, providing a lower limit even if one is not specifically provided. Where “at least,” “up to,” or other similar language modify numbers, it can be understood that they modify each number in the sequence.

[0057] As used herein, “less than” or “less than” is understood to mean a value adjacent to the phrase and, logically from the context, a logically lower value or integer down to zero. For example, the double-stranded region of “2 or fewer nucleotide base pairs” has 2, 1, or 0 nucleotide base pairs. When “less than” or “less than” precedes a series of numbers or ranges, it is understood that each number in that series or range is modified.

[0058] When used herein, if a maximum value is expressed as 100% (e.g., 100% inhibition), it is understood that the value is limited by the detection method. For example, 100% inhibition is understood as inhibition to a level below the detection level of the assay.

[0059] Unless otherwise evident from the context, the term “approximately” encompasses values ​​that are ±5% of the stated value. In certain embodiments, the term “approximately” is understood to encompass acceptable variation or error in the art, e.g., two standard deviations from the mean, or the sensitivity of the method used to make the measurement, or a percentage of a value that is acceptable in the art, e.g., with respect to age. When “approximately” precedes the first value in a series, it can be understood to modify each value in the series.

[0060] The terms "and / or" encompass any and all possible combinations of one or more of the related enumerated items, as well as the absence of any combination when interpreted as an alternative ("or").

[0061] The term "or" refers to any one member of a given list, including any combination of members of that list.

[0062] The singular articles "a," "an," and "the" include plural references unless the context explicitly specifies otherwise. For example, the terms "protein" or "at least one protein" may include multiple proteins, including mixtures thereof.

[0063] Statistically significant means p ≤ 0.05.

[0064] In the event of any discrepancy between the sequence in this application and the indicated accession number or position within the accession number, the sequence in this application shall prevail.

[0065] I. Overview This specification provides combinations comprising a CRISPR / Cas system, a CtBP-interacting protein (CtIP), and a 53BP1 inhibitor for use in enhancing homologous recombination repair of CRISPR / Cas-mediated cleavage of target DNA by exogenous donor nucleic acids. Methods for using such combinations to create targeted gene modifications within cells by homologous recombination repair of CRISPR / Cas-mediated cleavage at target genomic loci within cells are also provided.

[0066] The compositions and methods disclosed herein improve the efficiency of precise CRISPR editing (precise gene knock-in) by stimulating DNA end excision in CRISPR-targeted mammalian cells, thereby improving homologous recombination repair (HDR) efficiency. These compositions and methods can be applied to non-periodic cells (cells that are less susceptible to HDR).

[0067] The inventors observed that combining 53BP1 inhibition with CtIP localization resulted in an additive or combinatorial enhancement of HDR efficiency. This result was unexpected, as their effects were expected to overlap. Furthermore, in contrast to the expected results of 53BP1 inhibition and CtIP-mediated excision, which would result in mutagenic single-strand annealing repair, the inventors observed an error-free increase in HDR. The inventors' approach allows for a 1:4 stoichiometry for sgRNA2.0:MS2-CtIP, while providing multiple copies of i53 as a total but transient blockade of 53BP1, ensuring their availability and activity are synchronized with CRISPR activity. In some embodiments, the inventors use LNP-mediated mRNA delivery to minimize the long-term effects of these factors on overall genomic integrity by ensuring transient expression of the inventors' HDR booster.

[0068] II. Methods, compositions, and combinations for promoting homologous recombination repair This specification provides compositions or combinations for use in promoting homologous recombination repair. Such compositions or combinations include (a) a clustered equispaced short-chain palindromic repeat (CRISPR)-associated (Cas) protein or a nucleic acid encoding a Cas protein; (b) a guide RNA or one or more DNAs encoding a guide RNA, wherein the guide RNA forms a complex with the Cas protein and is guideable to a guide RNA target sequence at a target genomic locus; (c) a nucleic acid encoding a CtBP-interacting protein (CtIP) or a CtIP protein; (d) a nucleic acid encoding a 53BP1 inhibitor (i53) protein or an i53 protein; and (e) an exogenous donor nucleic acid comprising a 5' homology arm that hybridizes to a 5' target sequence at a target genomic locus and a 3' homology arm that hybridizes to a 3' target sequence at a target genomic locus. Optionally, the 5' and 3' homology arms are adjacent to the insertion nucleic acid. For example, such a composition or combination may include: (a) a Cas protein or nucleic acid encoding a Cas protein; (b) a guide RNA or one or more DNAs encoding a guide RNA, wherein the guide RNA comprises one or more adapter-binding elements to which an adapter protein can specifically bind, and the guide RNA forms a complex with the Cas protein and is guided to a guide RNA target sequence at a target genomic locus; (c) a fusion protein or nucleic acid encoding a fusion protein, wherein the fusion protein comprises a CtIP protein fused to the adapter protein; (d) an i53 protein or nucleic acid encoding an i53 protein; and (e) an exogenous donor nucleic acid comprising a 5' homology arm that hybridizes to a 5' target sequence at a target genomic locus and a 3' homology arm that hybridizes to a 3' target sequence at a target genomic locus. Optionally, the 5' homology arm and the 3' homology arm are adjacent to the insertion nucleic acid.As used herein, the term "in combination with" means that some components can be administered before, concurrently with, or after the administration of other components. Combinations of different components may be formulated, for example, in a single composition for simultaneous delivery, or separately in two or more compositions (e.g., a kit containing each component, e.g., further drugs in separate formulations). Suitable CRISPR / Cas systems, including Cas proteins and guide RNA, are described in more detail elsewhere herein. Similarly, suitable CtIP proteins, adapter proteins, fusion proteins, i53 proteins, and exogenous donor nucleic acids are described in more detail elsewhere herein.

[0069] Similarly, a method for producing targeted gene modifications by homologous recombination repair of double-strand breaks at target genomic loci within cells is provided herein. Such a method may involve administering to cells (a) a Cas protein or nucleic acid encoding a Cas protein, (b) a guide RNA or one or more DNAs encoding a guide RNA, wherein the guide RNA forms a complex with the Cas protein and is guideable to the guide RNA target sequence at the target genomic locus, (c) a CtIP protein or nucleic acid encoding a CtIP protein, (d) an i53 protein or nucleic acid encoding an i53 protein, and (e) an exogenous donor nucleic acid comprising a 5' homology arm that hybridizes to the 5' target sequence of the target genomic locus and a 3' homology arm that hybridizes to the 3' target sequence of the target genomic locus, wherein the Cas protein and guide RNA form a complex, the Cas protein cleaves the guide RNA target sequence to produce a double-strand break, and the exogenous donor nucleic acid recombinates with the target genomic locus via homologous recombination repair to produce a targeted gene modification. Optionally, the 5' homology arm and the 3' homology arm are adjacent to the insertion nucleic acid.For example, such a method involves a cell comprising (a) a Cas protein or nucleic acid encoding a Cas protein, (b) a guide RNA or one or more DNAs encoding a guide RNA, wherein the guide RNA comprises one or more adapter binding elements to which an adapter protein can specifically bind, and the guide RNA forms a complex with the Cas protein and is guided to a guide RNA target sequence at a target genomic locus, and (c) a fusion protein or nucleic acid encoding a fusion protein, wherein the fusion protein is fused to the adapter protein. The procedure may include administering (d) a fusion protein or nucleic acid encoding a fusion protein, comprising a CtIP protein, (e) an i53 protein or nucleic acid encoding an i53 protein, and (f) an exogenous donor nucleic acid comprising a 5' homology arm that hybridizes to a 5' target sequence of the target genomic locus and a 3' homology arm that hybridizes to a 3' target sequence of the target genomic locus, wherein the Cas protein and guide RNA form a complex, the Cas protein cleaves the guide RNA target sequence to produce a double-strand break, and the exogenous donor nucleic acid recombinates with the target genomic locus via homologous recombination repair to produce a targeted gene modification. Optionally, the 5' and 3' homology arms are flanked by the insertion nucleic acid. Suitable CRISPR / Cas systems comprising the Cas protein and guide RNA are described in more detail elsewhere herein. Similarly, suitable CtIP proteins, adapter proteins, fusion proteins, i53 proteins, and exogenous donor nucleic acids are described in more detail elsewhere herein.

[0070] The Cas protein in a composition, combination, or method may be any suitable Cas protein, and may be in any form such as a protein, RNA encoding a Cas protein, or DNA encoding a Cas protein (for example, in a vector such as a recombinant adeno-associated virus (AAV) vector, which is described in more detail elsewhere in this specification). Similarly, the Cas protein or nucleic acid encoding a Cas protein may be in any form for delivery, such as lipid nanoparticles, as described in more detail elsewhere in this specification. The Cas protein may be any Cas protein described herein, such as the Cas9 protein. In specific examples, the Cas9 protein may be the Streptococcus pyogenes Cas9 protein, the Campylobacter jejuni Cas9 protein, or the Staphylococcus aureus Cas9 protein (for example, the Streptococcus pyogenes Cas9 protein). The Cas protein and the CRISPR / Cas system are described in more detail elsewhere in this specification.

[0071] The guide RNA in a composition, combination, or method may be any suitable guide RNA and may be in any form, such as RNA or one or more DNAs encoding the guide RNA (for example, in a vector such as a recombinant adeno-associated virus (AAV) vector, as described in more detail elsewhere herein). Similarly, the guide RNA or the DNA encoding the guide RNA may be in any form for delivery, such as lipid nanoparticles, as described in more detail elsewhere herein. In one example, the guide RNA includes two adapter-binding elements to which an adapter protein can specifically bind. For example, the guide RNA may include a first adapter-binding element in a first loop of the guide RNA and a second adapter-binding element in a second loop of the guide RNA. For example, the guide RNA may be a single guide RNA containing a CRISPR RNA (crRNA) moiety fused to a transactivated CRISPR RNA (tracrRNA) moiety, where the first loop is a tetraloop corresponding to residues 13-16 of SEQ ID NOs. 11, 13, 15, or 16, and the second loop is a stemloop 2 corresponding to residues 53-56 of SEQ ID NOs. 11, 13, 15, or 16. In certain examples, the adapter binding element includes the sequence described in SEQ ID NOs. 19 or 20. For example, the guide RNA may include the sequence described in any of SEQ ID NOs. 21-26. The guide RNA will be described in more detail elsewhere in this specification.

[0072] The fusion protein or CtIP protein in a composition, combination, or method may be in any form, such as a protein, a protein-coding RNA, or a protein-coding DNA (for example, in a vector such as a recombinant adeno-associated virus (AAV) vector, as described in more detail elsewhere herein). Similarly, the fusion protein or CtIP protein or protein-coding nucleic acid may be in any form for delivery, such as lipid nanoparticles, as described in more detail elsewhere herein. In certain examples, the adapter protein in the fusion protein includes the MS2 coat protein or a functional fragment or variant thereof. For example, the adapter protein may contain a sequence that is at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence described in SEQ ID NO: 32, or may be encoded by a sequence that is at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence described in SEQ ID NO: 33. In one example, the CtIP protein is a human CtIP protein. For example, the CtIP protein contains a sequence that is at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence described in SEQ ID NO: 34, or is encoded by a sequence that is at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence described in SEQ ID NO: 36. In a specific example, the fusion protein contains a sequence that is at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence described in SEQ ID NO: 30, or is encoded by a sequence that is at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence described in SEQ ID NO: 31. The CtIP protein, adapter protein, and fusion protein are described in more detail elsewhere in this specification.

[0073] The i53 protein in a composition, combination, or method may be in any form, such as a protein, a protein-coding RNA, or a protein-coding DNA (for example, in a vector such as a recombinant adeno-associated virus (AAV) vector, as described in more detail elsewhere herein). Similarly, the i53 protein or protein-coding nucleic acid may be in any form for delivery, such as lipid nanoparticles, as described in more detail elsewhere herein. In certain examples, the i53 protein contains a sequence that is at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence described in SEQ ID NO: 40 or 42, or is encoded by a sequence that is at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence described in SEQ ID NO: 41 or 43. The i53 protein is described in more detail elsewhere herein.

[0074] The exogenous donor nucleic acid in a composition, combination, or method may be any suitable exogenous donor nucleic acid. For example, the exogenous donor nucleic acid may include an inserted nucleic acid. The exogenous donor nucleic acid may be in a vector such as a recombinant AAV vector. The exogenous donor nucleic acid may be a nucleic acid of any size. In some cases, it may be a large targeted vector (LTVEC). For example, it may be at least 10kb in size, or about 50kb to about 300kb in size, or the sum of the 5' and 3' homology arms may be at least 10kb, or about 10kb to about 200kb.

[0075] When lipid nanoparticles are used, for example, the Cas protein or nucleic acid encoding the Cas protein, a fusion protein or CtIP protein or nucleic acid encoding the fusion protein or CtIP protein, and the i53 protein or nucleic acid encoding the i53 protein may be present in the same lipid nanoparticle. Alternatively, the Cas protein or nucleic acid encoding the Cas protein, a fusion protein or CtIP protein or nucleic acid encoding the fusion protein or CtIP protein, the i53 protein or nucleic acid encoding the i53 protein, and guide RNA or DNA encoding the guide RNA may be present in the same lipid nanoparticle. When a vector is used, for example, the DNA encoding the guide RNA and the exogenous donor nucleic acid may be present in the vector. Alternatively, only the exogenous donor nucleic acid may be present in the vector.

[0076] In one specific example, the composition or combination comprises RNA encoding a fusion protein or CtIP protein and RNA encoding an i53 protein. In another specific example, the composition or combination comprises RNA encoding a fusion protein or CtIP protein and RNA encoding an i53 protein, with the RNA encoding the fusion protein and the RNA encoding the i53 protein located in lipid nanoparticles. In yet another specific example, the composition or combination comprises RNA encoding a fusion protein or CtIP protein and RNA encoding an i53 protein, with the RNA encoding the fusion protein and the RNA encoding the i53 protein located in lipid nanoparticles, and the exogenous donor nucleic acid located in a vector (e.g., a recombinant AAV vector).

[0077] In one particular example, the composition or combination comprises RNA encoding a Cas protein, RNA encoding a fusion protein or CtIP protein, RNA encoding an i53 protein, and one or more DNAs encoding a guide RNA, wherein the RNA encoding the Cas protein, the RNA encoding the fusion protein, and the RNA encoding the i53 protein are contained in lipid nanoparticles, and the one or more DNAs encoding the guide RNA and the exogenous donor nucleic acids are contained in a vector (e.g., a recombinant AAV vector).

[0078] In another specific example, the composition or combination comprises RNA encoding a Cas protein, RNA encoding a fusion protein or CtIP protein, RNA encoding an i53 protein, and a guide RNA in RNA form, where the RNA encoding the Cas protein, RNA encoding the fusion protein, RNA encoding the i53 protein, and the guide RNA are contained in lipid nanoparticles, and the exogenous donor nucleic acid is contained in a vector (e.g., a recombinant AAV vector).

[0079] In one specific example, the guide RNA comprises two adapter-binding elements to which the adapter protein can specifically bind, the first adapter-binding element being in a first loop of the guide RNA and the second adapter-binding element being in a second loop of the guide RNA; the adapter protein comprises the MS2 coat protein or a functional fragment or variant thereof; and the composition or combination comprises RNA encoding the fusion protein or CtIP protein and RNA encoding the i53 protein. In another specific example, the guide RNA comprises two adapter-binding elements to which the adapter protein can specifically bind, the first adapter-binding element being in a first loop of the guide RNA and the second adapter-binding element being in a second loop of the guide RNA; the adapter protein comprises the MS2 coat protein or a functional fragment or variant thereof; and the composition or combination comprises RNA encoding the fusion protein or CtIP protein and RNA encoding the i53 protein, with the RNA encoding the fusion protein and the RNA encoding the i53 protein being in lipid nanoparticles. In another specific example, the guide RNA comprises two adapter-binding elements to which the adapter protein can specifically bind, the first adapter-binding element being in the first loop of the guide RNA and the second adapter-binding element being in the second loop of the guide RNA, the adapter protein comprising the MS2 coat protein or a functional fragment or variant thereof, the composition or combination comprising RNA encoding the fusion protein or CtIP protein and RNA encoding the i53 protein, the RNA encoding the fusion protein and the RNA encoding the i53 protein being in lipid nanoparticles, and the exogenous donor nucleic acid being in a vector (e.g., a recombinant AAV vector).

[0080] In one specific example, the guide RNA comprises two adapter-binding elements to which an adapter protein can specifically bind, the first adapter-binding element being in a first loop of the guide RNA and the second adapter-binding element being in a second loop of the guide RNA, the adapter protein comprising the MS2 coat protein or a functional fragment or variant thereof, the composition or combination comprising RNA encoding the Cas protein, the composition or combination comprising RNA encoding the fusion protein or CtIP protein, the composition or combination comprising RNA encoding the i53 protein, the RNA encoding the Cas protein, the RNA encoding the fusion protein, and the RNA encoding the i53 protein being in lipid nanoparticles, the composition or combination comprising one or more DNAs encoding the guide RNA, and the one or more DNAs encoding the guide RNA and the exogenous donor nucleic acid being in a vector (e.g., a recombinant AAV vector).

[0081] In another specific example, the guide RNA comprises two adapter-binding elements to which the adapter protein can specifically bind, the first adapter-binding element being in the first loop of the guide RNA and the second adapter-binding element being in the second loop of the guide RNA, the adapter protein comprising the MS2 coat protein or a functional fragment or variant thereof, the composition or combination comprising RNA encoding the Cas protein, the composition or combination comprising RNA encoding the fusion protein or CtIP protein, the composition or combination comprising RNA encoding the i53 protein, the composition or combination comprising guide RNA in RNA form, the RNA encoding the Cas protein, the RNA encoding the fusion protein, the RNA encoding the i53 protein, and the guide RNA are contained in lipid nanoparticles, and the exogenous donor nucleic acid is contained in a vector (e.g., a recombinant AAV vector).

[0082] The cells used in this method can be any suitable cells. Examples of various cells are disclosed in more detail elsewhere in this specification. For example, the cells may be mammalian cells, rodent cells, mouse cells, rat cells, or human cells. In some methods, the cells are non-periodic cells (i.e., non-dividing). In some methods, the cells are periodic cells (i.e., dividing cells).

[0083] Nucleic acids or proteins used in the methods disclosed herein can be introduced into cells by any suitable means. Various methods and compositions are provided herein to enable the introduction of molecules (e.g., nucleic acids or proteins) into cells or targets. Methods for introducing molecules into various cell types are known and include, for example, stable transfection methods, transient transfection methods, and virus-mediated methods.

[0084] Transfection protocols and protocols for introducing molecules into cells can vary. Non-limiting transfection methods include chemical-based transfection methods using liposomes, nanoparticles, calcium phosphate (Graham et al. (1973) Virology 52(2):456-67, Bacchetti et al. (1977) Proc. Natl. Acad. Sci. USA 74(4):1590-4, and Kriegler, M (1991). Transfer and Expression: A Laboratory Manual. New York: WH Freeman and Company. pp.96-97), dendrimers, or cationic polymers such as DEAE-dextran or polyethyleneimine. Non-chemical methods include electroporation, sonoporation, and phototransfection. Particle-based transfections include the use of gene guns or magnet-assisted transfection (Bertram (2006) Current Pharmaceutical Biotechnology 7,277-28). Viral methods can also be used for transfection.

[0085] The introduction of nucleic acids or proteins into cells can also be mediated by electroporation, intracytoplasmic injection, viral infection, adenovirus, adeno-associated virus, lentivirus, retrovirus, transfection, lipid-mediated transfection, or nucleofection. Nucleofection is an improved electroporation technique that allows for the delivery of nucleic acid substrates to the nucleus not only through the cytoplasm but also across the nuclear membrane. In addition, the use of nucleofection in the methods disclosed herein typically requires far fewer cells than conventional electroporation (e.g., only about 2 million compared to 7 million for conventional electroporation). In one example, nucleofection is carried out using the LONZA® NUCLEOFECTOR® system.

[0086] The introduction of molecules (e.g., nucleic acids or proteins) into cells (e.g., zygotes) can also be achieved by microinjection. In zygotes (i.e., one-cell stage embryos), microinjection can be performed into the maternal and / or paternal pronuclei or cytoplasm. If microinjection is performed into only one pronucleus, the paternal pronucleus is preferable due to its larger size. Microinjection of mRNA is preferably into the cytoplasm (e.g., to deliver mRNA directly to the translation mechanism), while microinjection of Cas proteins or polynucleotides encoding Cas proteins or RNA is preferably into the nucleus / pronucleus. Alternatively, microinjection can be performed by injection into both the nucleus / pronucleus and cytoplasm, where the needle is first introduced into the nucleus / pronucleus and the first volume is injected, and a second volume is injected into the cytoplasm while the needle is removed from the one-cell stage embryo. When Cas proteins are injected into the cytoplasm, it is preferable that the Cas proteins include a nuclear localization signal to ensure delivery to the nucleus / pronucleus. Methods for performing microinjection are well known. For example, see Nagy et al. (Nagy A, Gertsenstein M, Vintersten K, Behringer R., 2003, Manipulating the Mouse Embryo. Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press), as well as Meyer et al. (2010) Proc. Natl. Acad. Sci. USA 107:15022-15026, and Meyer et al. (2012) Proc. Natl. Acad. Sci. USA 109:9354-9359, each of which is incorporated herein by reference in whole for all purposes.

[0087] Other methods for introducing molecules (e.g., nucleic acids or proteins) into cells or targets may include, for example, vector delivery, particle-mediated delivery, exosome-mediated delivery, lipid nanoparticle-mediated delivery, cell-permeable peptide-mediated delivery, or implantable device-mediated delivery. Specifically, nucleic acids or proteins may be introduced into cells or targets in carriers such as poly(lactic acid) (PLA) microspheres, poly(D,L-lactic acid-coglycolic acid) (PLGA) microspheres, liposomes, micelles, reverse micelles, lipid cochlates, or lipid microtubules. Some specific examples of delivery to targets include hydrodynamic delivery, viral delivery (e.g., adeno-associated virus (AAV)-mediated delivery), and lipid nanoparticle-mediated delivery.

[0088] The introduction of nucleic acids and proteins into cells or targets can be achieved by hydrodynamic delivery (HDD). In gene delivery to parenchymal cells, only essential DNA sequences need to be injected from selected blood vessels, eliminating the safety concerns associated with current viral and synthetic vectors. Once injected into the bloodstream, the DNA can reach cells in various tissues that have access to the blood. Hydrodynamic delivery utilizes the force generated by the rapid injection of a large volume of solution into circulating, incompressible blood to overcome the physical barriers of the endothelium and cell membranes that prevent large, membrane-impermeable compounds from entering parenchymal cells. In addition to DNA delivery, this method is useful for efficiently delivering RNA, proteins, and other small compounds into cells in vivo. See, for example, Bonamassa et al. (2011) Pharm. Res. 28(4):694-701, which is incorporated herein by reference in its entirety for all purposes.

[0089] Nucleic acid delivery can also be achieved by viral delivery, such as AAV-mediated delivery or lentiviral-mediated delivery. Other exemplary viral vectors include retroviruses, adenoviruses, vaccinia viruses, poxviruses, and herpes simplex viruses. Viruses can infect dividing cells, non-dividing cells, or both. Viruses can be integrated into the host genome, or alternatively, not integrated into the host genome. Such viruses can also be engineered to reduce immunodeficiency. Viruses can be replicable or replication-deficient (e.g., missing one or more genes required for an additional round of virion replication and / or packaging). Viruses can induce transient or longer-lasting expression. Viral vectors can be genetically modified from their wild-type counterparts. For example, viral vectors may include one or more nucleotide insertions, deletions, or substitutions to facilitate cloning or to alter one or more properties of the vector. Such properties may include packaging capacity, transduction efficiency, immunogenicity, genomic integration, replication, transcription, and translation. In some cases, a portion of the viral genome may be deleted so that the virus can package exogenous sequences of a larger size. In some cases, viral vectors may have enhanced transduction efficiency. In some cases, the immune response induced by the virus in the host may be reduced. In some cases, viral genes (such as integrases) that facilitate the integration of viral sequences into the host genome may be mutated so that the virus becomes non-integrated. In some cases, viral vectors may have replication defects. In some cases, viral vectors may contain exogenous transcriptional or translational regulatory sequences to drive the expression of coding sequences on the vector. In some cases, viruses may be helper-dependent. For example, a virus may require one or more helper components to supply the viral components (such as viral proteins) needed to amplify the vector and package it into viral particles.In such cases, one or more helper components, including one or more vectors encoding viral components, may be introduced into a host cell or population of host cells together with the vector system described herein. In other examples, the virus may be helper-free. For example, the virus can amplify and package the vector without a helper virus. In some examples, the vector system described herein may also encode viral components required for viral amplification and packaging.

[0090] An example of a viral titer (e.g., AAV titer) is approximately 10 12 ~about 10 16 One example is vg / mL. Another exemplary viral titer (e.g., AAV titer) is approximately 10% of body weight. 12 ~about 10 16 The value given is vg / kg.

[0091] The introduction of nucleic acids and proteins can also be achieved by lipid nanoparticle (LNP) mediated delivery. For example, LNP mediated delivery can be used to deliver a combination of Cas mRNA and guide RNA, or a combination of Cas protein and guide RNA. LNP mediated delivery can be used to deliver guide RNA in RNA form. In specific examples, guide RNA and Cas protein are introduced in RNA form via LNP mediated delivery at the same LNP. One or more of the RNAs may be modified, as will be discussed in more detail elsewhere in this specification. Delivery by such a method may result in transient Cas expression and / or the presence of transient guide RNA, and biodegradable lipids improve clearance, improve tolerability, and reduce immunogenicity. Lipid formulations can protect biomolecules from degradation while simultaneously improving uptake into cells. Lipid nanoparticles are particles containing multiple lipid molecules that are physically associated with each other by intermolecular forces. These include microspheres (monolayer and multilayer vesicles, e.g., liposomes), dispersed phases in emulsions, micelles, or inner phases in suspensions. Such lipid nanoparticles can be used to encapsulate one or more nucleic acids or proteins for delivery. Formulations containing cationic lipids are useful for delivering polyanions such as nucleic acids. Other lipids that may be included are neutral lipids (i.e., uncharged or amphoteric lipids), anionic lipids, helper lipids that enhance transfection, and stealth lipids that increase the length of time the nanoparticles can exist in vivo. Examples of suitable cationic lipids, neutral lipids, anionic lipids, helper lipids, and stealth lipids can be found in International Publications WO2016 / 010840(A1) and WO2017 / 173054(A1), each incorporated herein by reference in its entirety for all purposes.

[0092] In certain LNPs, the cargo may include guide RNA or a nucleic acid encoding guide RNA. In certain LNPs, the cargo may include mRNA encoding a Cas nuclease such as Cas9, and guide RNA or a nucleic acid encoding guide RNA. In certain LNPs, the cargo may include a nucleic acid construct. In certain LNPs, the cargo may include mRNA encoding a Cas nuclease such as Cas9, guide RNA or a nucleic acid encoding guide RNA, and a nucleic acid construct. LNPs for use in this method are described in more detail elsewhere in this specification.

[0093] To reduce immunogenicity, a delivery mode may be selected. For example, Cas proteins and gRNAs may be delivered by different modes (e.g., bimodal delivery). These different modes may impart different pharmacodynamic or pharmacokinetic properties to the delivered molecule of interest (e.g., a polypeptide of interest encoding Cas or nucleic acid, gRNA or nucleic acid, or a nucleic acid construct). For example, different modes may result in different tissue distribution, different half-lives, or different temporal distributions. Some delivery modes (e.g., delivery of nucleic acid vectors that persist in cells by autonomous replication or genomic integration) result in more persistent expression and presence of the molecule, while other delivery modes are transient and less persistent (e.g., delivery of RNA or protein). For example, delivery of Cas proteins in a more transient manner as mRNA or protein may ensure that the Cas / gRNA complex is present and active for only a short period, thus reducing immunogenicity caused by peptides from bacterial Cas enzymes displayed on the cell surface by MHC molecules. Such transient delivery may also reduce the possibility of off-target modifications.

[0094] In vivo administration may be via any appropriate route, including systemic administration routes such as intravenous, subcutaneous, intra-arterial, or intramuscular parenteral administration. A specific example of in vivo administration is intravenous.

[0095] Compositions comprising guide RNA and / or Cas protein (or nucleic acids encoding guide RNA and / or Cas protein) may be formulated using one or more physiologically and pharmaceutically acceptable carriers, diluents, excipients, or adjuvants. The formulation may depend on the chosen route of administration. Pharmacologically acceptable means that the carrier, diluent, excipient, or adjuvant is compatible with the other components of the formulation and is not substantially harmful to its recipient. Specific examples include the route of administration and / or the formulation, or the choice for delivery to the liver (e.g., hepatocytes).

[0096] The method may further include identifying cells having modified target genomic loci. Various methods, such as PCR, can be used to identify cells and animals having targeted gene modifications. The screening step may include, for example, a quantitative assay to evaluate parental chromosome allele modification (MOA). For example, the quantitative assay can be carried out via quantitative PCR such as real-time PCR (qPCR). Real-time PCR can utilize a first primer set that recognizes the target locus and a second primer set that recognizes a non-target reference locus. The primer sets may include fluorescent probes that recognize amplified sequences. Other examples of suitable quantitative assays include fluorescence-mediated in situ hybridization (FISH), comparative genomic hybridization, isothermal DNA amplification, quantitative hybridization to immobilized probes, INVADER® probes, TAQMAN® molecular beacon probes, or ECLIPSE® probe technology (see, for example, U.S. Publication No. 2005 / 0144655, which is incorporated herein by reference in its entirety for all purposes).

[0097] In some methods, the percentage of cells with targeted gene modifications resulting from homologous recombination repair is higher in a control method where CtIP protein (or CtIP fusion protein) is administered (in any form, such as protein, encoding RNA, or encoding DNA) but i53 protein is not administered (in any form). In some methods, the percentage of cells with targeted gene modifications resulting from homologous recombination repair is higher in a control method where i53 is administered (in any form) but CtIP protein (or CtIP fusion protein) is not administered (in any form). In some methods, the percentage of cells with targeted gene modifications resulting from homologous recombination repair is higher in a control method where neither CtIP protein (or CtIP fusion protein) nor i53 protein is administered (in any form). In some methods, the fold change in the percentage of cells having targeted gene alterations resulting from homologous recombination repair compared to a control method in which CtIP protein (or CtIP fusion protein) and i53 protein were not administered (in any form) is at least about 2x, at least about 3x, at least about 4x, at least about 5x, at least about 10x, at least about 15x, or at least about 20x. In some methods, the multiplier change in the percentage of cells having targeted gene alterations resulting from homologous recombination repair compared to a control method in which CtIP protein (or CtIP fusion protein) and i53 protein were not administered (in any form) is approximately 15-25x, 16-24x, 17-23x, 18-22x, 19-21x, 15-20x, 16-20x, 17-20x, 18-20x, 19-20x, 20-25x, 20-24x, 20-23x, 20-22x, 20-21x, or approximately 20x.

[0098] A. CRISPR / Cas systems The methods and compositions disclosed herein can modify the intracellular genome using clustered equispaced short-chain palindromic repeat (CRISPR) / CRISPR-associated (Cas) systems or components of such systems. CRISPR / Cas systems include transcripts and other elements that are involved in or direct the activity of the Cas gene. CRISPR / Cas systems may be, for example, type I, type II, type III, or type V systems (e.g., subtype VA or subtype VB). The methods and compositions disclosed herein may utilize CRISPR / Cas systems by using the CRISPR complex (including guide RNA (gRNA) complexed with the Cas protein) for site-specific binding or cleavage of nucleic acids. A CRISPR / Cas system targeting a target gene locus comprises a Cas protein (or nucleic acid encoding the Cas protein) and one or more guide RNAs (or DNA encoding one or more guide RNAs), each of which targets a different guide RNA target sequence at the target gene locus. Such a CRISPR / Cas system that targets a target gene locus may further include one or more exogenous donor sequences (e.g., targeting vectors) that target the target gene locus.

[0099] The CRISPR / Cas systems used in the compositions and methods disclosed herein may not exist in nature. Non-natural systems include any systems that indicate human involvement, such as when one or more components of the system are modified or mutated from their naturally occurring state, when they do not contain at least substantially one other component that is naturally associated in nature, or when they are associated with at least one other component that is not naturally associated. For example, some CRISPR / Cas systems use a non-natural CRISPR complex containing a non-natural gRNA and Cas protein together, or use a non-natural Cas protein, or use a non-natural gRNA.

[0100] (1) Cas protein Cas proteins generally contain at least one RNA recognition or binding domain capable of interacting with guide RNA. Cas proteins may also contain nuclease domains (e.g., DNase or RNase domains), DNA binding domains, helicase domains, protein-protein interaction domains, dimerization domains, and other domains. Some such domains (e.g., DNase domains) may be derived from native Cas proteins. Modified Cas proteins can be constructed by adding other such domains. Nuclease domains have catalytic activity for nucleic acid cleavage, including the cleavage of covalent bonds in nucleic acid molecules. Cleavage can produce blunt or adherent ends and may be single-stranded or double-stranded. For example, wild-type Cas9 protein typically produces blunt cleavage products. Alternatively, wild-type Cpf1 protein (e.g., FnCpf1) may yield cleavage products with a 5' overhang of 5-nucleotides, where the cleavage occurs after the 18th base pair from the PAM sequence in the untargeted strand and after the 23rd base in the targeted strand. The Cas protein may be a nickase that possesses complete cleavage activity and can produce double-strand breaks at target genomic loci (e.g., double-strand breaks with blunt ends), or it may be a nickase that produces single-strand breaks at target genomic loci.

[0101] Examples of Cas proteins include Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas5e (CasD), Cas6, Cas6e, Cas6f, Cas7, Cas8a1, Cas8a2, Cas8b, Cas8c, Cas9 (Csn1 or Csx12), Cas10, Cas10d, CasF, CasG, CasH, Csy1, Csy2, Csy3, Cse1 (CasA), Cse2 (CasB), and Cse3 (CasE). This includes Cse4 (CasC), Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4, and Cu1966, as well as their homologous or modified versions.

[0102] Exemplary Cas proteins are Cas9 proteins or proteins derived from Cas9 proteins. Cas9 proteins originate from the type II CRISPR / Cas system and typically share four key motifs with a conserved architecture. Motifs 1, 2, and 4 are RuvC-like motifs, and motif 3 is an HNH motif. Exemplary Cas9 proteins are Streptococcus pyogenes, Streptococcus thermophilus, Streptococcus sp., Staphylococcus aureus, Nocardiopsis dassonvillei, Streptomyces pristinaespiralis, Streptomyces viridochromogenes, Streptomyces viridochromogenes, Streptosporangium roseum, Streptosporangium roseum, Alicyclobacillus acidocaldarius, Bacillus pseudomycoides, Bacillus selenitireducens, Exiguobacterium sibiricum, Lactobacillus delbrueckii, Lactobacillus salivarius, Microscilla marina, Burkholderiales bacterium, Polaromonas naphthalenivorans, Polaromonas sp., Crocosphaera watsonii, Cyanothece sp., Microcystis aeruginosa, Synechococcus sp., Acetohalobium arabaticum, Ammonifex degensii, Caldicellulosiruptor becscii, Candidatus Desulforudis, Clostridium botulinum, Clostridium difficile, Finegoldia magna, Natranaerobius thermophilus, Pelotomaculum thermopropionicum, Acidithiobacillus caldus, Acidithiobacillus ferrooxidans, Allochromatium vinosum, Marinobacter sp., Nitrosococcus halophilus, Nitrosococcus watsoni, Pseudoalteromonas haloplanktis, Ktedonobacter racemifer, Methanohlobium evestigatum, Anabaena variabilis, Nodularia spumigena, Nostoc sp., Arthrospira maxima, Arthrospira platensis, Arthrospira sp., Lyngbya sp., Microcoleus chthonoplastes, Oscillatoria sp.These are derived from Petrotoga mobilis, Thermosipho africanus, Acaryochloris marina, Neisseria meningitidis, or Campylobacter jejuni. Additional examples of Cas9 family members are described in International Publication WO2014 / 131833, which is incorporated herein by reference in its entirety for all purposes. Cas9 from Streptococcus pyogenes (SpCas9) (e.g., assigned UniProt accession number Q99ZW2) is an exemplary Cas9 protein. Smaller Cas9 proteins (e.g., SaCas9, CjCas9, and Nme2Cas9, etc., whose coding sequences are compatible with the maximum AAV packaging capacity when combined with the guide RNA coding sequences and regulatory elements of Cas9 and guide RNA) are other exemplary Cas9 proteins. For example, Cas9 derived from S. aureus (SaCas9) (e.g., assigned UniProt accession number J7RUA5) is another exemplary Cas9 protein. Similarly, Cas9 derived from Campylobacter jejuni (CjCas9) (e.g., assigned UniProt accession number Q0P897) is another exemplary Cas9 protein. See, for example, Kim et al. (2017) Nat.Commun. 8:14500, which is incorporated herein by reference in its entirety for all purposes. SaCas9 is smaller than SpCas9, and CjCas9 is smaller than both SaCas9 and SpCas9. Cas9 derived from Neisseria meningitidis (Nme2Cas9) is another exemplary Cas9 protein. See, for example, Edraki et al. (2019) Mol.See Cell 73(4):714–726, which is incorporated herein by reference in its entirety for all purposes. Cas9 proteins from Streptococcus thermophilus (e.g., Streptococcus thermophilus LMD-9 Cas9 encoded by the CRISPR1 locus (St1Cas9) or Streptococcus thermophilus Cas9 from the CRISPR3 locus (St3Cas9)) are other exemplary Cas9 proteins. Cas9 from Francisella novicida (FnCas9) or the RHA Francisella novicida Cas9 mutant recognizing the alternative PAM (E1369R / E1449H / R1556A substitution) are other exemplary Cas9 proteins. These and other exemplary Cas9 proteins are outlined, for example, in Cebrian-Serrano and Davies (2017) Mamm. Genome 28(7):247–261, which is incorporated herein by reference in its entirety for all purposes. Examples of Cas9 coding sequences, Cas9 mRNA, and Cas9 protein sequences are provided in WO2013 / 176772, WO2014 / 065596, WO2016 / 106121, and WO2019 / 067910, each of which is incorporated herein by reference in its entirety for all purposes. Specific examples of ORFs and Cas9 amino acid sequences are provided in Table 30 of paragraph

[0449] of International Publication WO2019 / 067910, and specific examples of Cas9 mRNA and ORFs are provided in paragraphs

[0214] to

[0234] of International Publication WO2019 / 067910. As an example, a Cas9 protein may contain, essentially consist of, or be composed of the sequence shown in SEQ ID NO: 1. Such a Cas9 protein may be encoded by DNA containing, essentially consisting of, or composed of SEQ ID NO: 2.

[0103] Another example of a Cas protein is the Cpf1 (CRISPR) protein derived from Prevotella and Francisella 1. Cpf1 is a large protein (approximately 1300 amino acids) containing a RuvC-like nuclease domain homologous to the corresponding domain of Cas9, along with a corresponding arginine-rich cluster characteristic of Cas9. However, Cpf1 lacks the HNH nuclease domain present in the Cas9 protein, and in contrast to Cas9, which contains a long insert containing the HNH domain, the RuvC-like domain is contiguous in the Cpf1 sequence. See, for example, Zetsche et al. (2015) Cell 163(3):759-771, which is incorporated herein by reference in its entirety for all purposes. Exemplary Cpf1 proteins are Francisella tularensis 1, Francisella tularensis subsp.novicida, Prevotella albensis, Lachnospiraceae bacterium MC2017 1, Butyrivibrio proteoclasticus, Peregrinibacteria bacterium GW2011_GWA2_33_10, Parcubacteria bacterium GW2011_GWC2_44_17, Smithella sp.SCADC, Acidaminococcus sp.BV3L6, Lachnospiraceae bacterium MA2020, Candidatus Methanoplasma termitum, Eubacterium eligens, Moraxella bovoculi 237, Leptospira inadai, Lachnospiraceae bacterium ND2006, Porphyromonas crevioricanis 3. These are derived from Prevotella disiens and Porphyromonas macacae. Cpf1 derived from Francisella novicida U112 (FnCpf1, assigned UniProt accession number A0Q7Q2) is an exemplary Cpf1 protein.

[0104] Another example of a Cas protein is CasX (Cas12e). CasX is an RNA-induced DNA endonuclease that generates adherent double-strand breaks in DNA. CasX is less than 1000 amino acids in size. Exemplary CasX proteins are derived from Deltaproteobacteria (DpbCasX or DpbCas12e) and Plantomycetes (PlmCasX or PlmCas12e). Similar to Cpf1, CasX uses a single RuvC active site for DNA cleavage. See, for example, Liu et al. (2019) Nature 566(7743):218-223, which is incorporated herein by reference in its entirety for all purposes.

[0105] Another example of a Cas protein is CasΦ (CasPhi or Cas12j), which is uniquely found in bacteriophages. CasΦ is less than 1000 amino acids in size (e.g., 700-800 amino acids). CasΦ cleavage produces an attached 5' overhang. A single RuvC active site in CasΦ is capable of crRNA processing and DNA cleavage. See, for example, Pausch et al. (2020) Science 369(6501):333-337, which is incorporated herein by reference in its entirety for all purposes.

[0106] The Cas protein may be a wild-type protein (i.e., one that occurs in nature), a modified Cas protein (i.e., a Cas protein variant), or a fragment of a wild-type or modified Cas protein. The Cas protein may also be an active variant or fragment with respect to the catalytic activity of a wild-type or modified Cas protein. An active variant or fragment with respect to catalytic activity may contain at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more sequence identity with respect to a wild-type or modified Cas protein or a portion thereof, and the active variant retains the ability to cleave at a desired cleavage site and therefore retains nick-inducing or double-strand break-inducing activity. Assays for nick-inducing or double-strand break-inducing activity are known and generally measure the overall activity and specificity of the Cas protein on a DNA substrate containing a cleavage site.

[0107] One example of a modified Cas protein is the modified SpCas9-HF1 protein, which is a high-fidelity variant of Streptococcus pyogenes Cas9 with modifications (N497A / R661A / Q695A / Q926A) designed to reduce nonspecific DNA contact. See, for example, Kleinstiver et al. (2016) Nature 529(7587):490-495, which is incorporated herein by reference in its entirety for all purposes. Another example of a modified Cas protein is the modified eSpCas9 variant (K848A / K1003A / R1060A) designed to reduce off-target effects. See, for example, Slaymaker et al. (2016) Science 351(6268):84-88, which is incorporated herein by reference in its entirety for all purposes. Other SpCas9 variants include K855A and K810A / K1003A / R1060A. These and other modified Cas proteins are outlined, for example, in Cebrian-Serrano and Davie (2017) Mamm. Genome 28(7):247-261, which is incorporated herein by reference in its entirety for all purposes. Another example of a modified Cas9 protein is xCas9, which is a SpCas9 variant capable of recognizing an expanded range of PAM sequences. See, for example, Hu et al. (2018) Nature 556:57-63, which is incorporated herein by reference in its entirety for all purposes.

[0108] Cas proteins can be modified to increase or decrease one or more of the following: nucleic acid binding affinity, nucleic acid binding specificity, and enzymatic activity. Cas proteins can also be modified to alter other protein activities or properties, such as stability. For example, one or more nuclease domains of a Cas protein can be modified, deleted, or inactivated; or a Cas protein can be shortened to remove domains that are not essential for the protein's function; or the activity or properties of a Cas protein can be optimized (e.g., enhanced or reduced).

[0109] Cas proteins may contain at least one nuclease domain, such as a DNase domain. For example, the wild-type Cpf1 protein generally contains a RuvC-like domain that cleaves both strands of target DNA, possibly in a dimer conformation. Similarly, CasX and CasΦ generally contain a single RuvC-like domain that cleaves both strands of target DNA. Cas proteins may also contain at least two nuclease domains, such as a DNase domain. For example, the wild-type Cas9 protein generally contains a RuvC-like nuclease domain and an HNH-like nuclease domain. The RuvC domain and the HNH domain can each cleave different strands of double-stranded DNA, resulting in double-strand breaks in the DNA. See, for example, Jinek et al. (2012) Science 337(6096):816-821, which is incorporated herein by reference in its entirety for all purposes.

[0110] Because one or more or all of the nuclease domains can be deleted or mutated, they may no longer function or have reduced nuclease activity. For example, if one of the nuclease domains in the Cas9 protein is deleted or mutated, the resulting Cas9 protein may be called a nickase, which can produce single-strand breaks in double-stranded target DNA but not double-strand breaks (i.e., it can cleave complementary or non-complementary strands, but not both). If both nuclease domains are deleted or mutated, the resulting Cas protein (e.g., Cas9) has reduced ability to cleave both strands of double-stranded DNA (e.g., nuclease null or nuclease-inactive Cas protein, or Cas protein without catalytic activity (dCas)). If none of the nuclease domains in the Cas9 protein are deleted or mutated, the Cas9 protein retains double-strand break-inducing activity. An example of a mutation that converts Cas9 to nickase is the D10A mutation (from alanine to aspartic acid at position 10 of Cas9) in the RuvC domain of Cas9 from S. pyogenes. Similarly, H939A (from histidine to alanine at amino acid position 839), H840A (from histidine to alanine at amino acid position 840), or N863A (from asparagine to alanine at amino acid position N863) in the HNH domain of Cas9 from S. pyogenes can convert Cas9 to nickase. Other examples of mutations that convert Cas9 to nickase include the corresponding mutations for Cas9 from S. thermophilus. See, for example, Sapranauskas et al. (2011) Nucleic Acids Res. 39(21):9275-9282 and International Publication No. WO2013 / 141680, each of which is incorporated herein by reference in whole for all purposes. Such mutations can be generated using methods such as site-directed mutagenesis, PCR-mediated mutagenesis, or whole-gene synthesis.Other examples of mutations that produce nickases can be found, for example, in International Publication WO2013 / 176772 and International Publication WO2013 / 142578, each of which is incorporated herein by reference in whole for all purposes. When all nuclease domains are deleted or mutated in a Cas protein (e.g., both nuclease domains are deleted or mutated in a Cas9 protein), the resulting Cas protein (e.g., Cas9) has reduced ability to cleave both strands of double-stranded DNA (e.g., nuclease null or nuclease-inactive Cas protein). One specific example is the D10A / H840AS.pyogenes Cas9 double mutant, or the corresponding double mutant of Cas9 from another species when optimally aligned with S.pyogenes Cas9. Another specific example is the D10A / N863AS.pyogenes Cas9 double mutant, or the corresponding Cas9 double mutant from another species when optimally aligned with S.pyogenes Cas9.

[0111] Examples of inactivating mutations in the catalytic domain of xCas9 are the same as those described above for SpCas9. Examples of inactivating mutations in the catalytic domain of Staphylococcus aureus Cas9 protein are also known. For example, the Cas9 enzyme of Staphylococcus aureus (SaCas9) can produce a nuclease-inactive Cas protein by including substitutions at position N580 (e.g., N580A substitution) and at position D10 (e.g., D10A substitution). See, for example, International Publication WO2016 / 106236, which is incorporated herein by reference in its entirety for all purposes. Examples of inactivating mutations in the catalytic domain of Nme2Cas9 are also known (e.g., the combination of D16A and H588A). Examples of inactivating mutations in the catalytic domain of St1Cas9 are also known (e.g., the combination of D9A, D598A, H599A, and N622A). Examples of inactivating mutations in the catalytic domain of St3Cas9 are also known (e.g., the combination of D10A and N870A). Examples of inactivating mutations in the catalytic domain of CjCas9 are also known (e.g., the combination of D8A and H559A). Examples of inactivating mutations in the catalytic domain of FnCas9 and RHA are also known (e.g., N995A).

[0112] Examples of inactivating mutations in the catalytic domain of the Cpf1 protein are also known. With respect to Cpf1 proteins from Francisella novicida U112 (FnCpf1), Acidaminococcus species BV3L6 (AsCpf1), Lachnospiraceae bacterium ND2006 (LbCpf1), and Moraxella bovoculi 237 (MbCpf1 Cpf1), such mutations may include mutations at positions 908, 993, or 1263 in AsCpf1 or the corresponding positions in the Cpf1 ortholog, or at positions 832, 925, 947, or 1180 in LbCpf1 or the corresponding positions in the Cpf1 ortholog. Such mutations may include, for example, the mutations D908A, E993A, and D1263A in AsCpf1 or the corresponding mutations in the Cpf1 ortholog, or one or more of the mutations D832A, E925A, D947A, and D1180A in LbCpf1 or the corresponding mutations in the Cpf1 ortholog. See, for example, U.S. Publication 2016 / 0208243, which is incorporated herein by reference in its entirety for all purposes.

[0113] Examples of inactivating mutations in the catalytic domain of the CasX protein are also known. In the case of the Deltaproteobacteria-derived CasX protein, the corresponding positions in D672A, E769A, and D935A (individually or in combination) or other CasX orthologues have been inactivated. See, for example, Liu et al. (2019) Nature 566(7743):218-223, which is incorporated herein by reference in its entirety for all purposes.

[0114] Examples of inactivating mutations in the catalytic domain of the CasΦ protein are also known. For example, D371A and D394A are inactivating mutations, either individually or in combination. See, for example, Pausch et al. (2020) Science 369(6501):333-337, which is incorporated herein by reference in its entirety for all purposes.

[0115] The Cas protein can also be operably ligated to a heterologous polypeptide as a fusion protein. For example, the Cas protein can be fused to a cleavage domain. See International Publication WO2014 / 089290, which is incorporated herein by reference in its entirety for all purposes. The Cas protein can also be fused to a heterologous polypeptide that provides increased or decreased stability. The fusion domain or heterologous polypeptide may be located at the N-terminus, C-terminus, or internally within the Cas protein.

[0116] As an example, a Cas protein may be fused to one or more heterologous polypeptides that provide intracellular localization. Such heterologous polypeptides may include, for example, one or more nuclear localization signals (NLS), such as a single-part SV40 NLS and / or a bipartite alpha-importin NLS for targeting the nucleus, a mitochondrial localization signal for targeting mitochondria, an ER retention signal, and so on. See, for example, Lange et al. (2007) J. Biol. Chem. 282(8):5101-5105, which is incorporated herein by reference in its entirety for all purposes. Such intracellular localization signals may be located at the N-terminus, C-terminus, or anywhere within the Cas protein. An NLS may consist of a sequence of basic amino acids and may be a single-partite or bipartite sequence. Optionally, a Cas protein may contain two or more NLSs, including an NLS at the N-terminus (e.g., an α-importin NLS or a single-partite NLS) and an NLS at the C-terminus (e.g., an SV40 NLS or a bipartite NLS). The Cas protein may also contain two or more NLS at its N-terminus and / or two or more NLS at its C-terminus.

[0117] The Cas protein can be fused with, for example, 1 to 10 NLSs (e.g., 1 to 5 NLSs, or 1 NLS). When 1 NLS is used, the NLS may be linked at the N-terminus or C-terminus of the Cas protein sequence. The NLS may also be inserted into the Cas protein sequence. Alternatively, the Cas protein may be fused with two or more NLSs. For example, the Cas protein may be fused with 2, 3, 4, or 5 NLSs. In a specific example, the Cas protein may be fused with 2 NLSs. In certain situations, the 2 NLSs may be the same (e.g., 2 SV40 NLSs) or different. For example, the Cas protein may be fused with 2 SV40 NLS sequences linked at the carboxyl terminus. Alternatively, the Cas protein may be fused with 2 NLSs, one linked at the N-terminus and the other at the C-terminus. In other examples, the Cas protein may be fused with 3 NLSs, or without any NLSs. The NLS can be a single subsequence, such as SV40 NLS, PKKKRKV (SEQ ID NO: 3), or PKKKRRV (SEQ ID NO: 4). The NLS can also be a disubsequence, such as the nucleoplasmin NLS, KRPAATKKAGQAKKKK (SEQ ID NO: 5). In certain cases, a single PKKKRKV (SEQ ID NO: 3) NLS may be linked at the C-terminus of a Cas protein. One or more linkers may be optionally included at the fusion site.

[0118] The Cas protein can also be operably linked to a cell permeability domain or a protein transduction domain. For example, the cell permeability domain may be derived from the HIV-1 TAT protein, the TLM cell permeability motif from human hepatitis B virus, MPG, Pep-1, VP22, a cell permeability peptide from herpes simplex virus, or a polyarginine peptide sequence. See, for example, International Publication WO2014 / 089290 and International Publication WO2013 / 176772, each of which is incorporated herein by reference in whole for all purposes. The cell permeability domain may be located at the N-terminus, C-terminus, or anywhere within the Cas protein.

[0119] Cas proteins can also be operably ligated to heterologous polypeptides such as fluorescent proteins, purification tags, or epitope tags to facilitate tracking or purification. Examples of fluorescent proteins include green fluorescent proteins (e.g., GFP, GFP-2, tagGFP, turboGFP, eGFP, Emerald, Azami Green, Monomeric Azami). Green, CopGFP, AceGFP, ZsGreenl), yellow fluorescent proteins (e.g., YFP, eYFP, Citrine, Venus, YPet, PhiYFP, ZsYellowl), blue fluorescent proteins (e.g., eBFP, eBFP2, Azurite, mKalamal, GFPuv, Sapphire, T-sapphire), cyan fluorescent proteins (e.g., eCFP, Cerulean, CyPet, AmCyanl, Midoriishi-Cyan), red fluorescent proteins (e.g., mKate, mKate2, mPlum, DsRed monomer, mCherry, mRFP1, DsRed-Express, DsRed2, DsRed-Monomer, HcRed-Tandem, HcRedl, AsRed2, eqFP611, mRaspberry, mStrawberry, Jred), orange fluorescent proteins (e.g., mOrange, mKO, Kusabira-Orange, Monomeric) This includes Kusabira-Orange, mTangerine, tdTomato, and any other suitable fluorescent proteins.Examples of tags include glutathione-S-transferase (GST), chitin-binding protein (CBP), maltose-binding protein, thioredoxin (TRX), poly (NANP), tandemaffinity purification (TAP) tag, myc, AcV5, AU1, AU5, E, ECS, E2, FLAG, hemagglutinin (HA), nus, Softag 1, Softag 3, Strep, SBP, Glu-Glu, HSV, KT3, S, S1, T7, V5, VSV-G, histidine (His), biotin carboxyl carrier protein (BCCP), and calmodulin.

[0120] Cas proteins can also be tethered to labeled nucleic acids. Such tethering (i.e., physical linking) can be achieved via covalent or non-covalent interactions, and the tethering can be achieved directly (e.g., via direct fusion or chemical linking, which can be achieved by modification of cysteine ​​or lysine residues on the protein or intein modification) or via one or more intervening linker or adapter molecules such as streptavidin or aptamers. See, for example, Pierce et al. (2005) Mini Rev. Med. Chem. 5(1):41-55, Duckworth et al. (2007) Angew. Chem. Int. Ed. Engl. 46(46):8819-8822, Schaeffer and Dixon (2009) Australian J. Chem. 62(10):1328-1332, Goodman et al. (2009) Chembiochem. 10(9):1551-1557, and Khatwani et al. (2012) Bioorg. Med. Chem. 20(14):4532-4539, each of which is incorporated herein by reference in its entirety for all purposes. Non-coordinate strategies for synthesizing protein-nucleic acid conjugates include the biotin-streptavidin and nickel-histidine methods. Covalent protein-nucleic acid conjugates can be synthesized by linking appropriately functionalized nucleic acids with proteins using a variety of chemicals. Some of these chemicals involve the direct binding of oligonucleotides to amino acid residues on the protein surface (e.g., lysineamine or cysteinethiol), while other, more complex schemes require post-translational modification of the protein or the involvement of catalytic or reactive protein domains. Methods for covalently binding proteins to nucleic acids may include, for example, chemical crosslinking of oligonucleotides to protein lysine or cysteine ​​residues, expressed protein ligation, chemoenzymatic methods, and the use of photoaptamers. Labeled nucleic acids can be tethered to the C-terminus, N-terminus, or internal region of a Cas protein. In one example, labeled nucleic acids are tethered to the C-terminus or N-terminus of a Cas protein.Similarly, Cas proteins can be tethered to the 5' end, 3' end, or internal region of a labeled nucleic acid. That is, labeled nucleic acids can be tethered in any orientation and polarity. For example, Cas proteins can be tethered to the 5' end or 3' end of a labeled nucleic acid.

[0121] Cas proteins can be provided in any form. For example, Cas proteins can be provided in the form of a protein, such as Cas protein complexed with gRNA. Alternatively, Cas proteins can be provided in the form of nucleic acids encoding Cas proteins, such as RNA (e.g., messenger RNA (mRNA)) or DNA. Optionally, nucleic acids encoding Cas proteins can be codon-optimized for efficient translation into proteins in specific cells or organisms. For example, nucleic acids encoding Cas proteins can be modified to alternative codons that are more frequently used in bacterial cells, yeast cells, human cells, non-human cells, mammalian cells, rodent cells, mouse cells, rat cells, or any other host cells of interest, compared to naturally occurring polynucleotide sequences. Once nucleic acids encoding Cas proteins are introduced into cells, Cas proteins can be expressed transiently, conditionally, or constitutively within the cells.

[0122] The nucleic acid encoding the Cas protein can be stably integrated into the cell's genome and operably linked to an active promoter within the cell. Alternatively, the nucleic acid encoding the Cas protein can be operably linked to a promoter in an expression construct. An expression construct includes any nucleic acid construct that can direct the expression of a gene or other nucleic acid sequence of interest (e.g., the Cas gene) and can transfer such a nucleic acid sequence of interest into a target cell. For example, the nucleic acid encoding the Cas protein may reside in a vector containing DNA encoding gRNA. Alternatively, the nucleic acid may be in a vector or plasmid that is separate from the vector containing DNA encoding gRNA. Promoters that can be used in an expression construct include, for example, promoters active in one or more of the following: eukaryotic cells, human cells, non-human cells, mammalian cells, non-human mammalian cells, rodent cells, mouse cells, rat cells, pluripotent cells, embryonic stem (ES) cells, adult stem cells, developmentally restricted progenitor cells, induced pluripotent stem (iPS) cells, or one-cell stage embryos. Such promoters may be, for example, conditional promoters, inducible promoters, constitutive promoters, or tissue-specific promoters. Optionally, a promoter may be a bidirectional promoter that drives the expression of both unidirectional Cas proteins and guide RNAs in the other direction. Such a bidirectional promoter may consist of (1) a complete conventional unidirectional Pol III promoter comprising three external regulatory elements: a distal sequence element (DSE), a proximal sequence element (PSE), and a TATA box, and (2) a second basic Pol III promoter comprising a PSE and a TATA box fused in the opposite orientation to the 5' end of the DSE. For example, in the H1 promoter, the DSE is adjacent to the PSE and TATA box, and the promoter can be made bidirectional by creating a hybrid promoter in which reverse transcription is controlled by adding a PSE and TATA box derived from the U6 promoter. See, for example, U.S. Publication No. 2016 / 0074535, which is incorporated herein by reference in its entirety for all purposes.By using a bidirectional promoter to simultaneously express the genes encoding the Cas protein and guide RNA, it becomes possible to generate a compact expression cassette that facilitates delivery.

[0123] Cas or Cas9 expression can be driven using various promoters. In some methods, small promoters are used so that the Cas or Cas9 coding sequence can be adapted to the AAV construct. For example, Cas or Cas9 and one or more gRNAs (e.g., one, two, three, or four gRNAs) can be delivered via LNP-mediated delivery (e.g., in RNA form) or adeno-associated virus (AAV)-mediated delivery (e.g., AAV2-mediated delivery, AAV5-mediated delivery, AAV8-mediated delivery, or AAV7m8-mediated delivery). For example, Cas9 mRNA and gRNA targeting a target genomic locus can be delivered by LNP-mediated delivery, or DNA encoding Cas9 and DNA encoding gRNA targeting a target genomic locus can be delivered by AAV-mediated delivery. Cas or Cas9 and gRNA(s) can be delivered in a single AAV or via two separate AAVs. For example, a first AAV may carry a Cas or Cas9 expression cassette, and a second AAV may carry a gRNA expression cassette. Similarly, a first AAV may carry a Cas or Cas9 expression cassette, and a second AAV may carry two or more gRNA expression cassettes. Alternatively, a single AAV may carry a Cas or Cas9 expression cassette (e.g., a Cas or Cas9 coding sequence operably ligated to a promoter) and a gRNA expression cassette (e.g., a gRNA coding sequence operably ligated to a promoter). Similarly, a single AAV may carry a Cas or Cas9 expression cassette (e.g., a Cas or Cas9 coding sequence operably ligated to a promoter) and two or more gRNA expression cassettes (e.g., gRNA coding sequences operably ligated to a promoter). Various promoters, such as the U6 promoter or small tRNA Gln, can be used to drive gRNA expression. Similarly, various promoters can be used to drive Cas9 expression. For example, a small promoter is used so that the Cas9 coding sequence can be fitted into the AAV construct. Similarly, a small Cas9 protein (e.g., SaCas9 or CjCas9) is used to maximize AAV packaging capacity.

[0124] Cas proteins provided as mRNA may be modified to improve their stability and / or immunogenicity. Modifications may be made to one or more nucleosides within the mRNA. Examples of chemical modifications to mRNA nucleic acid bases include pseudouridine, 1-methylpseudridine, and 5-methylcytidine. The mRNA encoding the Cas protein may also be capped. The cap may be, for example, a cap 1 structure in which a +1 ribonucleotide is methylated at the 2'O position of the ribose. Capping may result in a native structure that provides superior activity in vivo and reduces stimulation of the host's innate immune system (e.g., by mimicking a native cap) (e.g., by reducing the activation of pattern recognition receptors in the innate immune system). The mRNA encoding the Cas protein may be polyadenylated (to include a poly(A) tail). The mRNA encoding the Cas protein may also be modified to include pseudouridine (e.g., it may be completely replaced with pseudouridine). As another example, capped and polyadenylated Cas mRNA containing N1-methylpseudridine can be used. As another example, Cas mRNA completely substituted with pseudouridine may be used (i.e., all standard uracil residues are replaced with pseudouridine, a uridine isomer in which uracil is linked by a carbon-carbon bond rather than a nitrogen-carbon bond). Similarly, Cas mRNA may be modified by depleting uridine using synonymous codons. For example, capped and polyadenylated Cas mRNA completely substituted with pseudouridine may be used.

[0125] Cas mRNA may contain modified uridine at at least one, more, or all uridine positions. The modified uridine may be uridine modified at the 5' position (e.g., with halogen, methyl, or ethyl). The modified uridine may be pseudouridine modified at the 1 position (e.g., with halogen, methyl, or ethyl). The modified uridine may be, for example, pseudouridine, N1-methyl-pseudridine, 5-methoxyuridine, 5-iodouridine, or a combination thereof. In some examples, the modified uridine is 5-methoxyuridine. In some examples, the modified uridine is 5-iodouridine. In some examples, the modified uridine is pseudouridine. In some examples, the modified uridine is N1-methyl-pseudridine. In some examples, the modified uridine is a combination of pseudouridine and N1-methyl-pseudridine. In some examples, the modified uridine is a combination of pseudouridine and 5-methoxyuridine. In some cases, the modified uridine is a combination of N1-methylpseudridine and 5-methoxyuridine. In some cases, the modified uridine is a combination of 5-iodouridine and N1-methylpseudridine. In some cases, the modified uridine is a combination of pseudouridine and 5-iodouridine. In some cases, the modified uridine is a combination of 5-iodouridine and 5-methoxyuridine.

[0126] The Cas mRNA disclosed herein may also include a 5' cap such as Cap0, Cap1, or Cap2. The 5' cap is generally a 7-methylguanine ribonucleotide (which may be further modified with respect to ARCA, for example) linked via a 5'-triphosphate to the 5' position of the first nucleotide of the 5'-to-3' chain of the mRNA (i.e., the first cap-proximal nucleotide). In Cap0, the ribose of both the first and second cap-proximal nucleotides of the mRNA contains 2'-hydroxyl. In Cap1, the ribose of the first and second transcription nucleotides of the mRNA contains 2'-methoxy and 2'-hydroxyl, respectively. In Cap2, the ribose of both the first and second cap-proximal nucleotides of the mRNA contains 2'-methoxy. See, for example, Katibah et al. (2014) Proc. Natl. Acad. Sci. USA 111(33):12025-30 and Abbas et al. (2017) Proc. Natl. Acad. Sci. USA 114(11):E2106-E2115, each of which is incorporated herein by reference in its entirety for all purposes. Most endogenous higher eukaryotic mRNAs, including mammalian mRNA such as human mRNA, contain either Cap1 or Cap2. Cap0 and other cap structures, distinct from Cap1 and Cap2, can be immunogenic in mammals such as humans because they are recognized as non-self by components of the innate immune system such as IFIT-1 and IFIT-5, potentially leading to elevated cytokine levels, including type I interferons. Components of the innate immune system such as IFIT-1 and IFIT-5 also compete with eIF4E for the binding of mRNA to caps other than Cap1 or Cap2, potentially inhibiting mRNA translation.

[0127] Caps may be included cotranscribed. For example, ARCA (anti-reverse cap analog; Thermo Fisher Scientific Cat. No. AM8045) is a cap analog containing 7-methylguanine 3'-methoxy-5'-triphosphate ligated to the 5' position of a guanine ribonucleotide and can be incorporated into the transcript in vitro at initiation. ARCA results in a Cap0 cap where the 2' position of the first cap-proximal nucleotide is hydroxyl. See, for example, Stepinski et al. (2001) RNA 7:1486-1495, which is incorporated herein by reference in its entirety for all purposes.

[0128] The Cap1 structure can be provided co-transcribed using CleanCap®AG (m7G(5')ppp(5')(2'OMeA)pG; TriLink Biotechnologies catalog number N-7113) or CleanCap®GG (m7G(5')ppp(5')(2'OMeG)pG; TriLink Biotechnologies catalog number N-7133). 3'-O-methylated versions of CleanCap®AG and CleanCap®GG are also available from TriLink Biotechnologies as catalog numbers N-7413 and N-7433, respectively.

[0129] Alternatively, a cap can be added to RNA after transcription. For example, vaccinia capping enzyme is commercially available (New England Biolabs, catalog number M2080S) and has RNA triphosphatase and guanylyltransferase activity provided by its D1 subunit, as well as guanine methyltransferase activity provided by its D12 subunit. Thus, in the presence of S-adenosylmethionine and GTP, 7-methylguanine can be added to RNA to give Cap0. See, for example, Guo and Moss (1990) Proc. Natl. Acad. Sci. USA 87:4023-4027 and Mao and Shuman (1994) J. Biol. Chem. 269:24472-24479, each of which is incorporated herein by reference in whole for all purposes.

[0130] Cas mRNA may further comprise polyadenylated (poly-A or poly(A) or polyadenine) tails. A poly-A tail may contain, for example, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, or at least 100 adenines, and optionally up to 300 adenines. For example, a poly-A tail may contain 95, 96, 97, 98, 99, or 100 adenine nucleotides.

[0131] Any of the above modifications to Cas mRNA (e.g., for improving stability and / or immunogenicity) can also be used for RNA encoding the CtIP fusion protein or i53 protein disclosed herein.

[0132] (2) Guide RNA A “guide RNA” or “gRNA” is an RNA molecule that binds to a Cas protein (e.g., the Cas9 protein) and targets the Cas protein to a specific location within target DNA. A guide RNA may contain two segments: a “DNA targeting segment” (also called a “guide sequence”) and a “protein-binding segment”. A “segment” is a section or region of a molecule, for example, a continuous range of nucleotides in RNA. Some gRNAs, such as those for Cas9, may contain two distinct RNA molecules: an “activator RNA” (e.g., tracrRNA) and a “targeter RNA” (e.g., CRISPR RNA or crRNA). Other gRNAs are single RNA molecules (single RNA polynucleotides), which may also be called “single-molecule gRNA,” “single-guide RNA,” or “sgRNA.” For example, see International Publications WO2013 / 176772, WO2014 / 065596, WO2014 / 089290, WO2014 / 093622, WO2014 / 099750, WO2013 / 142578, and WO2014 / 131833, each of which is incorporated herein by reference in its entirety for all purposes. Guide RNA may refer to either CRISPR RNA (crRNA) or a combination of crRNA and transactivated CRISPR RNA (tracrRNA). crRNA and tracrRNA may be associated as a single RNA molecule (single guide RNA or sgRNA) or as two separate RNA molecules (dual guide RNA or dgRNA). For example, in the case of Cas9, a single guide RNA may include a crRNA fused to a tracrRNA (e.g., via a linker). For example, in the case of Cpf1 and CasΦ, only a crRNA is required to achieve binding to the target sequence. The terms “guide RNA” and “gRNA” include both bimolecule (i.e., modular) gRNAs and monomolecule gRNAs. In some of the methods and compositions disclosed herein, the gRNA is S. pyogenes Cas9 gRNA or its equivalent.In some of the methods and compositions disclosed herein, the guide RNA is S. aureus Cas9 gRNA or an equivalent thereof.

[0133] Exemplary two-molecule gRNAs include a crRNA-like molecule ("CRISPR RNA" or "Targeter RNA" or "crRNA" or "crRNA repeat") and a corresponding tracrRNA-like molecule ("Transactivating CRISPR RNA" or "Activator RNA" or "tracrRNA"). The crRNA includes both the DNA-targeting segment (single-stranded) of the gRNA and the nucleotide stretch that forms half of the dsRNA double helix of the protein-binding segment of the gRNA. An example of a crRNA tail located downstream (3') of the DNA-targeting segment (e.g., for use with S. pyogenes Cas9) includes, essentially consists of, or comprises GUUUUAGAGCUAUGCU (SEQ ID NO: 6) or GUUUUAGAGCUAUGCUGUUUUG (SEQ ID NO: 7). Any DNA-targeting segment can bind to the 5' end of SEQ ID NO: 6 or SEQ ID NO: 7 to form a crRNA.

[0134] The corresponding tracrRNA (activator-RNA) contains a stretch of nucleotides that forms the other half of the dsRNA double helix of the protein-binding segment of the gRNA. The nucleotide stretch of the crRNA is complementary to the nucleotide stretch of the tracrRNA, and they hybridize to form the dsRNA double helix of the protein-binding domain of the gRNA. Therefore, it can be said that each crRNA has a corresponding tracrRNA. Examples of tracrRNA sequences include, essentially consist of, or consist of, any one of the following: AGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUU (Sequence ID 8), AAACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU (Sequence ID 9), or GUUGGAACCAUUCAAAACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGC (Sequence ID 10).

[0135] In systems requiring both crRNA and tracrRNA, the crRNA and its corresponding tracrRNA hybridize to form gRNA. In systems requiring only crRNA, the crRNA may be gRNA. The crRNA additionally provides a single-stranded DNA targeting segment that hybridizes to the complementary strand of the target DNA. When used for intracellular modification, the precise sequence of a given crRNA or tracrRNA molecule may be designed to be species-specific in which the RNA molecule is used. For example, see Mali et al. (2013) Science 339(6121):823-826, Jinek et al. (2012) Science 337(6096):816-821, Hwang et al. (2013) Nat. Biotechnol. 31(3):227-229, Jiang et al. (2013) Nat. Biotechnol. 31(3):233-239, and Cong et al. (2013) Science 339(6121):819-823, each of which is incorporated herein by reference in its entirety for all purposes.

[0136] The DNA targeting segment (crRNA) of a given gRNA contains a nucleotide sequence complementary to a sequence on the complementary strand of the target DNA, as described in more detail below. The DNA targeting segment of the gRNA interacts with the target DNA in a sequence-specific manner via hybridization (i.e., base pairing). Therefore, the nucleotide sequence of the DNA targeting segment varies, and the position within the target DNA where the gRNA and target DNA interact can be determined. The DNA targeting segment of a target gRNA can be modified to hybridize to any desired sequence within the target DNA. Naturally occurring crRNAs, depending on the CRISPR / Cas system and the organism, often contain a targeting segment of 21–72 nucleotides in length, flanked by two direct repeats (DRs) of 21–46 nucleotides in length (see, for example, International Publication WO2014 / 131833, the whole of which is incorporated herein by reference for all purposes). In the case of S. pyogenes, the DR is 36 nucleotides long and the targeting segment is 30 nucleotides long. The DR located at 3' is complementary to the corresponding tracrRNA, hybridizes with it, and then binds to the Cas protein.

[0137] DNA targeting segments may have, for example, nucleotide lengths of at least about 12, at least about 15, at least about 17, at least about 18, at least about 19, at least about 20, at least about 25, at least about 30, at least about 35, or at least about 40. Such DNA targeting segments may have, for example, lengths of about 12 to about 100, about 12 to about 80, about 12 to about 50, about 12 to about 40, about 12 to about 30, about 12 to about 25, or about 12 to about 20 nucleotides. For example, a DNA targeting segment may be about 15 to about 25 nucleotides (e.g., about 17 to about 20 nucleotides, or about 17, about 18, about 19, or about 20 nucleotides). See, for example, U.S. Publication No. 2016 / 0024523, which is incorporated herein by reference in its entirety for all purposes. In the case of Cas9 from S. pyogenes, the typical DNA targeting segment is 16-20 nucleotides long or 17-20 nucleotides long. In the case of Cas9 from S. aureus, the typical DNA targeting segment is 21-23 nucleotides long. In the case of Cpf1, the typical DNA targeting segment is at least 16 nucleotides long or at least 18 nucleotides long.

[0138] For example, a DNA targeting segment may be approximately 20 nucleotides long. However, shorter and longer sequences can also be used as targeting segments (e.g., 15–25 nucleotides long, such as 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides). The degree of identity between the DNA targeting segment and the corresponding guide RNA target sequence (or the degree of complementarity between the DNA targeting segment and the other strand of the guide RNA target sequence) may be, for example, approximately 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100%. The DNA targeting segment and the corresponding guide RNA target sequence may contain one or more mismatches. For example, the DNA targeting segment of the guide RNA and the corresponding guide RNA target sequence may contain 1-4, 1-3, 1-2, 1, 2, 3, or 4 mismatches (for example, the full length of the guide RNA target sequence is at least 17, at least 18, at least 19, or at least 20 nucleotides). For example, the DNA targeting segment of the guide RNA and the corresponding guide RNA target sequence may contain 1-4, 1-3, 1-2, 1, 2, 3, or 4 mismatches, with the full length of the guide RNA target sequence being 20 nucleotides.

[0139] TracrRNA can be in any form (e.g., full-length tracrRNA or active-part tracrRNA) and can be of various lengths. These may include primary transcripts or processed forms. For example, tracrRNA (as part of a single guide RNA or as a separate molecule as part of two gRNA molecules) may contain, be essentially, or be derived from all or part of a wild-type tracrRNA sequence (e.g., about 20 or more, about 26 or more, about 32 or more, about 45 or more, about 48 or more, about 54 or more, about 63 or more, about 67 or more, about 85 or more, or more nucleotides of a wild-type tracrRNA sequence). Examples of wild-type tracrRNA sequences from S. pyogenes include 171-nucleotide, 89-nucleotide, 75-nucleotide, and 65-nucleotide versions. For example, see Deltcheva et al. (2011) Nature 471(7340):602-607, International Publication No. WO2014 / 093661, each of which is incorporated herein by reference in its entirety for all purposes. Examples of tracrRNA within a single guide RNA (sgRNA) include tracrRNA segments found within the +48, ​​+54, +67, and +85 versions of the sgRNA, where "+n" indicates that the sgRNA contains the maximum +n nucleotides of wild-type tracrRNA. See U.S. Patent No. 8,697,359, which is incorporated herein by reference in its entirety for all purposes.

[0140] The complementarity percentage between the guide RNA's DNA targeting segment and the complementary strand of the target DNA may be at least 60% (e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100%). The complementarity percentage between the DNA targeting segment and the complementary strand of the target DNA may be at least 60% over approximately 20 consecutive nucleotides. As an example, the complementarity percentage between the DNA targeting segment and the complementary strand of the target DNA may be 100% over 14 consecutive nucleotides at the 5' end of the complementary strand of the target DNA, and as low as 0% over the rest. In such a case, the DNA targeting segment may be considered to be 14 nucleotides long. As another example, the complementarity percentage between the DNA targeting segment and the complementary strand of the target DNA may be 100% over the seven consecutive nucleotides at the 5' end of the complementary strand of the target DNA, and may be as low as 0% over the rest. In such a case, the DNA targeting segment may be considered to be 7 nucleotides long. For some guide RNAs, at least 17 nucleotides within the DNA targeting segment are complementary to the complementary strand of the target DNA. For example, the DNA targeting segment may be 20 nucleotides long and may contain one, two, or three mismatches with the complementary strand of the target DNA. For example, the mismatch is not adjacent to a region of the complementary strand corresponding to a protospacer adjacent motif (PAM) sequence (i.e., the reverse complement of the PAM sequence) (for example, the mismatch is at the 5' end of the DNA targeting segment of the guide RNA, or the mismatch is at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, or at least 19 base pairs away from the region of the complementary strand corresponding to the PAM sequence).

[0141] The protein-binding segment of a gRNA may contain stretches of two complementary nucleotides. These complementary nucleotides hybridize to form a double-stranded RNA (dsRNA). The protein-binding segment of a subject's gRNA interacts with a Cas protein, and the gRNA directs the bound Cas protein to a specific nucleotide sequence within target DNA via its DNA-targeting segment.

[0142] A single guide RNA may include a DNA targeting segment and a scaffold sequence (i.e., a protein-binding or Cas-binding sequence of the guide RNA). For example, such a guide RNA may have a 5' DNA targeting segment bound to a 3' scaffold sequence. An example scaffold sequence (e.g., S. pyogenes) is shown. (For use with Cas9) GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCU (Version 1, Sequence ID 11), GUUGGAACCAUUCAAAACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGC (Version 2, Sequence ID 12), GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGC (Version 3, Sequence ID 13), GUUUAAGAGCUAUGCUGGAAACAGCAUAGCAAGUUUAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGC (Version 4, Sequence ID 14), GUUUUAG AGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUUU (version 5, sequence number 15), GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU (version 6, sequence number 16), GUUUAAGAGCUAUGCUGGAAACAGCAUAGCAAGUUUAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUU (version 7, sequence number 17), or GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGGCACCGAGUCGGUGC (version 8, sequence number 18), including, essentially consisting of, or comprising. Some guide sgRNAs lack the four terminal U residues of version 6.Some guide sgRNAs have only one, two, or three of the four terminal U residues of version 6. The targeting guide RNA may include, for example, an arbitrary DNA targeting segment at the 5' end of the guide RNA fused to one of the exemplary guide RNA scaffold sequences at the 3' end of the guide RNA. That is, any of the DNA targeting segments disclosed herein may bind to the 5' end of any one of the above scaffold sequences to form a single guide RNA (chimeric guide RNA).

[0143] Guide RNA may contain modifications or sequences that provide additional desirable features (e.g., modified or regulated stability, intracellular targeting, tracking using fluorescent labeling, or protein or protein complex binding sites). Guide RNA may contain one or more modified nucleosides or nucleotides, or one or more non-naturally occurring and / or naturally occurring components or compositions used in place of or in addition to canonical A, G, C, and U residues. Examples of such modifications include, for example, 5' caps (e.g., 7-methylguanylate caps (m7G)), 3' polyadenylated tails (i.e., 3' poly(A) tails), riboswitch sequences (e.g., to enable regulated stability and / or regulated accessibility by proteins and / or protein complexes), stability control sequences, sequences that form dsRNA double helixes (i.e., hairpins), modifications or sequences that cause RNA to target intracellular locations (e.g., nucleus, mitochondria, chloroplasts, etc.), modifications or sequences that provide tracking (e.g., direct conjugation to fluorescent molecules, conjugation to regions that facilitate fluorescence detection, sequences that enable fluorescence detection, etc.), modifications or sequences that provide binding sites for proteins (e.g., DNA-acting proteins such as proteins that affect homologous recombination repair processes), or combinations thereof. Other examples of modifications include manipulated stem-loop double structures, manipulated bulge regions, manipulated hairpin 3' of stem-loop double structures, or any combination thereof. For example, see U.S. Publication No. 2015 / 0376586, which is incorporated herein by reference in its entirety for all purposes. A bulge may be an unpaired region of nucleotides within a double helix, comprising a crRNA-like region and a minimal tracrRNA-like region. A bulge may include an unpaired 5'-XXXY-3' on one side of the double helix, where X is any purine and Y may be a nucleotide capable of fluctuating pairing with a nucleotide on the opposite strand, and an unpaired nucleotide region on the other side of the double helix.

[0144] Guide RNAs include, for example, the following: (1) alterations or substitutions of one or both unbound phosphate oxygen atoms and / or one or more bound phosphate oxygen atoms in phosphodiester backbone bonds (exemplary backbone modifications); (2) alterations or substitutions of components of ribose sugars, e.g., alterations or substitutions of the 2' hydroxyl group on ribose sugars (exemplary sugar modifications); (3) substitutions of phosphate moieties by dephospholinkers, e.g., large-scale substitutions (exemplary backbone modifications); (4) alterations or substitutions of naturally occurring nucleic acid bases, including those by non-standard nucleic acid bases (exemplary base modifications); (5) substitutions or modifications of the ribose-phosphate backbone (exemplary backbone modifications); and (6) the 3' or 5' end of oligonucleotides. Modifications of (7) modified nucleosides and modified nucleotides may include one or more of the following: (e.g., removal, modification or substitution of terminal phosphate groups, or conjugation of a part, cap or linker (such 3' or 5' cap modifications may include sugar and / or skeletal modifications), and (7) sugar modification or substitution (exemplary sugar modifications). Other possible guide RNA modifications include modification or substitution of uracil or polyuracil tracts. See, for example, International Publication No. WO2015 / 048577 and U.S. Publication No. 2016 / 0237455, each of which is incorporated herein by reference in whole for all purposes. Similar modifications may be made to Cas-coding nucleic acids such as Cas mRNA. For example, Cas mRNA may be modified by depleting uridine using synonymous codons.

[0145] By combining chemical modifications such as those listed above, modified gRNAs and / or mRNAs can be provided that contain residues (nucleosides and nucleotides) having two, three, four, or more modifications. For example, modified residues may have modified sugars and modified nucleic acid bases. In one example, all bases of the gRNA are modified (for example, all bases have modified phosphate groups such as phosphorothioate groups). For example, all or substantially all phosphate groups of the gRNA may be replaced with phosphorothioate groups. Alternatively or additionally, modified gRNAs may contain at least one modified residue at or near the 5' end. Alternatively or additionally, modified gRNAs may contain at least one modified residue at or near the 3' end.

[0146] Some gRNAs contain one, two, three, or more modified residues. For example, at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% of the modified gRNA may be modified nucleosides or nucleotides.

[0147] Unmodified nucleic acids may be susceptible to degradation. Exogenous nucleic acids may also induce an innate immune response. Modifications may help introduce stability and reduce immunogenicity. Some gRNAs described herein may contain one or more modified nucleosides or nucleotides to introduce stability against intracellular or serum-based nucleases. Some modified gRNAs described herein may exhibit a reduced innate immune response when introduced into a population of cells.

[0148] The gRNAs disclosed herein may include skeletal modifications in which the phosphate groups of modified residues are modified by replacing one or more of the oxygen atoms with different substituents. Modifications may include large-scale replacement of unmodified phosphate groups with modified phosphate groups, as described herein. Skeletal modifications of the phosphate backbone may also include changes resulting in either uncharged linkers or charged linkers with asymmetric charge distributions.

[0149] Examples of modified phosphate groups include phosphorothioates, phosphoroselenates, boranophosphates, boranophosphate esters, hydrogen phosphonates, phosphoramidates, alkyl or aryl phosphonates, and phosphotryesters. The phosphorus atom in an unmodified phosphate group is achiral. However, replacing one of the non-bridged oxygen atoms with one of the above atoms or groups of atoms may make the phosphorus atom chiral. The phosphorus atom at the stereocenter may have either an "R" configuration (Rp) or an "S" configuration (Sp). The skeleton can also be modified by substituting the bridged oxygen (i.e., the oxygen that bonds phosphate to the nucleoside) with nitrogen (bridged phosphoramidate), sulfur (bridged phosphorothioate), and carbon (bridged methylene phosphonate). The substitution may occur on one or both of the bridged oxygen atoms.

[0150] The phosphate group can be replaced with a phosphate-free connector through specific skeletal modifications. In some embodiments, the charged phosphate group can be replaced by a neutral moiety. Examples of moieties that can replace the phosphate group include, but are not limited to, methylphosphonates, hydroxylaminos, siloxanes, carbonates, carboxymethyls, carbamates, amides, thioethers, ethylene oxide linkers, sulfonates, sulfonamides, thioformacetals, formacetals, oximes, methyleneiminos, methylenemethyliminos, methylenehydrazos, methylenedimethylhydrazos, and methyleneoxymethyliminos.

[0151] Scaffolds capable of mimicking nucleic acids can also be constructed such that the phosphate linker and ribose sugar are replaced by nuclease-resistant nucleosides or nucleotide substitutes. Such modifications may include skeletal and sugar modifications. In some embodiments, nucleic acid bases may be tethered by the surrogate skeleton. Examples include, but are not limited to, morpholino, cyclobutyl, pyrrolidine, and peptide nucleic acid (PNA) nucleoside substitutes.

[0152] Modified nucleosides and modified nucleotides may include one or more modifications to a sugar group (sugar modification). For example, the 2'-hydroxyl group (OH) may be modified (e.g., it may be substituted with several different oxy or deoxy substituents). Modification to the 2'-hydroxyl group can increase the stability of nucleic acids because it prevents the hydroxyl from being deprotonated to form a 2'-alkoxide ion.

[0153] Examples of 2'-hydroxyl group modifications include alkoxy or aryloxy (OR (wherein "R" can be, for example, alkyl, cycloalkyl, aryl, aralkyl, heteroaryl, or sugar)); polyethylene glycol (PEG); O(CH2CH2O) n Examples include CH2CH2OR (wherein R can be, for example, H or an optionally substituted alkyl, and n can be an integer from 0 to 20 (e.g., 0 to 4, 0 to 8, 0 to 10, 0 to 16, 1 to 4, 1 to 8, 1 to 10, 1 to 16, 1 to 20, 2 to 4, 2 to 8, 2 to 10, 2 to 16, 2 to 20, 4 to 8, 4 to 10, 4 to 16, and 4 to 20)). The 2'-hydroxyl group modification can be 2'-O-Me. Similarly, the 2'-hydroxyl group modification can be a 2'-fluoro modification, which replaces the 2'-hydroxyl group with a fluoride. The 2'-hydroxyl group modification can be such that the 2'-hydroxyl is, for example, C 1~6 Alkylene or C 1~6It can contain locked nucleic acids (LNA) that can be linked to the 4'-carbon of the same ribose sugar by heteroalkylene bridging, and exemplary bridges are methylene, propylene, ether or amino bridges; O-amino (where amino can be, for example, NH2; alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino or diheteroarylamino, ethylenediamine or polyamino) and aminoalkoxy, O(CH2) n -amino (where amino can be, for example, NH2; alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino or diheteroarylamino, ethylenediamine or polyamino). 2'-hydroxyl group modifications can include unlocked nucleic acids (UNA) in which the ribose ring lacks a C2'-C3' bond. 2'-hydroxyl group modifications can include a methoxyethyl group (MOE) (OCH2CH2OCH3, for example, a PEG derivative).

[0154] 2'-deoxy modifications can include hydrogen (i.e., for example, deoxyribose sugar in the overhang portion of a partial dsRNA); halo (e.g., bromo, chloro, fluoro, or iodo); amino (where amino can be, for example, NH2; alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, diheteroarylamino or an amino acid); NH(CH2CH2NH) n CH2CH2 - amino (where amino can be, for example, as described herein), -NHC(O)R (where R can be, for example, alkyl, cycloalkyl, aryl, aralkyl, heteroaryl or sugar), cyano; mercapto; alkyl - thio - alkyl; thioalkoxy; and alkyl, cycloalkyl, aryl, alkenyl and alkynyl (which can be optionally substituted with amino as described herein, for example).

[0155] Sugar modification may involve a sugar group containing one or more carbon atoms having the opposite stereochemical configuration to the corresponding carbon in ribose. Therefore, modified nucleic acids may contain, for example, nucleotides containing arabinose as the sugar. Modified nucleic acids may also contain abasic sugars. These abasic sugars may also be further modified with one or more of their constituent sugar atoms. Modified nucleic acids may also contain one or more L-type sugars (e.g., L-nucleosides).

[0156] The modified nucleosides and modified nucleotides described herein, which can be incorporated into modified nucleic acids, may include modified bases, also called nucleic acid bases. Examples of nucleic acid bases include, but are not limited to, adenine (A), guanine (G), cytosine (C), and uracil (U). These nucleic acid bases may be modified or completely substituted to provide a modified residue that can be incorporated into the modified nucleic acid. The nucleic acid bases of a nucleotide may be independently selected from purines, pyrimidines, purine analogs, or pyrimidine analogs. In some embodiments, the nucleic acid bases may include, for example, naturally occurring synthetic derivatives of the bases.

[0157] In dual guide RNAs, modifications may be present in both the crRNA and tracrRNA. Such modifications may be located at one or both ends of the crRNA and / or tracrRNA. In sgRNAs, one or more residues at one or both ends of the sgRNA may be chemically modified, and / or the internal nucleoside may be modified, and / or the entire sgRNA may be chemically modified. Some gRNAs include 5' end modifications. Some gRNAs include 3' end modifications.

[0158] The guide RNAs disclosed herein may include one of the modification patterns disclosed in International Publication No. WO2018 / 107028(Al), which is incorporated herein by reference in its entirety for all purposes. The guide RNAs disclosed herein may also include one of the structure / modification patterns disclosed in U.S. Publication No. 2017 / 0114334, which is incorporated herein by reference in its entirety for all purposes. The guide RNAs disclosed herein may also include one of the structure / modification patterns disclosed in International Publication No. WO2017 / 136794, International Publication No. WO2017 / 004279, U.S. Publication No. 2018 / 0187186, or U.S. Publication No. 2019 / 0048338, each of which is incorporated herein by reference in its entirety for all purposes.

[0159] As an example, the nucleotides at the 5' or 3' end of the guide RNA may contain phosphorothioate bonds (for example, the base may have a modified phosphate group which is a phosphorothioate group). For example, the guide RNA may contain phosphorothioate bonds between 2, 3, or 4 terminal nucleotides at the 5' or 3' end of the guide RNA. Another example is that the nucleotides at the 5' and / or 3' end of the guide RNA may have 2'-O-methyl modifications. For example, the guide RNA may contain 2'-O-methyl modifications on 2, 3, or 4 terminal nucleotides at the 5' and / or 3' end (e.g., the 5' end) of the guide RNA. See, for example, International Publication No. WO2017 / 173054(A1) and Finn et al. (2018) Cell Rep. 22(9):2227-2235, each of which is incorporated herein by reference in whole for all purposes. Other possible modifications are described in more detail elsewhere herein. In a specific example, the guide RNA contains 2'-O-methyl analogues and 3' phosphorothioate nucleotide linkages at the first three 5' and 3' terminal RNA residues. Such chemical modifications provide, for example, better stability and protection of the guide RNA from exonucleases, allowing it to persist in cells longer than unmodified guide RNA. Such chemical modifications can also protect the RNA from innate intracellular immune responses that could aggressively degrade the RNA or trigger immune cascades leading to cell death.

[0160] As an example, any of the guide RNAs described herein may include at least one modification. For example, the at least one modification may include a 2'-O-methyl (2'-O-Me) modified nucleotide, a phosphorothioate (PS) bond between nucleotides, a 2'-fluoro (2'-F) modified nucleotide, or a combination thereof. For example, at least one modification may include a 2'-O-methyl (2'-O-Me) modified nucleotide. Alternatively or additionally, at least one modification may include a phosphorothioate (PS) bond between nucleotides. Alternatively or additionally, at least one modification may include a 2'-fluoro (2'-F) modified nucleotide. For example, the guide RNA described herein includes one or more 2'-O-methyl (2'-O-Me) modified nucleotides and one or more phosphorothioate (PS) bonds between nucleotides.

[0161] Modifications can occur anywhere in the guide RNA. For example, the guide RNA may include modifications on one or more of the first five nucleotides at the 5' end of the guide RNA, or modifications on one or more of the last five nucleotides at the 3' end of the guide RNA, or a combination thereof. For example, the guide RNA may include phosphorothioate bonds between the first four nucleotides of the guide RNA, phosphorothioate bonds between the last four nucleotides of the guide RNA, or a combination thereof. Alternatively or additionally, the guide RNA may include 2'-O-Me modified nucleotides at the first three nucleotides at the 5' end of the guide RNA, or 2'-O-Me modified nucleotides at the last three nucleotides at the 3' end of the guide RNA, or a combination thereof.

[0162] Other chemical modifications proven to affect nucleotide sugar rings are halogen substitutions. For example, 2'-fluoro(2'-F) substitutions in nucleotide sugar rings can increase oligonucleotide binding affinity and nuclease stability. Debasic nucleotides are nucleotides lacking a nitrogenous base. Inverted bases are those with a linkage that is inverted from the usual 5'-to-3' linkage (i.e., either 5'-to-5' or 3'-to-3' linkage).

[0163] Debasic nucleotides can be joined via inverted ligatures. For example, a debasic nucleotide can be joined to the terminal 5' nucleotide via a 5'-to-5' ligature, or to the terminal 3' nucleotide via a 3'-to-3' ligature. An inverted debasic nucleotide at either the terminal 5' or 3' nucleotide may also be called an inverted debasic end cap.

[0164] In one example, one or more of the first three, four, or five nucleotides at the 5' end and one or more of the last three, four, or five nucleotides at the 3' end are modified. The modifications may be, for example, 2'-O-Me, 2'-F, inverted debasal nucleotides, phosphorothioate bonds, or other nucleotide modifications known to increase stability and / or performance.

[0165] In another example, the first four nucleotides at the 5' end and the last four nucleotides at the 3' end can be linked by a phosphorothioate bond.

[0166] In another example, the first three nucleotides at the 5' end and the last three nucleotides at the 3' end may contain 2'-O-methyl (2'-O-Me) modified nucleotides. In yet another example, the first three nucleotides at the 5' end and the last three nucleotides at the 3' end may contain 2'-fluoro (2'-F) modified nucleotides. In yet another example, the first three nucleotides at the 5' end and the last three nucleotides at the 3' end may contain inverted debased nucleotides.

[0167] In some guide RNAs (e.g., single guide RNAs), at least one loop (e.g., two loops) of the guide RNA is modified by the insertion of a distinctly different RNA sequence that binds to one or more adapters (i.e., adapter proteins or domains). Such adapter proteins may be used to further recruit one or more heterologous functional domains, such as proteins that influence homologous recombination repair processes in cells. Examples of fusion proteins, including such adapter proteins (i.e., fusion proteins), are disclosed elsewhere in this specification. For example, the MS2-binding loop ggccAACAUGAGGAUCACCCAUGUCUGCAGggcc (SEQ ID NO: 19) can substitute nucleotides +13 to +16 and nucleotides +53 to +56 of the sgRNA scaffold (backbone) shown in SEQ ID NOs. 11, 13, 15, or 16) or the sgRNA backbone for the S. pyogenes CRISPR / Cas9 system described in International Publication No. WO2016 / 049258 and Konermann et al. (2015) Nature 517(7536):583-588, each of which is incorporated herein by reference in its entirety for all purposes. The numbering of guide RNAs used herein refers to the numbering of nucleotides in the guide RNA scaffold sequence (i.e., the sequence downstream of the DNA targeting segment of the guide RNA). For example, the first nucleotide of the guide RNA scaffold is +1, the second nucleotide of the scaffold is +2, and so on. The residues corresponding to nucleotides +13 to +16 in SEQ ID NOs. 11, 13, 15, or 16 are a loop sequence spanning nucleotides +9 to +21 in SEQ ID NOs. 11, 13, 15, or 16, which is referred to herein as the tetraloop. The residues corresponding to nucleotides +53 to +56 in SEQ ID NOs. 11, 13, 15, or 16 are a loop sequence spanning nucleotides +48 to +61 in SEQ ID NOs. 11, 13, 15, or 16 are a loop sequence spanning nucleotides +48 to +61 in SEQ ID NOs. 16, 11, 13, 15, or 16 include stemloop 1 (nucleotides +33 to +41) and stemloop 3 (nucleotides +63 to +75).The resulting structure is an sgRNA scaffold in which each of the tetraloop and stemloop 2 sequences is replaced by an MS2-binding loop. The tetraloop and stemloop 2 protrude from the Cas9 protein so that the addition of the MS2-binding loop does not interfere with any Cas9 residues. Additionally, the proximity of the tetraloop and stemloop 2 sites to DNA suggests that localization to these sites can lead to a high degree of interaction between the DNA and any recruited protein, such as a protein that affects the homologous recombination repair process. Therefore, in some sgRNAs, the nucleotides corresponding to +13 to +16 and / or +53 to +56 of the guide RNA scaffold described in SEQ ID NOs. 11, 13, 15, or 16, or the corresponding residues when optimally aligned with any of these scaffolds / backbone, are replaced by one or more adapter proteins or separate RNA sequences capable of binding to a domain. Alternatively or additionally, the adapter-binding sequence may be added to the 5' or 3' end of the guide RNA. Exemplary guide RNA scaffolds containing an MS2-binding loop in the tetraloop and stemloop 2 regions contain, essentially consist of, or may consist of the sequences described in SEQ ID NOs. 21, 22, or 23 (e.g., SEQ ID NOs. 23). Exemplary general single guide RNAs containing an MS2-binding loop in the tetraloop and stemloop 2 regions contain, essentially consist of, or may consist of the sequences described in SEQ ID NOs. 24, 25, or 26 (e.g., SEQ ID NOs. 26).

[0168] Guide RNA can be provided in any form. For example, gRNA can be provided in RNA form as either two molecules (separate crRNA and tracrRNA) or one molecule (sgRNA), and optionally in the form of a complex with the Cas protein. gRNA can also be provided in the form of DNA encoding gRNA. DNA encoding gRNA can encode a single RNA molecule (sgRNA) or separate RNA molecules (e.g., separate crRNA and tracrRNA). In the latter case, the DNA encoding gRNA can be provided as a single DNA molecule or as separate DNA molecules encoding crRNA and tracrRNA, respectively.

[0169] If gRNA is provided in the form of DNA, it can be expressed transiently, conditionally, or constitutively within a cell. The DNA encoding the gRNA can be stably integrated into the cell's genome and operably linked to an active promoter in the cell. Alternatively, the DNA encoding the gRNA can be operably linked to a promoter in an expression construct. For example, the DNA encoding the gRNA may be in a vector containing heterologous nucleic acids. Promoters that can be used in such expression constructs include, for example, promoters active in one or more of the following: eukaryotic cells, human cells, non-human cells, mammalian cells, non-human mammalian cells, rodent cells, mouse cells, rat cells, pluripotent cells, embryonic stem (ES) cells, adult stem cells, developmentally restricted progenitor cells, induced pluripotent stem (iPS) cells, or one-cell stage embryos. Such promoters may be, for example, conditional promoters, inducible promoters, constitutive promoters, or tissue-specific promoters. Such promoters may also be, for example, bidirectional promoters. Specific examples of suitable promoters include RNA polymerase III promoters such as the human U6 promoter, the rat U6 polymerase III promoter, or the mouse U6 polymerase III promoter.

[0170] Alternatively, gRNA can be prepared by various other methods. For example, gRNA can be prepared by in vitro transcription using T7 RNA polymerase (see, for example, International Publications WO2014 / 089290 and WO2014 / 065596, each of which is incorporated herein by reference in whole for all purposes). Guide RNA can also be a synthetically produced molecule prepared by chemical synthesis. For example, guide RNA may be chemically synthesized to include 2'-O-methyl analogs and 3' phosphorothioate nucleotide linkages in the first three 5' and 3' terminal RNA residues.

[0171] Guide RNA (or nucleic acid encoding guide RNA) may be in a composition comprising one or more guide RNAs (e.g., 1, 2, 3, 4, or more guide RNAs) and a carrier that increases the stability of the guide RNA (e.g., extends the period under given storage conditions (e.g., -20°C, 4°C, or ambient temperature) during which degradation products remain below a threshold, e.g., less than 0.5% by weight of the starting nucleic acid or protein, or increases in vivo stability). Non-limiting examples of such carriers include poly(lactic acid) (PLA) microspheres, poly(D,L-lactic acid-coglycol-acid) (PLGA) microspheres, liposomes, micelles, reverse micelles, lipid cochlates, and lipid microtubules. Such compositions may further comprise Cas proteins, such as Cas9 protein, or nucleic acids encoding Cas proteins.

[0172] (3) Guide RNA target sequence The target DNA of the guide RNA includes nucleic acid sequences present on the DNA to which the DNA-targeting segment of the gRNA binds, provided that sufficient binding conditions are present. Suitable DNA / RNA binding conditions include physiological conditions normally present in cells. Other suitable DNA / RNA binding conditions (e.g., conditions in cell-free systems) are known in the art (see, for example, Molecular Cloning: A Laboratory Manual, 3rd edition (Sambrook et al., Harbor Laboratory Press 2001), which is incorporated herein by reference in its entirety for all purposes). A strand of target DNA that is complementary to and hybridizes with the gRNA may be called the “complementary strand,” and a strand of target DNA that is complementary to the “complementary strand” (and therefore not complementary to the Cas protein or gRNA) may be called the “non-complementary strand” or “template strand.”

[0173] The target DNA includes both the sequence on the complementary strand into which the guide RNA hybridizes and the corresponding sequence on the non-complementary strand (e.g., adjacent to the protospacer fringe motif (PAM)). The term “guide RNA target sequence,” as used herein, specifically refers to the sequence on the non-complementary strand that corresponds to (i.e., its reverse complement) the sequence into which the guide RNA hybridizes on the complementary strand. That is, the guide RNA target sequence refers to the sequence on the non-complementary strand adjacent to the PAM (e.g., upstream or 5' of the PAM in the case of Cas9). The guide RNA target sequence is equivalent to the DNA targeting segment of the guide RNA, but contains thymine instead of uracil. For example, the guide RNA target sequence for the SpCas9 enzyme may refer to the sequence upstream of the 5'-NGG-3'PAM on the non-complementary strand. Guide RNA is designed to be complementary to the complementary strand of target DNA, and hybridization between the DNA-targeting segment of the guide RNA and the complementary strand of target DNA promotes the formation of the CRISPR complex. Perfect complementarity is not necessarily required, as long as there is sufficient complementarity to induce hybridization and promote the formation of the CRISPR complex. When a guide RNA is referred to herein as targeting a guide RNA target sequence, it means that the guide RNA hybridizes to the complementary strand sequence of target DNA, which is the reverse complement of the guide RNA target sequence on the non-complementary strand.

[0174] The target DNA or guide RNA target sequence may contain any polynucleotide and may be located, for example, in the nucleus or cytoplasm of a cell, or in a cellular organelle such as a mitochondria or chloroplast. The target DNA or guide RNA target sequence may be any nucleic acid sequence that is endogenous or exogenous to the cell. The guide RNA target sequence may be a sequence that codes for a gene product (e.g., a protein) or a non-coding sequence (e.g., a regulatory sequence), or may include both.

[0175] Target genes may include genes expressed in specific organs or tissues, such as the liver. Target genes may also include disease-related genes. A disease-related gene is any gene that produces a transcription or translation product at an abnormal level or in an abnormal form in cells derived from disease-affected tissue compared to non-disease control tissue or cells. It may be a gene that becomes expressed at an abnormally high level, where the altered expression correlates with the onset and / or progression of the disease. A disease-related gene also refers to a gene that possesses a mutation or genetic variation that is involved in the pathogenesis of a disease. The transcription or translation product may be known or unknown, and may be at normal or abnormal levels. A target gene may also be a gene involved in pathways associated with a disease or condition, or a gene that, when overexpressed, can model such a disease or condition. A target gene may also be a gene that is expressed or overexpressed in one or more types of cancer. See, for example, Santarius et al. (2010) Nat. Rev. Cancer 10(1):59-64, which is incorporated herein by reference in its entirety for all purposes.

[0176] Site-specific binding and cleavage of target DNA by the Cas protein can occur at a location determined by both (i) base pair complementarity between the guide RNA and the complementary strand of the target DNA, and (ii) a short motif called a protospacer adjacency motif (PAM) on the non-complementary strand of the target DNA. The PAM can be adjacency to the guide RNA target sequence. Optionally, the guide RNA target sequence may have a PAM adjacency at its 3' end (e.g., Cas9). Alternatively, the guide RNA target sequence may have a PAM adjacency at its 5' end (e.g., Cpf1). For example, the cleavage site of the Cas protein may be approximately 1 to 10 or 2 to 5 base pairs (e.g., 3 base pairs) upstream or downstream of the PAM sequence (e.g., within the guide RNA target sequence). In the case of SpCas9, the PAM sequence (i.e., on the non-complementary strand) can be 5'-N1GG-3', where N1 is any DNA nucleotide and PAM is immediately adjacent to the 3' end of the guide RNA target sequence on the non-complementary strand of the target DNA. Therefore, the sequence corresponding to PAM on the complementary strand (i.e., the reverse complement) is 5'-CCN2-3', where N2 is any DNA nucleotide and is immediately adjacent to the 5' end of the sequence where the DNA targeting segment of the guide RNA hybridizes on the complementary strand of the target DNA. In some such cases, N1 and N2 can be complementary, and the N1-N2 base pair can be any base pair (e.g., N1=C and N2=G, N1=G and N2=C, N1=A and N2=T, or N1=T and N2=A). For Cas9 from S. aureus, PAM can be NNGRRT or NNGRR, where N can be A, G, C, or T, and R can be G or A. For Cas9 from C. jejuni, PAM can be, for example, NNNNACAC or NNNNRYAC, where N can be A, G, C, or T, and R can be G or A. In some cases (for example, in the case of FnCpf1), the PAM sequence may be upstream of the 5' end and may have the sequence 5'-TTN-3'. In the case of DpbCasX, PAM may have the sequence 5'-TTCN-3'. In the case of CasΦ, PAM may have the sequence 5'-TBN-3', where B is G, T, or C.

[0177] An example of a guide RNA target sequence is the 20-nucleotide DNA sequence immediately preceding the NGG motif recognized by the SpCas9 protein. For example, two examples of guide RNA target sequences and PAMs are GN 19 NGG or N 20 This is NGG. For example, see International Publication No. WO2014 / 165825, which is incorporated herein by reference in its entirety for all purposes. Guanine at the 5' end can facilitate transcription by intracellular RNA polymerase. Other examples of guide RNA target sequences and PAMs include two guanine nucleotides at the 5' end (e.g., GGN) to promote efficient transcription by T7 polymerase in vitro. 20 This may include NGG. For example, see International Publication No. WO2014 / 065596, which is incorporated herein by reference in its entirety for all purposes. Other guide RNA target sequences and PAMs may have a length of 4 to 22 nucleotides of the above sequences, including 5'G or GG and 3'GG or NGG. Further other guide RNA target sequences and PAMs may have a length of 14 to 20 nucleotides of the above sequences.

[0178] The formation of a CRISPR complex hybridized to target DNA can result in a cleavage of one or both strands of target DNA within or near a region corresponding to the guide RNA target sequence (i.e., the guide RNA target sequence on the non-complementary strand of target DNA and its reverse complement on the complementary strand into which the guide RNA hybridizes). For example, the cleavage site may be within the guide RNA target sequence (e.g., at a position defined relative to the PAM sequence). The “cleavage site” includes the location on the target DNA where the Cas protein generates a single-strand or double-strand break. The cleavage site may be on a single strand only (e.g., when nickase is used) or on both strands of double-stranded DNA. The cleavage site may be at the same location on both strands (generating a blunt end, e.g., Cas9), or at different locations on each strand (sticky end (i.e., generating an overhang), e.g., Cpf1). Sticky ends can be generated, for example, by using two Cas proteins, each generating a single-strand break at a different cleavage site on a different strand, thereby generating a double-strand break. For example, a first nickase can create a single-strand break on the first strand of double-stranded DNA (dsDNA), and a second nickase can create a single-strand break on the second strand of dsDNA such that an overhang sequence is created. In some cases, the guide RNA target sequence or cleavage site of the nickase on the first strand is separated from the guide RNA target sequence or cleavage site of the nickase on the second strand by at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 15, at least 20, at least 25, at least 30, at least 40, at least 50, at least 75, at least 100, at least 250, at least 500, or at least 1,000 base pairs.

[0179] B.CtBP-interacting protein (CtIP) fusion protein The compositions or combinations and corresponding methods disclosed herein utilize a CtIP protein, which may be part of a fusion protein capable of binding to a guide RNA disclosed elsewhere herein. The fusion proteins disclosed herein are useful in the methods described herein to bring CtIP near a cleaved target genomic locus to facilitate homologous recombination repair. The nucleic acid encoding the fusion protein can be incorporated into the genome of a cell or animal (e.g., a cell or animal containing a fusion protein expression cassette integrated into the genome), or the fusion protein or nucleic acid can be introduced into such cells and animals using methods disclosed elsewhere herein (e.g., LNP-mediated delivery or AAV-mediated delivery).

[0180] Such a fusion comprises (a) an adapter (i.e., an adapter domain or adapter protein) that specifically binds to an adapter-binding element in the guide RNA, and (b) a CtIP protein. For example, the fusion protein may comprise (a) an MS2 coat protein adapter that specifically binds to one or more MS2 aptamers of the guide RNA (e.g., two MS2 aptamers at separate locations on the guide RNA), and (b) a CtIP protein.

[0181] CtIP can be fused directly to the adapter. Alternatively, CtIP can be linked to the adapter via a linker or a combination of linkers, or via one or more additional domains. Linkers that can be used in these fusion proteins may include any sequence that does not interfere with the function of the fusion protein. Exemplary linkers are short (e.g., 2-20 amino acids) and typically flexible (e.g., including highly flexible amino acids such as glycine, alanine, and serine). Some specific examples of linkers include one or more units consisting of GGGS (SEQ ID NO: 28) or GGGGS (SEQ ID NO: 29), for example, two, three, four, or more repeats of GGGS (SEQ ID NO: 28) or GGGGS (SEQ ID NO: 29) in any combination. Other linker sequences may also be used.

[0182] CtIP and the adapter can be in any order within the fusion protein. One option is that CtIP may be at the C-terminus of the adapter, and the adapter may be at the N-terminus of CtIP. For example, CtIP may be at the C-terminus of the fusion protein, and the adapter may be at the N-terminus of the fusion protein. However, CtIP may not be at the C-terminus of the fusion protein, but at the C-terminus of the adapter (for example, if the nuclear localization signal is at the C-terminus of the fusion protein). Similarly, the adapter may not be at the N-terminus of the fusion protein, but at the N-terminus of CtIP (for example, if the nuclear localization signal is at the N-terminus of the fusion protein). Another option is that CtIP may be at the N-terminus of the adapter, and the adapter may be at the C-terminus of CtIP. For example, CtIP may be at the N-terminus of the fusion protein, and the adapter may be at the C-terminus of the fusion protein.

[0183] The fusion proteins described herein may also be operably linked or fused to additional heterologous polypeptides. The fused or linked heterologous polypeptides may be located at the N-terminus, C-terminus, or any other location within the fusion protein. For example, the CtIP protein may further contain a nuclear localization signal. A specific example of such a protein includes an MS2 coat protein (adapter) linked (directly or via NLS) to a CtIP protein at the C-terminal end of the MS2 coat protein (MCP). Such a protein may contain, from N-terminus to C-terminus, the MCP; nuclear localization signal, and the CtIP protein. In one example, the fusion protein may contain an amino acid sequence that is at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the fusion protein sequence described in SEQ ID NO: 30. In another example, the fusion protein may consist of an amino acid sequence that is at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the fusion protein sequence described in Sequence ID No. 30. For example, the fusion protein may be encoded by a nucleic acid containing a sequence that is at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the sequence described in SEQ ID NO: 31.In another example, the fusion protein may be encoded by a nucleic acid consisting of a sequence that is at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the sequence described in SEQ ID NO: 31.

[0184] In one example, the fusion protein contains the sequence described in SEQ ID NO: 30. In another example, the fusion protein essentially consists of the sequence described in SEQ ID NO: 30. In yet another example, the fusion protein consists of the sequence described in SEQ ID NO: 30. In one example, the nucleic acid encoding the fusion protein contains the sequence described in SEQ ID NO: 31. In yet another example, the nucleic acid encoding the fusion protein essentially consists of the sequence described in SEQ ID NO: 31. In yet another example, the nucleic acid encoding the fusion protein consists of the sequence described in SEQ ID NO: 31.

[0185] Fusion proteins can also be fused to or linked to one or more heterologous polypeptides that provide intracellular localization. Such heterologous polypeptides may include, for example, one or more nuclear localization signals (NLS), such as SV40 NLS and / or alpha-importin NLS for targeting the nucleus, a mitochondrial localization signal for targeting mitochondria, an ER retention signal, and the like. See, for example, Lange et al. (2007) J. Biol. Chem. 282:5101-5105, which is incorporated herein by reference in its entirety for all purposes. An NLS may, for example, consist of a sequence of basic amino acids and may be a mono-segmental or bi-segmental sequence. Optionally, a fusion protein may contain two or more NLSs, including an NLS (e.g., alpha-importin NLS) at the N-terminus and / or an NLS (e.g., SV40 NLS) at the C-terminus.

[0186] The fusion protein may also be operably linked to a cell permeability domain or a protein transduction domain. For example, the cell permeability domain may be derived from the HIV-1 TAT protein, the TLM cell permeability motif from human hepatitis B virus, MPG, Pep-1, VP22, a cell permeability peptide from herpes simplex virus, or a polyarginine peptide sequence. See, for example, International Publication WO2014 / 089290 and International Publication WO2013 / 176772, respectively, which are incorporated herein by reference in their entirety for any purpose. As another example, the fusion protein may be fused to or linked to a heterologous polypeptide to provide increased or decreased stability.

[0187] Fusion proteins can also be operably linked to heterologous polypeptides such as fluorescent proteins, purification tags, or epitope tags to facilitate tracking or purification. Examples of fluorescent proteins include green fluorescent proteins (e.g., GFP, GFP-2, tagGFP, turboGFP, eGFP, Emerald, Azami Green, Monomeric Azami). Green, CopGFP, AceGFP, ZsGreenl), yellow fluorescent proteins (e.g., YFP, eYFP, Citrine, Venus, YPet, PhiYFP, ZsYellowl), blue fluorescent proteins (e.g., eBFP, eBFP2, Azurite, mKalamal, GFPuv, Sapphire, T-sapphire), cyan fluorescent proteins (e.g., eCFP, Cerulean, CyPet, AmCyanl, Midoriishi-Cyan), red fluorescent proteins (e.g., mKate, mKate2, mPlum, DsRed monomer, mCherry, mRFP1, DsRed-Express, DsRed2, DsRed-Monomer, HcRed-Tandem, HcRedl, AsRed2, eqFP611, mRaspberry, mStrawberry, Jred), orange fluorescent proteins (e.g., mOrange, mKO, Kusabira-Orange, Monomeric) This includes Kusabira-Orange, mTangerine, tdTomato, and any other suitable fluorescent proteins.Examples of tags include glutathione-S-transferase (GST), chitin-binding protein (CBP), maltose-binding protein, thioredoxin (TRX), poly (NANP), tandemaffinity purification (TAP) tag, myc, AcV5, AU1, AU5, E, ECS, E2, FLAG, hemagglutinin (HA), nus, Softag 1, Softag 3, Strep, SBP, Glu-Glu, HSV, KT3, S, S1, T7, V5, VSV-G, histidine (His), biotin carboxyl carrier protein (BCCP), and calmodulin.

[0188] Fusion proteins can also be tethered to labeled nucleic acids. Such tethering (i.e., physical linking) can be achieved via covalent or non-covalent interactions, and the tethering can be achieved directly (e.g., via direct fusion or chemical linking, which can be achieved by modification of cysteine ​​or lysine residues on the protein or intein modification) or via one or more intervening linker or adapter molecules such as streptavidin or aptamers. See, for example, Pierce et al. (2005) Mini Rev. Med. Chem. 5(1):41-55, Duckworth et al. (2007) Angew. Chem. Int. Ed. Engl. 46(46):8819-8822, Schaeffer and Dixon (2009) Australian J. Chem. 62(10):1328-1332, Goodman et al. (2009) Chembiochem. 10(9):1551-1557, and Khatwani et al. (2012) Bioorg. Med. Chem. 20(14):4532-4539, each of which is incorporated herein by reference in its entirety for all purposes. Non-coordinate strategies for synthesizing protein-nucleic acid conjugates include the biotin-streptavidin and nickel-histidine methods. Covalent protein-nucleic acid conjugates can be synthesized by linking appropriately functionalized nucleic acids with proteins using a variety of chemicals. Some of these chemicals involve the direct binding of oligonucleotides to amino acid residues on the protein surface (e.g., lysineamine or cysteine ​​thiol), while other, more complex schemes require post-translational modification of the protein or the involvement of catalytic or reactive protein domains. Methods for covalently binding proteins to nucleic acids may include, for example, chemical crosslinking of oligonucleotides to protein lysine or cysteine ​​residues, expressed protein ligation, chemoenzymatic methods, and the use of photoaptamers. Labeled nucleic acids can be tethered to the C-terminus, N-terminus, or internal region of the fusion protein. Similarly, fusion proteins can be tethered to the 5' end, 3' end, or internal region of the labeled nucleic acid.In other words, labeled nucleic acids can be tethered in any orientation and polarity.

[0189] (1) Adapter protein or adapter domain An adapter (i.e., an adapter domain or adapter protein) is a nucleic acid-binding domain (e.g., a DNA-binding domain and / or RNA-binding domain) that specifically recognizes and binds to a distinct sequence (e.g., a distinct DNA and / or RNA sequence, such as an aptamer, in a sequence-specific manner). Aptamers contain nucleic acids that can bind to target molecules with high affinity and specificity through their ability to adopt specific three-dimensional conformations. Such adapters can bind to specific RNA sequences and secondary structures, for example. These sequences (i.e., adapter-binding elements) can be engineered into guide RNA. For example, the MS2 aptamer can be engineered into guide RNA to specifically bind to the MS2 coat protein (MCP). In one example, the adapter may contain an amino acid sequence that is at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the MCP sequence described in Sequence ID No. 32. In another example, the adapter may essentially consist of an amino acid sequence that is at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the MCP sequence described in Sequence ID No. 32. For example, the adapter may be encoded by a nucleic acid containing a sequence that is at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the sequence described in Sequence ID No. 33.In another example, the adapter may be encoded by a nucleic acid consisting of a sequence that is at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the sequence described in Sequence ID No. 33.

[0190] In one example, the adapter contains the sequence described in SEQ ID NO: 32. In another example, the adapter is essentially derived from the sequence described in SEQ ID NO: 32. In yet another example, the adapter consists of the sequence described in SEQ ID NO: 32. In one example, the nucleic acid encoding the adapter contains the sequence described in SEQ ID NO: 33. In yet another example, the nucleic acid encoding the adapter is essentially derived from the sequence described in SEQ ID NO: 33. In yet another example, the nucleic acid encoding the adapter consists of the sequence described in SEQ ID NO: 33.

[0191] Some specific examples of adapters and targets include RNA-binding protein / aptamer combinations present in the diversity of bacteriophage coat proteins. For example, adapter proteins or functional fragments or variants thereof of MS2 coat protein (MCP), PP7, Qβ, F2, GA, fr, JP501, M12, R17, BZ13, JP34, JP500, KU1, M1l, MX1, TW18, VK, SP, FI, ID2, NL95, TW19, AP205, φCb5, ΦCb8r, ΦCb12r, ΦCb23r, 7s, and PRR1 can be used. See, for example, International Publication No. WO2016 / 049258, which is incorporated herein by reference in its entirety for all purposes. Functional fragments or functional variants of adapter proteins retain the ability to bind to specific adapter-binding elements (e.g., the ability to bind to specific adapter-binding sequences in a sequence-specific manner). For example, a PP7 Pseudomonas bacteriophage coat protein mutant can be used, in which amino acids 68-69 are mutated to SG and amino acids 70-75 are deleted from the wild-type protein. See, for example, Wu et al. (2012) Biophys. J. 102(12):2936-2944 and Chao et al. (2007) Nat. Struct. Mol. Biol. 15(1):103-105, each of which is incorporated herein by reference in its entirety for all purposes. Similarly, MCP mutants such as the N55K mutant can also be used. See, for example, Spingola and Peabody (1994) J. Biol. Chem. 269(12):9006-9010, which is incorporated herein by reference in its entirety for all purposes.

[0192] Other examples of adapter proteins that can be used include the endribonuclease Csy4 or lambda N protein, in whole or in part (e.g., in DNA-bound form). See, for example, U.S. Publication 2016 / 0312198, the whole of which is incorporated herein by reference for all purposes.

[0193] (2) CtIP The compositions or combinations and corresponding methods disclosed herein utilize the CtIP protein. For example, the CtIP protein used in the methods, compositions, and combinations disclosed herein is the human CtIP protein. The human C-terminal binding protein (CtBP) interacting protein (CtIP) (also known as DNA endonuclease RBBP8, RBBP8, retinoblastoma-binding protein 8, RBBP-8, retinoblastoma-interacting protein, and myosin-like, RIM, spore formation in the absence of SPO11 protein 2 homolog, SAE2) is encoded by the gene CTIP (also known as RBBP8), which is assigned UniProt reference number Q99807 and NCBI gene ID 5932. The gene is located at position 18q11.2 on chromosome 18 (assembly: GRCh38.p14 (GCF_000001405.40), position: NC_000018.10 (22914139..23026486)). The canonical isoform of human CtIP (UniProt reference number Q99708-1, NCBI reference number NP_002885.1) is described in SEQ ID NO: 37. The mRNA encoding the canonical isoform is assigned NCBI reference number NM_002894.3 (SEQ ID NO: 38). The coding sequence of the canonical isoform is assigned CCDS number CCDS11875.1 (SEQ ID NO: 39). Another isoform of human CtIP (NCBI reference number AAC14371.1) is described in SEQ ID NO: 34. The mRNA encoding the canonical isoform has been assigned NCBI reference number U72066.1 (SEQ ID NO: 35). The coding sequence for the canonical isoform is described in SEQ ID NO: 36. CtIP is an endonuclease that cooperates with the MRE11-RAD50-NBN (MRN) complex in DNA end excision, the first step in double-strand break repair via the homologous recombination pathway.

[0194] In one example, the CtIP protein used in the methods, compositions, and combinations disclosed herein comprises a sequence that is at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% identical to SEQ ID NO: 34. In another example, the CtIP protein used in the methods, compositions, and combinations disclosed herein consists essentially of a sequence that is at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% identical to SEQ ID NO: 34. In another example, the CtIP protein used in the methods, compositions, and combinations disclosed herein consists of a sequence that is at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% identical to SEQ ID NO: 34. In another example, the CtIP protein used in the methods, compositions, and combinations disclosed herein comprises the sequence described in SEQ ID NO: 34. In another example, the CtIP protein used in the methods, compositions, and combinations disclosed herein is essentially derived from the sequence described in SEQ ID NO: 34. In another example, the CtIP protein used in the methods, compositions, and combinations disclosed herein consists of the sequence described in SEQ ID NO: 34.

[0195] In one example, the CtIP protein is encoded by a nucleic acid containing a sequence that is at least approximately 90%, at least approximately 91%, at least approximately 92%, at least approximately 93%, at least approximately 94%, at least approximately 95%, at least approximately 96%, at least approximately 97%, at least approximately 98%, at least approximately 99%, or approximately 100% identical to SEQ ID NO: 36. In another example, the CtIP protein is encoded by a nucleic acid consisting essentially of a sequence that is at least approximately 90%, at least approximately 91%, at least approximately 92%, at least approximately 93%, at least approximately 94%, at least approximately 95%, at least approximately 96%, at least approximately 97%, at least approximately 98%, at least approximately 99%, or approximately 100% identical to SEQ ID NO: 36. In another example, the CtIP protein is encoded by a nucleic acid consisting of a sequence that is at least approximately 90%, at least approximately 91%, at least approximately 92%, at least approximately 93%, at least approximately 94%, at least approximately 95%, at least approximately 96%, at least approximately 97%, at least approximately 98%, at least approximately 99%, or approximately 100% identical to SEQ ID NO: 36. In yet another example, the CtIP protein is encoded by a nucleic acid containing the sequence described in SEQ ID NO: 36. In yet another example, the CtIP protein is encoded by a nucleic acid essentially consisting of the sequence described in SEQ ID NO: 36. In yet another example, the CtIP protein is encoded by a nucleic acid consisting of the sequence described in SEQ ID NO: 36.

[0196] C.53BP1 inhibitors The compositions or combinations and corresponding methods disclosed herein utilize a 53BP1 inhibitor (i53) protein. i53 is a ubiquitin variant that blocks the accumulation of 53BP1 at DNA damage sites. i53 binds to and occludes the ligand-binding site of the tudor domain of 53BP1, thereby blocking its ability to accumulate at DNA damage sites.

[0197] In one example, the i53 protein used in the methods, compositions, and combinations disclosed herein comprises a sequence that is at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% identical to SEQ ID NO: 40 or 42 (e.g., 40). In another example, the i53 protein used in the methods, compositions, and combinations disclosed herein essentially consists of a sequence that is at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% identical to SEQ ID NO: 40 or 42 (e.g., 40). In another example, the i53 protein used in the methods, compositions, and combinations disclosed herein consists of a sequence that is at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% identical to SEQ ID NO: 40 or 42 (e.g., 40). In another example, the i53 protein used in the methods, compositions, and combinations disclosed herein comprises the sequence described in SEQ ID NO: 40 or 42 (e.g., 40). In another example, the i53 protein used in the methods, compositions, and combinations disclosed herein essentially consists of the sequence described in SEQ ID NO: 40 or 42 (e.g., 40). In another example, the i53 protein used in the methods, compositions, and combinations disclosed herein consists of the sequence described in SEQ ID NO: 40 or 42 (e.g., 40).

[0198] In one example, the i53 protein is encoded by a nucleic acid containing a sequence that is at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% identical to SEQ ID NO: 41 or 43 (e.g., 41). In another example, the i53 protein is encoded by a nucleic acid consisting of a sequence that is at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% identical to SEQ ID NO: 41 or 43 (e.g., 41). In another example, the i53 protein is encoded by a nucleic acid consisting of a sequence that is at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% identical to SEQ ID NO: 41 or 43 (e.g., 41). In another example, the i53 protein is encoded by a nucleic acid containing the sequence described in SEQ ID NO: 41 or 43 (e.g., 41). In another example, the i53 protein used in the methods, compositions, and combinations disclosed herein essentially consists of the sequence described in SEQ ID NO: 41 or 43 (e.g., 41). In another example, the i53 protein is encoded by a nucleic acid consisting of the sequence described in SEQ ID NO: 41 or 43 (e.g., 41).

[0199] D. Exogenous donor nucleic acids The methods and compositions disclosed herein utilize exogenous donor nucleic acids to modify target genomic loci after cleavage by Cas proteins. In such methods, the Cas protein cleaves the target genomic locus (e.g., to create a double-strand break), and the exogenous donor nucleic acid recombinates the target nucleic acid via a homologous recombination repair event. Optionally, the repair by the exogenous donor nucleic acid removes or disrupts the guide RNA target sequence or Cas cleavage site so that the targeted allele cannot be retargeted by the Cas protein. In some cases, the exogenous repair template is adjacent to the guide RNA target sequence that is cleaved by the Cas protein in the cell.

[0200] Exogenous donor nucleic acids can include deoxyribonucleic acid (DNA) or ribonucleic acid (RNA), which may be single-stranded or double-stranded, and may be linear or circular in form. For example, an exogenous donor nucleic acid may be a single-stranded oligodeoxynucleotide (ssODN). See, for example, Yoshimi et al. (2016) Nat.Commun. 7:10431. Exemplary exogenous donor nucleic acids are approximately 50 nucleotides to 5 kb in length, approximately 50 nucleotides to 3 kb in length, or approximately 50 to 1,000 nucleotides in length. Other exemplary exogenous donor nucleic acids are approximately 40 to 200 nucleotides in length. For example, exogenous donor nucleic acids may be approximately 50-60, 60-70, 70-80, 80-90, 90-100, 100-110, 110-120, 120-130, 130-140, 140-150, 150-160, 160-170, 170-180, 180-190, or 190-200 nucleotides in length. Alternatively, exogenous donor nucleic acids may be approximately 50-100, 100-200, 200-300, 300-400, 400-500, 500-600, 600-700, 700-800, 800-900, or 900-1000 nucleotides in length. Alternatively, exogenous donor nucleic acids may be approximately 1–1.5, 1.5–2, 2–2.5, 2.5–3, 3–3.5, 3.5–4, 4–4.5, or 4.5–5 kb in length. Alternatively, exogenous donor nucleic acids may be, for example, 5 kb, 4.5 kb, 4 kb, 3.5 kb, 3 kb, 2.5 kb, 2 kb, 1.5 kb, 1 kb, 900 nucleotides, 800 nucleotides, 700 nucleotides, 600 nucleotides, 500 nucleotides, 400 nucleotides, 300 nucleotides, 200 nucleotides, 100 nucleotides, or less than 50 nucleotides in length. Exogenous donor nucleic acids (e.g., targeting vectors) may also be longer.

[0201] In one example, the exogenous donor nucleic acid is an ssODN with a length of approximately 80 to 200 nucleotides. In another example, the exogenous donor nucleic acid is an ssODN with a length of approximately 80 to 3 kb. Such an ssODN may also have homology arms that are, for example, approximately 40 to 60 nucleotides in length. Such an ssODN may also have homology arms that are, for example, approximately 30 to 100 nucleotides in length. The homology arms may be symmetrical (e.g., 40 nucleotides each or 60 nucleotides each), or they may be asymmetrical (e.g., one homology arm that is 36 nucleotides long and one homology arm that is 91 nucleotides long).

[0202] Exogenous donor nucleic acids may include modifiers or sequences that provide additional desirable features (e.g., modified or regulated stability, tracking or detection using fluorescent labeling, or binding sites for proteins or protein complexes). Exogenous donor nucleic acids may include one or more fluorescent labels, purification tags, epitope tags, or combinations thereof. For example, exogenous donor nucleic acids may include one or more fluorescent labels (e.g., fluorescent proteins or other fluorophores or dyes), such as at least one, at least two, at least three, at least four, or at least five fluorescent labels. Exemplary fluorescent labels include fluorescein (e.g., 6-carboxyfluorescein (6-FAM)), Texas Red, HEX, Cy3, Cy5, Cy5.5, Pacific Blue, 5-(and-6)-carboxytetramethylrhodamine (TAMRA), and fluorophores such as Cy7. A wide range of fluorescent dyes for labeling oligonucleotides are commercially available (e.g., from Integrated DNA Technologies). Such fluorescent labels (e.g., internal fluorescent labels) can be used, for example, to detect exogenous donor nucleic acids directly incorporated into a cleaved target nucleic acid having a protruding end compatible with the end of the exogenous donor nucleic acid. The label or tag may be located at the 5' end, 3' end, or internally within the exogenous donor nucleic acid. For example, an exogenous donor nucleic acid can be conjugated to the 5' end having an IR700 fluorophore (5'IRDYE® 700) from Integrated DNA Technologies.

[0203] The exogenous donor nucleic acids disclosed herein include homology arms. If the exogenous donor nucleic acid also includes a nucleic acid insert, the homology arms may be adjacent to the nucleic acid insert. For ease of reference, the homology arms are referred to herein as 5' and 3' (i.e., upstream and downstream) homology arms. This term relates to the relative position of the homology arms to the nucleic acid insert within the exogenous donor nucleic acid. The 5' and 3' homology arms correspond to regions within the target genomic locus, which are referred herein as the “5' target sequence” and the “3' target sequence,” respectively.

[0204] Homology arms and target sequences are “corresponding” or “corresponding” to each other if the two regions share a sufficient level of sequence identity to act as substrates for homologous recombination. The term “homology” includes DNA sequences that are identical to or share sequence identity with a corresponding sequence. The sequence identity between a given target sequence and the corresponding homology arm found in an exogenous donor nucleic acid may be any degree of sequence identity that allows homologous recombination to occur. Furthermore, the corresponding homology region between the homology arm and the corresponding target sequence may be of any length sufficient to facilitate homologous recombination. Exemplary homology arms are approximately 25 nucleotides to 2.5 kb in length, approximately 25 nucleotides to 1.5 kb in length, or approximately 25 to 500 nucleotides in length. For example, a given homology arm (or each homology arm) and / or the corresponding target sequence may contain a corresponding homology region having a length of approximately 25-30, 30-40, 40-50, 50-60, 60-70, 70-80, 80-90, 90-100, 100-150, 150-200, 200-250, 250-300, 300-350, 350-400, 400-450, or 450-500 nucleotides, thereby having sufficient homology for the homology arm to undergo homologous recombination with the corresponding target sequence in the target nucleic acid. Alternatively, a given homology arm (or each homology arm) and / or corresponding target sequence may contain corresponding homology regions of approximately 0.5kb–1kb, 1kb–1.5kb, 1.5kb–2kb, or 2kb–2.5kb in length. For example, each homology arm may be approximately 750 nucleotides in length. The homology arms may be symmetrical (each approximately the same length) or asymmetrical (one longer than the other).

[0205] When using the CRISPR / Cas system in combination with exogenous donor nucleic acids, the 5' and 3' target sequences are optionally positioned sufficiently close to the Cas cleavage site (e.g., sufficiently close to the guide RNA target sequence) to facilitate the occurrence of homologous recombination events between the target sequence and the homology arm during single-strand breaks (nicks) or double-strand breaks at the Cas cleavage site. The term "Cas cleavage site" includes the DNA sequence on which nicks or double-strand breaks are produced by the Cas enzyme (e.g., the Cas9 protein in complex with guide RNA). Target sequences within the targeting locus corresponding to the 5' and 3' homology arms of the exogenous donor nucleic acid are "sufficiently positioned close" to the Cas cleavage site if the distance is such that it facilitates the occurrence of homologous recombination events between the 5' and 3' target sequences and the homology arm during single-strand or double-strand breaks at the Cas cleavage site. Therefore, the target sequences corresponding to the 5' and / or 3' homology arms of the exogenous donor nucleic acid may, for example, be within at least one nucleotide of a given Cas cleavage site, or within at least 10 to about 1,000 nucleotides of a given Cas cleavage site. As an example, the Cas cleavage site may be directly adjacent to at least one or both of the target sequences.

[0206] The spatial relationship between the homology arms of the exogenous donor nucleic acid and the target sequence corresponding to the Cas cleavage site can vary. For example, the target sequence may be located 5' of the Cas cleavage site, 3' of the Cas cleavage site, or adjacent to the Cas cleavage site.

[0207] Exogenous donor nucleic acids may also contain nucleic acid inserts that include a segment of DNA to be integrated into a target genomic locus. Integration of a nucleic acid insert at a target genomic locus may result in the addition of a desired nucleic acid sequence to the locus, deletion of a desired nucleic acid sequence at the locus, or replacement of a desired nucleic acid sequence at the locus (i.e., deletion and insertion). Some exogenous donor nucleic acids are designed for the insertion of a nucleic acid insert at a target genomic locus without a corresponding deletion at the locus. Other exogenous donor nucleic acids are designed to delete a desired nucleic acid sequence at a target genomic locus without insertion of any corresponding nucleic acid insert. Still other exogenous donor nucleic acids are designed to delete a desired nucleic acid sequence at a target genomic locus and replace it with a nucleic acid insert.

[0208] The nucleic acid insert or corresponding nucleic acid at the target genomic locus to be deleted and / or substituted may be of varying lengths. Exemplary nucleic acid inserts or corresponding nucleic acids at the target genomic locus to be deleted and / or substituted are approximately 1 nucleotide to approximately 5 kb in length, or approximately 1 nucleotide to approximately 1,000 kb in length. For example, the nucleic acid insert or corresponding nucleic acid at the target genomic locus to be deleted and / or substituted may be approximately 1-10, 10-20, 20-30, 30-40, 40-50, 50-60, 60-70, 70-80, 80-90, 90-100, 100-110, 110-120, 120-130, 130-140, 140-150, 150-160, 160-170, 170-180, 180-190, or 190-120 nucleotides in length. Similarly, the nucleic acid insert or corresponding nucleic acid at the target genomic locus to be deleted and / or substituted may be 1–100, 100–200, 200–300, 300–400, 400–500, 500–600, 600–700, 700–800, 800–900, or 900–1000 nucleotides in length. Similarly, the nucleic acid insert or corresponding nucleic acid at the target genomic locus to be deleted and / or substituted may be approximately 1–1.5, 1.5–2, 2–2.5, 2.5–3, 3–3.5, 3.5–4, 4–4.5, or 4.5–5 kb or longer in length.

[0209] A nucleic acid insert may include a sequence that is homologous or orthologous to all or part of the sequence to be substituted. For example, a nucleic acid insert may include a sequence containing one or more point mutations (e.g., 1, 2, 3, 4, 5, or more) compared to the sequence targeting the substitution at the target genomic locus. Optionally, such point mutations may result in a conserved amino acid substitution in the encoded polypeptide (e.g., a substitution of aspartic acid [Asp, D] to glutamic acid [Glu, E]).

[0210] In some cases, the exogenous donor nucleic acid may be a “large targeting vector” or “LTVEC,” which includes a targeting vector containing homology arms that correspond to and derive from nucleic acid sequences larger than those typically used in other approaches aimed at in-cellular homologous recombination. LTVECs also include targeting vectors containing nucleic acid inserts having nucleic acid sequences larger than those typically used in other approaches aimed at in-cellular homologous recombination. For example, LTVECs enable modification of large loci that cannot be addressed by conventional plasmid-based targeting vectors due to size limitations. For example, the targeted locus may be a cellular locus that cannot be targeted using conventional methods, or that can only be targeted improperly or with significantly lower efficiency in the absence of nicks or double-strand breaks induced by a nuclease agent (e.g., Cas protein) (i.e., 5' and 3' homology arms may correspond). LTVECs can be of any length, but are typically at least 10 kb long. The combined length of the 5' homology arm and 3' homology arm of an LTVEC is typically at least 10kb. In one example, the LTVEC may be approximately 50kb to 300kb in length, or the combined length of the 5' and 3' homology arms may be approximately 10kb to 200kb.

[0211] E. Vector Nucleic acids disclosed herein (e.g., DNA encoding a CtIP fusion protein, DNA encoding an i53 protein, DNA encoding a Cas protein, DNA encoding a guide RNA, exogenous donor nucleic acid, or a combination thereof such as DNA encoding an exogenous donor nucleic acid and guide RNA) may be provided in a vector. The vector may include additional sequences such as genes encoding an origin of replication, promoters, and antibiotic resistance.

[0212] Some vectors may be circular. Alternatively, vectors may be linear. Vectors may be packaged to be delivered via lipid nanoparticles, liposomes, non-lipid nanoparticles, or viral capsids. Non-limiting exemplary vectors include plasmids, phagemids, cosmids, artificial chromosomes, minichromosomes, transposons, viral vectors, and expression vectors.

[0213] The vector may be a viral vector, such as an adeno-associated virus (AAV) vector. The AAV may be any suitable serotype and may be single-stranded AAV (ssAAV) or self-complementary AAV (scAAV). Other exemplary viral vectors include retroviruses, lentiviruses, adenoviruses, vaccinia viruses, poxviruses, and herpes simplex viruses. The virus may infect dividing cells, non-dividing cells, or both. The virus may be integrated into the host genome or, alternatively, not integrated into the host genome. Such viruses may also be engineered to reduce immunodeficiency. The virus may be replicable or replication-deficient (e.g., missing one or more genes required for an additional round of virion replication and / or packaging). The virus may induce transient or longer-lasting expression. Viral vectors may be genetically modified from their wild-type counterparts. For example, a viral vector may include one or more nucleotide insertions, deletions, or substitutions to facilitate cloning or to alter one or more properties of the vector. Such properties may include packaging capacity, transduction efficiency, immunogenicity, genomic integration, replication, transcription, and translation. In some examples, a portion of the viral genome may be deleted so that the virus can package exogenous sequences of a larger size. In some examples, the viral vector may have enhanced transduction efficiency. In some examples, the immune response induced by the virus in the host may be reduced. In some examples, viral genes (such as integrases) that facilitate the integration of the viral sequence into the host genome may be mutated so that the virus becomes non-integrated. In some examples, the viral vector may be replication-deficient. In some examples, the viral vector may include exogenous transcriptional or translational regulatory sequences to drive the expression of the coding sequence on the vector. In some examples, the virus may be helper-dependent.For example, a virus may require one or more helper components to supply the viral components (such as viral proteins) necessary to amplify the vector and package it into viral particles. In such cases, one or more helper components, including one or more vectors encoding viral components, may be introduced into a host cell or population of host cells together with the vector system described herein. In other examples, a virus may be helper-free. For example, a virus can amplify and package a vector without a helper virus. In some examples, the vector system described herein may also encode viral components necessary for viral amplification and packaging.

[0214] An example of a viral titer (e.g., AAV titer) is approximately 10 12 ~about 10 16 One example is vg / mL. Another exemplary viral titer (e.g., AAV titer) is approximately 10% of body weight. 12 ~about 10 16 The value given is vg / kg.

[0215] Adeno-associated viruses (AAVs) are endemic to several species, including humans and non-human primates (NHPs). To date, at least 12 native serotypes and hundreds of native variants have been isolated and characterized. See, for example, Li et al. (2020) Nat. Rev. Genet. 21:255-272, which is incorporated herein by reference in its entirety for all purposes. AAV particles are naturally composed of a non-enveloped icosahedral protein capsid containing a single-stranded DNA (ssDNA) genome. The DNA genome contains two inverted end repeats (ITRs) that act as the origin of viral replication and packaging signals. The rep gene encodes four proteins required for viral replication and packaging, while the cap gene encodes three structural capsid subunits that define AAV serotypes, and an assembly-activating protein (AAP) that promotes virion assembly in some serotypes.

[0216] Recombinant AAV (rAAV) is currently one of the most commonly used viral vectors in gene therapy to treat human diseases by delivering therapeutic transgenes to target cells in vivo. rAAV vectors consist of an icosahedral capsid similar to natural AAV, but rAAV virions do not capsidize the AAV protein-coding sequence or AAV replication sequence. These viral vectors are non-replicating. The only viral sequences required in rAAV vectors are two ITRs, which are needed to induce genome replication and packaging during the production of rAAV vectors. The rAAV genome lacks the AAV rep and cap genes, making them non-replicating in vivo. rAAV vectors are produced by expressing the rep and cap genes in trans, along with additional viral helper proteins, in combination with an intended transgene cassette flanked by the AAV ITRs.

[0217] In the rAAV genome, gene expression cassettes can be positioned between ITR sequences. Typically, the rAAV genome cassette contains a promoter for driving transgene expression, followed by a polyadenylation sequence. The ITRs adjacent to the rAAV expression cassette are usually derived from AAV2, the first serotype isolated and converted into recombinant viral vectors. Since then, most rAAV generation methods have relied on AAV2Rep-based packaging systems. See, for example, Colella et al. (2017) Mol.Ther.Methods Clin.Dev. 8:87-104, which is incorporated herein by reference in its entirety for all purposes.

[0218] The specific serotype of a recombinant AAV vector influences its in vivo directivity to specific tissues. The AAV capsid protein mediates attachment to and entry into target cells, followed by endosomal escape and transport to the nucleus. Therefore, the selection of serotype when developing an rAAV vector influences which cell types and tissues the vector is most likely to bind to and transduce when injected in vivo. Several serotypes of rAAV, including rAAV8, can transduce into the liver when delivered systemically in mice, NHP, and humans. See, for example, Li et al. (2020) Nat. Rev. Genet. 21:255-272, which is incorporated herein by reference in its entirety for all purposes.

[0219] Upon entering the nucleus, the ssDNA genome is released from the virion, and a complementary DNA strand is synthesized to produce a double-stranded DNA (dsDNA) molecule. The double-stranded AAV genome spontaneously circularizes via their ITRs, becoming an episome that persists outside the chromosome within the nucleus. Therefore, for episomal gene therapy programs, rAAV-delivered rAAV episomes provide long-term promoter-driven gene expression in non-dividing cells. However, this rAAV-delivered episomal DNA is diluted as the cell divides. In contrast, the gene therapies described herein are based on gene insertions that enable long-term gene expression.

[0220] The ssDNA AAV genome consists of two open reading frames, Rep and Cap, with two inverted terminal repeats adjacent to each other, enabling the synthesis of complementary DNA strands. When constructing an AAV transfer plasmid, the transgene is placed between the two ITRs, and Rep and Cap can be supplied in trans. In addition to Rep and Cap, AAV may require a helper plasmid containing genes from adenovirus. These genes (E4, E2a, and VA) mediate AAV replication. For example, the transfer plasmid, Rep / Cap, and helper plasmid can be transfected into HEK293 cells containing the adenovirus gene E1+ to generate infectious AAV particles. Alternatively, Rep, Cap, and the adenovirus helper gene may be combined into a single plasmid. Similar packaging cells and methods can be used for other viruses, such as retroviruses.

[0221] Multiple serotypes of AAV have been identified. These serotypes differ in the types of cells they infect (i.e., their targeting), allowing for preferential transduction of specific cell types. The term AAV includes, for example, AAV1, AAV2, AAV3, AAV3B, AAV4, AAV5, AAV6, AAV6.2, AAV7, AAVrh.64R1, AAVhu.37, AAVrh.8, AAVrh.32.33, AAV8, AAV9, AAV-DJ, AAV2 / 8, AAVrh10, AAVLK03, AV10, AAV11, AAV12, rh10, and their hybrids, avian AAV, bovine AAV, canine AAV, equine AAV, primate AAV, non-primate AAV, and sheep AAV. The genomic sequences of various serotypes of AAV, as well as the sequences of native terminal repeats (TRs), Rep proteins, and capsid subunits, are known in the art. Such sequences can be found in the literature or in publicly available databases such as GenBank. As used herein, "AAV vector" refers to an AAV vector containing heterologous sequences that are not of AAV origin (i.e., nucleic acid sequences heterologous to AAV), and typically contains sequences encoding the heterologous polypeptide of interest. The constructs may include AAV1, AAV2, AAV3, AAV3B, AAV4, AAV5, AAV6, AAV6.2, AAV7, AAVrh.64R1, AAVhu.37, AAVrh.8, AAVrh.32.33, AAV8, AAV9, AAV-DJ, AAV2 / 8, AAVrh10, AAVLK03, AV10, AAV11, AAV12, rh10, and their hybrids, avian AAV, bovine AAV, canine AAV, equine AAV, primate AAV, non-primate AAV, and sheep AAV capsid sequences. Generally, heterologous nucleic acid sequences (transgenes) are adjacent to at least one, and generally two, AAV inverted terminal repeat sequences (ITRs). AAV vectors can be either single-stranded (ssAAV) or self-complementary (scAAV). Examples of liver tissue serotypes include AAV3B, AAV5, AAV6, AAV7, AAV8, AAV9, AAVrh.74, AAV-DJ, and AAVhu.37, with AAV8 being particularly important. In certain cases, the AAV vector may be recombinant AAV8 (rAAV8).The rAAV8 vectors described herein are vectors whose capsid is derived from AAV8. For example, an AAV vector using an ITR derived from AAV2 and an AAV8 capsid is considered an rAAV8 vector in this specification. In another specific example, the AAV vector may be recombinant AAV2 (rAAV2).

[0222] Directionality can be further refined by pseudotyping, which is a mixture of capsids and genomes from different viral serotypes. For example, AAV2 / 5 represents a virus containing a serotype 2 genome packaged in a serotype 5 capsid. The use of pseudotyped viruses can not only improve transduction efficiency but also alter directionality. Hybrid capsids derived from different serotypes can also be used to alter the directionality of the virus. For example, AAV-DJ contains a hybrid capsid from eight serotypes and exhibits high infectivity across a wide range of cell types in vivo. AAV-DJ8 is another example that exhibits the characteristics of AAV-DJ but with enhanced uptake into the brain. AAV serotypes can also be modified by mutation. Examples of mutational modifications of AAV2 include Y444F, Y500F, Y730F, and S662V. Examples of mutational modifications of AAV3 include Y705F, Y731F, and T492V. Examples of AAV6 mutations include S663V and T492V. Other pseudotypes / modified AAV variants include AAV2 / 1, AAV2 / 6, AAV2 / 7, AAV2 / 8, AAV2 / 9, AAV2.5, AAV8.2, and AAV / SASTG.

[0223] To accelerate the expression of a transgene, self-complementary AAV (scAAV) variants can be used. Because AAV relies on the cell's DNA replication mechanism to synthesize the complementary strand of its single-stranded DNA genome, transgene expression may be delayed. To address this delay, scAAVs containing complementary sequences that can spontaneously anneal upon infection can be used, eliminating the need for host cell DNA synthesis. However, single-stranded AAV (ssAAV) vectors can also be used.

[0224] To increase packaging capacity, long transgenes can be split between two AAV transfer plasmids, the first being a 3' splice donor and the second a 5' splice acceptor. During cell co-infection, these viruses form concatemers and are spliced ​​together, allowing for the expression of the full-length transgene. This enables the expression of longer transgenes, although the efficiency of expression decreases. A similar method for increasing capacity utilizes homologous recombination. For example, the transgene may be split between two transfer plasmids, but there is substantial sequence overlap so that co-expression induces homologous recombination and the expression of the full-length transgene.

[0225] F. Lipid nanoparticles Different compositions or combinations of components disclosed herein (e.g., CtIP fusion protein or encoding DNA or RNA, i53 protein or encoding DNA or RNA, Cas protein or encoding DNA or RNA, guide RNA or encoding DNA, exogenous donor nucleic acids, or combinations thereof (e.g., RNA encoding Cas protein, RNA encoding CtIP fusion protein, RNA encoding i53 protein, and optionally guide RNA) may be provided in lipid nanoparticles.

[0226] Lipid formulations can protect biomolecules from degradation while simultaneously improving their uptake into cells. Lipid nanoparticles are particles containing multiple lipid molecules that are physically associated with each other by intermolecular forces. These include microspheres (monolayer and multilayer vesicles, e.g., liposomes), dispersed phases in emulsions, micelles, or internal phases in suspensions. Such lipid nanoparticles can be used to encapsulate one or more nucleic acids or proteins for delivery. Formulations containing cationic lipids are useful for delivering polyanions such as nucleic acids. Other lipids that may be included are neutral lipids (i.e., uncharged or amphoteric lipids), anionic lipids, helper lipids that enhance transfection, and stealth lipids that increase the length of time nanoparticles can exist in vivo. Examples of suitable cationic lipids, neutral lipids, anionic lipids, helper lipids, and stealth lipids can be found in International Publication No. WO2016 / 010840(A1), which is incorporated herein by reference in its entirety for all purposes. Exemplary lipid nanoparticles may include cationic lipids and one or more other components. In one example, the other components may include helper lipids such as cholesterol. In another example, the other components may include helper lipids such as cholesterol and neutral lipids such as DSPC. In yet another example, the other components may include helper lipids such as cholesterol, an optional neutral lipid such as DSPC, and stealth lipids such as S010, S024, S027, S031, or S033.

[0227] In certain cases, the RNA encoding the CtIP fusion protein and the RNA encoding the i53 protein are introduced, respectively, via LNP-mediated delivery within the same LNP. In another specific case, the RNA encoding the Cas protein, the RNA encoding the CtIP fusion protein, and the RNA encoding the i53 protein are introduced, respectively, via LNP-mediated delivery within the same LNP. In yet another specific case, the RNA encoding the Cas protein, the RNA encoding the CtIP fusion protein, the RNA encoding the i53 protein, and optionally a guide RNA are introduced, respectively, via LNP-mediated delivery within the same LNP. One or more of the RNAs may be modified, as will be discussed in more detail elsewhere in this specification. Delivery by such a method may result in transient expression of Cas, CtIP fusion protein, or i53 protein and / or the presence of transient guide RNA, and biodegradable lipids improve clearance, improve tolerability, and reduce immunogenicity. Lipid formulations can protect biomolecules from degradation while simultaneously improving their uptake into cells. Lipid nanoparticles are particles containing multiple lipid molecules that are physically associated with each other by intermolecular forces. These include microspheres (monolayer and multilayer vesicles, e.g., liposomes), dispersed phases in emulsions, micelles, or inner phases in suspensions. Such lipid nanoparticles can be used to encapsulate one or more nucleic acids or proteins for delivery. Formulations containing cationic lipids are useful for delivering polyanions such as nucleic acids. Other lipids that may be included are neutral lipids (i.e., uncharged or amphoteric lipids), anionic lipids, helper lipids that enhance transfection, and stealth lipids that increase the length of time the nanoparticles can exist in vivo. See, for example, International Publication Nos. WO2016 / 010840(A1) and International Publication Nos. WO2017 / 173054(A1), each of which is incorporated herein by reference in whole for all purposes. Exemplary lipid nanoparticles may include cationic lipids and one or more other components.

[0228] In some LNPs, the cargo may contain Cas mRNA (e.g., Cas9 mRNA) and gRNA. Cas mRNA and gRNA may be present in various ratios. In some LNPs, the cargo may contain a nucleic acid construct encoding the product of interest (e.g., the polypeptide of interest) and gRNA. The nucleic acid construct encoding the product of interest and gRNA may be present in different ratios.

[0229] Suitable examples of LNPs can be found, for example, in International Publication WO2019 / 067992, International Publication WO2020 / 082042, U.S. Publication 2020 / 0270617, International Publication WO2020 / 082041, U.S. Publication 2020 / 0268906, International Publication WO2020 / 082046 (see, for example, pp. 85–86), and U.S. Publication 2020 / 0289628, each of which is incorporated herein by reference in whole for all purposes.

[0230] LNPs may contain one or more or all of the following: (i) lipids for encapsulation and endosomal escape, (ii) neutral lipids for stabilization, (iii) helper lipids for stabilization, and (iv) stealth lipids. See, for example, Finn et al. (2018) Cell Rep. 22(9): 2227-2235 and International Publication No. WO2017 / 173054(A1), each of which is incorporated herein by reference in whole for all purposes. For specific examples of using LNPs for delivery to the brain, see Nabhan et al. (2016) Sci. Rep. 6: 20019, which is incorporated herein by reference in whole for all purposes.

[0231] G. Cells or animals The cells targeted in the methods disclosed herein may be, for example, mammals, non-human mammals, or humans. Mammals may be, for example, non-human mammals, humans, rodents, rats, mice, or hamsters. Other non-human mammals include, for example, non-human primates, monkeys, apes, cats, dogs, rabbits, horses, bulls, deer, bison, and domestic animals (e.g., cattle breeds such as cattle and steers; sheep breeds such as sheep and goats; and pig breeds such as pigs and wild boars). The term “non-human” excludes humans. In one particular example, the cells are mammalian cells. In another example, the cells are rodent cells. In another example, the cells are mouse or rat cells. In another example, the cells are mouse cells. In another example, the cells are rat cells. In another example, the cells are human cells. In one example, the cells are non-periodic cells (i.e., non-dividing). In another example, the cells are periodic cells (i.e., dividing) cells.

[0232] Cells may be isolated cells (e.g., in vitro) or in vivo within a subject (e.g., an animal or mammal). Cells may also be in any type of undifferentiated or differentiated state. In one example, the cells are hepatocytes. The cells provided herein may be normal and healthy cells or diseased cells.

[0233] In some embodiments, the cells may be induced pluripotent stem cells (iPSCs), such as human iPSCs. In some embodiments, the cells may be hematopoietic stem cells (HSCs), such as human HSCs. In some embodiments, the cells may be embryonic stem cells (ES cells), such as mouse ES cells or rat ES cells. In some embodiments, the cells may be one-cell stage embryos, such as mouse one-cell stage embryos or rat one-cell stage embryos.

[0234] In some cases, cells containing targeted gene modifications produced by the methods disclosed herein can be used to produce genetically modified organisms containing targeted gene modifications. Any convenient method or protocol for producing genetically modified organisms is suitable for producing such genetically modified non-human animals. See, for example, Cho et al. (2009) Current Protocols in Cell Biology 42:19.11:19.11.1-19.11.22 and Gama Sosa et al. (2010) Brain Struct. Funct. 214(2-3):91-109, each of which is incorporated herein by reference in whole for all purposes.

[0235] For example, a method for producing non-human animals containing a targeted gene modification at a target genomic locus may include: (1) modifying the genome of pluripotent cells to contain a targeted gene modification at a target genomic locus; (2) identifying or selecting genetically modified pluripotent cells containing a targeted gene modification at a target genomic locus; (3) introducing the genetically modified pluripotent cells into a non-human animal host embryo; and (4) allowing a surrogate mother to conceive the host embryo. Optionally, a host embryo containing modified pluripotent cells (e.g., non-human ES cells) may be implanted in a surrogate mother to produce F0 non-human animals and incubated to the blastocyst stage before conception. The surrogate mother can then produce F0 generation non-human animals containing a targeted gene modification at a target genomic locus.

[0236] A suitable example of pluripotent cells is embryonic stem (ES) cells (e.g., mouse ES cells or rat ES cells). Modified pluripotent cells can be generated, for example, using the methods disclosed herein. Donor cells can be introduced into a host embryo at any stage, such as the blastocyst or pre-morula stage (i.e., the 4-cell or 8-cell stage). Offspring capable of transmitting the genetic modification via the germline are produced. See, for example, U.S. Patent No. 7,294,754, which is incorporated herein by reference in its entirety for all purposes.

[0237] Alternatively, methods for producing non-human animals as described elsewhere in this specification may include (1) modifying the genome of a one-cell stage embryo to include a targeted gene modification at a target genomic locus; (2) selecting the gene-modified embryo; and (3) having a surrogate mother conceive the gene-modified embryo. Offspring capable of transmitting the gene modification via the germline are produced.

[0238] Nuclear transfer technology can also be used to generate non-human mammals. Briefly, a method for nuclear transfer may include (1) the steps of enucleating or providing enucleated oocytes, (2) isolating or providing donor cells or nuclei combined with enucleated oocytes, (3) inserting the cells or nuclei into the enucleated oocytes to form reconstituted cells, (4) implanting the reconstituted cells in the uterus of an animal to form an embryo, and (5) developing the embryo. In such a method, oocytes are generally recovered from deceased animals, but can also be isolated from the fallopian tubes and / or ovaries of living animals. Oocytes can be matured in various well-known culture media before enucleation. Enucleation of oocytes can be carried out by many well-known methods. Insertion of donor cells or nuclei into enucleated oocytes to form reconstituted cells can be carried out by microinjecting the donor cells under the zona pellucida before fusion. Fusion can be induced by the application of DC electrical pulses across the contact / fusion surface (electrofusion), exposure of cells to fusion-promoting chemicals such as polyethylene glycol, or by inactivated viruses such as Sendai virus. Reconstituted cells can be activated by electrical and / or non-electrical means before, during, and / or after the fusion of nuclear donor and recipient oocytes. Activation methods include electrical pulses, chemically induced shocks, sperm penetration, increasing the level of divalent cations in oocytes, and reducing the phosphorylation of cellular proteins in oocytes (by kinase inhibitors). Activated reconstituted cells or embryos can be cultured in known media and then transplanted into the uterus of an animal. See, for example, U.S. Publication No. 2008 / 0092249, International Publication No. WO1999 / 005266, U.S. Publication No. 2004 / 0177390, International Publication No. WO2008 / 017234, and U.S. Publication No. 7,612,250, each incorporated herein in whole for all purposes.

[0239] The various methods provided herein enable the generation of genetically modified non-human F0 animals, in which the cells of the genetically modified F0 animals contain targeted gene modifications at target genomic loci. It is recognized that the number of cells in the F0 animals having targeted gene modifications at target genomic loci differs depending on the method used to generate the F0 animals. For example, by introducing donor ES cells into premorlar stage embryos (e.g., 8-cell stage mouse embryos) from a corresponding organism via the VELOCIMOUSE® method, a larger percentage of the cell population of the F0 animals can be made to contain cells having the desired nucleotide sequence containing the targeted gene modification. For example, at least 50%, 60%, 65%, 70%, 75%, 85%, 86%, 87%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% of the cell contribution of the non-human F0 animals may contain a cell population with targeted modifications.

[0240] Cells from genetically modified F0 animals may be heterozygous or homozygous for targeted gene modifications at the target genomic locus.

[0241] All patent applications, websites, other publications, accession numbers, etc., cited above or below are incorporated by reference in whole for all purposes to the same extent that each individual item is specifically and individually indicated to be incorporated by reference. Where different versions of an array are associated with an accession number at different times, the version associated with the accession number on the effective filing date of this application is meant. The effective filing date, where applicable, means prior to the actual filing date relating to the accession number or the filing date of the priority application. Similarly, where different versions of a publication, website, etc., are published at different times, unless otherwise specified, the version published most recently on the effective filing date of this application is meant. Unless otherwise specifically specified, any feature, process, element, embodiment, or aspect of the present invention may be used in combination with any other. While the present invention has described some details through diagrams and examples for the purposes of clarity and understanding, it will become apparent that certain changes and modifications may be made within the scope of the appended claims.

[0242] A brief explanation of arrays The nucleotide and amino acid sequences listed in the attached sequence listing are shown using standard letter abbreviations for nucleotide bases and three-letter notation for amino acids. Nucleotide sequences follow the standard rule of starting from the 5' end of the sequence and proceeding forward (i.e., from left to right in each row) to the 3' end. Only one strand of each nucleotide sequence is shown, but complementary strands are understood to be included by any reference to the shown strand. Where nucleotide sequences encoding amino acid sequences are provided, it is understood that their codon-degenerate variants encoding the same amino acid sequences are also provided. Amino acid sequences follow the standard rule of starting from the amino terminus of the sequence and proceeding forward (i.e., from left to right in each row) to the carboxyl terminus.

[0243] [Table 2] [Examples]

[0244] Example 1. Combinatorial expression of DNA repair regulators enhances CRISPR-mediated homologous recombination. To stimulate homologous recombination repair (HDR) without inhibiting the endogenous function or cell cycle regulation of other DSB repair mechanisms, the inventors have created an HDR booster cocktail containing CtBP-interacting protein (CtIP) and TP53-binding protein 1 (53BP1) inhibitors, namely the mRNA encoding i53. The former is involved in initiating DNA excision at the DSB site, the rate-limiting step of HDR, while the latter inhibits the recruitment and function of 53BP1 in damaged chromatin, thereby creating a favorable environment for HDR. The inventors have designed a dual delivery system that can efficiently and transiently deliver the combination of the two proteins together with Cas9 mRNA, sgRNA, and a donor template. In one version, all mRNA is packaged in lipid nanoparticles (LNPs), and the donor template and sgRNA are delivered by an adeno-associated virus (AAV) vector. As shown below, our data demonstrate that the combination of two enhancers (MS2-CtIP and i53), with rapid, transient, and non-integrational expression of these proteins, provides a significant improvement of approximately 20-fold compared to CRISPR-mediated HDR in human cells, thus enabling a better and more efficient method for precise genome editing.

[0245] High-throughput microscopy-based evaluation of CRISPR-mediated HDR efficiency via precise knock-in of mCLOVER at the LMNA locus. To measure the efficiency of CRISPR-induced HDR, a microscopy-based assay was used to quantify the percentage of cells that underwent accurate gene integration. The CRISPR reagent was designed to integrate the mCLOVER coding sequence into the 5' end of the LMNA gene encoding the lamin A / C proteins. See Figure 1. This gene was targeted because lamin A / C is clearly localized to the nuclear membrane, allowing for the identification of cells that underwent HDR (i.e., in-frame expression of the mCLOVER-lamin fusion). A donor template (SEQ ID NO: 44) was designed containing the mCLOVER coding sequence adjacent to a homology arm of approximately 600 bp corresponding to the region adjacent to the LMNA start codon. To prevent re-cleavage by Cas9 after integration, the repair template contained a silent mutation in the gRNA PAM sequence. The repair template was adjacent to the gRNA target site, allowing the template to linearize upon Cas9 cleavage within the cell.

[0246] To enable LMNA-HDR, Cas9-expressing HEK293 cells were transduced using AAV2 (AAV-sgRNA2.0-mClover), a vector packaged with a donor template and a U6-sgRNA2.0 expression cassette. The Cas9 protein and DNA sequences are described in SEQ ID NOs: 1 and 2, respectively, and the LMNA sgRNA sequence is described in SEQ ID NO: 27. To optimize AAV delivery and establish baseline HDR efficiency in these cells, transduction was performed at different MOIs, and cells were imaged by confocal microscopy after 96 hours. Increased availability of sgRNA and donor templates was observed to increase HDR events, validating the sensitivity of our assay. See Figures 2A-2B. AAV transduction into Cas9-expressing HEK293 cells with increased MOI (Cas9-HEK) resulted in an increase in the percentage of corresponding mClover-LMNA-positive cells (Figure 2B). mClover-LMNA expression was reduced when cells were co-treated with mirin, the well-established MRE11, homologous recombinant proteins, or inhibitors, or when HA-free donor templates were used (Figure 2C). These data suggest that the presence of the mClover-LMNA fusion protein actually represents the success of HDR.

[0247] Screening of homologous recombinant proteins to improve the efficiency of Cas9-induced HDR. To selectively support HDR repair in CRISPR-mediated DSBs, we aimed to identify potential HDR boosting factors and recruit them to Cas9 cleavage sites using an MS2-tagged approach. In this approach, the sgRNA scaffold sequence was modified to include the MS2 phage aptamer (sgRNA2.0), and the HDR boosting protein was fused to the MS2 coat protein (MS2) for interaction with sgRNA2.0 (Figure 3A). We hypothesized that the specific accumulation of these factors at CRISPR / Cas9 targeting loci would increase the frequency of precise editing without altering the overall DSB repair status. In this study, all sgRNAs used contained the MS2 scaffold unless otherwise specified.

[0248] Nine homologous recombinant proteins were selected, and their effects on HDR frequency during expression and recruitment to Cas9-targeted LMNA loci were evaluated. Therefore, individual plasmids expressing these proteins fused with MS2 at the 5' end were generated. The plasmids and AAVs were then used. sgLMNA+mClover The drugs were simultaneously delivered to Cas9-HEK cells, and their respective HDR efficiencies were determined after 96 hours. Most candidates resulted in increased HDR, but AAV sgLMNA+mClover Compared to baseline HDR activity induced by the MS2-only plasmid, MS2-CtIP expression yielded the most significant HDR improvement (Figure 3B).

[0249] LNP delivery by individual terminal resection enhancers improves the efficiency of Cas9-induced HDR. The CtIP protein plays a crucial role in DNA repair, particularly in DNA end excision, the rate-limiting step in homologous recombination. Despite its convenience and ease of use, plasmid delivery is limited to in vitro applications due to the potential risks of immune responses and nonspecific DNA recombination with the genome. Furthermore, while CtIP is generally considered a tumor suppressor, studies have indicated a potential oncogenic role in promoting tumorigenesis. In particular, CtIP overexpression has been observed in gastric cancer, and its amplification has been shown in several other cancers. See, for example, Mozaffari et al. (2021) Semin. Cell. Dev. Biol. 113:47-56, which is incorporated herein by reference in its entirety for all purposes. Therefore, we sought to explore therapeutic approaches for delivering exogenous MS2-CtIP to enhance precise editing while minimizing unwanted long-term activity. Lipid nanoparticles (LNPs) have emerged as an effective and clinically viable delivery method for CRISPR editing systems (e.g., for delivering Cas9 mRNA and gRNA) because they can effectively encapsulate and deliver these components to cells. This approach enables rapid and transient expression of Cas9 in cells, allowing for efficient editing while mitigating concerns associated with long-term off-target nuclease exposure. Based on this, we propose that delivery of MS2-CtIP mRNA via LNPs may yield efficient HDR boosting activity without any persistent adverse effects.

[0250] To confirm the potential for boosting HDR through CtIP localization, we investigated whether LNP-mediated delivery of MS2-CtIP mRNA (LNP-MS2-CtIP) (amino acid and nucleotide sequences described in SEQ ID NOs. 30 and 31, respectively) could affect HDR efficiency in Cas9-HEK293. LNP-MS2-CtIP and AAV-sgRNA2.0-mClover were simultaneously delivered to Cas9-HEK293 cells (Figure 4A). To maximize the resolution of the effect of LNP-MS2-CtIP, cells were transduced using AAV at the lowest MOI we tested (1 × 10⁻⁶).4 In parallel, cells were treated with LNPs packaged with varying amounts of mRNA (resulting in 0.28% HDR in one representative replica). These results showed that MS2-CtIP expression resulted in up to approximately 13-fold increases in HDR at the LMNA locus (Figure 4B). Co-delivery of MS2-CtIP with donor templates and AAV containing normal gRNA without aptamers (AAV-sgRNA-mClover) did not result in any change in HDR efficiency (Figure 4C), suggesting that localization of CtIP to DSBs is required to commit cells to repair breaks via HDR. Next, using NGS amplicon sequencing, we analyzed the indel rate at the LMNA locus of the same sample to quantify the frequency of insertion or deletion mutations (indels) surrounding Cas9 cleavage sites. We found that MS2-CtIP treatment reduced the efficiency of indel formation, suggesting that MS2-CtIP-induced terminal excision shifts the balance of DSB repair from NHEJ to HDR (Figure 4B). This result indicates that enhancing the availability of CtIP at CRISPR sites can significantly increase the efficiency of precise gene knock-in. See Figures 4A-4C. In summary, our data suggest that localizing the CtIP protein to Cas9 cleavage sites can effectively shift the repair pathway selection from NHEJ to HDR, and that LNP transfection is a suitable delivery method for transient MS2-CtIP expression.

[0251] Next, we compared LNP delivery of exogenous MS2-CtIP mRNA with plasmid delivery of MST-CtIP DNA and found that mRNA LNP delivery functioned better than plasmid expression. The transient nature of MS2-CtIP expression via LNP-mediated delivery raised concerns that it might reduce the HDR-enhancing effect compared to stable expression of MS2-CtIP from a plasmid or other source. Contrary to expectations, when comparing the effect of MS2-CtIP on HDR efficiency delivered via LNP versus plasmid expression, a significantly stronger effect was observed with LNP delivery. Specifically, compared to baseline HDR efficiency without MS2-CtIP delivery, the increase with plasmid expression was 2.5 times, while the increase with LNP was 12.5 times (Figure 5).

[0252] Considering that LNP-mediated enhancement of end excision may promote CRISPR-HDR, we then evaluated whether the expression of a end protection inhibitor, i.e., the 53BP1 inhibitory peptide i53, could also promote HDR during CRISPR editing. 53BP1 plays a crucial role in DSB repair pathway selection by preventing the initial stages of DNA excision, partly by physically blocking excision nuclease activity and partly by mediating CtIP dephosphorylation. Various amounts of i53 mRNA (amino acid and nucleotide sequences described in SEQ ID NOs. 42 and 43, respectively) were packaged into LNPs and delivered to AAV-treated Cas9-HEK293 cells (Figure 6A). Increased i53 expression resulted in a gradual and significant increase in HDR (Figure 6B). Correspondingly, a decrease in indel rates at the LMNA locus was observed, indicating that LNP-mediated expression of i53 can promote HDR during CRISPR editing (Figure 6B). These data demonstrate that 53BP1 inhibition, which indirectly enables BRCA1 function and DNA end excision, is a viable approach for boosting CRISPR-mediated precise gene knock-in. See Figures 6A–6B.

[0253] Combinatorial expression of i53 and MS2-CtiP further enhances HDR performance. We hypothesized that while recombinant CtIP overexpression and localization to CRISPR sites can directly enhance DNA end excision for HDR activation, the role of 53BP1 inhibition is to indirectly provide an HDR-friendly environment for CtIP and other HDR proteins to function without significantly downregulating NHEJ. Therefore, we investigated whether co-delivery of MS2-CtIP and i53 mRNA via LNPs could induce combinatorial HDR enhancement in CRISPR-treated cells. Cas9-expressing HEK293 cells were treated with LNPs encapsulating both AAV-sgRNA2.0-mClover and both MS2-CtIP and i53. These data suggest that delivery of 7.5 μg of MS2-CtIP and 15 μg of i53 via LNPs in CRISPR-treated cells could enhance HDR efficiency in HEK cells by approximately 20-fold. See Figure 7. Combinatorial enhancement of HDR efficiency was also observed in Cas9-expressing Huh7 cells, showing approximately a 5-fold increase in HDR efficiency compared to baseline (data not shown).

[0254] During the S / G2 phase of the cell cycle (when HDR is permitted), CtIP is known to be phosphorylated by the cell cycle regulator CDK, which then inhibits 53BP1 function and initiates HDR. See, for example, Daley et al. (2014) Mol.Cell.Biol.34(8):1380-1388 ("In S / G2, CtIP is phosphorylated by CDK, inducing the formation of a complex with BRCA1 and MRN. This complex replaces 53BP1 and initiates excision."), which is incorporated herein by reference in its entirety for all purposes. Given this well-established mechanism, it was surprising to find that in our system, the addition of i53 simultaneously with exogenous MS2-CtIP overexpression / localization could further increase HDR efficiency. It has been previously reported that silencing 53BP1, or depleting its ability to bind to damaged chromatin, alters limited DSB excision to overexcision, resulting in a shift from error-free gene conversion by RAD51 to mutagenic single-strand annealing by RAD52. See, for example, Ochs et al. (2016) Nat. Struct. Mol. Biol. 23(8):714-721, which is incorporated herein by reference in its entirety for all purposes. Based on this, it was hypothesized that our booster, employing two excision-prone strategies, could result in mutagenic editing outcomes (overexcision) as demonstrated in the studies. However, contrary to this expectation, the booster successfully promoted error-free HDR.

[0255] To our knowledge, this strategy yields the highest HDR enhancement rate compared to other published strategies. Our strategy offers potential benefits in various research applications, such as the creation of cellular and in vivo disease models, as well as in therapeutic situations where the efficiency of precise gene knock-in can be significantly enhanced. This strategy also offers advantages over approaches in which all components are fused to a single Cas9 protein. For example, this system facilitates further recruitment of CtIP molecules, which are described as acting as a multimeric complex, whereas the fusion protein allows only one CtIP molecule because only one Cas9 molecule can bind to the target site. Similarly, i53 may have a stronger effect when delivered independently than as a fusion with limited stoichiometry.

[0256] Chemical inhibition of NHEJ Chemical inhibition of NHEJ is often used as a strategy to enhance HDR in cells. In this context, we compared our HDR booster with AZD7648, one of the most potent NHEJ (DNA-PKcs) inhibitory small molecules. Our reporter showed that the HDR booster was significantly superior to AZD7648 in enhancing HDR (Figure 8). Notably, the combination of the HDR booster and AZD7648 did not result in further HDR enhancement (Figure 8). Considering the amount of sgRNA / donor template provided and the capacity of the endogenous HDR mechanism, we inferred that our HDR booster maximized CRISPR-mediated HDR at the LMNA locus.

[0257] HDR boosters achieve accurate gene integration while reducing HDR templates. To mimic therapeutic gene editing, we then investigated the effect of HDR boosters on precise gene editing even when Cas9 is transiently expressed by LNPs rather than being stably expressed in the cell line. Simultaneously, we investigated whether HDR boosters affect AAV without impacting gene targeting efficiency. sgLMNA+mCloverWe tested whether it would allow for a reduction in quantity. For this purpose, we encapsulated two LNPs, Cas9, MS2-CtIP, and i53 mRNA in LNPs. ブースター , as well as LNPs that encapsulate Cas9 and mCherry mRNA ベースライン We prepared the LNPs. Then, we used AAV with different MOIs. sgLMNA+mClover The transfected HEK293 cells were transfected with [the gene]. As expected, reducing the AAV MOI reduced the gene targeting efficiency. Importantly, regardless of the AAV MOI, LNP ブースター In cells treated with LNP ベースライン A consistent increase in HDR efficiency was observed compared to processing with the previous method (Figure 9A). This was accompanied by a corresponding decrease in indel formation (Figure 9A).

[0258] Repeated experiments targeting the C-terminuses of two other genes, HMGA1 and SEC61B, led to similar conclusions (Figure 9B). In summary, our results suggest that the HDR booster can be used in clinically relevant situations where Cas9 is transiently co-expressed with the booster. Importantly, this co-delivery enables highly accurate gene integration efficiency while reducing the amount of CRISPR reagent (AAV) required, thus reducing the opportunity for off-target CRISPR activity and transgene integration.

[0259] HDR boosters promote precise gene integration using different delivery approaches. The data above highlights the ability of HDR boosters to enhance precise editing using an LNP / AAV co-delivery approach. While AAV remains the preferred donor template carrier in in vivo preclinical and clinical settings, non-viral templates, such as linear dsDNA and ssDNA, are emerging as promising alternatives. This is particularly evident in gene editing of clinically relevant primary human hematopoietic cells, as well as in CRIPSR-mediated disease modeling using iPSCs, mESCs, and animal embryos.

[0260] Therefore, we attempted to investigate whether the HDR booster can enhance HDR in the context of non-viral donor delivery. To achieve this, we used linear closed-end dsDNA (dsDNA) containing the mClover coding sequence adjacent to the LMNA homology arm sequence as described above. mclover-LMNA The LNPs were obtained and delivered to Cas9-HEK cells by electroporation along with the plasmid encoding sgLMNA2.0. The electroporated cells were then cultured for 96 hours in medium with or without the HDR booster-encapsulated LNPs. The data showed that HDR booster inclusion significantly increased the percentage of mClover-LMNA cells (Figure 10).

[0261] We also investigated whether the HDR booster mRNA could be co-delivered by electroporation along with the remaining CRISPR reagents. For this purpose, we obtained synthetic sgLMNA2.0 and verified that its editing efficiency was as good as that of synthetic sgLMNA-REG. Subsequently, we used sgLMNA2.0 and dsDNA. mclover-LMNA Furthermore, electroporating the mRNA of the HDR booster with HEK-Cas9 resulted in a significant increase in HDR efficiency (Figure 11). In summary, our findings demonstrate that the HDR booster can be effectively combined with different delivery approaches, highlighting its high versatility.

Claims

1. A method for modifying targeted genes by homologous recombination repair at a target genomic locus within a cell, wherein the cell contains (a) A clustered equispaced short-chain palindromic repeat (CRISPR)-related (Cas) protein or a nucleic acid encoding the said Cas protein, (b) A guide RNA or one or more DNAs encoding the guide RNA, wherein the guide RNA comprises one or more adapter-binding elements to which an adapter protein can specifically bind, and the guide RNA forms a complex with the Cas protein and is guided to the guide RNA target sequence at the target genomic locus, (c) A fusion protein or a nucleic acid encoding the fusion protein, wherein the fusion protein includes a CtBP interacting protein (CtIP) fused to the adapter protein, and (d) a 53BP1 inhibitor (i53) protein or a nucleic acid encoding the i53 protein, (e) an exogenous donor nucleic acid comprising a 5' homology arm that hybridizes to the 5' target sequence of the target genome locus and a 3' homology arm that hybridizes to the 3' target sequence of the target genome locus, wherein optionally, the 5' homology arm and the 3' homology arm are adjacent to the inserted nucleic acid, and the administration of the exogenous donor nucleic acid, A method comprising the following steps: the Cas protein and the guide RNA form a complex, the Cas protein cleaves the guide RNA target sequence to produce a double-strand break, and the exogenous donor nucleic acid recombinates with the target genomic locus via homologous recombination repair to produce the targeted gene modification.

2. The method according to claim 1, wherein the Cas protein is administered to the cells in the form of a protein, and optionally the Cas protein is present in lipid nanoparticles.

3. The method according to claim 1, wherein the nucleic acid encoding the Cas protein is administered to the cells, and the nucleic acid encoding the Cas protein includes RNA encoding the Cas protein, and optionally, the RNA encoding the Cas protein is present in lipid nanoparticles.

4. The method according to claim 1, wherein the nucleic acid encoding the Cas protein is administered to the cell, the nucleic acid encoding the Cas protein comprises DNA encoding the Cas protein, optionally, the DNA encoding the Cas protein is in a viral vector, optionally, the viral vector is a recombinant adeno-associated virus (AAV) vector.

5. The method according to any one of claims 1 to 4, wherein the Cas protein is a Cas9 protein.

6. The method according to claim 5, wherein the Cas9 protein is Streptococcus pyogenes Cas9 protein, Campylobacter jejuni Cas9 protein, or Staphylococcus aureus Cas9 protein, and optionally the Cas9 protein is Streptococcus pyogenes Cas9 protein.

7. The method according to any one of claims 1 to 6, wherein the guide RNA is administered in RNA form, and optionally, the guide RNA is present in lipid nanoparticles.

8. The method according to any one of claims 1 to 6, wherein the one or more DNAs encoding the guide RNA are administered to the cells, and optionally the one or more DNAs encoding the guide RNA are in a viral vector, and optionally the viral vector is a recombinant AAV vector.

9. The method according to any one of claims 1 to 8, wherein the guide RNA includes two adapter-binding elements to which the adapter protein can specifically bind.

10. The method according to claim 9, wherein the first adapter binding element is located within the first loop of the guide RNA, and the second adapter binding element is located within the second loop of the guide RNA.

11. The aforementioned guide RNA is a single guide RNA containing a CRISPR RNA (crRNA) moiety that is fused with a trans-activated CRISPR RNA (tracrRNA) moiety. The method according to claim 10, wherein the first loop is a tetraloop corresponding to residues 13-16 of sequence number 11, 13, 15, or 16, and the second loop is a stemloop 2 corresponding to residues 53-56 of sequence number 11, 13, 15, or 16.

12. The method according to any one of claims 1 to 11, wherein the adapter coupling element includes the sequence described in sequence number 19 or 20.

13. The method according to any one of claims 1 to 12, wherein the guide RNA includes the sequence described in SEQ ID NO: 21, 22, 23, 24, 25, or 26.

14. The method according to any one of claims 1 to 13, wherein the fusion protein is administered to the cells in the form of a protein, and optionally the fusion protein is contained in lipid nanoparticles.

15. The method according to any one of claims 1 to 13, wherein the nucleic acid encoding the fusion protein is administered to the cells, and the nucleic acid encoding the fusion protein includes RNA encoding the fusion protein, and optionally, the RNA encoding the fusion protein is present in lipid nanoparticles.

16. The method according to any one of claims 1 to 13, wherein the nucleic acid encoding the fusion protein is administered to the cell, the nucleic acid encoding the fusion protein includes DNA encoding the fusion protein, optionally, the DNA encoding the fusion protein is in a viral vector, optionally, the viral vector is a recombinant AAV vector.

17. The method according to any one of claims 1 to 16, wherein the adapter protein comprises an MS2 coat protein or a functional fragment or variant thereof.

18. The method according to any one of claims 1 to 17, wherein the adapter protein comprises a sequence that is at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence described in SEQ ID NO:

32.

19. The method according to any one of claims 1 to 18, wherein the adapter protein is encoded by a sequence that is at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence described in SEQ ID NO:

33.

20. The method according to any one of claims 1 to 19, wherein the CtIP protein comprises a sequence that is at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence described in SEQ ID NO:

34.

21. The method according to any one of claims 1 to 20, wherein the CtIP protein is encoded by a sequence that is at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence described in SEQ ID NO:

36.

22. The method according to any one of claims 1 to 21, wherein the fusion protein comprises a sequence that is at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence described in SEQ ID NO:

30.

23. The method according to any one of claims 1 to 22, wherein the fusion protein is encoded by a sequence that is at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence described in SEQ ID NO:

31.

24. The method according to any one of claims 1 to 23, wherein the i53 protein is administered to the cells in the form of a protein, and optionally the i53 protein is present in lipid nanoparticles.

25. The method according to any one of claims 1 to 24, wherein the nucleic acid encoding the i53 protein is administered to the cells, and the nucleic acid encoding the i53 protein includes the RNA messenger RNA encoding the i53 protein, and optionally the RNA encoding the i53 protein is present in lipid nanoparticles.

26. The method according to any one of claims 1 to 25, wherein the nucleic acid encoding the i53 protein is administered to the cells, the nucleic acid encoding the i53 protein comprises DNA encoding the i53 protein, optionally, the DNA encoding the i53 protein is in a viral vector, optionally, the viral vector is a recombinant AAV vector.

27. The method according to any one of claims 1 to 26, wherein the i53 protein comprises a sequence that is at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence described in SEQ ID NO: 40 or 42.

28. The method according to any one of claims 1 to 27, wherein the i53 protein is encoded by a sequence that is at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence described in SEQ ID NO: 41 or 43.

29. The method according to any one of claims 1 to 28, wherein the exogenous donor nucleic acid includes the inserted nucleic acid.

30. The method according to any one of claims 1 to 29, wherein the exogenous donor nucleic acid is present in a viral vector.

31. The method according to claim 30, wherein the viral vector is a recombinant AAV vector.

32. The aforementioned exogenous donor nucleic acid is a large targeting vector (LTVEC), (a) The LTVEC is at least 10kb, (b) The sum of the 5' and 3' homology arms of the LTVEC is at least 10 kb, (c) The LTVEC is approximately 50kb to approximately 300kb, or (d) The method according to any one of claims 1 to 31, wherein the sum of the 5' and 3' homology arms of the LTVEC is about 10 kb to about 200 kb.

33. The nucleic acid encoding the fusion protein is administered to the cell, and the nucleic acid encoding the fusion protein includes the RNA encoding the fusion protein. The nucleic acid encoding the i53 protein is administered to the cells, and the nucleic acid encoding the i53 protein includes the RNA encoding the i53 protein. The method according to any one of claims 1 to 32, wherein the RNA encoding the fusion protein and the RNA encoding the i53 protein are present in lipid nanoparticles.

34. The guide RNA includes two adapter-binding elements to which the adapter protein can specifically bind, wherein the first adapter-binding element is located within a first loop of the guide RNA, and the second adapter-binding element is located within a second loop of the guide RNA. The adapter protein comprises the MS2 coat protein or a functional fragment or variant thereof. The nucleic acid encoding the fusion protein is administered to the cell, and the nucleic acid encoding the fusion protein includes the RNA encoding the fusion protein. The nucleic acid encoding the i53 protein is administered to the cells, and the nucleic acid encoding the i53 protein includes the RNA encoding the i53 protein. The method according to any one of claims 1 to 32, wherein the RNA encoding the fusion protein and the RNA encoding the i53 protein are present in lipid nanoparticles.

35. The guide RNA includes two adapter-binding elements to which the adapter protein can specifically bind, wherein the first adapter-binding element is located within a first loop of the guide RNA, and the second adapter-binding element is located within a second loop of the guide RNA. The adapter protein comprises the MS2 coat protein or a functional fragment or variant thereof. The nucleic acid encoding the Cas protein is administered to the cell, and the nucleic acid encoding the Cas protein includes the RNA encoding the Cas protein. The nucleic acid encoding the fusion protein is administered to the cell, and the nucleic acid encoding the fusion protein includes the RNA encoding the fusion protein. The nucleic acid encoding the i53 protein is administered to the cells, and the nucleic acid encoding the i53 protein includes the RNA encoding the i53 protein. The RNA encoding the Cas protein, the RNA encoding the fusion protein, and the RNA encoding the i53 protein are present in lipid nanoparticles. The one or more DNAs encoding the guide RNA are administered to the cells. The method according to any one of claims 1 to 32, wherein the one or more DNAs encoding the guide RNA and the exogenous donor nucleic acid are present in a recombinant AAV vector.

36. The guide RNA includes two adapter-binding elements to which the adapter protein can specifically bind, wherein the first adapter-binding element is located within a first loop of the guide RNA, and the second adapter-binding element is located within a second loop of the guide RNA. The adapter protein comprises the MS2 coat protein or a functional fragment or variant thereof. The nucleic acid encoding the Cas protein is administered to the cell, and the nucleic acid encoding the Cas protein includes the RNA encoding the Cas protein. The nucleic acid encoding the fusion protein is administered to the cell, and the nucleic acid encoding the fusion protein includes the RNA encoding the fusion protein. The nucleic acid encoding the i53 protein is administered to the cells, and the nucleic acid encoding the i53 protein includes the RNA encoding the i53 protein. The guide RNA is administered to the cells in RNA form. The RNA encoding the Cas protein, the RNA encoding the fusion protein, the RNA encoding the i53 protein, and the guide RNA are located in lipid nanoparticles. The method according to any one of claims 1 to 32, wherein the exogenous donor nucleic acid is present in a recombinant AAV vector.

37. The method according to any one of claims 1 to 36, wherein the cells are mammalian cells.

38. The method according to any one of claims 1 to 37, wherein the cells are rodent cells.

39. The method according to any one of claims 1 to 38, wherein the cells are mouse cells or rat cells.

40. The method according to any one of claims 1 to 38, wherein the cells are mouse cells.

41. The method according to any one of claims 1 to 37, wherein the cells are human cells.

42. The method according to any one of claims 1 to 41, wherein the cells are in vitro.

43. The method according to any one of claims 1 to 41, wherein the cells are in vivo.

44. A composition or combination, (a) A clustered equispaced short-chain palindromic repeat (CRISPR)-related (Cas) protein or a nucleic acid encoding the said Cas protein, (b) A guide RNA or one or more DNAs encoding the guide RNA, wherein the guide RNA comprises one or more adapter-binding elements to which an adapter protein can specifically bind, and the guide RNA forms a complex with the Cas protein and is guided to the guide RNA target sequence at the target genomic locus, (c) A fusion protein or a nucleic acid encoding the fusion protein, wherein the fusion protein includes a CtBP interacting protein (CtIP) fused to the adapter protein, and (d) a 53BP1 inhibitor (i53) protein or a nucleic acid encoding the i53 protein, (e) A composition or combination comprising an exogenous donor nucleic acid comprising a 5' homology arm that hybridizes to a 5' target sequence of the target genome locus and a 3' homology arm that hybridizes to a 3' target sequence of the target genome locus, wherein optionally, the 5' homology arm and the 3' homology arm are adjacent to the inserted nucleic acid.

45. The composition or combination according to claim 44, wherein the composition or combination comprises the Cas protein in the form of a protein, and optionally the Cas protein is present in lipid nanoparticles.

46. The composition or combination according to claim 44, wherein the composition or combination comprises the nucleic acid encoding the Cas protein, the nucleic acid encoding the Cas protein comprises the RNA encoding the Cas protein, and optionally the RNA encoding the Cas protein is contained in lipid nanoparticles.

47. The composition or combination according to claim 44, wherein the composition or combination comprises the nucleic acid encoding the Cas protein, the nucleic acid encoding the Cas protein comprises the DNA encoding the Cas protein, optionally, the DNA encoding the Cas protein is in a viral vector, optionally, the viral vector is a recombinant adeno-associated virus (AAV) vector.

48. The composition or combination according to any one of claims 44 to 47, wherein the Cas protein is a Cas9 protein.

49. The composition or combination according to claim 48, wherein the Cas9 protein is Streptococcus pyogenes Cas9 protein, Campylobacter jejuni Cas9 protein, or Staphylococcus aureus Cas9 protein, and optionally the Cas9 protein is Streptococcus pyogenes Cas9 protein.

50. The composition or combination according to any one of claims 44 to 49, wherein the composition or combination comprises the guide RNA in the form of RNA, and optionally the guide RNA is in lipid nanoparticles.

51. The composition or combination according to any one of claims 44 to 49, wherein the composition or combination comprises one or more DNAs encoding the guide RNA, optionally, the one or more DNAs encoding the guide RNA are in a viral vector, and optionally, the viral vector is a recombinant AAV vector.

52. The composition or combination according to any one of claims 44 to 51, wherein the guide RNA comprises two adapter-binding elements to which the adapter protein can specifically bind.

53. The composition or combination according to claim 52, wherein the first adapter binding element is located within the first loop of the guide RNA, and the second adapter binding element is located within the second loop of the guide RNA.

54. The aforementioned guide RNA is a single guide RNA containing a CRISPR RNA (crRNA) moiety that is fused with a trans-activated CRISPR RNA (tracrRNA) moiety. The composition or combination according to claim 53, wherein the first loop is a tetraloop corresponding to residues 13-16 of sequence number 11, 13, 15, or 16, and the second loop is a stemloop 2 corresponding to residues 53-56 of sequence number 11, 13, 15, or 16.

55. The composition or combination according to any one of claims 44 to 54, wherein the adapter coupling element includes the sequence described in Sequence ID No. 19 or 20.

56. The composition or combination according to any one of claims 44 to 55, wherein the guide RNA comprises the sequence described in SEQ ID NO: 21, 22, 23, 24, 25, or 26.

57. The composition or combination according to any one of claims 44 to 56, wherein the composition or combination comprises the fusion protein in the form of a protein, and optionally the fusion protein is located in lipid nanoparticles.

58. The composition or combination according to any one of claims 44 to 56, wherein the composition or combination comprises the nucleic acid encoding the fusion protein, the nucleic acid encoding the fusion protein comprises the RNA encoding the fusion protein, and optionally the RNA encoding the fusion protein is present in lipid nanoparticles.

59. The composition or combination according to any one of claims 44 to 56, wherein the composition or combination comprises the nucleic acid encoding the fusion protein, the nucleic acid encoding the fusion protein comprises the DNA encoding the fusion protein, optionally the DNA encoding the fusion protein is in a viral vector, and optionally the viral vector is a recombinant AAV vector.

60. The composition or combination according to any one of claims 44 to 59, wherein the adapter protein comprises an MS2 coat protein or a functional fragment or variant thereof.

61. The composition or combination according to any one of claims 44 to 60, wherein the adapter protein comprises a sequence that is at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence described in SEQ ID NO:

32.

62. The composition or combination according to any one of claims 44 to 61, wherein the adapter protein is encoded by a sequence that is at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence described in SEQ ID NO:

33.

63. The composition or combination according to any one of claims 44 to 62, wherein the CtIP protein comprises a sequence that is at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence described in SEQ ID NO:

34.

64. The composition or combination according to any one of claims 44 to 63, wherein the CtIP protein is encoded by a sequence that is at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence described in SEQ ID NO:

36.

65. The composition or combination according to any one of claims 44 to 64, wherein the fusion protein comprises a sequence that is at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence described in SEQ ID NO:

30.

66. The composition or combination according to any one of claims 44 to 65, wherein the fusion protein is encoded by a sequence that is at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence described in SEQ ID NO:

31.

67. The composition or combination according to any one of claims 44 to 66, wherein the composition or combination comprises the i53 protein in the form of a protein, and optionally the i53 protein is present in lipid nanoparticles.

68. The composition or combination according to any one of claims 44 to 67, wherein the composition or combination comprises the nucleic acid encoding the i53 protein, the nucleic acid encoding the i53 protein comprises the RNA messenger RNA encoding the i53 protein, and optionally the RNA encoding the i53 protein is contained in lipid nanoparticles.

69. The composition or combination according to any one of claims 44 to 68, wherein the composition or combination comprises the nucleic acid encoding the i53 protein, the nucleic acid encoding the i53 protein comprises the DNA encoding the i53 protein, optionally the DNA encoding the i53 protein is in a viral vector, and optionally the viral vector is a recombinant AAV vector.

70. The composition or combination according to any one of claims 44 to 69, wherein the i53 protein comprises a sequence that is at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence described in SEQ ID NO: 40 or 42.

71. The composition or combination according to any one of claims 44 to 70, wherein the i53 protein is encoded by a sequence that is at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence described in SEQ ID NO: 41 or 43.

72. The composition or combination according to any one of claims 44 to 71, wherein the exogenous donor nucleic acid comprises the inserted nucleic acid.

73. The composition or combination according to any one of claims 44 to 72, wherein the exogenous donor nucleic acid is present in the viral vector.

74. The composition or combination according to claim 73, wherein the viral vector is a recombinant AAV vector.

75. The aforementioned exogenous donor nucleic acid is a large targeting vector (LTVEC), (a) The LTVEC is at least 10kb, (b) The sum of the 5' and 3' homology arms of the LTVEC is at least 10 kb, (c) The LTVEC is approximately 50kb to approximately 300kb, or (d) The composition or combination according to any one of claims 44 to 74, wherein the sum of the 5' and 3' homology arms of the LTVEC is about 10 kb to about 200 kb.

76. The composition or combination comprises the nucleic acid encoding the fusion protein, and the nucleic acid encoding the fusion protein comprises the RNA encoding the fusion protein. The composition or combination comprises the nucleic acid encoding the i53 protein, and the nucleic acid encoding the i53 protein comprises the RNA encoding the i53 protein. The composition or combination according to any one of claims 44 to 75, wherein the RNA encoding the fusion protein and the RNA encoding the i53 protein are present in lipid nanoparticles.

77. The guide RNA includes two adapter-binding elements to which the adapter protein can specifically bind, wherein the first adapter-binding element is located within a first loop of the guide RNA, and the second adapter-binding element is located within a second loop of the guide RNA. The adapter protein comprises the MS2 coat protein or a functional fragment or variant thereof. The composition or combination comprises the nucleic acid encoding the fusion protein, and the nucleic acid encoding the fusion protein comprises the RNA encoding the fusion protein. The composition or combination comprises the nucleic acid encoding the i53 protein, and the nucleic acid encoding the i53 protein comprises the RNA encoding the i53 protein. The composition or combination according to any one of claims 44 to 75, wherein the RNA encoding the fusion protein and the RNA encoding the i53 protein are present in lipid nanoparticles.

78. The guide RNA includes two adapter-binding elements to which the adapter protein can specifically bind, wherein the first adapter-binding element is located within a first loop of the guide RNA, and the second adapter-binding element is located within a second loop of the guide RNA. The adapter protein comprises the MS2 coat protein or a functional fragment or variant thereof. The composition or combination comprises the nucleic acid encoding the Cas protein, and the nucleic acid encoding the Cas protein comprises the RNA encoding the Cas protein. The composition or combination comprises the nucleic acid encoding the fusion protein, and the nucleic acid encoding the fusion protein comprises the RNA encoding the fusion protein. The composition or combination comprises the nucleic acid encoding the i53 protein, and the nucleic acid encoding the i53 protein comprises the RNA encoding the i53 protein. The RNA encoding the Cas protein, the RNA encoding the fusion protein, and the RNA encoding the i53 protein are present in lipid nanoparticles. The composition or combination comprises one or more DNAs that encode the guide RNA, The composition or combination according to any one of claims 44 to 75, wherein the one or more DNAs encoding the guide RNA and the exogenous donor nucleic acid are present in a recombinant AAV vector.

79. The guide RNA includes two adapter-binding elements to which the adapter protein can specifically bind, wherein the first adapter-binding element is located within a first loop of the guide RNA, and the second adapter-binding element is located within a second loop of the guide RNA. The adapter protein comprises the MS2 coat protein or a functional fragment or variant thereof. The composition or combination comprises the nucleic acid encoding the Cas protein, and the nucleic acid encoding the Cas protein comprises the RNA encoding the Cas protein. The composition or combination comprises the nucleic acid encoding the fusion protein, and the nucleic acid encoding the fusion protein comprises the RNA encoding the fusion protein. The composition or combination comprises the nucleic acid encoding the i53 protein, and the nucleic acid encoding the i53 protein comprises the RNA encoding the i53 protein. The composition or combination includes the guide RNA, which is in the form of RNA. The RNA encoding the Cas protein, the RNA encoding the fusion protein, the RNA encoding the i53 protein, and the guide RNA are located in lipid nanoparticles. The composition or combination according to any one of claims 44 to 75, wherein the exogenous donor nucleic acid is present in a recombinant AAV vector.

Images