Live attenuated respiratory syncytial virus

Abstract

This paper reports a novel recombinant respiratory syncytial virus (RSV) with an attenuated phenotype.The recombinant RSV strains described herein are suitable for use as live attenuated RSV vaccines.Polynucleotide sequences capable of encoding the described viruses, as well as methods for producing and using the viruses, are also provided.This paper reports an embodiment of a novel recombinant human RSV with an attenuated phenotype that is suitable for use as a live attenuated RSV vaccine.The disclosed recombinant RSV comprises one or more genetic mutations that result in an attenuated phenotype.

Description

Technical Field

[0001] Cross - reference to related applications This application claims priority to U.S. Provisional Application No. 63 / 035,617, filed on June 5, 2020, which is hereby incorporated by reference in its entirety.

[0002] Field The subject matter disclosed herein relates to respiratory syncytial virus (RSV) and attenuated mutant strains thereof suitable for use as vaccines.

[0003] Parties to a joint research agreement This invention was made under Public Health Service - Cooperative Research and Development Agreement (PHS - CRADA) No. 2013 - 0810 between the National Institute of Allergy and Infectious Diseases of the National Institutes of Health and Sanofi Pasteur, Inc.

Background Art

[0004] Background Human respiratory syncytial virus (RSV) infects nearly everyone worldwide during early childhood and is a cause of significant mortality and morbidity. In the United States alone, RSV is responsible for 75,000 - 125,000 hospitalizations each year, and conservative estimates indicate that RSV causes 64 million childhood infections and more than 160,000 childhood deaths worldwide each year. Another notable characteristic of RSV is that severe infections in infancy are frequently followed by persistent airway dysfunction, including a predisposition to airway hyperreactivity, which can persist for years in some individuals and continue into and beyond adolescence. RSV infection can exacerbate asthma and may be involved in the development of asthma.

[0005] RSV is a member of the family Pneumoviridae and is therefore an enveloped virus that replicates in the cytoplasm and matures by budding on the plasma membrane of the host cell. The RSV genome is a 15.2 kilobase negative-sense single-stranded RNA, which is transcribed into 10 mRNAs by viral polymerase via a sequential stop-start mechanism that begins at a single viral promoter at the 3' end of the genome. Each mRNA encodes a single major protein, with the exception of the M2 mRNA, which has two overlapping open reading frames (ORFs) and encodes two separate proteins, M2-1 and M2-2. The 11 RSV proteins are RNA-binding nucleoprotein (N), phosphoprotein (P), large polymerase protein (L), binding glycoprotein (G), fusion protein (F), small hydrophobic (SH) surface glycoprotein, internal matrix protein (M), two non-structural proteins NS1 and NS2, as well as the M2-1 and M2-2 proteins. The order of RSV genes is 3'-NS1-NS2-NPM-SH-GF-M2-L. Each gene is flanked by short, conserved transcription signals: a gene start (GS) signal located upstream of the gene and involved in the initiation of transcription, and a gene termination (GE) signal located downstream of the gene and involved in the direction of poly(A) tail synthesis and subsequent mRNA release. Transcription begins at the 3' end in a single promoter and proceeds sequentially.

[0006] The development of RSV vaccines has been ongoing since the 1960s, but has been complicated by many factors. For example, immunity to inactivated RSV in RSV-unsensitized infants has been shown to prime the disease upon subsequent spontaneous RSV infection, and studies in experimental animals have shown that disease enhancement is also associated with purified RSV subunit vaccines.

[0007] Another limitation of immune defense is that RSV replicates in surface cells of the respiratory airway lumen where the effectiveness of immune defense is reduced, leading to disease. Therefore, immune control of RSV infection is inefficient and often incomplete, making it crucial for RSV vaccines to be as immunogenic as possible. Another limitation for RSV vaccines is that the magnitude of the protective immune response is roughly proportional to the degree of viral replication (and antigen production). Therefore, attenuation of RSV necessary to produce a live vaccine typically involves reduced replication and antigen synthesis, as well as a corresponding reduction in immunogenicity. Thus, it is beneficial to identify a level of replication that exhibits good tolerability but still possesses satisfactory immunogenicity.

[0008] Another obstacle is that RSVs only grow to moderate titers in cell culture and are often present in long filaments that are difficult to purify. RSVs can easily lose their infectivity during handling. Another obstacle is the difficulty in identifying and generating attenuating mutations. A suitable mutation must result in attenuation in vivo, but with minimal restriction on replication in vitro, as this is preferable for efficient vaccine production. Another obstacle is the genetic instability characteristic of RNA viruses, which allows attenuating mutations to revert to wild-type (wt) assignments or alternative assignments that confer an unattenuated phenotype. Instability and deattenuation are particularly problematic for point mutations.

[0009] Considering these factors, there is a need for a bio-attenuated RSV strain that replicates efficiently in vitro, is maximally immunogenic, is satisfactorily attenuated, and is resistant to deattenuation. [Overview of the project] [Means for solving the problem]

[0010] overview This specification reports a novel recombinant human RSV embodiment having an attenuated phenotype suitable for use as a live attenuated RSV vaccine. The disclosed recombinant RSV contains one or more genetic mutations that result in an attenuated phenotype.

[0011] In some embodiments, recombinant human RSV comprises a genome containing RSV F, G, NS2, N, P, M, SH, M2, and L genes located at gene positions 1-9, respectively, wherein the F and G genes located at gene positions 1 and 2 have been moved from native gene positions 8 and 7, respectively, and the genome includes a deletion in the sequence encoding the NS1 protein, and the recombinant RSV comprises a genome that is infectious, attenuated, and self-replicating. In some embodiments, the SH gene of recombinant RSV includes a deletion at positions 4499-4610 (including both ends) corresponding to the reference RSV sequence shown in SEQ ID NO: 1, as well as C4489T, C4492T, A4495T, A4497G, and G4498A substitutions corresponding to the reference RSV sequence shown in SEQ ID NO: 1.

[0012] In some embodiments, the deletion of the sequence encoding the NS1 protein includes a deletion at positions 99–627 (including both ends) corresponding to the reference RSV sequence shown in SEQ ID NO: 1. In some embodiments, the L gene encodes an L protein containing the S1313 residue encoded by the TCA codon and the Y1314K substitution encoded by the AAA codon, the amino acid positions corresponding to the reference L protein sequence shown in SEQ ID NO: 13 (amino acid sequence of the L protein).

[0013] In some embodiments, the L gene encodes an L protein containing a deletion at S1313 and an I1314L substitution, where the amino acid positions correspond to the reference L protein sequence shown in SEQ ID NO: 13.

[0014] In some embodiments, the nucleic acid sequence encoding the F protein includes SEQ ID NO: 14 (FWT) or SEQ ID NO: 15 (FBB). In some embodiments, the recombinant RSV genome does not contain any heterologous genes. In some embodiments, the recombinant RSV genome further includes a deletion of the NS2 gene.

[0015] In some embodiments, the RSV genome includes the modifications discussed above and contains nucleotide sequences corresponding to positive sense sequences that are at least 99% identical to sequence number 3 (LID / F1G2 / ΔNS1), sequence number 4 (LID / F1BBG2 / ΔNS1), sequence number 6 (LID / F1G2 / ΔNS1 / 1030s), sequence number 7 (LID / F1BBG2 / ΔNS1 / 1030s), sequence number 9 (LID / F1G2 / ΔNS1 / Δ1313 / I1314L), or sequence number 10 (LID / F1BBG2 / ΔNS1 / Δ1313 / I1314L). For example, an RSV genome may contain, or may consist of, nucleotide sequences corresponding to positive sense sequences represented by sequence numbers 3 (LID / F1G2 / ΔNS1), 4 (LID / F1BBG2 / ΔNS1), 6 (LID / F1G2 / ΔNS1 / 1030s), 7 (LID / F1BBG2 / ΔNS1 / 1030s), 9 (LID / F1G2 / ΔNS1 / Δ1313 / I1314L), or 10 (LID / F1BBG2 / ΔNS1 / Δ1313 / I1314L).

[0016] Embodiments of recombinant RSV disclosed herein may be subtype A RSV or subtype B RSV.

[0017] Methods and compositions relating to the expression of the disclosed virus are also provided herein. For example, isolated polynucleotide molecules comprising nucleic acid sequences encoding the genome or antigenome of the described virus are provided. Further provided are methods for producing recombinant RSV, comprising transfecting a permissible cell culture with a vector comprising nucleic acid molecules comprising the genome or antigenome of the disclosed recombinant RSV, incubating the cell culture for a time sufficient to allow viral replication, and purifying the replicated recombinant RSV.

[0018] Pharmaceutical compositions containing recombinant RSV are also provided. The compositions may further comprise an adjuvant. Methods for inducing an immune response in a subject by administering an effective amount of the disclosed recombinant RSV to the subject are also disclosed. In some embodiments, the subject is a human subject, for example, a human subject aged 1 to 6 months, or 1 to 12 months, or 1 to 18 months, or older.

[0019] The aforementioned and other features and advantages of this disclosure will become more apparent from the following detailed description of some embodiments, which proceed with reference to the accompanying drawings. [Brief explanation of the drawing]

[0020] [Figure 1A-B]D46 includes deletions of NS1 (ΔNS1), deletions of NS1 and NS2 together (ΔNS1+2), and deletions and modifications of parts of the SH gene (LID mutations). (Figure 1A) Details of the ΔNS1 deletion. The 529-nt deletion (nucleotides 99-627 (including both ends)) starts and includes nucleotide 99, the first nucleotide of the ATG of the NS1 ORF, and extends to and includes nucleotide 627, the nucleotide immediately preceding the ATG (nucleotides 628-630) of the NS2 ORF. This deletion connects the untranslated region upstream of the NS1 gene to the translation start codon of the NS2 ORF. It shows the encoded amino acid MDTTHNDN (SEQ ID NO: 21). (Figure 1B) Details of the ΔNS1+2 mutation. The 1042-nt deletion (nucleotides 99-1140 (including both ends)) begins and includes nucleotide 99, the first nucleotide of the ATG of the NS1 ORF, and extends to and includes nucleotide 1140, immediately preceding the ATG (1141-1143) of the N ORF. This connects the upstream untranslated region of the NS1 gene to the translation start codon of the N ORF. It shows the encoded amino acids MALSKVKL (SEQ ID NO: 22). (Figure 1C) Details of the LID mutation. This consists of a combination of deletions that encompass most of the downstream untranslated region of the SH gene at D46, together with the last three codons and five translational silent substitutions in the termination codon of the SH ORF. The 112-nt deletion begins and includes nucleotide 4499, immediately preceding the TAG termination codon of the SH ORF, and extends to and includes nucleotide 4610, seven nucleotides upstream of the SH gene-termination signal. This deletion is combined with synonymous nucleotide substitutions C4489T, C4492T, A4495T, A4497G, and G4498A (bold and underlined). The encoded amino acid ARVNT (SEQ ID NO: 23) is shown. Note that RSV LID is generally similar to wild-type RSV and is used as a wild-type-like control in some of the following experiments. [Figure 1C] Same as above. [Figure 2A]The promoters for F and G are adjacent to F preceding G (not the native order of G preceding F) at gene positions 1 and 2, respectively, and the G and F genes have been moved from their native genomic positions (gene positions 7 and 8, respectively) (Figure 2A). Nucleotides 4630-7551 (including both ends) were deleted from the RSV antigenomic cDNA to remove the F and G genes. This has the effect of fusing the SH gene-termination signal to the F / M2 intergeneric region. This mutation is indicated by the antigenomic D46 cDNA with a LID mutation (LID mutations are indicated by white triangles above or below the SH gene), but the modification is independent of the LID mutation (Figure 2B). The G and F ORFs (shaded sequences) were reconstructed into genes in the reverse of their native order (i.e., FG instead of GF). Each ORF was flanked by short untranslated regions as well as gene start and gene termination signals and separated by short intergeneric regions consisting of single nucleotides. A nucleotide adapter containing the Xho I site (boxed in Figure 2B) was added upstream of the F ORF (CTCGAGTTCACC, XhoI site underlined, SEQ ID NO: 28) and downstream of the gene-stop-intergene-gene-start sequence (AGTTAATAAAAAATGGGGCAAATACTCGAG, XhoI site underlined, SEQ ID NO: 29) followed by the G ORF. Using four nucleotide substitutions, the XhoI site was introduced into the non-coding region preceding the NS1 ORF in the LID antigenomic cDNA shown in the lower section, which required mutations at nucleotides 88-91 in the sequence representing the upstream untranslated NS1 gene region from CTTG (uppercase) to tcga (lowercase). The encoded amino acids are shown as MELLILK (SEQ ID NO: 24), FSN, MSKN (SEQ ID NO: 25), TPRQ (SEQ ID NO: 26), and MDTT (SEQ ID NO: 27). As shown below along with the antigenome, the FG gene cassette (shaded rectangle) was inserted into the genomic cDNA using the Xho I site. [Figure 2B] Same as above. [Figure 3A]Genome map of RSV strains with various mutation combinations, including LID mutations (indicated by white triangles above the SH gene); deletions of G and F from their native positions (ΔG+F), as well as migrations to the second and first gene positions, respectively (F1G2, with F and G in the reverse of their native order GF); F1G2 (F1BBG2) where F ORF is codon-optimized; deletion of the NS1 gene (ΔNS1); addition of “stabilizing” 1030s mutations consisting of 1321K (AAA) and 1313S (TCA) in L assignment (i.e., resistance to deattenuation); addition of “stabilizing” Δ1313 and I1314L (CTG) mutations in L (i.e., resistance to deattenuation); and deletions of both the NS1 and NS2 genes (ΔNS1+2). (Figure 3A) RSV LID plus ΔNS1 deletion, remaining as or having the F1G2 or F1BBG2 modification. (Figure 3B) RSV LID / ΔNS1 plus 1030s mutation, remaining unchanged or possessing the F1G2 or F1BBG2 modification. (Figure 3C) RSV LID / ΔNS1 plus Δ1313 and I1314L mutations, remaining unchanged or possessing the F1G2 or F1BBG2 modification. (Figure 3D) RSV LID plus ΔNS1+2 deletion, remaining unchanged or possessing the F1G2 or F1BBG2 modification. [Figure 3B] Same as above. [Figure 3C] Same as above. [Figure 3D] Same as above. [Figure 4] Multicycle growth dynamics of recombinant RSV demonstrated in Vero cells. This shows that viruses with various combinations of LID, ΔNS1, F1G2, and F1BBG2 mutations replicate to reasonable titers in Vero cells, the cell substrate for vaccine production. [Figure 5]Multicycle growth dynamics of recombinant RSV demonstrated in human airway epithelial (HAE) cell cultures. HAE cultures form differentiated, polarized, pseudostratified mucociliary tissue that closely resembles true airway epithelium. Attenuated replication in these cultures is a prediction of attenuated replication in non-human primates and humans. These data indicate that viruses with ΔNS1, F1G2, and F1BBG2 variants are strongly attenuated. [Figure 6] Recombinant RSVs with various combinations of LID, F1BBG2, F1G2, and ΔNS1 mutations readily form plaques in Vero cells. [Figure 7] Recombinant RSVs with F1G2 and F1BBG2 gene transfer direct the formation of large syncytia in Vero cells during multicycle replication, consistent with increased F protein expression. An example of a syncytia is shown with an arrow. [Figure 8] Increased expression of RSV F and G proteins in Vero cells infected with recombinant RSV having F1G2 and F1BBG2 modifications. Vero cells were infected with 3 PFU / cell MOI, harvested 24 hours after infection, and analyzed by gel electrophoresis under denaturing and reducing conditions, as well as by Western blotting analysis using antibodies of indicated specificity. The levels of expression of RSV F, G, N, P, and M proteins compared to RSV LID as 1.0 are shown on the right. This indicates that gene transfer of RSV G and F increases their expression with a slight effect on other genes. [Figure 9] Increased expression of type 1 (α, β) and type 3 (λ) interferons in human respiratory A549 cells infected with recombinant RSV lacking the NS1 gene. A549 cells were infected with 3 PFU / cell MOI, and the supernatant of tissue culture medium was collected 24 hours after infection. IFN concentrations were determined by ELISA. This indicates that deletion of the RSV NS1 gene results in a substantial increase in host cell interferon expression. [Figure 10A]The presence of F1G2, F1BBG2, or ΔNS1 modification results in reduced RSV replication in the mouse airways. Six-week-old BALB / c mice were infected with the indicated RSV at doses of 104 or 106 PFU per animal, respectively. Five animals per virus and dose were sacrificed 3 days (Figure 10A) and 5 days (Figure 10B) after infection, and nasal turbinates and lungs were collected, homogenized, and viral titers were determined by plaque assay. [Figure 10B] Same as above. [Figure 11] Despite their limited replication, recombinant RSV with the indicated combinations of ΔNS1, F1G2, and F1BBG2 modifications induced titers of RSV neutralizing serum antibodies that were well comparable to those of LID virus. Animals were infected as described in Figure 10, and serum samples were collected 28 days after infection. [Figure 12] AGM data from Tables 1 and 2. [Figure 13] AGM data from Table 3. [Figure 14A]Evaluation of prime-boost titers of selected immunogens in hamsters. (Figure 14A) Study design. 96 hamsters were ensured to be RSV and HPIV3 seronegative and assigned to eight groups of 12 animals each. On day 0, groups A-D were given primary in-in infection with 106 PFU of RSV D46 in 0.1 ml of L15 medium, while groups E-H were left uninfected. After 6 weeks, serum was collected to determine the pre-boost 60% RSV plaque reduction neutralizing titer (RSV-PRNT). Two days later, primed and non-primed groups were paired and in-boiled with one of four viruses: (i) empty rB / HPIV3 vector (groups A and E); (ii) DS-Cav1 vector (groups B and F); (iii) DS-Cav1 / B3TMCT vector (groups C and G); and (iv) RSV D46 (groups D and H) (105 TCID50 for the vector and 106 PFU for RSV). Five days after boosting, nasal turbinates (NTs) and lungs from six hamsters per group were collected for viral titration. Serum from the other six hamsters per group was collected two weeks after boosting to measure RSV-PRNTs and HPIV3-PRNTs, and two days later, the animals were in-challenged with 106 PFU of RSV D46. Three days after challenging, NTs and lungs were collected for RSV replication titration. (Figures 14B, 14C) Titers of boosting virus in (Figure 14B) NT and (Figure 14C) lung tissue homogenates 5 days after boosting. Dashed and dotted lines indicate the limit of detection (LOD) for rB / HPIV3 vector and RSV D46, respectively. (Figure 14D) Serum HPIV3-PRNT 2 weeks after boosting in primed and non-primed hamsters assayed without complement. (Figures 14E, 14F) Serum RSV-PRNT before and after boosting in animals from groups A-D primed with RSV D46 and boosted with the indicated virus, assayed with (Figure 14E) and without (Figure 14F) complement supplementation.The significance of the differences between the comparisons shown was determined by Student's t-test: ns indicates no significance (P > 0.05); * indicates 0.01 < P < 0.05; ** indicates 0.001 < P < 0.01; *** indicates 0.0001 < P < 0.001. [Figure 14B-D] The same as above. [Figure 14E-F] The same as above. [Figure 15A-C]AGM Experiment No. 1: Viral replication and serum RSV-PRNT in AGM when the interval between priming and boosting was approximately 2 months (2 months minus 9 days). (Figure 15A) Study design. Twelve AGMs were pre-infected with one of three RSVs (Table 8) by the combined IN / IT route. Serum was collected on day 37 (2 weeks before boosting), and RSV-PRNT was determined in the presence of complement. The AGMs were divided into two groups of six animals each balanced with respect to RSV-PRNT on day 37, identity of the priming virus, and sex ratio (Table 8). On day 51 after priming (2 months minus 9 days), the groups were boosted with RSV 276 (ΔM2-2 virus; SEQ ID NO: 12) or the DS-Cav1 / B3TMCT vector by the combined IN / IT route. Viral shedding was monitored by NP and TL as well as viral titration on days 1 to 10 after boosting. Serum was collected on days 7, 14, 21, and 28 after boosting. (Figures 15B, 15C) Virus titers in (Figure 15B) NP and (Figure 15C) TL shown as mean with brackets indicating SEM, and the limit of detection shown as dashed line (vector) and dotted line (RSV). (Figure 15D) Serum RSV-PRNT on day 37 after priming and on days 0, 7, 14, 21, and 28 after boosting assayed in the presence of complement. (Figure 15E) Serum RSV-PRNT on days 0, 7, 14, 21, and 28 after boosting assayed without complement. D and E are annotated to show the mean serum RSV-PRNT (black dashed line, showing the arithmetic mean) for the two combined groups at the time of boosting, and in addition, the colored dashed lines show the highest mean serum RSV-PRNT for each group along with the arithmetic values shown. The mean serum RSV-PRNT is shown with brackets indicating SEM. The peak mean titers of the two groups were compared by Student's t-test: * indicates 0.001 < P < 0.01; *** indicates 0.0001 < P < 0.001. [Figure 15D-E] Same as above. [Figure 16A-C]AGM Experiment No. 2: Viral replication and serum RSV-PRNT in AGMs when the interval between priming and boosting was approximately 6 months (6 months plus 9 days). (Figure 16A) Study design. Twenty AGMs were pre-infected with primary infection using one of five attenuated RSVs (Table 9) via a combination of IN / IT pathways. Serums were collected on days 28 and 154 (the latter 35 days before boosting), and RSV-PRNT was determined in the presence of complement. The AGMs were divided into three balanced groups (n=6, 7, and 7) based on serum RSV-PRNT at day 154, priming virus identity, and sex ratio (Table 9). 189 days (6 months plus 9 days) after priming, the groups were boosted with one of three viruses: (i) RSV 276 (n=6), (ii) DS-Cav1 vector (n=7), or (iii) DS-Cav1 / B3TMCT vector (n=7). Viral shedding and serum RSV-PRNT were monitored as described in the legend in Figure 15. Nasal mucosal lining fluid was collected for IgA analysis using SAM strips on days 0, 14, 21, and 28 after boosting (see Methods and Materials for details). (Figures 16B, 16C) Viral titers in NPs (Figure 16B) and TLs (Figure 16C) were determined and shown as mean with brackets indicating the standard error of the mean (SEM), with detection limits shown as dashed lines (vector) and dotted lines (RSV). (Figure 16D) Serum RSV-PRNT assayed with complement at 28, 154, and 189 days post-priming, and 7, 14, 21, and 28 days post-boosting. (Figure 16E) RSV-PRNT assayed without complement at 0, 7, 14, 21, and 28 days post-boosting, shown as mean with brackets showing SEM. D and E are annotated to show mean serum RSV-PRNT (black dashed lines, showing mean arithmetic values) for three combined groups at boosting time points, and in addition, colored dashed lines show the highest mean RSV-PRNT for each group, along with given arithmetic values. (Figures 16F, 16G) Serum and nasal mucosa IgA response in AGM.The IgA antibody titers were determined in serum samples collected at 0, 7, 14, 21, and 28 days after boosting (Figure 16F), and in nasal mucosal lavage fluids collected at 0, 14, 21, and 28 days after boosting (Figure 16G). (Note that in the DS-Cav1 / BTMCT group, one of the 28-day SAM specimens did not provide sufficient volume, and thus the mean titer for the DS-Cav1 / BTMCT vector at day 28 was calculated for only 6 animals). IgA titers were measured by binding to purified RSV DS-Cav1 F protein in a DELFIA TRF assay. Antibody titers are given as the log2 dilution of serum or mucosal specimens that yield 400 fluorescence units, and are shown as the mean with brackets indicating SEM. The mean antibody titers for the combined three groups at the boost time point (day 0) are shown by the larger black dotted line, and the titers of all SAM samples at day 0 were below the detection level (5.3 log2). The limit of detection (LOD) is shown by the smaller black dotted line. The colored dashed lines indicate the highest mean antibody titers for each group. The peak mean titers of the three groups were compared pairwise by Student's t-test (GraphPad Prism): * indicates 0.01 < P < 0.05; ** indicates 0.001 < P < 0.01; *** indicates 0.0001 < P < 0.001; ns indicates P > 0.05, no significance. [Figure 16D-E] Same as above. [Figure 16F-G] Same as above. [Figure 17A-C]AGM Experiment No. 3: Viral replication and serum RSV-PRNT in AGMs when the interval between priming and boosting was approximately 15 months (15 months minus 7 days). (Figure 17A) Study design. Four AGMs were pre-treated with primary infection using the live attenuated vaccine candidate RSV 276 (Table 10). Serum was collected on day 429 (two weeks before boosting), and RSV-PRNT was determined with complement. The AGMs were allocated to two groups of two animals each, so that each group had similar individuals and mean RSV-PRNT based on the serum at day 429 (Table 10). Serum was collected 443 days post-priming (15 months minus 7 days), and the two groups were boosted with DS-Cav1 / B3TMCT vector (n=2) or RSV 276 (n=2) administered in and out at doses of 106 TCID50 (DS-Cav1 / B3TMCT vector) or PFU (RSV 276) per site. Viral replication and serological response were monitored as described in the legends of Figures 15 and 16. (Figures 17B, 17C) Viral titers in (Figure 17B) NP and (Figure 17C) TL, shown as mean values ​​with detection limits shown as dashed lines. Symbols indicate titers for individual animals, and lines indicate mean values. (Figure 17D) Serum RSV-PRNT assayed with complement at 429 days post-priming, and at 0, 7, 14, 21, and 28 days post-boosting. (Figure 17E) Serum RSV-PRNT at 0, 7, 14, 21, and 28 days post-boosting, assayed without complement. D is annotated to show the mean serum RSV-PRNT for two combined groups at boosting time (black dashed line in D, showing mean arithmetic value 1:26), and in addition, D and E are annotated with colored dashed lines showing the highest mean serum RSV-PRNT for each group, along with the arithmetic values ​​shown. [Figure 17D-E] Same as above. [Figure 18]Multicycle replication of rB / HPIV3 vectors in vitro in the presence or absence of RSV neutralizing antibodies. LLC-MK2 cells were infected with empty rB / HPIV3 vector (Figure 18A), DS-Cav1 vector (Figure 18B), or DS-Cav1 / B3TMCT vector (Figure 18C) at an MOI of 0.01 TCID50 per cell. After 1 hour of adsorption, the cells were washed three times with cell culture medium and then incubated with culture medium containing one of the following 10% serums (pre-heated at 56°C for 30 minutes): pre-immunized hamster serum, or pooled serum from hamsters infected with RSV D46 or empty rB / HPIV3 vector in the absence of supplemented complement. The hamster serum was from the experiment shown in Figure 14. Different treatments were performed in three consecutive cycles. Aliquots of the medium were collected daily for three consecutive days after infection, rapidly frozen, and viral titers were determined. The significance of the difference between replication in the presence of preimmunized serum and RSV-immunized serum was determined by Student's t-test:*, P<0.05;**, P<0.01. [Figure 19] Replication of RSV 276 and wt rRSV in RSV seronegative AGMs. RSV seronegative AGMs were infected with 106 PFU of RSV 276 (n=8) or wt rRSV (n=4) by a combination of IN / IT pathways with 1 mL of inoculation per site. NPs and TLs were collected daily and every other day for 10 days, plus on day 12, respectively. Viral titers were determined by immunoplaque assay and are shown as group mean for each time point. Brackets indicate SEM, and the limit of detection is indicated by a dotted line. The eight animals infected with RSV 276 are shown here in Tables 8 and 10, and were subsequently boosted in AGM experiments 1 and 3. [Figure 20]Replication of boosting RSV 276 in tracheal lavage (TL) from AGMs primed with attenuated RSV approximately 6 months earlier. From the experiment in Figure 16, the titer of RSV 276 in TLs at 2, 4, 6, 8, and 10 days post-boosting was quantified by immunoplaque assay (Figure 20A) and RT-qPCR specific to both positive and negative sense RSV M gene sequences (Figure 20B). Each color represents an individual monkey. The detection limit is indicated by a dotted line. [Figure 21] Serum HPIV3-PRNT induced by DS-Cav1 and DS-Cav1 / B3TMCT vectors in AGM primed with live attenuated RSV 6 months earlier. From the experiment in Figure 16, serum collected 2 weeks after boosting with DS-Cav1 and DS-Cav1 / B3TMCT vectors was analyzed by complement-free HPIV3 PRNT assay. Dots represent individual animals, and the group mean is shown by a short horizontal line. The dotted line indicates the limit of detection. Mean serum HPIV3-PRNT of the two groups were compared by Student's t-test: ns indicates P>0.05, no significance. [Modes for carrying out the invention]

[0021] Sequence List The nucleic acid and amino acid sequences listed in the attached sequence listing are indicated using standard letter abbreviations for nucleotide bases and three-letter codes for amino acids as defined in 37 CFR 1.822. Only one strand of each nucleic acid sequence is shown, but complementary strands are understood to be included by any reference to the presented strand. The sequence listing was submitted as an ASCII text file in the form of a file named "Sequence.txt" (approximately 356kb) created on June 4, 2021, which is incorporated herein by reference. The attached sequence listing is as follows: Sequence ID 1 is the antigenogenic nucleic acid sequence of RSV D46. Sequence ID 2 is the antigenogenic nucleic acid sequence of RSV LID / ΔNS1. Sequence ID 3 is the antigenogenic nucleic acid sequence for RSV LID / F1G2 / ΔNS1. Sequence ID 4 is the antigenogenic nucleic acid sequence for RSV LID / F1BBG2 / ΔNS1. Sequence ID 5 is the antigenome nucleic acid sequence of RSV LID / ΔNS1 / 1030s. Sequence ID 6 is the antigenogenic nucleic acid sequence for RSV LID / F1G2 / ΔNS1 / 1030s. Sequence ID 7 is the antigenogenic nucleic acid sequence for RSV LID / F1BBG2 / ΔNS1 / 1030s. Sequence ID 8 is the antigenogenic nucleic acid sequence for RSV LID / ΔNS1 / Δ1313 / I1314L. Sequence ID 9 is the antigenogenic nucleic acid sequence for RSV LID / F1G2 / ΔNS1 / Δ1313 / I1314L. Sequence ID 10 is the antigenogenic nucleic acid sequence for RSV LID / F1BBG2 / ΔNS1 / Δ1313 / I1314L. Sequence ID 11 is the antigenogenic nucleic acid sequence for RSV D46 / NS2 / N / ΔM2-2-HindIII. Sequence ID 12 is the antigenome nucleic acid sequence of the RSV 276 genome. Sequence ID 13 is the amino acid sequence of the L protein derived from D46. Sequence ID 14 is the amino acid sequence of the RSV F protein derived from D46. Sequence ID 15 is the amino acid sequence of the RSV FBB protein. Sequence ID 16 is the antigenome sequence of B / HPIV3 DS-Cav1. Sequence ID 17 is the antigenome sequence for B / HPIV3 DS-Cav1 / B3TMCT. Sequence ID 18 is the antigenome sequence of RSV LID / ΔNS2 / 1030s. Sequence ID 19 is the antigenome sequence for RSV LID / ΔNS2 / Δ1313 / I1314L. Sequence IDs 20-29 are fragments of DNA and protein sequences.

[0022] Detailed explanation Major challenges in developing a pediatric vaccine against RSV include the immaturity of the immune system during infancy, immunosuppression by maternal antibodies, inefficient immune defense in the superficial epithelium of the airways, suppression of host interferons and viral suppression of host responses such as apoptotic responses by NS1 and NS2, and enhanced vaccine-induced disease observed in studies with inactivated or subunit RSV vaccines in virus-unsensitized recipients (Kim et al., Amer. J. Epidemiol. 89:422-434, 1969; Ottolini et al., Viral Immunol. 13:231-236, 2000; Schneider-Ohrum et al., J. Virol. 91:e02180-16, 2017). Therefore, despite considerable effort, the need for effective immunogens that induce a protective immune response against RSV remains.

[0023] This disclosure provides recombinant RSV that is attenuated, infectious, self-replicating, and satisfies the requirements discussed above.

[0024] I. Overview of Terminology Unless otherwise specified, technical terms will be used according to their conventional usage. Definitions of common terms in molecular biology can be found in Benjamin Lewin, Genes X, published by Jones & Bartlett Publishers, 2009; and Meyers et al. (eds.), The Encyclopedia of Cell Biology and Molecular Medicine, published by Wiley-VCH in 16 volumes, 2008; and other similar references.

[0025] As used herein, the term “comprises” means “includes.” Many methods and materials similar or equivalent to those described herein can be used, but particularly preferred methods and materials are described herein. In case of any conflict, this specification, including the definitions of terms, shall prevail. In addition, materials, methods, and examples are illustrative and not intended to be limiting. To facilitate review of various embodiments, the following definitions of terms are provided.

[0026] Approximately: Plus or minus 5% of the indicated quantity. For example, "approximately 5" refers to a range of 4.75 to 5.25. The ratio "approximately 5:1" refers to a ratio between 4.75:1 and 5.25:1.

[0027] Adjuvant: A medium used to enhance antigenicity. Examples of adjuvants include suspensions of minerals (alum, aluminum hydroxide, or phosphates) on which the antigen is adsorbed; or water-in-oil emulsions, such as a water-in-oil emulsion in which the antigen solution is emulsified in mineral oil (Freund's incomplete adjuvant), sometimes containing mycobacterial killers to further enhance antigenicity (inhibiting antigen degradation and / or inducing macrophage influx) (Freund's complete adjuvant). Immunostimulatory oligonucleotides (such as those containing CpG motifs) can also be used as adjuvants. Examples of adjuvants include biological molecules ("biological adjuvants"), such as co-stimulatory molecules. Exemplary adjuvants include IL-2, RANTES, GM-CSF, TNF-α, IFN-γ, G-CSF, LFA-3, CD72, B7-1, B7-2, OX-40L, 4-1BBL, immunostimulatory complex (ISCOM) matrices, and Toll-like receptor (TLR) agonists, such as TLR-9 agonists, poly-I:C, or poly-ICLC. Adjuvants are described, for example, in Singh (ed.) Vaccine Adjuvants and Delivery Systems. Wiley-Interscience, 2007.

[0028] Administration: Introduction of the composition to the subject via the selected route. Administration may be topical or systemic. For example, if the selected route is intranasal, the composition (such as the composition containing the disclosed attenuated RSV) is administered by introducing the composition into the subject's nasal passages. Exemplary routes of administration include, but are not limited to, oral, injection (subcutaneous, intramuscular, intradermal, intraperitoneal, and intravenous, etc.), sublingual, rectal, percutaneous (e.g., topical), intranasal, vaginal, and inhalation routes.

[0029] Amino acid substitution: The replacement of one amino acid in a polypeptide with a different amino acid.

[0030] Attenuated: A virus that is “attenuated” or has an “attenuated phenotype” refers to a virus that, under similar infection conditions, exhibits reduced pathogenicity compared to a reference virus. Attenuation is usually associated with reduced viral replication compared to the replication of a reference wild-type virus under similar infection conditions; therefore, “attenuated” and “restricted replication” are often used synonymously. In some hosts (typically non-natural hosts, including laboratory animals), the disease is not evident during infection with the reference virus in question, and restricted viral replication can be used as an alternative marker for attenuation. In some embodiments, the disclosed attenuated RSV exhibits a reduction in viral titer in the upper or lower respiratory tract of a mammal to at least about one-tenth or less, e.g., at least about one-hundredth or less, compared to the titer of an unattenuated wild-type virus in the upper or lower respiratory tract of a mammal of the same species, under the same infection conditions. Examples of mammals include, but are not limited to, humans, mice, rabbits, rats, hamsters such as Mesocricetus auratus, and non-human primates such as Ceropisthicus aethiops. Attenuated RSV may present different phenotypes, but are not limited to, altered growth, temperature-sensitive growth, host-range-limited growth, or altered plaque size.

[0031] Control: Reference standard. In some embodiments, the control is a negative control sample obtained from a healthy patient. In other embodiments, the control is a positive control sample obtained from a patient diagnosed with RSV infection. In yet another embodiment, the control is a historical control or a reference value or range of values ​​of the standard (e.g., a pre-tested control sample, e.g., a group of RSV patients with a known prognosis or outcome, or a group of samples representing baseline or normal values).

[0032] The difference between the test sample and the control may be an increase or a decrease. The difference may be a qualitative or quantitative difference, for example, a statistically significant difference. In some cases, the difference is an increase or decrease of at least about 5% compared to the control, for example, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100%, at least about 150%, at least about 200%, at least about 250%, at least about 300%, at least about 350%, at least about 400%, at least about 500%, or greater than 500%.

[0033] Effective dose: The amount of drug sufficient to induce the desired response, e.g., an immune response in a subject. It is understood that obtaining a protective immune response against a target virus may require multiple doses of the disclosed immunogen, and / or administration of the disclosed immunogen as a "prime" in a prime-boost protocol, where the boost immunogen may differ from the prime immunogen. Therefore, the effective dose of the disclosed immunogen may be the amount of immunogen sufficient to induce priming of an immune response in a subject that may subsequently be boosted with the same or a different immunogen to induce a protective immune response.

[0034] For example, the desired response is to inhibit, reduce, or prevent RSV infection. RSV infection does not need to be completely eliminated, reduced, or prevented for the method to be effective. For instance, administration of an effective dose of a drug can reduce RSV infection by, depending on the desired dose, to, for example, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, or even further to at least 100% (elimination or prevention of detectable RSV infection) compared to a suitable control (e.g., measured by the number or percentage of infected cells or objects infected with RSV).

[0035] Gene: A nucleic acid sequence, whether mRNA or of another type, that includes regulatory and coding sequences necessary for the transcription of RNA. For example, a gene may include a promoter, one or more enhancers or silencers, a nucleic acid sequence encoding RNA and / or polypeptides, a downstream regulatory sequence, and optionally other nucleic acid sequences involved in regulating mRNA expression.

[0036] In this specification, “gene” in recombinant RSV refers to a portion of the recombinant RSV that codes for mRNA, typically initiated at the upstream (3') end by a gene start (GS) signal and terminated at the downstream (5') end by a gene stop (GE) signal. In this context, the term “gene” also includes what is called a “translation open reading frame” or ORF, particularly when the protein is expressed from an additional ORF rather than its own mRNA. To construct the disclosed recombinant RSV, one or more genes or genomic segments may be deleted, inserted, or replaced, either whole or in part.

[0037] Heterogeneous: Derived from a different genetic origin. Heterogeneous genes included in a recombinant genome are genes that do not originate from that genome.

[0038] Host cell: A cell on which a vector can be replicated and whose nucleic acid can be expressed. The cell may be a prokaryotic or eukaryotic cell. This term also includes any offspring of the host cell in question. It is understood that not all offspring may be identical to the parent cell, as mutations may occur during replication. However, when the term "host cell" is used, such offspring are included.

[0039] Infectious and self-replicating viruses: Viruses that can invade and replicate in cultured cells or the cells of animal or human hosts, producing progeny viruses with the same activity.

[0040] Immune response: The response of cells of the immune system, such as B cells, T cells, or monocytes, to a stimulus. In one embodiment, the response is specific to a particular antigen ("antigen-specific response"). In one embodiment, the immune response is a T cell response, such as a CD4+ response or a CD8+ response. In another embodiment, the response is a B cell response, resulting in the production of a specific antibody.

[0041] Immunogenic composition: A preparation of immunogenic material that can stimulate an immune response, which in some cases may be administered for the prevention, alleviation, or treatment of infectious diseases or other types of diseases. Immunogenic materials may include attenuated or killed microorganisms (such as bacteria or viruses), or antigenic proteins, peptides, or DNA derived therefrom. An immunogenic composition contains an antigen (such as a virus) that induces a measurable T-cell response to the antigen or a measurable B-cell response (such as antibody production) to the antigen. In one example, an immunogenic composition contains a disclosed recombinant RSV that, when administered to a subject, induces a measurable CTL response and / or a measurable B-cell response (such as antibody production) to RSV. For in vivo use, an immunogenic composition typically contains a recombinant virus in a pharmaceutically acceptable carrier and may also contain other active agents, such as adjuvants.

[0042] Isolated: An “isolated” biological component is substantially separated or purified from other biological components, e.g., other biological components in naturally occurring components, e.g., other chromosomes and extrachromosome DNA, RNA, and proteins. “Isolated” proteins, peptides, nucleic acids, and viruses include those purified by standard purification methods. Isolated may include proteins, peptides, nucleic acids, or viral molecules that do not require absolute purity and are at least 50% pure, e.g., at least 75%, 80%, 90%, 95%, 98%, 99%, or even 99.9% pure.

[0043] Nucleic acid molecules: polymeric forms of nucleotides that may include RNA, cDNA, both sense and antisense strands of genomic DNA, as well as the synthetic and mixed polymers of the above. Nucleotides refer to ribonucleotides, deoxynucleotides, or modified forms of any type of nucleotide. The term “nucleic acid molecule” is synonymous with “polynucleotide” as used herein. Nucleic acid molecules are typically at least 10 nucleotides long unless otherwise specified. The term includes single-stranded and double-stranded forms of DNA. Nucleic acid molecules may include either or both naturally occurring nucleotides and modified nucleotides linked together by the linkage of naturally occurring nucleotides and / or non-naturally occurring nucleotides.

[0044] Operablely linked: A first nucleic acid sequence is operably linked to a second nucleic acid sequence if the first nucleic acid sequence is functionally related to the second nucleic acid sequence. For example, a promoter is operably linked to a coding sequence if the promoter affects the transcription or expression of the coding sequence. Generally, operably linked nucleic acid sequences are contiguous and, if two protein-coding regions need to be linked, they are in the same reading frame.

[0045] Pharmacoherent carriers: The pharmaceutically acceptable carriers used are conventional ones. Remington's Pharmaceutical Sciences, by EW Martin, Mack Publishing Co., Easton, PA, 19th Edition, 1995 describes suitable compositions and formulations for the pharmaceutically acceptable delivery of the disclosed immunogen.

[0046] Generally, the characteristics of the carrier depend on the specific mode of administration used. For example, parenteral formulations typically contain an injectable fluid, such as a pharmaceutically and physiologically acceptable fluid, e.g., water, saline, equilibrium salt solution, aqueous dextrose, glycerol, etc., as the medium. In addition to a biologically neutral carrier, the administered pharmaceutical composition may contain trace amounts of non-toxic adjuncts, such as wetting or emulsifying agents, preservatives, and pH buffers, e.g., sodium acetate or sorbitan monolaurate. In certain embodiments, a carrier suitable for administration to a subject may be sterile and / or suspended in a unit dosage form containing one or more measured doses of compositions suitable for inducing a desired immune response, or may instead be contained therein. It may also be accompanied by a pharmacotherapy for its use for therapeutic purposes. The unit dosage form may be, for example, a sealed vial containing sterile contents, or in a syringe for injection to a subject, or it may be lyophilized for subsequent solubilization and administration, or it may be in solid form or in controlled-release doses.

[0047] Polypeptide: Any chain of amino acids, regardless of length or post-translational modifications (e.g., glycosylation or phosphorylation). “Polypeptide” applies to amino acid polymers, including naturally occurring and non-naturally occurring amino acid polymers, as well as those in which one or more amino acid residues are non-natural amino acids, such as artificial chemical mimics of corresponding naturally occurring amino acids. “Residue” refers to an amino acid or amino acid mimic incorporated into the polypeptide by an amide bond or amide bond mimic. Polypeptides have an amino terminus (N-terminus) and a carboxyl terminus (C-terminus). “Polypeptide” is used interchangeably with peptide or protein and is used herein to refer to a polymer of amino acid residues.

[0048] Prime-boost immunization: An immunotherapy protocol comprising administering a first immunogenic composition to a subject (prime immunization) and subsequently administering a second immunogenic composition (boost immunization) to induce a desired immune response. Preferred time intervals between prime and boost administrations and examples of such timeframes are disclosed herein. In some embodiments, the prime, boost, or both prime and boost further comprise an adjuvant.

[0049] Recombinant: Recombinant nucleic acid molecules, proteins, or viruses are typically produced from cloned cDNA by recombinant DNA methods. The cDNA sequence may be identical to the sequence of a biologically derived molecule, or it may contain a sequence that does not exist in nature: for example, a sequence containing one or more nucleic acid substitutions, deletions, or insertions, and / or a sequence created by an artificial combination of two isolated sequence segments. This artificial combination can be achieved, for example, by chemosynthesis, targeted mutation of naturally occurring nucleic acid molecules or proteins, or artificial manipulation of isolated nucleic acid segments, such as genetic engineering techniques.

[0050] Respiratory syncytial virus (RSV): An enveloped, unsegmented, negative-sense single-stranded RNA virus belonging to the genus Orthopneumovirus in the family Pneumoviridae. The RSV genome is approximately 15,000 nucleotides long (15,223 for KT 992094) and contains 10 genes encoding 11 proteins, including glycoproteins SH, G, and F. The F protein mediates fusion, enabling viral entry into the cytoplasm and also promoting syncytial formation. Based primarily on differences in the antigenicity of the G glycoprotein, two antigenic subgroups of human RSV strains, subgroup A and subgroup B, have been described. RSV strains from other species, including bovine RSV, are also known. Several animal models of infection with human RSV and closely related animal counterparts are available, including model organisms infected with human RSV and model organisms infected with species-specific RSVs, such as the use of bRSV infection in cattle (see, for example, Bern et al., Am J, Physiol. Lung Cell Mol. Physiol., 301: L148-L156, 2011; and Nam and Kun (Eds.). Respiratory Syncytial Virus: Prevention, Diagnosis and Treatment. Nova Biomedical Nova Science Publisher, 2011; and Cane (Ed.) Respiratory Syncytial Virus. Elsevier Science, 2007).

[0051] Unless otherwise indicated by context, the positioning of RSV nucleic acid residues follows the reference RSV antigenome sequence provided herein as Sequence ID No. 1, which is the RSV strain A2 antigenome sequence also provided as Genbank accession number KT 992094.1 (incorporated herein by reference) and described in Collins, et al., Proc Natl Acad Sci USA, 92:11563-11567 1995. This sequence is also known as the “D46” antigenome RSV sequence.

[0052] Sequence identity: The percentage of nucleotide or amino acid sequence assignments that are identical between two or more nucleotide or amino acid sequences being compared, with a gap allowed to maximize the identity percentage. A higher percentage indicates that the two sequences are more similar. Homologs, orthologues, or variants of polypeptides have a relatively high degree of sequence identity when aligned using standard methods.

[0053] Methods for aligning sequences for comparison are well known in the art. Various programs and alignment algorithms are cited in Smith & Waterman, Adv. Appl. Math. 2:482, 1981; Needleman & Wunsch, J. Mol. Biol. 48:443, 1970; Pearson & Lipman, Proc. Natl. Acad. Sci. USA 85:2444, 1988; Higgins & Sharp, Gene, 73:237-44, 1988; Higgins & Sharp, CABIOS 5:151-3, 1989; Corpet et al., Nuc. Acids Res. 16:10881-90, 1988; Huang et al. Computer Appls. In the Biosciences 8, 155-65, 1992; and Pearson et al., Meth. Mol. Bio. 24:307-31. This was described in 1994. Altschul et al., J. Mol. Biol. 215:403-10, 1990, presents a detailed discussion of sequence alignment methods and homology calculations.

[0054] Polypeptide variants are typically characterized by possessing at least about 75% sequence identity, e.g., at least about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, as counted against full-length alignment with the amino acid sequence of interest. Proteins with greater similarity to the reference sequence will exhibit increased identity percentages, e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99%, when evaluated by this method. When fewer sequences than the whole are compared for sequence identity, homologs and variants typically have at least 80% sequence identity over a short window of 10–20 amino acids, and may have at least 85%, or at least 90% or 95%, depending on their similarity to the reference sequence. Methods for determining sequence identity over such short windows are available on the NCBI website on the internet.

[0055] As used herein, a reference to “at least 90% identity” (or similar phrase) means “at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or even 100% identity” with a given reference array.

[0056] Subjects: Living multicellular vertebrates, a category that includes humans and non-human mammals. In some cases, the subject is human. In specific cases, the subject is a newborn. Additional cases are selected for subjects that require inhibition of RSV infection. For example, subjects requiring treatment are either not infected and at risk of RSV infection, or are infected.

[0057] Under sufficient conditions for: A phrase used to describe any environment that allows the desired activity.

[0058] II. Recombinant RSV Mutations useful for producing recombinant human RSV strains that exhibit a range of attenuated phenotypes and are suitable for use as attenuated live vaccines in humans are disclosed herein. As reported herein, certain combinations of mutations against wtRSV result in live attenuated viruses that induce a superior immune response.

[0059] Methods and compositions relating to the expression of the disclosed virus are further disclosed herein. For example, isolated polynucleotide molecules containing nucleic acid sequences encoding the genome or antigenome of the described virus are disclosed.

[0060] The recombinant RSV provided herein includes a genome or antigenome containing modifications or mutations described herein that attenuate recombinant RSV compared to wild-type RSV, as detailed herein. The wild-type RSV genome or antigenome encodes the following 11 proteins: RNA-binding nucleoprotein (N), phosphoprotein (P), large polymerase protein (L), binding surface glycoprotein (G), fusion surface glycoprotein (F), small hydrophobic surface glycoprotein (SH), internal matrix protein (M), two non-structural proteins NS1 and NS2, and M2-1 and M2-2 proteins. The RSV genome is a single strand of negative sense RNA of approximately 15.2 kb containing 10 genes encoding 10 mRNAs. Each mRNA encodes a single protein, with the exception of the M2 mRNA which encodes two separate proteins, M2-1 and M2-2. The order of the RSV genes is 3'-NS1-NS2-NPM-SH-GF-M2-L, with a single viral promoter located at the 3' end. Therefore, in the native RSV genome, NS1 is located at position 1, NS2 at position 2, N at position 3, P at position 4, M at position 5, SH at position 6, G at position 7, F at position 8, M2 at position 9, and L at position 10. This tissue is schematically shown in Figure 1C.

[0061] In some embodiments, the recombinant RSV provided herein comprises a genome having the RSV F, G, NS2, N, P, M, SH, M2, and L genes located at gene positions 1–9, respectively, where the F and G genes located at gene positions 1 and 2 are migrated from native gene positions 8 and 7, respectively. The recombinant RSV genome further comprises modifications that delete a sequence encoding the NS1 protein. In some embodiments, the deletion includes deletions at positions 99–626 corresponding to the reference RSV sequence shown in SEQ ID NO: 1 (wt recombinant RSV strain A2, Genbank KT 992094). In some embodiments, the recombinant RSV genome provided herein further comprises a 112-nucleotide deletion corresponding to positions 4499–4610 (including both ends) corresponding to the reference RSV sequence shown in SEQ ID NO: 1, as well as C4489T, C4492T, A4495T, A4497G, and G4498A of SEQ ID NO: 1. These deletions and 5-nucleotide substitutions are collectively referred to as "LID" mutations or modifications. As discussed in the examples below, novel combinations of these modifications to the native RSV genome result in recombinant RSVs that elicit a superior immune response.

[0062] Where used herein, virus names are descriptive, not restrictive, unless the context indicates otherwise. The complete set of modifications or mutations in each virus is not necessarily fully listed by its name. In addition, unless the context indicates otherwise, the order of appearance of modifications / mutations and the forward slashes in virus names can vary; for example, "LID / F1G2 / ΔNS1" is the same as "LID / ΔNS1 / F1G1".

[0063] In some embodiments, the recombinant RSV provided herein comprises a genome containing a deletion of a sequence encoding the NS1 protein, wherein the deletion is a (of) deletion at positions 99-627 corresponding to the reference RSV sequence shown in SEQ ID NO: 1, and the recombinant RSV comprises a genome that is infectious, attenuated, and self-replicating. In some such embodiments, the recombinant RSV genome provided herein further comprises a 112-nucleotide deletion corresponding to positions 4499-4610 (including both ends) corresponding to the reference RSV sequence shown in SEQ ID NO: 1, as well as C4489T, C4492T, A4495T, A4497G, and G4498A of SEQ ID NO: 1. As discussed in the examples below, novel combinations of these modifications to the native RSV genome result in recombinant RSV that elicits a superior immune response.

[0064] In some embodiments, recombinant RSV further comprises an L protein containing the S1313 residue encoded by the TCA codon and the Y1314K substitution encoded by the AAA codon, with amino acid positions corresponding to the reference L protein sequence shown in SEQ ID NO: 13 (amino acid sequence of the L protein). This pair of mutations is called "1030s" and has been developed and optimized by reverse genetics to be highly resistant to deattenuation (Luongo, et al. 2012. J Virol 86:10792-10804).

[0065] In some embodiments, recombinant RSV further comprises an L protein containing a deletion at S1313 and an I1314L substitution, with amino acid positions corresponding to the reference L protein sequence shown in SEQ ID NO: 13. This pair of mutations is called "Δ1313 / I1314L" and has been developed and optimized by reverse genetics to be highly resistant to deattenuation (Luongo, et al. 2013. J Virol 87:1985-1996).

[0066] In some embodiments, the F protein of recombinant RSV is encoded by a wild-type sequence, e.g., SEQ ID NO: 14. In other embodiments, recombinant RSV may contain one or more changes in the F protein sequence. For example, in some embodiments, the native or naturally occurring nucleotide sequence encoding the RSV protein may be replaced with a codon-optimized sequence designed for increased expression in a selected host, particularly humans. For example, in some embodiments, the F protein of recombinant RSV is encoded by a codon-optimized sequence FBB ("FBB") ​​(SEQ ID NO: 15). Different versions of codon optimization can be obtained.

[0067] In some embodiments, the recombinant RSV genome does not contain any heterologous genes.

[0068] In some embodiments, the recombinant RSV genome includes one or more of the mutations discussed above and a nucleic acid sequence complementary to an antigenome sequence that is at least 90% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical to SEQ ID NO: 1 (D46 sequence). In some embodiments, the recombinant RSV genome is a D46 genome modified with one or more of the mutations discussed above. In some embodiments, the recombinant RSV genome includes one or more of the mutations discussed herein, and any remaining sequence differences of the recombinant RSV genome compared to the D46 RSV (SEQ ID NO: 1) genome sequence are not biologically significant (e.g., the remaining sequence differences do not include changes to the wild-type genome sequence that alter known cis-acting signals, change amino acid coding, or have a measurable effect on viral in vitro replication or plaque size).

[0069] The embodiments of recombinant RSV disclosed herein may be subtype A RSV or subtype B RSV. The embodiments of recombinant RSV disclosed herein are infectious, attenuated, and self-replicating.

[0070] In some embodiments, recombinant RSV comprises an RSV genome including the RSV NS2, N, P, M, SH, G, F M2, and L genes located at gene positions 1-9, wherein the genome includes a deletion of the sequence encoding the NS1 protein. In some such embodiments, the SH gene of recombinant RSV includes a deletion at positions 4499-4610 corresponding to the reference RSV sequence shown in SEQ ID NO: 1, as well as the C4489T, C4492T, A4495T, A4497G, and G4498A substitutions corresponding to the reference RSV sequence shown in SEQ ID NO: 1. In some such embodiments, the genome of recombinant RSV comprises a nucleic acid sequence complementary to a positive sense antigenome sequence that is at least 90%, at least 95%, at least 98%, and / or at least 99% identical to SEQ ID NO: 2 (RSV LID / ΔNS1). In some such embodiments, the genome of recombinant RSV comprises a nucleic acid sequence complementary to the positive sense antigenome sequence shown in SEQ ID NO: 2 (RSV LID / ΔNS1).

[0071] In some embodiments, recombinant RSV comprises an RSV genome including RSV F, G, NS2, N, P, M, SH, M2, and L genes located at gene positions 1–9, respectively, wherein the F and G genes located at gene positions 1 and 2 have been moved from native gene positions 8 and 7, respectively, and the genome includes an RSV genome containing a deletion of the sequence encoding the NS1 protein. In some such embodiments, the SH gene of recombinant RSV includes a deletion at positions 4499–4610 corresponding to the reference RSV sequence shown in SEQ ID NO: 1, as well as C4489T, C4492T, A4495T, A4497G, and G4498A substitutions corresponding to the reference RSV sequence shown in SEQ ID NO: 1. In some such embodiments, the genome of recombinant RSV comprises a nucleic acid sequence complementary to a positive sense antigenome sequence that is at least 90%, at least 95%, at least 98%, and / or at least 99% identical to SEQ ID NO: 3 (RSV LID / F1G2 / ΔNS1). In some such embodiments, the recombinant RSV genome includes a nucleic acid sequence complementary to the positive sense antigenome sequence shown in Sequence ID No. 3 (RSV LID / F1G2 / ΔNS1).

[0072] In some embodiments, recombinant RSV comprises an RSV genome including RSV F, G, NS2, N, P, M, SH, M2, and L genes located at gene positions 1-9, wherein the F and G genes located at gene positions 1 and 2 have been moved from native gene positions 8 and 7, respectively, and the L gene encodes an L protein containing an S1313 residue encoded by a TCA codon and a Y1314K substitution encoded by an AAA codon, with amino acid positions corresponding to the reference L protein sequence shown in SEQ ID NO: 13. In some such embodiments, the SH gene of recombinant RSV includes a deletion at positions 4499-4610 corresponding to the reference RSV sequence shown in SEQ ID NO: 1, as well as C4489T, C4492T, A4495T, A4497G, and G4498A substitutions corresponding to the reference RSV sequence shown in SEQ ID NO: 1. In some such embodiments, the recombinant RSV genome includes nucleic acid sequences complementary to a positive sense antigenome sequence that is at least 90%, at least 95%, at least 98%, and / or at least 99% identical to SEQ ID NO: 6 (RSV LID / F1G2 / ΔNS1 / 1030s).

[0073] In some embodiments, recombinant RSV comprises an RSV genome including RSV F, G, NS2, N, P, M, SH, M2, and L genes located at gene positions 1-9, respectively, wherein the F and G genes located at gene positions 1 and 2 have been moved from native gene positions 8 and 7, respectively, the genome includes a deletion of the sequence encoding the NS1 protein, and the L gene encodes an L protein including a deletion at S1313 and an I1314L substitution, with amino acid positions corresponding to the reference L protein sequence shown in SEQ ID NO: 13. In some such embodiments, the SH gene of recombinant RSV includes a deletion at positions 4499-4610 corresponding to the reference RSV sequence shown in SEQ ID NO: 1, as well as C4489T, C4492T, A4495T, A4497G, and G4498A substitutions corresponding to the reference RSV sequence shown in SEQ ID NO: 1. In some such embodiments, the recombinant RSV genome includes nucleic acid sequences complementary to a positive sense antigenome sequence that is at least 90%, at least 95%, at least 98%, and / or at least 99% identical to sequence number 9 (RSV LID / F1G2 / ΔNS1 / Δ1313 / I1314L).

[0074] In some embodiments, recombinant RSV comprises an RSV genome including RSV F, G, NS2, N, P, M, SH, M2, and L genes located at gene positions 1-9, wherein the F and G genes located at gene positions 1 and 2 have been moved from native gene positions 8 and 7, respectively, the F protein is encoded by the sequence shown in SEQ ID NO: 15 (FBB), and the genome includes a deletion of the sequence encoding the NS1 protein. In some such embodiments, the SH gene of recombinant RSV includes a deletion at positions 4499-4610 corresponding to the reference RSV sequence shown in SEQ ID NO: 1, as well as C4489T, C4492T, A4495T, A4497G, and G4498A substitutions corresponding to the reference RSV sequence shown in SEQ ID NO: 1. In some such embodiments, the recombinant RSV genome includes nucleic acid sequences complementary to a positive sense antigenome sequence that is at least 90%, at least 95%, at least 98%, and / or at least 99% identical to SEQ ID NO: 4 (RSV LID / F1BBG2 / ΔNS1).

[0075] In some embodiments, recombinant RSV comprises an RSV genome including RSV F, G, NS2, N, P, M, SH, M2, and L genes located at gene positions 1-9, wherein the F and G genes located at gene positions 1 and 2 have been moved from native gene positions 8 and 7, respectively, the F protein is encoded by the sequence shown in SEQ ID NO: 15 (FBB), the genome includes a deletion of the sequence encoding the NS1 protein, and the L gene encodes an L protein including an S1313 residue encoded by a TCA codon and a Y1314K substitution encoded by an AAA codon, the amino acid positions of which correspond to the reference L protein sequence shown in SEQ ID NO: 13. In some such embodiments, the SH gene of recombinant RSV includes a deletion at positions 4499-4610 corresponding to the reference RSV sequence shown in SEQ ID NO: 1, as well as C4489T, C4492T, A4495T, A4497G, and G4498A substitutions corresponding to the reference RSV sequence shown in SEQ ID NO: 1. In some such embodiments, the recombinant RSV genome includes nucleic acid sequences complementary to a positive sense antigenome sequence that is at least 90%, at least 95%, at least 98%, and / or at least 99% identical to SEQ ID NO: 7 (RSV LID / F1BBG2 / ΔNS1 / 1030s).

[0076] In some embodiments, recombinant RSV comprises an RSV genome including RSV F, G, NS2, N, P, M, SH, M2, and L genes located at gene positions 1-9, respectively, wherein the F and G genes located at gene positions 1 and 2 have been moved from native gene positions 8 and 7, respectively, the genome includes a deletion of the sequence encoding the NS1 protein, and the L gene encodes an L protein including a deletion at S1313 and an I1314L substitution, with amino acid positions corresponding to the reference L protein sequence shown in SEQ ID NO: 13. In some such embodiments, the SH gene of recombinant RSV includes a deletion at positions 4499-4610 corresponding to the reference RSV sequence shown in SEQ ID NO: 1, as well as C4489T, C4492T, A4495T, A4497G, and G4498A substitutions corresponding to the reference RSV sequence shown in SEQ ID NO: 1. In some such embodiments, the recombinant RSV genome includes nucleic acid sequences complementary to a positive sense antigenome sequence that is at least 90%, at least 95%, at least 98%, and / or at least 99% identical to SEQ ID NO: 10 (RSV LID / F1BBG2 / ΔNS1 / Δ1313 / I1314L).

[0077] In some embodiments, recombinant RSVs include deletions of untranslated sequences in the gene, in intergenetic regions, and in trailer regions, in addition to the modifications described above.

[0078] Viruses are named in this specification by listing the combinations of mutations present in them, and this is descriptive rather than restrictive. The use of the symbol " / " in viral names (such as in RSV LID / ΔNS1 / 1030s, which represents RSV D46 containing mutations ΔNS1, LID, and 1030s) is not significant, apart from being present to make the name more readable, especially when it is present in the text. Therefore, RSV LID / ΔNS1 / 1030s is the same as RSV LID / ΔNS1 / 1030s and RSV LID / ΔNS1 / 1030s. RSV is not always used in names. The names of antigenomic cDNAs and the RSVs they encode are typically interchangeable.

[0079] Unless the context indicates otherwise, the numbering used in this disclosure is based on the sequence of RSV A2 strain D46, provided herein as to be positive sense, as Sequence ID No. 1 and the described viral genome sequence. With regard to the numbering of nucleotide and amino acid sequence positions for the described virus, convention has been used so that each nucleotide or amino acid residue in a given viral sequence retains its sequence position number in the RSV D46 strain provided as Sequence ID No. 1, with any modifications whatsoever. Thus, while many genomes contain deletions and / or insertions that cause changes in nucleotide length and, in some cases, amino acid length, the numbering of all other residues (nucleotides or amino acids) in the genome and encoded protein remains unchanged. Even without this convenient convention, it will also be recognized that corresponding sequence positions between viral genomes or proteins of potentially different lengths can be easily identified, not only by sequence alignment but also by the position of the open reading frame, well-known RNA properties such as gene start and gene termination signals, and amino acid sequence properties.

[0080] The example utilizes RSV strain A2 of antigenic subgroup A, which is the most widely used experimental strain and the parent of numerous bioattenuated RSV vaccine candidates evaluated in clinical studies. Given the existence of various further RSV strains (e.g., RSV B1, RSV Long, RSV Line 19), those skilled in the art will recognize that a particular strain of RSV may have nucleotide or amino acid insertions or deletions that alter the position of a given residue. For example, if the protein of another RSV strain has two additional amino acids at the upstream end of the protein compared to strain A2, this would increase the amino acid numbering of the downstream residues by two compared to strain A2. However, since these strains share a high degree of sequence identity, those skilled in the art will be able to determine the corresponding sequence position by simply aligning the nucleotide or amino acid sequence of the A2 reference strain with that of the strain in question. Thus, while the amino acid and nucleotide positions described herein are specifically enumerated in the context of this disclosure, it should be understood that they may correspond to other positions if the sequence shift occurred or resulted from sequence variations between viral strains. In comparisons of proteins, or protein segments, or genes, or genomes, or genomic segments between two or more related viruses, "corresponding" amino acid or nucleotide residues are those that appear to have exactly or approximately equivalent function in different species.

[0081] In addition to the modifications to recombinant RSV described above, different or additional modifications can be made to RSV clones to facilitate manipulation, such as the insertion of specific restriction sites in various intergenetic regions or other locations. Uncoding gene sequences can be removed to increase the ability to insert foreign sequences.

[0082] The introduction of the defined mutations into infectious RSV clones can be achieved by various well-known methods. “Infectious clone” means synthetic or other cDNA or its products that can be transcribed into a genome or antigenomic RNA capable of producing infectious viruses. The term “infectious” refers to a virus or viral structure that can replicate in cultured cells or in an animal or human host to produce identically active progeny viruses or viral structures. Therefore, defined mutations can be introduced into a cDNA copy of the genome or antigenomic by conventional techniques (e.g., site-directed mutagenesis). Assembling a complete antigenomic or genomic cDNA using subfragments of an antigenomic or genomic cDNA is well known to those skilled in the art and has the advantage of allowing manipulation of each region separately (smaller cDNAs are easier to manipulate than larger ones) and then easily assembling them into a complete cDNA. Therefore, a complete antigenomic or genomic cDNA, or any of its subfragments, can be used as a template for oligonucleotide-specific mutagenesis. The mutated subfragments can then be assembled into a complete antigenomic or genomic cDNA. Mutations can range from single nucleotide changes to the replacement of large cDNA pieces containing one or more genes or genomic regions.

[0083] In some embodiments, the disclosed recombinant RSV can be produced using a recombinant DNA-based technique called reverse genetics (Collins, et al. 1995. Proc Natl Acad Sci USA 92:11563-11567). This system allows for the de novo recovery of infectious viruses from all cDNA in eligible cell substrates under defined conditions. Reverse genetics provides a means of introducing predetermined mutations into the RSV genome via cDNA intermediates. Specific attenuating mutations have been characterized in preclinical studies and, in combination, have achieved the desired level of attenuation. Induction of vaccine viruses from cDNA minimizes the risk of contamination by exogenous factors and helps keep the passage history concise and well-documented. Once recovered, the engineered virus strains replicate in the same manner as biologically induced viruses. As a result of passage and amplification, the vaccine virus does not contain recombinant DNA from the original recovered source.

[0084] Recombinant RSV may be produced by intracellular co-expression of cDNA encoding the RSV genomic RNA together with the viral proteins necessary to transcribe and replicate a nucleocapsid. Plasmids encoding other RSV proteins may also be included along with these essential proteins. Alternatively, the RNA may be synthesized in an in vitro transcription reaction and transfected into cultured cells.

[0085] Many cell lines that enable RSV growth can be used to grow RSV virus for vaccine use and other purposes. RSV grows in various human and animal cells. Preferred cell lines for growing attenuated RSV for vaccine use include DBSFRhL-2, MRC-5, and Vero cells. The highest viral yields are usually achieved using epithelial cell lines such as Vero cells. Cells are inoculated with the virus at an infection multiplicity typically ranging from about 0.001 to 1.0 or higher, and the cells are cultured under conditions that allow viral replication, for example, at about 30 to 37°C for about 3 to 10 days, or for as long as necessary for the virus to reach a suitable titer. Temperature-sensitive viruses are often grown using 32°C as the "acceptable temperature". The virus is removed from the cell culture and typically separated from cellular components by well-known clarification procedures, e.g., centrifugation, and may be further purified, if desired, using procedures well known to those skilled in the art.

[0086] RSV attenuated as described herein can be tested in a variety of well-known and generally acceptable in vitro and in vivo models to confirm suitable attenuation, resistance to phenotypic reversion, and immunogenicity for vaccine use. In in vitro assays, modified viruses that can be multiple attenuated, biologically induced, or recombinant RSV are tested for temperature sensitivity of viral replication, or "ts phenotype," and for small plaque phenotype. Modified viruses may also be evaluated in an in vitro human airway epithelium (HAE) model, which appears to provide a means of ranking the viruses in order of their relative attenuation in non-human primates and humans (Zhang et al 2002 J Virol 76:5654-5666; Schaap-Nutt et al 2010 Vaccine 28:2788-2798; Ilyushina et al 2012 J Virol 86:11725-11734). The modified virus will be further tested in animal models of RSV infection. Various animal models (e.g., mice, cotton rats, and primates) have been described and are known to those skilled in the art.

[0087] Recombinant viruses may be evaluated in cell cultures, rodents, and non-human primates for infectivity, replication dynamics, yield, protein expression efficiency, and genetic stability. While these semi-tolerant systems may not reliably detect all differences in replication, substantial differences may be detected, in particular. Recombinant strains may also be subsequently evaluated in adults, seropositive children, and seronegative children. In some cases, new strains may be directly evaluated in seronegative children if similar strains have previously been shown to be well-tolerated in seronegative children. Evaluations may be performed in small groups, for example, 10 vaccine recipients and 5 placebo recipients, to allow for the simultaneous evaluation of multiple candidates. Candidates may be evaluated for the infectivity, replication dynamics, shedding, tolerability, immunogenicity, and genetic stability of the vaccine virus in the period immediately following immunization, and the vaccine may be investigated during the next RSV season for safety, RSV disease, and changes in RSV-specific serum antibodies, as described in Karron, et al. 2015, Science Transl Med 2015 7(312):312ra175, which is incorporated herein in whole. Thus, analysis of selected representative viruses can provide relatively rapid triage to narrow down the candidates and identify the most appropriate one.

[0088] Also provided herein are isolated polynucleotides encoding various proteins useful for encoding the described mutated virus, constructing the described genome or antigenome, expressing the described genome or antigenome, or for constructing recombinant RSV in vitro. Nucleic acid sequences of several exemplary polynucleotides are also provided. Polynucleotides comprising any of the aforementioned nucleic acid sequences, or sequences essentially thereof, are included in the embodiments provided herein. Furthermore, polynucleotides having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 percent or higher identity, or any numerical identity in between, with any of the aforementioned sequences or sequence numbers provided herein, and polynucleotides that hybridize to or are complements thereof to the aforementioned molecules.

[0089] These polynucleotides may be included in the vector or expressed by the vector to produce recombinant RSV. Therefore, this also includes isolated polynucleotides or cells transfected with the vector.

[0090] In additional embodiments, compositions (e.g., isolated polynucleotides and vectors incorporating RSV-coding cDNA) and methods for producing recombinant RSV are provided. Novel isolated polynucleotide molecules, including an RSV genome or antigenome modified as described herein, and vectors incorporating such molecules are also provided. The same or different expression vectors, each containing one or more isolated polynucleotide molecules encoding RSV proteins, are also provided. These proteins can also be expressed directly from the genome or antigenome cDNA. The vector(s) are preferably expressed or co-expressed in cells or cell-free lysates to produce infectious mutant RSV particles or subviral particles.

[0091] A method for producing one or more purified RSV proteins is also provided, comprising infecting RSV-tolerant host cells with a recombinant RSV strain under conditions that allow RSV proliferation in infected cells. After a replication period in culture, the cells are lysed and recombinant RSVs are isolated therefrom. One or more desired RSV proteins are purified after virus isolation to obtain one or more RSV proteins for vaccine, diagnostic, and other uses.

[0092] The methods and compositions described above yield infectious viruses or subviral particles, or derivatives thereof. Infectious viruses are equivalent to genuine RSV virus particles and are infectious in their pure form. They can directly infect fresh cells. Infectious subviral particles are typically subcomponents of viral particles that can initiate infection under appropriate conditions. For example, nucleocapsids containing genome or antigenomic RNA as well as N, P, L, and M2-1 proteins are examples of subviral particles that can initiate infection when introduced into the cytoplasm of a cell. Subviral particles include viral particles that lack one or more proteins, protein segments, or other viral components that are not essential for infectivity.

[0093] In other embodiments, the present invention provides an expression vector comprising an isolated polynucleotide molecule encoding the mutant RSV genome or antigenome described above, and a cell or cell-free lysate comprising an expression vector (the same or different vector) comprising one or more isolated polynucleotide molecules encoding the RSV N, P, L and RNA polymerase elongation factor proteins. One or more of these proteins may also be expressed from genome or antigenome cDNA. During expression, the genome or antigenome and the N, P, L and RNA polymerase elongation factor proteins combine to produce infectious RSV virus or subviral particles.

[0094] III. Immunogenic composition Immunogenic compositions comprising the disclosed recombinant RSV and a pharmaceutically acceptable carrier are also provided. Such compositions can be administered to subjects in various ways, for example, by an intranasal route. Standard methods for preparing administerable immunogenic compositions are described in publications such as Remingtons Pharmaceutical Sciences, 19th Ed., Mack Publishing Company, Easton, Pennsylvania, 1995.

[0095] Potential carriers include, but are not limited to, physiological equilibrium culture media, phosphate-buffered saline, water, emulsions (e.g., oil / water or water / oil emulsions), various types of wetting agents, cryoprotective additives or stabilizers, such as proteins, peptides or hydrolysates (e.g., albumin, gelatin), sugars (e.g., sucrose, lactose, sorbitol), amino acids (e.g., monosodium glutamate), or other protective agents. The resulting aqueous solution may be packaged for use as is or lyophilized. The lyophilized preparation is combined with a sterile solution before administration for either a single or multiple doses.

[0096] The immunogenic composition may contain, but is not limited to, bacteriostatic agents that prevent or minimize degradation during storage, including benzyl alcohol, phenol, m-cresol, chlorobutanol, methylparaben, and / or propylparaben in an effective concentration (usually ≤1% w / v). Bacteriostatic agents may be contraindicated in some patients, and therefore the lyophilized formulation may be restored in a solution containing or not containing such components.

[0097] The immunogenic composition may contain, as a pharmaceutically acceptable medium, substances necessary to approximate physiological conditions, such as pH adjusters and buffers, osmotic pressure adjusters, and wetting agents, such as sodium acetate, sodium lactate, sodium chloride, potassium chloride, calcium chloride, sorbitan monolaurate, and triethanolamine oleate.

[0098] The immunogenic composition may optionally contain adjuvants that enhance the host immune response. Suitable adjuvants include, for example, Toll-like receptor agonists, alum, AlPO4, alpha-hydrogels, lipid A and its derivatives or variants, oil emulsions, saponins, neutral liposomes, liposomes containing recombinant viruses, as well as cytokines, nonionic block copolymers, and chemokines. Among the many other suitable adjuvants known in the art, nonionic block polymers containing polyoxyethylene (POE) and polyoxypropylene (POP), such as POE-POP-POE block copolymer, MPL® (3-O-deacylated monophosphoryl lipid A; Corixa, Hamilton, IN), and IL-12 (Genetics Institute, Cambridge, MA) may be used as adjuvants (Newman et al., 1998, Critical Reviews in Therapeutic Drug Carrier Systems 15:89-142). These adjuvants help stimulate the immune system in a nonspecific manner, thus having the advantage of enhancing the immune response to the pharmaceutical product.

[0099] In some cases, it may be desirable to combine immunogenic compositions containing recombinant RSV with other pharmaceutical products (e.g., vaccines) that induce a protective response against other viral pathogens, particularly those that cause other childhood illnesses. For example, the recombinant RSV compositions described herein may also include other vaccines recommended by the Advisory Committee on Immunization Practices (ACIP; cdc.gov / vaccines / acip / index.html) for the target age group (e.g., infants approximately 1–6 months of age). These additional vaccines include, but are not limited to, vaccines administered in combination. Therefore, the recombinant RSV described herein may be administered concurrently with vaccines against, for example, hepatitis B (HepB), diphtheria, tetanus and pertussis (DTaP), pneumococcal disease (PCV), Haemophilus influenzae type b (Hib), polio, influenza, and rotavirus.

[0100] In some embodiments, the immunogenic composition may be provided in unit dosage forms for use to induce an immune response in a subject, for example, to prevent RSV infection in a subject. The unit dosage form contains a single pre-selected dose suitable for administration to a subject, or two or more pre-selected unit doses, or a measured multiple of such doses, and / or a metering mechanism for administering a unit dose or multiple thereof.

[0101] IV. Methods for inducing an immune response A method for inducing an immune response in a subject by administering an immunogenic composition containing the disclosed recombinant RSV to the subject is provided herein. During immunization, the subject responds by producing antibodies specific to RSV. In addition, innate and cell-mediated immune responses are induced that modulate the immune response, as well as providing antiviral effectors. As a result of immunization, the host becomes at least partially or completely immune to RSV infection or becomes resistant to the development of moderate or severe RSV disease, particularly lower respiratory tract RSV disease.

[0102] In additional embodiments, a method for inducing an immune response in a subject by administering an immunogenic composition containing recombinant RSV, the recombinant RSV comprising a genome containing a deletion in the sequence encoding the NS1 protein (such as a deletion at positions 99-627 corresponding to the reference RSV sequence shown in SEQ ID NO: 1), wherein the recombinant RSV is infectious, attenuated, and self-replicating. In some such embodiments, the recombinant RSV genome comprises an SH gene containing a deletion at positions 4499-4610 corresponding to the reference RSV sequence shown in SEQ ID NO: 1, as well as C4489T, C4492T, A4495T, A4497G, and G4498A substitutions corresponding to the reference RSV sequence shown in SEQ ID NO: 1. In some such embodiments, the recombinant RSV genome comprises a nucleic acid sequence complementary to an antigenome sequence shown in SEQ ID NO: 2 (LID / ΔNS1) or at least 99% identical thereto. During immunization, the subject responds by producing antibodies specific to RSV. In addition, it can provide antiviral effectors, and also induces innate and cell-mediated immune responses that modulate the immune response. As a result of immunity, the host becomes at least partially or completely immune to RSV infection, or becomes resistant to moderate or severe RSV disease, particularly the development of lower respiratory tract RSV disease.

[0103] Since almost all humans are infected with RSV by the age of 5, the entire birth cohort is included as a relevant population for immunity. This can be done, for example, by initiating an immunization regimen in pregnant women (or women of childbearing age), families of newborns or fetuses, or subjects over 50 years of age, at any time between birth and 6 months of age, or between 6 months and 5 years of age, to protect their own infants by passive transfer of antibodies. The scope of this disclosure is intended to include maternal immunity. In some embodiments, subjects are human subjects who are seronegative for RSV-specific antibodies. In additional embodiments, subjects are under 1 year of age, e.g., under 6 months of age, under 3 months of age, or under 1 month of age.

[0104] The subjects at highest risk of RSV infection with severe symptoms (e.g., requiring hospitalization) include premature children, those with bronchopulmonary dysplasia, and congenital heart disease, who are most susceptible to severe illness. During childhood and adulthood, the illness may be milder but associated with lower respiratory tract disease and commonly accompanied by sinusitis. The severity of the illness increases in institutionalized elderly individuals (e.g., those over 65 years of age). Severe illness also occurs in individuals with severe combined immunodeficiency or those who have undergone bone marrow or lung transplantation. In some embodiments, these subjects may be selected for administration of the disclosed recombinant RSV.

[0105] An immunogenic composition containing recombinant RSV is administered to subjects who are susceptible to or at risk of RSV infection in an "effective dose" sufficient to induce or enhance the individual's ability to respond to RSV. The immunogenic composition may be administered by any preferred method, including, but not limited to, injection, aerosol delivery, nasal spray, nasal drops, oral administration, or topical application. In some embodiments, the vaccine may be administered intranasally, subcutaneously, or intramuscularly. In some embodiments, this may be administered into the upper respiratory tract. This may be done by any preferred method, including, but not limited to, spray, droplet, or aerosol delivery. Often, the composition is administered to individuals who are seronegative with respect to antibodies against RSV or who have transplacentally acquired maternal antibodies against RSV.

[0106] Upon immunization with an effective amount of disclosed recombinant RSV, the subject responds by producing antibodies specific to RSV viral proteins, such as F and G glycoproteins. In addition, not only can antiviral effectors be provided, but innate and cell-mediated immune responses that modulate the immune response are also induced. As a result of immunization, the host becomes at least partially or completely immune to RSV infection, or becomes resistant to moderate or severe RSV disease, particularly the development of lower respiratory tract RSV disease.

[0107] In preferred embodiments, the attenuated virus is administered according to established human intranasal administration protocols (e.g., as discussed in Karron et al. JID 191:1093-104, 2005). Briefly, adults or children are typically intranasally inoculated via droplets containing an effective amount of recombinant RSV in a physiologically acceptable diluent or carrier in a volume of 0.5 ml. This offers advantages in simplicity and safety compared to parenteral immunization with non-replicating viruses. It also provides direct stimulation of local airway immunity, which plays a major role in resistance to RSV. Furthermore, this mode of vaccination efficiently bypasses the immunosuppressive effect of RSV-specific maternal-derived serum antibodies, which are typically found in very young individuals. Additionally, parenteral administration of RSV antigen may be associated with immunopathological complications, which have not been observed with live viruses.

[0108] The precise amount of immunogen administered, as well as the timing and repetition of administration, are determined by various factors, including the patient's health status and weight, the mode of administration, and the characteristics of the formulation. The dosage is generally approximately 3.0 log per patient. 10 ~Approximately 6.0 log 10 Plaque-forming units ("PFUs") or more viruses, more commonly about 4.0 log per patient. 10 ~5.0log 10 This is the range of PFU viruses. In one embodiment, approximately 5.0 log per patient. 10 ~6.0log 10 PFU may be administered during infancy, for example, at 1–6 months of age, with one or more additional booster doses given at 2–6 months or later. In another embodiment, younger infants receive approximately 5.0 log per patient at around 2, 4, and 6 months of age, which are the recommended times for administration of many other pediatric vaccines. 10 ~6.0log 10 A dose of PFU may be administered. In yet another embodiment, an additional booster dose may be administered at approximately 10–15 months of age.

[0109] Embodiments of recombinant RSV and its immunogenic compositions described herein are administered to a subject in an amount effective to induce or enhance an immune response to the RSV antigen in the recombinant RSV. The effective amount allows for some growth and replication of the virus to produce the desired immune response, but does not cause any virus-related symptoms or disease. Based on the guidance provided herein and the knowledge in the art, an appropriate amount of recombinant RSV for use in immunization can be determined.

[0110] The resulting immune response can be characterized by various methods, including, but not limited to, the collection of nasal lavage or serum samples for the analysis of RSV-specific antibodies, which can be detected by tests including complement fixation, plaque neutralization, enzyme-linked immunosorbent assay, luciferase immunoprecipitation assay, and flow cytometry. In addition, the immune response can be detected by cytokine assays in nasal lavage or serum, ELISPOT of immune cells from either source, quantitative RT-PCR or microarray analysis of nasal lavage or serum samples, and restimulation of immune cells from nasal lavage or serum by re-exposure to viral antigens in vitro, as well as analysis of the production or presentation of cytokines, surface markers, or other immune correlants, or cytotoxic activity against indicator target cells presenting RSV antigens, as measured by flow cytometry. In this regard, individuals are also monitored for signs and symptoms of upper respiratory tract disease.

[0111] The desired immune response is to inhibit subsequent infection by RSV. For the method to be effective, RSV infection does not need to be completely inhibited. For example, administration of an effective dose of disclosed recombinant RSV can reduce subsequent RSV infection by, depending on the desired dose, at least 10%, at least 20%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, or even at least 100% (prevention of detectable RSV infection) compared to a suitable control (e.g., measured by the number or percentage of cells infected or subjects infected with RSV).

[0112] The determination of the effective dose is typically based on animal model studies, followed by human clinical trials, and guided by a dosage protocol that significantly reduces the appearance or severity of symptoms or conditions of the target disease in the subject, or induces a desired response (such as neutralization of the immune response) in the subject. Suitable models for this include, for example, mice, rats, hamsters, cotton rats, cattle, sheep, pigs, cats, ferrets, non-human primates, and other acceptable animal model subjects known in the art. Alternatively, the effective dose can be determined using in vitro models (e.g., immunological and histopathological assays). Using such models, only standard calculations and adjustments are required to determine the appropriate concentration and dose for administering an effective amount of the composition (e.g., an amount effective in inducing a desired immune response or alleviating one or more symptoms of the target disease).

[0113] Administration of recombinant RSV to subjects can induce the production of a protective immune response against serious lower respiratory tract diseases, such as pneumonia and bronchiolitis, or croup, if the subject subsequently becomes infected or reinfected with wild-type RSV. While naturally circulating viruses can still cause infection, particularly in the upper respiratory tract, the likelihood of rhinitis is reduced as a result of immunity and possibly a boost in resistance from subsequent infection with wild-type virus. Postimmunization, detectable levels of host-produced serum and secretory antibodies are present that can neutralize the same type (same subgroup) of wild-type virus in vitro and in vivo. In many cases, host antibodies also neutralize wild-type viruses of different non-vaccine subgroups.

[0114] An immunogenic composition comprising one or more disclosed recombinant RSV viruses may be used in a coordinated (or prime-boost) immunoprotocol or combination formulation. Several boosts may be performed, and each boost may be a different disclosed immunogen. In some examples, it is intended that a boost may be the same immunogen as another boost or prime. In certain embodiments, novel combination immunogenic compositions and coordinated immunoprotocols use separate immunogens or formulations that are directed, respectively, toward inducing an antiviral immune response, e.g., an immune response against the RSV protein. The separate immunogenic compositions that induce an antiviral immune response may be combined in a multivalent immunogenic composition administered to a target in a single immunization step, or they may be administered separately (in a monovalent immunogenic composition) in a coordinated (or prime-boost) immunoprotocol.

[0115] In some embodiments, the disclosed recombinant RSV (such as any one of RSV LID / ΔNS1 (SEQ ID NO: 2), RSV LID / F1G2 / ΔNS1 (SEQ ID NO: 3), RSV LID / F1BBG2 / ΔNS1 (SEQ ID NO: 4), RSV LID / F1G2 / ΔNS1 / 1030s (SEQ ID NO: 6), RSV LID / F1BBG2 / ΔNS1 / 1030s (SEQ ID NO: 7), RSV LID / F1G2 / ΔNS1 / Δ1313 / I1314L (SEQ ID NO: 9), or RSV LID / F1BBG2 / ΔNS1 / Δ1313 / I1314L (SEQ ID NO: 10)) is used for prime immunization, and boost immunization includes immunization with RSV 276 virus (SEQ ID NO: 12), B / HPIV3 DS-Cav1 virus (SEQ ID NO: 16), or B / HPIV3 DS-Cav1 / B3TMCT virus (SEQ ID NO: 17).

[0116] In some embodiments, the prime includes administration of RSV LID / ΔNS2 / Δ1313 / I1314L virus (SEQ ID NO: 19), RSV LID / F1BBG2 / ΔNS1 virus (SEQ ID NO: 4), RSV LID / ΔNS1 virus (SEQ ID NO: 2), RSV LID / ΔNS2 / 1030s virus (SEQ ID NO: 18), or RSV D46 / NS2 / N / ΔM2-2-HindIII virus (SEQ ID NO: 11), and the boost includes administration of RSV 276 virus (SEQ ID NO: 12).

[0117] In some embodiments, the prime includes administration of RSV LID / ΔNS2 / Δ1313 / I1314L virus (SEQ ID NO: 19), RSV LID / F1BBG2 / ΔNS1 virus (SEQ ID NO: 4), RSV LID / ΔNS1 virus (SEQ ID NO: 2), RSV LID / ΔNS2 / 1030s virus (SEQ ID NO: 18), RSV D46 / NS2 / N / ΔM2-2-HindIII virus (SEQ ID NO: 11), or RSV 276 virus (SEQ ID NO: 12), and the boost includes administration of B / HPIV3 DS-Cav1 / B3TMCT virus (SEQ ID NO: 17).

[0118] In some embodiments, the prime includes administration of RSV LID / ΔNS2 / Δ1313 / I1314L virus (SEQ ID NO: 19), RSV LID / F1BBG2 / ΔNS1 virus (SEQ ID NO: 4), RSV LID / ΔNS1 virus (SEQ ID NO: 2), RSV LID / ΔNS2 / 1030s virus (SEQ ID NO: 18), RSV D46 / NS2 / N / ΔM2-2-HindIII virus (SEQ ID NO: 11), or RSV 276 virus (SEQ ID NO: 12), and the boost includes administration of B / HPIV3 DS-Cav1 virus (SEQ ID NO: 16).

[0119] In some embodiments, the prime includes administration of the RSV LID / ΔNS2 / Δ1313 / I1314L virus (SEQ ID NO: 19), and the boost includes administration of the B / HPIV3 DS-Cav1 virus (SEQ ID NO: 16). In some embodiments, the prime includes administration of the RSV LID / ΔNS2 / Δ1313 / I1314L virus (SEQ ID NO: 19), and the boost includes administration of the B / HPIV3 DS-Cav1 / B3TMCT virus (SEQ ID NO: 17). In some embodiments, the prime includes administration of the RSV LID / ΔNS2 / Δ1313 / I1314L virus (SEQ ID NO: 19), and the boost includes administration of the RSV 276 virus (SEQ ID NO: 12).

[0120] In some embodiments, the prime includes administration of RSV LID / ΔNS2 / 1030s virus (SEQ ID NO: 18), and the boost includes administration of B / HPIV3 DS-Cav1 virus (SEQ ID NO: 16). In some embodiments, the prime includes administration of RSV LID / ΔNS2 / 1030s virus (SEQ ID NO: 18), and the boost includes administration of B / HPIV3 DS-Cav1 / B3TMCT virus (SEQ ID NO: 17). In some embodiments, the prime includes administration of RSV LID / ΔNS2 / 1030s virus (SEQ ID NO: 18), and the boost includes administration of RSV 276 virus (SEQ ID NO: 12).

[0121] In some embodiments, the prime includes administration of RSV 276 virus (SEQ ID NO: 12), and the boost includes administration of B / HPIV3 DS-Cav1 virus (SEQ ID NO: 16). In some embodiments, the prime includes administration of RSV 276 virus (SEQ ID NO: 12), and the boost includes administration of B / HPIV3 DS-Cav1 / B3TMCT virus (SEQ ID NO: 17).

[0122] In some embodiments, the prime includes administration of the RSV LID / F1BBG2 / ΔNS1 virus (SEQ ID NO: 4), and the boost includes administration of the B / HPIV3 DS-Cav1 virus (SEQ ID NO: 16). In some embodiments, the prime includes administration of the RSV LID / F1BBG2 / ΔNS1 virus (SEQ ID NO: 4), and the boost includes administration of the B / HPIV3 DS-Cav1 / B3TMCT virus (SEQ ID NO: 17). In some embodiments, the prime includes administration of the RSV LID / F1BBG2 / ΔNS1 virus (SEQ ID NO: 4), and the boost includes administration of the RSV 276 virus (SEQ ID NO: 12).

[0123] In some embodiments, the prime includes administration of RSV LID / ΔNS1 virus (SEQ ID NO: 2), and the boost includes administration of B / HPIV3 DS-Cav1 virus (SEQ ID NO: 16). In some embodiments, the prime includes administration of RSV LID / ΔNS1 virus (SEQ ID NO: 2), and the boost includes administration of B / HPIV3 DS-Cav1 / B3TMCT virus (SEQ ID NO: 17). In some embodiments, the prime includes administration of RSV LID / ΔNS1 virus (SEQ ID NO: 2), and the boost includes administration of RSV 276 virus (SEQ ID NO: 12).

[0124] In some embodiments, priming comprises administration of the RSV D46 / NS2 / N / ΔM2-2-HindIII virus (SEQ ID NO: 11), and boosting comprises administration of the B / HPIV3 DS-Cav1 virus (SEQ ID NO: 16). In some embodiments, priming comprises administration of the RSV D46 / NS2 / N / ΔM2-2-HindIII virus (SEQ ID NO: 11), and boosting comprises administration of the B / HPIV3 DS-Cav1 / B3TMCT virus (SEQ ID NO: 17). In some embodiments, priming comprises administration of the RSV D46 / NS2 / N / ΔM2-2-HindIII virus (SEQ ID NO: 11), and boosting comprises administration of the RSV 276 virus (SEQ ID NO: 12).

[0125] In any of the prime-boost immunization methods provided herein, the prime and the boost are about 5.0 log 10 PFU to about 6.0 log 10 PFU and may be administered intranasally to a subject. In any of the prime-boost immunization methods provided herein, a suitable subject, e.g., a human subject 5 years of age or younger, may be selected for immunization. In the prime-boost immunization methods provided herein, the virus is administered to the subject by a suitable method, e.g., intranasal administration.

[0126] In some embodiments, the recombinant RSV disclosed herein is 3.0 log 10 to 7.0 log 10 PFU, e.g., about 5.0 log 10 to about 6.0 log 10 PFU (e.g., about 6.0 log 10 PFU) and is administered intranasally to a human subject 5 years of age or younger (e.g., about 2 years of age or younger).

[0127] In some embodiments, the recombinant RSV disclosed herein is 3.0 log 10 to 7.0 log 10 PFU (e.g., about 6.0 log 10PFU doses were administered intranasally to RSV seropositive human subjects aged 5 years or younger (e.g., approximately 2 years or younger), where the recombinant RSV titer in nasal lavage fluid collected during the first two weeks after administration was 3.0 log 10 The PFU / ml nasal lavage solution contains less than or equal to the recombinant RSV administered to the subjects, and as a result, within the first month following intranasal administration to the subjects, the subjects will either not exhibit respiratory / febrile illness or will exhibit mild (grade 1) respiratory / febrile illness of the same type and severity as comparable subjects who have not been infected with the virus.

[0128] In some embodiments, the recombinant RSV disclosed herein is 3.0log 10 ~7.0log 10 PFU dosage (e.g., approximately 6.0 log) 10 PFU doses were administered intranasally to RSV seropositive human subjects aged 5 years or younger (e.g., approximately 2 years or younger), where the recombinant RSV titer in nasal lavage fluid collected during the first two weeks after administration was 3.0 log 10 The nasal irrigation solution is PFU / ml or less.

[0129] In some embodiments, the recombinant RSV disclosed herein is 3.0log 10 ~7.0log 10 PFU dosage (e.g., approximately 6.0 log) 10 PFU doses were administered intranasally to RSV seropositive human subjects aged 5 years or younger (e.g., approximately 2 years or younger), where administration of recombinant RSV induced an increase in serum RSV-specific antibodies in ≥75% of recipients.

[0130] The resulting immune response can be characterized by various methods, including, but not limited to, the collection of nasal lavage or serum samples for the analysis of RSV-specific antibodies, which can be detected by tests including complement fixation, plaque neutralization, enzyme-linked immunosorbent assay, luciferase immunoprecipitation assay, and flow cytometry. In addition, the immune response can be detected by cytokine assays in nasal lavage or serum, ELISPOT of immune cells from either source, quantitative RT-PCR or microarray analysis of nasal lavage or serum samples, and restimulation of immune cells from nasal lavage or serum by re-exposure to viral antigens in vitro, as well as analysis by flow cytometry for the generation or presentation of measures of cytokines, surface markers, or other immune correlants, or for cytotoxic activity against indicator target cells presenting RSV antigens. In this regard, individuals are also monitored for signs and symptoms of upper respiratory tract disease. [Examples]

[0131] The materials, information, and methods described herein provide a series of attenuated strains having graded attenuated phenotypes and provide guidance in selecting a suitable vaccine candidate strain based on clinical benchmarks. The following examples are provided to illustrate certain characteristics of a particular embodiment, but the scope of the claims should not be limited to those illustrated characteristics.

[0132] (Example 1) Recombinant respiratory syncytial virus with NS1 deletion and F and G gene transfer This example describes recombinant attenuated RSV containing a deletion of the NS1 gene in combination with one or more additional mutations.

[0133] NS1 and NS2 proteins have also been found to mediate strong suppression of the host's innate immune response and apoptosis, and to suppress and modify adaptive immune responses, independently and to some extent cooperatively. NS1 appears to play a more significant role in many of these activities. The mechanisms by which NS1 and NS2 suppress and modify host responses are numerous, incompletely identified, and incompletely characterized. Both proteins, NS1 in particular, inhibit the induction of type I and type III interferons (IFNs) and pro-inflammatory cytokines. This inhibition involves multiple mechanisms. For example, NS1 and NS2 inhibit intracellular signaling pathways by, for example, binding to RIG-I and MAVS and blocking their interactions, as well as by promoting the degradation of RIG-I, TRAF3, TBK1, and IKKε (Boyapalle, et al. 2012. PLoS One 7:e29386; Sweden, et al. 2009. J Virol 83:9682-9693). NS1 can block IRF3 activation, its nuclear translocation, and its interaction with the transcript coactivator in the IFN-β promoter (Spann, et al. 2005. J Virol 79:5353-5362; Ren, et al. 2011. J Gen Virol 92:2153-2159). Both proteins have been reported to inhibit signaling from the type I IFN receptor (IFNAR), which in turn amplifies the INF response and induces dozens of other proteins that contribute to the antiviral state. For example, both proteins, particularly NS2, have been described as promoting the degradation of STAT2 (Lo, et al. 2005, J Virol 79:9315-9319; Xu, et al. 2014. Intervirology 57:65-73). NS1 has also been shown to directly inhibit 2'-5'-oligoadenylate synthetase-like (OASL) protein, a component of the IFN-induced antiviral state, which inhibits RSV replication if not inhibited by NS1 (Dhar, et al. 2015. J Virol 89:10115-10119).Both proteins, particularly NS1, suppress the induction of cellular apoptosis in response to RSV infection, with the effect of prolonging the survival of infected cells and increasing the production of progeny RSVs (Bitko, et al. 2007. J Virol 81:1786-1795). Both proteins, particularly NS1, suppress the development of adaptive immunity by inhibiting the maturation of dendritic cells (DCs), by partially antagonizing the IFN response and distorting the activation of T cell subsets, and by altering the response of regulatory T cells (Munir, et al. 2008. J Virol 82:8780-8796; Munir, et al. 2011. PLoS Pathogen 7:e1001336; Yang, et al. 2015. Virology 485:223-232). The NS1 protein has also been shown to facilitate RSV infection by altering the expression of specific miRNAs (Bakre, et al. 2015. J Gen Virol 96:3179-3191; Zhang, et al. 2016. Biochem Biophys Res Comm 478:1436-1441). The NS1 protein, and to a lesser extent the NS2 protein, has also been shown to downregulate RNA synthesis in the minigenomic system, suggesting that they have direct effects on viral gene expression and / or genome replication that are not yet elucidated (Atreya, et al. 1998. J Virol 72:1452-1461). This list of activities and mechanisms attributable to NS1 and NS2 is by no means fully or completely characterized.

[0134] Deletion or silencing of either or both genes attenuates RSV replication in vivo, with NS1 deletion exhibiting a higher attenuating effect than NS2 deletion in seronegative chimpanzees (Whitehead, et al. 1999. J Virol 73:3438-3442; Teng, et al. 2000. J Virol 74:9317-9321). This is considered the most predictive alternative for RSV-unsensitized humans. Increased IFN and apoptotic responses in the absence of NS1 and / or NS2 proteins are presumed to be the primary drivers of this attenuation. However, the significance and impact of numerous NS1-mediated and NS2-mediated activities on RSV replication in unsensitized human hosts, as well as on the attenuation and immunogenicity of live attenuated RSV vaccine candidates in humans, remain under investigation and are not fully understood. Several experimental vaccines containing NS2 deletion in combination with various point mutations have been evaluated in humans. One of these vaccine viruses, rA2cpΔNS2, which combines a ΔNS2 deletion with five point mutations in the N, F, and L proteins of a cold-passaged (cp) RSV strain, was attenuated in seropositive children (Wright, et al. 2006. J Infect Dis 193:573-581). Two other vaccine viruses, rA2cp248 / 404ΔNS2 and rA2cp530 / 1009ΔNS2, each having further additions of different pairs of attenuated temperature-sensitive (ts) mutations (248 / 404 or 530 / 1009), were excessively attenuated in seronegative children (Wright, et al. 2006. J Infect Dis 193:573-581). While these studies confirmed that the NS2 deletion attenuates the virus in the human host, the virus was not considered to be sufficiently attenuated for further evaluation as a pediatric vaccine. Previously, RSV with NS1 gene deletion had not been evaluated in humans. In this disclosure, we present data from a Phase I clinical trial in RSV seropositive children aged 12–59 months and RSV seronegative children aged 6–24 months.

[0135] Design of recombinant RSV with ΔNS1 and additional mutations The RSV antigenome used to construct recombinant RSV was the wild-type RSV strain A2 antigenomic cDNA called D46. This antigenomic cDNA is sometimes referred to as D53 in the literature. D46 is the foundation for this reverse genetics system (Collins, et al. 1995. Proc Natl Acad Sci USA 92:11563-11567), and its complete sequence is shown in U.S. Patent No. 6,790,449 and GenBank KT992094, and is provided herein as Sequence ID No. 1.

[0136] Figure 1A shows a deletion in the NS1 gene. The 529-nt deletion (nucleotides 99-627 (including both ends)) starts and includes nucleotide 99, the first nucleotide of the ATG of the NS1 ORF, and extends to and includes nucleotide 627, the nucleotide immediately preceding the ATG (nucleotides 628-630) of the NS2 ORF. This deletion connects the upstream untranslated region of the NS1 gene to the translation start codon of the NS2 ORF.

[0137] Figure 1B shows the deletions in the NS1 and NS2 ORFs, along with most of their adjacent gene sequences from their native positions 1 and 2 in the genome. The 1042-nt deletion (nucleotides 99–1140 (including both ends)) begins and includes nucleotide 99, the first nucleotide of the ATG of the NS1 ORF, and extends to and includes nucleotide 1140, the nucleotide immediately preceding the ATG (1141–1143) of the N ORF. This connects the untranslated region upstream of the NS1 gene to the translation start codon of the N ORF.

[0138] Figure 1C shows the “LID” mutation, which includes five nucleotide substitutions (C4489T, C4492T, A4495T, A4497G, and G4498A) along with a deletion of 112 nucleotides in the untranslated region downstream of the SH gene at D46. This includes the last three codons and stop codon of the SH ORF and does not alter the amino acid coding (Bukreyev, et al. 2001. J Virol 75:12128-12140). While RSV with the LID mutation generally appears to have a wild-type-like phenotype in preclinical studies (Bukreyev, et al. 2001. J Virol 75:12128-12140), it should be noted that this does not interfere with subtle differences that may occur in cell culture, such as a moderate increase in replication.

[0139] Figure 2 shows the migration of the G and F genes from their native genomic locations, where the promoters are close together and F precedes G (rather than the native order of G precedes F). Figure 2A shows the deletion of the F and G genes from the RSV LID. Nucleotides 4630–7551 (including both ends) were deleted from the RSV antigenomic cDNA, removing the F and G genes. This has the effect of fusing the SH gene-termination signal to the F / M2 intergenic region. This mutation is indicated by the antigenomic cDNA having a LID mutation (indicated by white triangles above or below the SH gene), but the modification is independent of the LID mutation. Figure 2B shows the insertion of the F and G genes at gene positions 1 and 2, respectively, in the recombinant RSV antigenomic. The G and F ORFs (shaded sequences) were reconstructed into genes in the reverse of their native order (i.e., FG instead of GF). Each ORF was designed so that in the final construct (antigenomic cDNA), it would be flanked by short untranslated regions and gene start and terminate signals, along with the F and G genes separated by short single-nucleotide intergeneric regions. Nucleotide adapters containing Xho I sites were added upstream and downstream of the F and G ORFs. The creation of the upstream Xho I site required mutations at nucleotides 88-91 in the sequence representing the upstream untranslated NS1 gene region from CTTG (uppercase) to tcga (lowercase) in the LID antigenomic cDNA. As shown below with the antigenomic, the FG gene cassette (shaded rectangle) was inserted into the genomic cDNA using the Xho I site.

[0140] Figure 3 provides genome maps of RSV strains with various mutation combinations, including LID mutations (LID mutations are indicated by white triangles above the SH gene); deletions of G and F from their native positions (ΔG+F), as well as their migration to the second and first gene positions, respectively (F1G2, with F and G in the reverse of their native order GF); F1G2 (F1BBG2) where F ORF is codon-optimized; deletion of the NS1 gene (ΔNS1); addition of the 1030s mutation consisting of 1321K (AAA) and 1313S (TCA) in the L assignment; addition of the Δ1313 and I1314L (CTG) mutations in L; and deletions of both the NS1 and NS2 genes (ΔNS1+2). The LID / F1BBG2 / ΔNS1, LID / F1BBG2 / ΔNS1 / 1030s, LID / F1BBG2 / ΔNS1 / Δ1313 / I1314L, and LID / ΔNS1+2 / F1BBG2 constructs contained codon-optimized F1BB2 ORFs, while the parallel constructs called LID / F1G2 / ΔNS1, LID / F1G2 / ΔNS1 / 1030s, LID / F1G2 / ΔNS1 / Δ1313 / I1314L, and LID / F1G2 / ΔNS1+2 contained unoptimized wild-type versions (not shown).

[0141] Recombinant RSVs were recovered by reverse genetics (see Collins et al. 1995. Proc Natl Acad Sci USA 92:11563-7). RSVs were grown in Vero cells at 32°C. The complete genome sequences of all viruses were confirmed to be free of exogenous mutations detectable above the background by automated Sanger sequencing analysis of uncloned RT-PCR products.

[0142] In vitro evaluation of recombinant RSV The dynamics and yield of multicycle replication of various recombinant RSVs were evaluated in African green monkey Vero cells, which are unable to produce type I interferon in response to viral infection (Figure 4). This indicates that viruses with various combinations of LID, ΔNS1, F1G2, and F1BBG2 mutations replicate to reasonable titers in Vero cells, which are the cell substrate for vaccine production. Note that the RSV LID virus is a wild-type-like virus and therefore serves as a wild-type-like control in this and subsequent experiments.

[0143] The multicycle growth dynamics of various recombinant RSVs were also evaluated in human airway epithelial (HAE) cell cultures (Figure 5). HAE cultures form differentiated, polarized, pseudostratified mucociliary tissue that closely resembles true airway epithelium. Attenuated replication in these cultures is a predictor of attenuated replication in non-human primates and humans. These data indicate that viruses possessing the ΔNS1 modification alone or in combination with the F1G2 and F1BBG2 modifications were strongly attenuated compared to RSV LID parents.

[0144] The plaque and syncytial formation of recombinant RSV was evaluated in Vero cells (Figures 6 and 7). Recombinant RSVs with various combinations of LID, F1BBG2, F1G2, and ΔNS1 mutations readily formed plaques in Vero cells, and recombinant RSVs with F1G2 and F1BBG2 gene shifts directed the formation of large syncytia in Vero cells during multicycle replication, consistent with increased F protein expression.

[0145] In addition, Vero cells infected with recombinant RSV having F1G2 and F1BBG2 modifications showed increased expression of RSV F and G proteins in Vero cells, as determined by gel electrophoresis under denaturing and reducing conditions and Western blot analysis using antibodies of the indicated specificity (Figure 8), with the levels of RSV F, G, N, P, and M protein expression shown to the right compared to RSV LID as 1.0.

[0146] Recombinant RSV was also evaluated in human airway A549 cells, which are well-suited for the interferon response to viral infection. Cells infected with recombinant RSV lacking the NS1 gene showed increased expression of type 1 (α, β) and type 3 (λ) interferons (Figure 9). A549 cells were infected with a MOI of 3 PFU / cell, and the supernatant of tissue culture medium was collected 24 hours after infection. IFN concentrations in the supernatant were determined by ELISA. This indicates that deletion of the NS1 gene resulted in a substantial increase in the expression of type 1 and type 3 interferons, which can stimulate the immune response and attenuate viral replication.

[0147] Evaluation of recombinant RSV in experimental animals Recombinant RSV was evaluated in mice (Figure 10). The presence of F1G2 or F1BBG2 modifications with or without NS1 deletion and LID mutations resulted in reduced RSV replication in the upper and lower respiratory tracts of mice compared to the wild-type-like RSV LID virus. For these assays, 6-week-old BALB / c mice were used, with 10 samples per animal. 4 or 10 6 Each of the indicated doses of PFU was used to infect animals with RSV. Five animals per dose were sacrificed 3 and 5 days after infection, and their nasal turbinates and lungs were collected, homogenized, and viral titers were determined by plaque assay.

[0148] Despite their limited replication in the upper and lower respiratory tracts, recombinant RSV with the indicated combinations of LID, ΔNS1, F1G2, and F1BBG2 modifications induced titers of RSV neutralizing serum antibodies that were well comparable to those of the wild-type-like LID virus (Figure 11). For these assays, 6-week-old BALB / c mice were used, with 10 mice per animal. 4 or 10 6 RSV was infected with each indicated dose of PFU, and serum samples were collected 28 days after infection.

[0149] African green monkeys (AGMs) were used to evaluate RSV ΔNS2 / Δ1313 / I1314L with ΔNS2, RSV 276 with ΔM2-2, and RSV LID / ΔNS1 and LID / F1BBG2 / ΔNS1 in comparison to wild-type viruses. Four animals were infected with each virus, and viral titers were determined from nasopharyngeal swab and tracheal lavage samples from each animal (Tables 1 and 2; Figure 12). Serum samples were also obtained from each animal, and serum PRNTs were performed. 60 The titers were determined (Table 3; Figure 13). The results indicate that LID / F1BBG2 / ΔNS1 possesses a promising attenuated phenotype and induces a superior immune response. [Table 1] [Table 2] [Table 3]

[0150] (Example 2) Evaluation of recombinant RSV in human subjects Information from studies in experimental animals is often not entirely accurate in predicting the magnitude of attenuation, tolerability, and immunogenicity in humans, particularly in infants and young children, who are at the highest risk of RSV infection and are a primary target of vaccine development. Furthermore, experimental animals are typically adult animals with mature immune systems compared to the immature and less effective immune systems of infants and young children. With respect to respiratory viruses, the size, structure, and composition of the upper and lower respiratory tracts of experimental animals may differ from those of humans. In addition, the effects of deleting RSV accessory proteins, such as the NS1 and NS2 proteins described herein, cannot be assumed to be identical in experimental animals and humans, as these viral proteins may have evolved to interact with human host cell proteins and may not have the same interactions and effects as the corresponding proteins in experimental animals. Therefore, clinical trials in infants and young children are crucial for evaluating candidate pediatric RSV vaccines.

[0151] In particular, while live attenuated RSV strains appear promising as pediatric vaccine candidates based on preclinical studies, including those involving experimental animals, most of the live attenuated RSV strains that advanced to Phase I clinical trials were found not sufficiently promising to proceed to further clinical studies. Karron et al recently reviewed clinical trials of 19 live attenuated RSV strains as pediatric vaccine candidates evaluated over more than 25 years (Karron et al 2013 In Challenges and Opportunities for Respiratory Syncytial Virus Vaccines, Current Topics in Microbiology and Immunology 372, pp 259-284). Of the 10 biologically induced live attenuated RSV strains in that review, none were deemed suitable for further study. Of the nine additional recombinantly induced bioattenuated candidates in that review, only RSV Medi / ΔM2-2 (Karron et al Sci Transl Med 312:ra175; ClinicalTrials.gov identifier: NCT01459198) appeared likely suitable for further clinical study, but did not proceed. Subsequently, five additional recombinantly induced bioattenuated RSV strains were evaluated in Phase I clinical studies to obtain sufficient data and determine their suitability for further clinical evaluation. These additional strains are: (i) RSV LID / ΔM2-2 (McFarland et al. 2018. Live-attenuated respiratory syncytial virus vaccine candidate with deletion of RSV synthesis regulatory protein M2-2 is immunogenic in children. J. Infect. Dis. 217:1347-55; ClinicalTrials.gov identifiers: NCT02040831 and NCT02237209); (ii) RSV D46 / cp / M2-2 (ClinicalTrials.gov identifier NCT02601612); (iii) RSV LID / cp / ΔM2-2 (Cunningham et al.2019. Live-attenuated respiratory syncytial virus vaccine with deletion of RNA synthesis regulatory protein M2-2 and cold-passage mutations is over-attenuated. Open Forum Infect Dis. 2019 May 6;6(6):ofz212. doi: 10.1093 / ofid / ofz212. eCollection 2019 Jun;ClinicalTrials.gov identifiers: NCT02890381 and NCT02948127);(iv)RSV LID / ΔM2-2 / 1030s(McFarland et al. 2020. Live respiratory syncytial attenuated by M2-2 deletion and stabilized temperature sensitivity mutation 1030s is a promising vaccine candidate in children. J. Infect. Dis. 221:534-43;ClinicalTrials.gov identifiers: NCT02952339 and NCT02794870), and (v) RSV D46 / NS2 / N / ΔM2-2-HindIII (McFarland et al. 2020. Live-attenuated respiratory syncytial virus vaccine with M2-2 deletion and with SH non-coding region is highly immunogenic in children. J. Infect. Dis. 2020 Feb 1. pii: jiaa049. doi: 10.1093 / infdis / jiaa049. [Electronic publication before printing];ClinicalTrials.(gov identifier: NCT03102034). Of these five additional viruses, only RSV LID / ΔM2-2 / 1030s appears suitable for further clinical studies. Therefore, of the 24 live attenuated RSV strains evaluated over more than 25 years that were examined for potential in preclinical studies and advanced to pediatric clinical studies, only two (Medi / ΔM2-2 and LID / ΔM2-2 / 1030s) were considered candidates for further clinical studies. Thus, the clinical evaluation of live attenuated RSV vaccine candidates in infants and young children has been unpredictable and historically has not had a high success rate.

[0152] Two viruses in this disclosure advanced to Phase I clinical studies in children as candidate live attenuated pediatric RSV vaccines, namely RSV LID / ΔNS1 and RSV LID / F1G2 / ΔNS1 (see Figure 3A for genome maps). This study provides the first clinical evaluation of two independent modifications / mutations in live RSV strains: (i) deletion of the NS1 gene, and (ii) migration of the F and G genes from their usual positions 8 and 7 to positions 1 and 2, respectively. To prepare CTMs acceptable for human use, seed viruses of each variant were de novo-genetically constructed from cDNA electroporated into cGMP-compliant Vero cells produced from World Health Organization Vero cells. cGMP-compliant CTMs for each variant were prepared from seed viruses on the same cell substrate at Charles River Laboratories. Whole-genome sequencing analysis using RT-PCR amplification confirmed that the two seed virus preparations and the two CTM preparations did not contain any detectable exogenous mutations. Preclinical safety studies confirmed that the two CTM preparations were suitable for human administration.

[0153] Single doses of LID / ΔNS1 and LID / F1G2 / ΔNS1, 6.0 log 10 PFU(LID / ΔNS1) or 5.8log 10PFU(LID / F1G2 / ΔNS1) doses were used in RSV seropositive children aged 12-59 months and 5.0 log. 10 In a sequential, randomized, double-blind, placebo-controlled study, PFU doses were evaluated alongside placebo recipients in RSV seronegative children aged 6–24 months. Children were randomized in a 2:2:1 ratio to receive either LID / ΔNS1, LID / F1G2 / ΔNS1, or placebo, administered as nasal sprays (0.5 ml per subject, approximately 0.25 ml per nostril). The clinical protocol, informed consent form, and investigational drug brochure were developed by CIR and NIAID investigators, and the notification of commencement of new drug clinical trials, FDA review, informed consent, institutional review board review, randomization, blinding, open-labeling, trial execution, and review by the NIAID Data Safety Monitoring Committee were carried out essentially as previously described (Karron et al. 2015. A gene deletion that up-regulates viral gene expression yields an attenuated RSV vaccine with improved antibody responses in children. Sci Transl Med7:312ra175).

[0154] Children were enrolled annually from April 1 to October 31, outside of the RSV season. Children were evaluated, and nasal lavage (NW) samples were obtained the day after vaccination: RSV seropositive children, days 0, 3–7, and 10 of the study; RSV seronegative children, days 0, 3, 5, 7, 10, 12, 14, 17, and 28 ± 1 day of the study, respectively. Adverse events were collected up to day 28 for RSV seropositive and RSV seronegative children, and serious adverse events and LRIs were collected up to day 56 for RSV seronegative children. Additional health examinations were performed, and NW samples were obtained for LRI events. Fever, upper respiratory tract illness (URI; including runny nose, pharyngitis, and hoarseness), cough, LRI, and otitis media were defined as described elsewhere (Karron et al. 1997. Evaluation of two live, cold-passaged, temperature-sensitive respiratory syncytial virus vaccines in chimpanzees and in adult humans. J Infect Dis 176:1428-36). Once illness occurred, NW samples were tested for other viruses and mycoplasmas by real-time reverse transcription polymerase chain reaction (RT-PCR) (Respiratory Pathogens 21 kit; Fast Track Diagnostics, Luxembourg). The vaccine virus in the NW solution was quantified by an immunoplaque assay using a mixture of three monoclonal antibodies (mAbs) against RSV F (mAbs 1129, 1243, and 1269, and quantitative RT-PCR (RT-qPCR)) (Karron 2015, ibid.). Serum samples were obtained before vaccination and approximately one month after vaccination for RSV seropositive participants, and two months after vaccination for RSV seronegative participants. Serum samples were tested for RSV neutralizing antibodies using a complement-enhanced 60% RSV plaque reduction neutralization assay, and for immunoglobulin G (IgG) antibodies against RSV F glycoprotein using an enzyme-linked immunosorbent assay (Karron et al. 2015, ibid.). Plaque reduction neutralization titers (PRNT) and RSV F IgG titers are expressed as inverse log2 values.Antibody response was defined as a ≥4-fold increase in titer compared to the pre-vaccination titer. Vaccine-induced infection was defined as detection of vaccine virus by culture or RT-qPCR, and / or a ≥4-fold increase in serum RSV-PRNT or RSV F IgG. Mean peak titer (log) of vaccine virus shedding. 10 PFU / mL was calculated only for infectious vaccines. PRNT and RSV F IgG titers were converted to log2 values ​​for mean calculation, and Student's t-test was used to compare group means. Serum antibody titers were calculated for all subjects, and those with titers below the detection limit were assigned values ​​of 2.3log2(PRNT) and 4.6log2(ELISA). Disease rates and antibody responses were compared using two-sided Fisher's exact test.

[0155] The RSV LID / ΔNS1 and LID / F1G2 / ΔNS1 vaccine candidates were first evaluated in RSV seropositive children aged 12–59 months to confirm that they were sufficiently attenuated for evaluation in RSV seronegative children (Tables 4 and 5). RSV seropositive children were enrolled in 2018 and 2019. Each vaccine was administered to 10 subjects, and a placebo (containing L-15 tissue culture medium) was administered to 5 subjects. Mild respiratory or febrile illnesses occurring between days 0 and 28 of the study were observed in 30%, 50%, and 40% of participants who received RSV LID / ΔNS1, LID / F1G2 / ΔNS1, and placebo, respectively (Table 4). No cases of lower respiratory tract illness (LRI) were observed during this period. In vaccine recipients, each of these mild respiratory / febrile illness incidents occurred concurrently with the detection of exogenous respiratory pathogens (data not shown). Subjects in all groups did not shed detectable vaccine virus and showed attenuation (Table 4). Single-vaccine recipients (LID / F1G2 / ΔNS1 group) had ≥4-fold increases in serum RSV neutralizing antibodies and RSV-F binding antibodies, but no vaccine virus shedding or exogenous RSV was detected (Tables 4 and 5). This low level of immunogenicity also indicated attenuation. Thus, both of these new vaccine candidates were sufficiently attenuated to proceed to evaluation in younger children with RSV seronegative blood.

[0156] Therefore, RSV LID / ΔNS1 and LID / F1G2 / ΔNS1 vaccine candidates were evaluated in RSV seronegative children aged 6–24 months, a potentially primary target age group for pediatric RSV vaccination (Tables 5 and 6). Enrollment began in 2019 and is still ongoing. Data are available for 4 subjects and 2 placebo recipients in each vaccine group (full enrollment will include 35–50 subjects in total, with 14–20 subjects per vaccine group and 7–10 placebo recipients). Mild respiratory or febrile illnesses occurring between days 0 and 28 of the study were observed in 50%, 75%, and 50% of participants receiving RSV LID / ΔNS1, LID / F1G2 / ΔNS1, and placebo, respectively (Table 6). These incidents did not appear to be related to vaccine virus shedding (data not shown). There were no LRI incidents. Two vaccine recipients in the LID / ΔNS1 group showed a 2.1 log 10 PFU (culture) and 5.4log 10 Vaccine virus excretion was measured at the mean peak titer of copy number (RT-PCR). In the LID / F1G2 / ΔNS1 group, all four vaccine recipients excreted 1.3 log. 10 PFU (culture) and 3.9log 10 Vaccine virus detectable by culture and / or RT-PCR was excreted at mean peak titers by copy number (RT-PCR) (Table 6). A ≥4-fold increase in serum RSV neutralizing antibody and / or RSV-F-binding antibody was not observed in any recipient of RSV LID / ΔNS1 virus, but it was detected in 75% of recipients of RSV LID / F1G2 / ΔNS1 virus at mean titers of 5.5log2 (PRNT) and 10.8log2 (ELISA) (Table 7).

[0157] Based on these initial data, the two novel viruses (LID / ΔNS1 and LID / F1G2 / ΔNS1) appeared to be significantly attenuated and well tolerable. In both RSV seropositive and RSV seronegative subjects, the frequency of mild respiratory / febrile illness was approximately the same as in placebo recipients and typically occurred concurrently with the exogenous pathogen.

[0158] Both viruses appeared to be very restrictive. In RSV seropositive subjects, no shedding of either virus was observed, regardless of whether it was assayed by culture or RT-PCR, and only one vaccine recipient had a serum RSV-specific antibody response. In RSV seronegative subjects, 50% of LID / ΔNS1 recipients shed virus detectable by culture and RT-PCR, albeit only at low titers. In RSV seronegative subjects, 50% and 100% of LID / F1G2 / ΔNS1 recipients shed virus detectable by culture and RT-PCR, respectively, albeit only at low titers.

[0159] In RSV seronegative recipients, LID / ΔNS1 virus did not induce a ≥4-fold increase in serum RSV-PRNT and ELISA antibody responses, while LID / F1G2 / ΔNS1 virus induced a ≥4-fold increase in serum RSV-PRNT and ELISA antibodies in 75% of recipients.

[0160] In summary, this study provided the first human evaluation of two modifications to a live attenuated RSV vaccine candidate: (i) deletion of the NS1 gene, and (ii) migration of the F and G gene positions from 8 and 7 to 1 and 2, respectively. The deletion of the NS1 gene resulted in a virus that was very attenuated, well-tolerated, and very restrictive, with moderate immunogenicity in the case of LID / F1G2 / ΔNS1. The F1G2 gene migration appeared to increase immunogenicity, increasing the percentage of recipients with a ≥4-fold serum antibody response from 0% (LID / ΔNS1) to 75% (LID / F1G2 / ΔNS1). This study remains ongoing and will enroll additional 6-24 month old RSV seronegative subjects.

[0161] The inventors generally believe that in order to have a sufficient antigenic load, the infectious frequency detected by culture must be approximately 85% or higher, and the logarithm must be 3.0-4.0. 10 Since it is preferable to have an average peak titer of excreted virus detected by culture at PFU / ml, the available data should be such that these viruses are 5.0 log 10 The PFU dose increased the likelihood of excessive attenuation. Naturally, further data from ongoing clinical studies should clarify the nature of these viruses. If either or both viruses are considered excessively attenuated, this would likely be 5.0log, as previously done with another live attenuated RSV candidate described below. 10 6.0log from PFU 10 This can be compensated for by increasing the dose up to PFU.

[0162] The inventors evaluated a virus previously called RSV ΔNS2 / Δ1313 / I1314L (having a deletion in the NS2 gene, as well as the presence of a Δ1313 codon deletion in L, and stabilization of the I1314L mutation in L) in RSV-seronegative and RSV-seronegative children (Karron 2019. Safety and Immunogenicity of the Respiratory Syncytial Virus Vaccine RSV / ΔNS2 / Δ1313 / I1314L in RSV-Seronegative Children. J Infect Dis. pii: jiz408. doi: 10.1093 / infdis / jiz408. [Electronic publication before printing]; ClinicalTrials.gov identifier: NCT01893554). 5.0log 10 When administered at PFU doses to RSV seronegative children, the RSV ΔNS2 / Δ1313 / I1314L virus showed good tolerance. Shedding was observed in one out of 15 recipients by culture (peak titer 1.4 log). 10 PFU / ml), and RT-PCR results for 11 out of 15 recipients (mean peak titer 3.0 log). 10 It was detectable by copy / ml. 6.0log 10 When administered at a dose 10 times higher than PFU, infectivity was substantially improved, and excretion was observed in 16 out of 20 recipients by culture (mean peak titer 1.8 log). 10 PFU / ml), and RT-PCR results for 18 out of 20 recipients (mean peak titer 3.5 log). 10 Detected at (copies / ml). Importantly, the percentage of recipients with a ≥4-fold increase in serum PRNT increased from 53% to 80%. Dose increases had no effect on tolerability, and 5.0 and 6.0 log 10 The incidence of mild respiratory / febrile illness at the doses was 73% and 55%, respectively, compared to 14% and 70% in the individual placebo recipient groups.

[0163] In conclusion, the Phase I clinical study in RSV seronegative children aged 6–24 months showed a 5.0 log 10 At PFU doses, RSV LID / ΔNS1 and LID / F1G2 / ΔNS1 were significantly attenuated, very restrictive, and well tolerable, while LID / F1G2 / ΔNS1 showed moderate immunogenicity. Migration of the F and G genes to positions 1 and 2 was associated with increased immunogenicity. [Table 4] [Table 5] [Table 6] [Table 7]

[0164] (Example 3) Prime-boosted immunity with a live attenuated RSV vaccine This study evaluated the boosting effect of an rB / HPIV3 vector expressing DS-Cav1-stabilized RSV pre-F protein, with and without the B3TMCT mutation, in comparison to RSV. Boosting was evaluated in hamsters and African green monkeys (AGMs) that were pre-infected with primary RSV. In addition, the effect of different time intervals between priming and boosting (approximately 2, 6, and 15 months) was evaluated in AGMs. The results show that in all experimental animals and at all time intervals, boosting with an rB / HPIV3 vector expressing RSV F, engineered for enhanced immunogenicity, induced significantly higher titers of serum RSV-neutralizing antibodies compared to boosting with RSV, particularly antibodies capable of neutralizing RSV in vitro without complement supplementation, and therefore particularly potent.

[0165] RSV F and G proteins are the two RSV neutralizing antigens and major protective antigens. F is generally considered to be a more potent neutralizing and protective antigen than G, and its amino acid sequence is highly conserved among RSV strains. RSV F is produced in a metastable pre-fusion (pre-F) conformation, which drives membrane fusion and can easily be triggered to undergo a major irreversible conformational rearrangement that releases F in a highly stable post-fusion (post-F) conformation (McLellan et al. 2010. Structure of a major antigenic site on the respiratory syncytial virus fusion glycoprotein in complex with neutralizing antibody 101F. J Virol 84:12236-44; Swanson et al. 2011. Structural basis for immunization with postfusion respiratory syncytial virus fusion F glycoprotein (RSV F) to elicit high neutralizing antibody titers. Proc Natl Acad Sci USA 108:9619-24; McLellan et al. 2013. Structure of RSV fusion glycoprotein trimer bound to a prefusion-specific neutralizing antibody. Science See 340:1113-7). Pre-F and post-F share some neutralizing epitopes, but most of the neutralizing activity in convalescent human serum recognizes pre-F specific epitopes (Graham. 2017. Vaccine development for respiratory syncytial virus. Curr Opin Virol 23:107-112).RSV F can be substantially stabilized in the pre-F conformation by structure-based manipulation, for example, by introducing a disulfide bond called "DS" and two hydrophobic cavity-filling amino acid substitutions called "Cav1" (McLellan et al. 2013. Structure-based design of a fusion glycoprotein vaccine for respiratory syncytial virus. Science 342:592-8). DS-Cav1 stabilized pre-F exhibits substantially higher immunogenicity in rodents and non-human primates than either post-F expressed as a subunit vaccine or by a parainfluenza virus (PIV) vector (Liang et al. 2015. Enhanced Neutralizing Antibody Response Induced by Respiratory Syncytial Virus Prefusion F Protein Expressed by a Vaccine Candidate. J Virol 89:9499-510).

[0166] Several attenuated derivatives of RSV strain A2 are being developed as candidate attenuated-in-RSV vaccines (see Karron et al. 2013. Live-attenuated respiratory syncytial virus vaccines. Curr Top Microbiol Immunol 372:259-84). Some of these attenuated viruses have shown good tolerability and immunogenicity in Phase I studies in infants and young children.

[0167] In addition, PIV vector strategies expressing RSV antigens, primarily the F protein, from added genes are being explored. HPIV serotypes 1, 2, and 3 are important pediatric respiratory viruses, and HPIV3 is second only to RSV as a major cause of severe pediatric respiratory infections. PIV is an enveloped, unsegmented, negative-sense RNA virus associated with RSV, belonging to the family Paramyxoviridae in the order Mononegavirales. rB / HPIV3 consists of the bovine PIV3 (BPIV3) genome (which, due to host range restriction, confers attenuation in humans and non-human primates), where the BPIV3 F and hemagglutinin-neuraminidase (HN) glycoprotein genes (encoding two PIV3 neutralizing antigens and a major protective antigen) are replaced with their human PIV3 (HPIV3) counterparts.

[0168] result Comparison of booster immunization with RSV versus rB / HPIV3-RSV-preF vector in hamsters pre-infected with RSV. Two rB / HPIV3 vectors have been previously described (Liang et al. 2017. Improved Prefusion Stability, Optimized Codon Usage, and Augmented Virion Packaging Enhance the Immunogenicity of Respiratory Syncytial Virus Fusion Protein in a Vectored-Vaccine Candidate. J Virol 91): rB / HPIV3 / DS-Cav1 (abbreviated as DS-Cav1 vector) expressing RSV F with significantly increased preF conformation stability due to the DS-Cav1 mutation; and rB / HPIV3 / DS-Cav1 / B3TMCT (abbreviated as DS-Cav1 / B3TMCT vector) expressing RSV F with the same DS-Cav1 mutation and replacement of its TMCT domain with that of the BPIV3 F protein to achieve efficient integration into the vector virion. These two vectors were compared to RSV D46 in hamsters pre-infected with a single primary IN infection, in terms of their ability to infect and induce a secondary or booster response of serum RSV neutralizing antibodies (Figure 14A). RSV D46 was used for infection because the attenuated RSV strains were insufficiently infectious in hamsters due to strong host range limitations.

[0169] 48 hamsters were confirmed to be seronegative for RSV and HPIV3, and divided into four groups (groups A-D, n=12 each), with 10 animals per group. 6PFUs were primed by IN inoculation with RSV D46 (Figure 14A). Forty-eight additional RSV and HPIV3 seronegative hamsters from four groups (groups E-H, n=12 each) were left unprimed for comparison. Six weeks after priming, serum was collected and RSV-PRNT and HPIV3-PRNT were measured. Two days later, primed and unprimed pairs were boosted with IN using either (i) empty rB / HPIV3 vector (groups A and E); (ii) DS-Cav1 vector (groups B and F); (iii) DS-Cav1 / B3TMCT vector (groups C and G); or (iv) RSV D46 (groups D and H). The vectors were administered at a dose of 10 per animal. 5 TCID 50 At this dosage, RSV D46 is 10 6 The hamsters were administered in PFU doses. Five days after boosting, six hamsters per group were sacrificed, and their turbinates (NTs) and lungs were collected and assayed by immunoplaque assay (RSV) or limiting dilution assay (rB / HPIV3 vector) to determine infectious virus titers. Serum from the other six hamsters per group was collected two weeks after boosting, and RSV-PRNTs and HPIV3-PRNTs were measured. Two days later, the animals were in challenged with RSV D46 as described below.

[0170] Analysis of viral titers in non-primed animals 5 days after boosting showed that DS-Cav1 and DS-Cav1 / B3TMCT vectors replicated to lower titers than empty vectors in the NT and lungs (Figures 14B and 14C, lanes 3 and 5 vs 1, respectively), indicating attenuation due to the presence of RSV F inserts. The DS-Cav1 / B3TMCT vector was somewhat attenuated compared to the DS-Cav1 vector, consistent with the view that the incorporation of RSV F into the vector envelope may interfere with vector replication.

[0171] A comparison of RSV-primed versus unprimed animals (Figures 14B and 14C: even lanes vs. odd lanes) showed that priming immunity completely restricted the replication of RSV D46 booster (Figures 14B, 14C, lanes 8 vs. 7) but had no effect on the replication of empty rB / HPIV3 vectors (lanes 2 vs. 1), consistent with the expectation that RSV-specific immunity restricts the replication of RSV rather than rB / HPIV3. Priming with RSV resulted in moderate restriction of DS-Cav1 vector replication (2x in NT, 4x in lungs) (Figures 14B, 14C, lanes 4 vs. 3) and somewhat greater restriction of DS-Cav1 / B3TMCT vector replication (32x in NT, 10x in lungs; Figures 14B and 14C, lanes 6 vs. 5), but the difference between the primed and unprimed groups was statistically significant only for DS-Cav1 / B3TMCT vector in NT (Figure 14B, lanes 6 vs. 5). These observations suggest that rB / HPIV3-mediated expression of RSV F conferred a somewhat increased, lower level of sensitivity to RSV-specific immunization when RSV F was packaged in a vector virion.

[0172] Analysis of HPIV3 neutralizing antibody titers in serum collected from non-primed animals two weeks after boosting showed that the presence of any RSV insert in the rB / HPIV3 vector was associated with a decrease in HPIV3 neutralizing antibodies compared to an empty vector (Figure 14D, lanes 3 and 5 vs 1), consistent with the decrease in replication associated with the aforementioned inserts. The presence of the DS-Cav1 insert did not detectably reduce HPIV3 immunogenicity in primed versus non-primed animals (Figure 14D, lanes 4 vs 3), while the DS-Cav1 / B3TMCT insert resulted in a significant decrease in HPIV3 immunogenicity in primed versus non-primed animals (Figure 14D, lanes 6 vs 5), consistent with the above limitation.

[0173] Serum RSV-PRNTs induced by priming and boosting were determined by assays with and without guinea pig complement (Figures 14E and 14F). Complement addition can confer steric hindrance and viral lytic activity to antibodies, resulting in enhanced detection of RSV-specific antibodies that may have inferior neutralizing activity by other methods. Neutralization assays in the absence of added complement are a more rigorous assay for “high-quality” antibodies that directly neutralize RSV (see Liang et al. 2016 Packaging and Prefusion Stabilization Separately and Additively Increase the Quantity and Quality of Respiratory Syncytial Virus (RSV)-Neutralizing Antibodies Induced by an RSV Fusion Protein Expressed by a Parainfluenza Virus Vector. J Virol 90:10022-10038; Liang et al. 2017 Improved Prefusion Stability, Optimized Codon Usage, and Augmented Virion Packaging Enhance the Immunogenicity of Respiratory Syncytial Virus Fusion Protein in a Vectored-Vaccine Candidate. J Virol 91).

[0174] Primary priming infection with RSV D46 induced high serum RSV-PRNT measured in the presence of complement and lower RSV-PRNT measured in the absence of complement. Specifically, serum collected from groups A-D 6 weeks after priming had mean serum RSV-PRNTs ranging from 10.6 log2 (1:1,552) to 11.2 log2 (1:2,353) determined with complement (Figure 14E), and from 4.5 log2 (1:23) to 5.2 log2 (1:37) determined without complement (Figure 14F).

[0175] Boosting with RSV D46 tripled the mean serum RSV-PRNT measured with complement up to a mean post-boosting titer of 12.3 log2 (1:5,043) (Figure 14E, lanes 7 vs 8), and tripled the mean serum RSV-PRNT measured without complement up to a mean post-boosting titer of 6.6 log2 PRNT (1:97) (Figure 14F, lanes 7 vs 8).

[0176] Boosting with DS-Cav1 and DS-Cav1 / B3TMCT vectors increased the mean serum RSV-PRNT measured with complement by 8-fold and 6-fold, respectively, up to significantly high post-boosting mean titers of 13.8log2 (1:14,263) and 13.7log2 (1:13,308) (Figure 14E, lanes 3 vs 4 for DS-Cav1, lanes 5 vs 6 for DS-Cav1 / B3TMCT). Mean serum RSV-PRNT before and after boosting, measured without complement, increased by 9-fold and 18-fold, respectively, up to post-boosting mean titers of 8.3log2 (1:315) and 9.3log2 (1:630) (Figure 14F, lanes 3 vs 4 for DS-Cav1 vector, lanes 5 vs 6 for DS-Cav1 / B3TMCT vector).

[0177] Six animals per group are used for post-boosting serology, with 10 per animal. 6 Intravenous infection (IN) with RSV D46 in PFUs was performed, and challenged NTs and lungs were collected 2 days after serum collection. Challenged RSV titers were determined by immunoplaque assay 3 days after challenge. Animals not primed with RSV and boosted with an empty rB / HPIV3 vector, and therefore lacking RSV-specific immunity, showed approximately 5.0 log challenged RSV titers in NTs and lungs. 10The hamsters had PFU / g tissue. All hamsters in other groups primed and / or boosted with RSV D46 and / or rB / HPIV3 expressing RSV F did not have detectable infectious challenge RSV in the NT and lungs (data not shown). Thus, all priming and / or boosting combinations were highly protective in this semi-permissible model for RSV replication and could not be distinguished based on protective efficacy.

[0178] In summary, when the rB / HPIV3 vector was used for booster immunization, there was substantial vector replication and a robust increase in serum RSV-PRNT, resulting in very high titers. In contrast, when RSV D46 was used as a booster, its replication was very limited, and the increase in RSV-PRNT was significantly lower. Furthermore, the multiplier of increase in serum RSV-PRNT induced by the rB / HPIV3 vector was higher for high-quality RSV neutralizing serum antibodies measured without complement.

[0179] Comparison of booster immunization in AGM. Booster immunization also depends on the combination of IN / IT pathways (10 per site). 6 PFUs were evaluated in AGMs pre-primed with a single RSV infection. The viruses used in these primary immunizations were various attenuated derivatives of RSV strain A2 or wt strain rRSV A / Maryland / 001 / 11 (which, like strain A2, is derived from subgroup A). ​​The priming RSVs are listed in Tables 8-10 and described below. Note that while we treated all these viruses to be equal with respect to priming, we distributed animals receiving different viruses evenly among the boosting groups. In three separate experiments (AGM experiment numbers 1-3), pre-primed AGMs were evaluated by a combination of IN / IT pathways against attenuated RSV (10 per site). 6 PFU) or DS-Cav1 / B3TMCT vector (10 per site) 6 TCID 50In experiment number 2, a single booster infection was administered. In experiment number 2, additional RSV prime AGM was administered via DS-Cav1 vector (10 per site). 6 TCID 50 In all cases, the booster RSV was a live attenuated vaccine candidate called RSV 276, which is a version of RSV strain A2 that has been attenuated by the deletion of most M2-2 ORFs.

[0180] For 12 animals (AGM Experiment No. 1, Figure 15 and Table 8), the time interval between prime and boost was approximately 2 months (specifically 51 days, equivalent to 2 months minus 9 days). For 20 other animals (AGM Experiment No. 2, Figure 16 and Table 9), the time interval between prime and boost was approximately 6 months (specifically 189 days, equivalent to 6 months plus 9 days). For the remaining 4 animals (AGM Experiment No. 3, Figure 17 and Table 10), the time interval was approximately 15 months (specifically 443 days, equivalent to 15 months minus 7 days).

[0181] To monitor viral shedding after boosting, NPs and TLs were collected daily and every other day, respectively, for 10 consecutive days, and viral titers were determined by immunoplaque assay (RSV) or limiting dilution (B / HPIV3 vector). Serum was collected every 7 days for 4 consecutive weeks, one day before or earlier than the boost day, on the boost day, and thereafter, and PRNT was determined.

[0182] AGM Experiment No. 1: Booster immunization of AGM approximately 2 months (2 months minus 9 days) after priming with RSV. One of three different RSV strains (Table 8) was available: (i) RSV LID / ΔNS1, an NS1 gene deletion mutant; (ii) RSV LID / F1G2 / ΔNS1, a derivative of the preceding virus in which the RSV F and G genes were moved to the first and second genomic positions to increase their expression; and (iii) 12 AGMs that had been pre-immunized with single priming immunization with subgroup A wt strain rRSV A / Maryland / 001 / 11. On day 37 postpriming (2 weeks before boosting), serum was collected and analyzed to determine RSV-PRNT in the presence of complement and to confirm HPIV3 seronegativity. Twelve AGMs were reassigned to two separate groups of six animals each, so that the two groups would have a similar number of animals with high, moderate, or low 37-day serum RSV-PRNT, have essentially identical group-average RSV-PRNT, and be balanced in terms of priming virus identity and sex ratio (Table 8). [Table 8]

[0183] On day 51, one group was boosted with RSV 276, and the other group with the DS-Cav1 / B3TMCT vector. NP, TL, and serum samples were collected to assess viral shedding and immunogenicity (Figures 15B-15E). RSV 276 shedding was detected only in trace amounts in NP for 1 day and not in TL. In previous experiments, infection of four RSV seronegative AGMs with RSV 276 resulted in a 3.0 log increase in both NP and TL. 10 The high peak average titer reaching PFU / ml resulted in substantial viral shedding over a 10-day period, thus substantiating the very low shedding of RSV 276, attributable to limitation by RSV-specific immunization in RSV-primed animals (Figure 19). In contrast, shedding of the DS-Cav1 / B3TMCT vector was approximately 5.0 log at NP. 10 TCID 503.4log in / ml and TL 10 TCID 50 The peak mean titer in / ml was substantial over 10 days in both NP and TL (Figures 15B and 15C).

[0184] The mean pre-boost serum RSV-PRNT for all 12 animals measured with complement was 1:256 (Figure 15D). Boosting with RSV 276 and DS-Cav1 / B3TMCT vectors increased serum RSV-PRNT measured with complement 22-fold and 91-fold relative to the pre-boost titer, reaching peak mean titers of 1:5,793 and 1:23,170, respectively (occurring 14 days post-boost), which was significantly different (Figure 15D). The peak mean post-boost serum RSV-PRNT for the vectors was four times greater than that for RSV 276.

[0185] When measured in the absence of complement, the mean pre-boost serum RSV-PRNT for all 12 animals was 1:12 (Figure 15E). Boosting with the RSV 276 and DS-Cav1 / B3TMCT vectors increased titers 25-fold and 366-fold, respectively, to peak mean titers of 1:294 and 1:4,390 (occurring 14 days post-boost; Figure 15E), which was significantly different. The peak mean post-boost serum RSV-PRNT for the vectors was 15-fold greater than that for RSV 276. Thus, the vectors had a stronger boosting effect than RSV 276, particularly for “high-quality” neutralizing antibodies detected without complement.

[0186] AGM Experiment No. 2: Booster immunization with AGM approximately 6 months (6 months plus 9 days) after priming with RSV. One of five different RSVs (Table 9): (i) RSV D46 / NS2 / N / ΔM2-2-HindIII, an M2-2 deletion mutant; (ii) RSV LID / ΔNS2 / 1030s, an NS2 deletion mutant with a genetically stabilized temperature-sensitive (ts) mutation in L polymerase; (iii) RSV LID / ΔNS1, an NS1 deletion mutant, which was also one of the priming viruses in experiment number 1, although in a different AGM; (iv) RSV LID / F1BBG2 / ΔNS1 / , a version of the preceding LID / ΔNS1 mutant in which the F gene was codon-optimized for increased translation, and the F and G genes were moved to the first and second genomic positions, respectively, for increased expression; and (v) 20 other AGMs that had been pre-primed with single priming immunization with RSV 276 (described above), which is also an attenuated ΔM2-2 RSV used in the boost as already described. [Table 9]

[0187] Following primary immunization, serum was collected and analyzed at days 28 and 154 to measure RSV-PRNT in the presence of complement and to confirm HPIV3 seronegativity (one animal, number AG 8960 [Table 9], was found to be HPIV3 seropositive and was therefore assigned to be boosted with RSV rather than the rB / HPIV3 vector). Twenty AGMs were reassigned to three groups (n=6, 7, and 7) with balanced serum RSV-PRNT, priming virus identity, and sex ratio at day 154 (Table 9). At 189 days post-priming (6 months plus 9 days), the three groups were boosted with RSV 276, DS-Cav1 vector, or DS-Cav1 / B3TMCT vector. NPs, TLs, and serum specimens were collected to assess viral shedding and immunogenicity (Figure 16).

[0188] RSV 276 efflux was undetectable in NPs by immunoplaque assay (Figure 16B), while detection of RSV 276 in TLs was low and scattered (Figure 16C). Evaluation of TL samples from many animals by RT-qPCR (detecting both positive and negative sense RSV M RNA) was more sensitive, giving a large number of samples positive for RSV RNA with titers of up to 450–5,500 RNA molecules / ml (Figure 20). In contrast, efflux of DS-Cav1 and DS-Cav1 / B3TMCT vectors was approximately 5.5 log in NPs. 10 TCID 50 5.0 log in / ml and TL 10 TCID 50 The DS-Cav1 / B3TMCT vector was abundantly detected by limiting dilution assays in NP and TL over a period of 8–10 days, with similar peak mean titers of / ml. The DS-Cav1 / B3TMCT vector appeared to replicate slightly slower than the DS-Cav1 vector, but this difference was significant in TL only on days 2 and 4 (Figure 16C). The two vectors eventually reached similar peak NP and TL titers (Figures 16B and 16C).

[0189] When measured by a complement-enhanced neutralization assay (Figure 16D), the mean serum RSV-PRNT in 20 AGMs immunized with attenuated RSV approached 10Log2(1:1,024) on day 28 (Figure 16D), then decreased to 1:64 on day 189 when boosting was administered. Boosting with RSV 276, DS-Cav1 vector, and DS-Cav1 / B3TMCT vector increased the mean serum RSV-PRNT measured with complement by 78-fold, 260-fold, and 776-fold, respectively, to peak mean titers of 1:4,973, 1:16,615, and 1:49,667 (occurring on day 14 after boosting; Figure 16D), which differed significantly between each vector and RSV 276. Peak mean boosted serum RSV-PRNT for DS-Cav1 and DS-Cav1 / B3TMCT vectors were 3-fold and 10-fold higher, respectively, than for RSV 276. The DS-Cav1 / B3TMCT vector appeared to be slightly more immunogenic than DS-Cav1 despite its slightly slower replication, which may be due to the B3TMCT modification, although the difference was not statistically significant (Figure 16D).

[0190] When measured by a complement-free PRN assay (Figure 16E), the mean pre-boost serum RSV-PRNT in 20 AGMs was 1:8. Boosting with RSV 276, DS-Cav1 vector, and DS-Cav1 / B3TMCT vector increased peak mean serum RSV-PRNT by 37-fold, 315-fold, and 446-fold, respectively, up to titers of 1:294, 1:2,521, and 1:3,565 (occurring 14 days post-boost), which differed significantly between each vector and RSV 276. Peak mean post-boost serum RSV-PRNT for DS-Cav1 and DS-Cav1 / B3TMCT vectors were 9-fold and 12-fold higher, respectively, than for RSV 276.

[0191] The ability of boosts with DS-Cav1 and DS-Cav1 / B3TMCT vectors to induce serum HPIV3 neutralizing antibodies was compared using an HPIV3 neutralization assay without complement supplementation (Figure 21). Note that the animals were seronegative for HPIV3 prior to boosting, and therefore these inoculations were primary immunizations against HPIV3. The two vectors induced very similar peak mean serum HPIV3-PRNTs (1:724 and 1:776, respectively, occurring 14 days post-inoculation), indicating that they were essentially equivalent immunogenicity against HPIV3. This is consistent with the observation that the two vectors replicated to similar peak titers in AGM (Figures 16B and 16C).

[0192] The ability of DS-Cav1 and DS-Cav1 / B3TMCT vectors versus RSV 276 boosting to induce serum and mucosal IgA antibodies binding to the RSV DS-Cav1 F protein was also evaluated (Figures 16F and 16G). A highly sensitive DELFIA TRF immunoassay was used to detect monkey IgA binding to the purified recombinant RSV DS-Cav1 F protein as an antigen. IgA titer is expressed as a log2 dilution giving 400 fluorescence units in the DELFIA TRF assay. Boosting with both vectors induced a strong serum IgA response, and the peak mean titers after boosting with both vectors were identical (19.5 log2), approximately 16 times higher than those induced by boosting with RSV 276 (15.6 log2). A peak serum IgA response consistent with the peak serum RSV neutralizing antibody response was detected 14 days after boosting. Since respiratory mucosal antibody responses are considered particularly effective in limiting RSV infection, we also evaluated nasal mucosal IgA responses to boost. Intranasal mucosal fluid was collected using absorbent membranes (SAM strips). This method provides a relatively high concentration mucosal sample suitable for detecting IgA (Figure 16G). In all groups, the peak of the mucosal IgA response, coinciding with the peaks of serum IgA (Figure 16F) and serum RSV neutralizing antibodies (Figures 16D and 16E), occurred 14 days after boost (Figure 16G). Again, DS-Cav1 and DS-Cav1 / B3TMCT vectors induced similar strong responses (mean peak titers of 12.1 and 12.8 log2, respectively), but the response to RSV 276 was about one-eighth (mean peak titer of 9.2 log2). Therefore, the DS-Cav1 and DS-Cav1 / B3TMCT vectors significantly outperformed RSV 276 in their ability to boost serum and mucosal IgA antibody responses to the RSV pre-F protein.

[0193] AGM Experiment No. 3: Booster immunization of AGM approximately 15 months (15 months minus 7 days) after priming with RSV. Four other AGMs that had previously received monoprimary immunization with RSV 276 were available (Table 10). Serum was collected and analyzed 429 days post-primary infection (and 2 weeks prior to boosting) to determine RSV-PRNT in the presence of complement and to confirm HPIV3 seronegativity. The AGMs were allocated to two groups (n=2 each) balanced in terms of serum RSV-PRNT and sex ratio (Table 10). 443 days post-primary infection (15 months minus 7 days), the two groups were boosted with either RSV 276 or DS-Cav1 / B3TMCT vectors, and viral replication and serological responses were monitored as described above. [Table 10]

[0194] Replication of RSV 276 after approximately 15 months was very limited, and the virus was not detected by immunoplaque assays of NPs and TLs, but replication of the DS-Cav1 / B3TMCT vector was robust (Figures 17B and 17C).

[0195] The mean pre-boost serum RSV-PRNT for four animals measured with complement was 1:33 (Figure 17D). Boosting with RSV 276 and DS-Cav1 / B3TMCT vectors increased the peak mean serum RSV-PRNT measured in the presence of complement by 216-fold and 926-fold, up to titers of 1:7,132 and 1:30,574, respectively (occurring on day 14; Figure 17D). The peak mean post-boost serum RSV-PRNT for the vectors was four times higher than for RSV 276.

[0196] The mean pre-boost serum RSV-PRNT for four animals measured without complement was 1:6 (Figure 17D). Boosting with RSV 276 and DS-Cav1 / B3TMCT vectors increased peak mean serum RSV-PRNT by 171-fold and 1,274-fold, respectively, up to titers of 1:1,024 and 1:7,643 (occurring on day 14; Figure 17E). Peak mean post-boost serum RSV-PRNT for the vectors was 7 times higher than for RSV 276.

[0197] RSV serum antibodies suppressed the replication of the DS-Cav1 / B3TMCT vector in vitro. Since the replication of the DS-Cav1 / B3TMCT vector in hamsters was significantly reduced in the NT by RSV-specific immunization from primary infection (Figures 14B-14D), we investigated whether the replication of this vector in vitro could be inhibited by RSV neutralizing antibodies. LLC-MK2 cells were infected with empty rB / HPIV3 vector or DS-Cav1 or DS-Cav1 / B3TMCT vector at a MOI of 0.01 and then incubated in medium containing 10% heat-inactivated (56°C for 30 minutes) serum from uninfected hamsters or hamsters infected with RSV D46 or rB / HPIV3 (from the experiment in Figure 14) in the absence of supplemented complement (Figure 18). The replication of the vector in the presence of added hamster serum was monitored for viral titer by taking small aliquots of the culture medium supernatant daily for three consecutive days.

[0198] As expected, rB / HPIV3 immunoserum completely inhibited the replication of all three vector constructs (Figures 18A-18C, black curves), while preimmune serum collected before primary immunization did not affect the replication of any construct (Figures 18A-18C). RSV immunoserum had no effect on the replication of empty rB / HPIV3 vectors (Figure 18A) or DS-Cav1 vectors (Figure 18B), but it significantly reduced the replication of DS-Cav1 / B3TMCT vectors by days 2 and 3, reducing the latter to 1 / 100th (Figure 18C). These results indicate that RSV-specific serum antibodies inhibited the replication of DS-Cav1 / B3TMCT vectors, but not DS-Cav1 vectors.

[0199] Consideration Non-restrictive approaches to developing pediatric RSV vaccines include (i) attenuated derivatives of RSV and (ii) rB / HPIV3 expressing the RSV F protein derived from the added gene. Both approaches have provided promising candidates under evaluation for primary immunization, but their usefulness for booster immunization has not been very clear. In previous pediatric clinical studies, live attenuated RSV as a vaccine candidate was not efficient in booster immunization administered in continuous doses over several months (at least in terms of inducing an increase in RSV-specific serum antibodies). For example, when a live attenuated RSV called MEDI-559 was administered to infants and young children in three consecutive doses at 2-month intervals, the second and third doses were generally less infective and less efficient in boosting the serum antibody response in these subjects who had previously received doses (see Malkin et al. 2013. Safety and immunogenicity of a live attenuated RSV vaccine in healthy RSV-seronegative children 5 to 24 months of age. PLoS One 8:e77104). Similar findings were obtained when a live attenuated RSV cpts248 / 404 was administered to infants and young children in two consecutive doses at 4-6 week intervals (see Wright et al. 2000. Evaluation of a live, cold-passaged, temperature-sensitive, respiratory syncytial virus vaccine candidate in infancy. J Infect Dis 182:1331-42). Similar findings have also been obtained with attenuated versions of PIV3 administered in consecutive doses at intervals of up to six months. Thus, in a “homogeneic” prime-boost (i.e., consecutive doses of the same vaccine virus), the attenuated RSV (or PIV3) is typically infectious, and only the first “ingestion” within a time interval of at least six months or less is substantially immunogenic to serum virus-neutralizing antibodies.However, the situation is different when secondary infection is caused by RSV D46 rather than attenuated RSV. Specifically, in a vaccine trial where subjects received attenuated RSV during the summer and were subsequently exposed to community RSV D46 during the winter, there was a 20-40 fold boost in serum RSV-PRNT (see Karron et al. 2015. A gene deletion that up-regulates viral gene expression yields an attenuated RSV vaccine with improved antibody responses in children. Sci Transl Med 7:312ra175). Therefore, the poor immunogenicity of repeated doses of attenuated RSV appears to be largely due to their attenuation.

[0200] This study investigated a "heterogeneous" prime-boost strategy. In this strategy, primary immunization with RSV was boosted by secondary immunization with rB / HPIV3 expressing the RSV F protein from an added gene. The RSV F protein's pre-F conformation was substantially stabilized by the DS-Cav1 mutation, and in the case of the DS-Cav1 / B3TMCT vector used in each experiment, it contained a B3TMCT modification that mediated the efficient packaging of RSV F into the vector virion. The rB / HPIV3 vector itself is antigenically distinct from RSV, but it expresses the RSV antigen, in this case the F protein. This can be targeted not only by RSV-specific immunization, including RSV-specific serum antibodies as measured in this study, but also by other historically less well-characterized effectors, including RSV-specific mucosal antibodies and cellular immunization. Regarding RSV-specific antibodies, binding to RSV F expressed by the vector would likely not directly block vector infection and transmission, because RSV F in this study is largely non-functional for fusion due to the DS-Cav1 mutation, and therefore, putatively, would minimize or not contribute to vector replication and propagation. However, RSV F expression in vector-infected cells may target these cells for destruction by cytotoxic T cells or antibody-dependent cell-mediated injury. In addition, as described, the DS-Cav1 / B3TMCT vector used in all experiments in this study expresses a B3TMCT version of the RSV F protein efficiently packaged in the vector virion, which may target the vector virion for destruction, for example, by opsonization. Binding of antibodies to the packaged RSV F may also create steric hindrance that interferes with the vector's HN and F proteins during binding and entry. It was also possible that the antibody response to RSV F could be suppressed by existing F-specific antibodies.

[0201] Homogeneous and heterogeneous boosting were evaluated in hamsters. When hamsters were given primary infection with RSV D46 and homogeneous booster infection with RSV D46 approximately 6 weeks later, no detectable infectious RSV was present in the recovered NT and lung tissue, consistent with the expectation that RSV-specific immunity would severely limit the replication of the RSV boost. However, there was a significant approximately 3-fold increase in measured serum RSV-PRNT with and without complement supplementation, suggesting that some infection and antigen expression occurred. In hamsters boosted with an empty rB / HPIV3 vector, there was no difference in viral titers in NT and lung between RSV-primed and non-primed animals, indicating that RSV-specific immunity did not actually limit the rB / HPIV3 backbone. In contrast, replication of DS-Cav1 and DS-Cav1 / B3TMCT vectors showed a moderate degree of restriction in RSV-primed versus non-primed animals, but the difference was significant only in the case of DS-Cav1 / B3TMCT vectors in NTs. This suggests that expression of the unpackaged version of the RSV F protein resulted in slight restriction of the vector by RSV-specific immunization, while expression of the packaged version of the RSV F protein resulted in somewhat greater restriction. This is related to a significant decrease in the induction of serum HPIV3 neutralizing antibodies by the DS-Cav1 / B3TMCT vector (but not the DS-Cav1 vector) in RSV-primed versus non-primed hamsters, providing another indicator of reduced replication of the DS-Cav1 / B3TMCT vector. In RSV prime hamsters, the DS-Cav1 and DS-Cav1 / B3TMCT vectors induced increases in serum RSV-PRNT assayed with complement (8x and 6x vs. 3x) for RSV D46, respectively. When assayed without complement, the increases were 9x and 18x vs. 3x, respectively. The resulting peak mean post-boosted serum RSV-PRNT assayed with or without complement was significantly greater for the vectors than for RSV D46.Thus, these results in hamsters indicate that (i) allogeneic boosting with RSV D46 was very limited and moderately immunogenic; (ii) empty rB / HPIV3 vectors were not limited by RSV-specific immunization; (iii) RSV F expression with rB / HPIV3 conferred a low level of susceptibility to limitation by RSV-specific immunization, which becomes significant when RSV F is packaged in a vector virion; and (iv) boosting with the vector was significantly more immunogenic than boosting with RSV D46.

[0202] Boosting was also evaluated in AGMs who had prior primary RSV infection. Three different time intervals between primary RSV infection and boosting were evaluated: approximately 2, 6, and 15 months. It was anticipated that pre-boost host immunity might decrease with increasing time intervals, which could affect the effectiveness of the boost. Indeed, mean pre-boost serum RSV-PRNT progressively decreased in the approximately 2, 6, and 15-month groups, with titers of 1:256, 1:64, and 1:33 measured with complement, and 1:12, 1:8, and 1:6 measured without complement, respectively. It is reasonable to assume that other immune effectors were induced by primary RSV infection, e.g., mucosal antibodies and cellular immunity, and also decreased over time.

[0203] Replication of RSV 276 boost was restricted very almost equally after each time interval, accompanied only by sporadic traces of infectious virus shedding. Therefore, there was no difference between the time intervals in their ability to strongly restrict this attenuated RSV. Although infectious RSV shedding was very restricted, there was presumably some viral infection and antigen expression resulting in the observed secondary immune response. This is supported by RT-qPCR performed in experiment number 2, which detected viral nucleic acid shedding, and may include progeny viruses neutralized by secreted antibodies and undetectable by the infectivity assay.

[0204] In contrast to RSV, the DS-Cav1 / B3TMCT vector was robustly replicated. The peak mean titers of the vector at NP and TL were 4.8–5.4 log for experiment numbers 2 and 3. 10 TCID 50 The levels were very similar within the range of / ml. This level of DS-Cav1 / B3TMCT vector efflux is similar to what has been previously observed in RSV and HPIV3 seronegative rhesus monkeys (see Liang et al. 2017. Improved Prefusion Stability, Optimized Codon Usage, and Augmented Virion Packaging Enhance the Immunogenicity of Respiratory Syncytial Virus Fusion Protein in a Vectored-Vaccine Candidate. J Virol 91), suggesting that there was slight or no limitation of the vector by pre-existing immunization to RSV after time intervals of approximately 6 months and 15 months. In contrast, for experiment number 1 (time interval of approximately 2 months), the titer of the effluxed DS-Cav1 / B3TMCT vector was approximately 0.5log at NP. 10 TCID 50 Up to / ml, and 1.4-1.8 log in TL. 10 TCID 50 The levels decreased to as low as / ml (Table 11). This may indicate that the expression of RSV F by this vector, and the packaging of RSV F into vector virions, conferred a moderate amount of susceptibility to restriction by RSV-specific immunization after the shortest interval, similar to the restriction of the DS-Cav1 / B3TMCT vector, in RSV-prime hamsters versus non-prime hamsters. Since cellular immunity induced by primary infection can only persist for a few months, this may have contributed to the restriction of the DS-Cav1 / B3TMCT vector, which was observed at approximately 2 months rather than approximately 6 and 15 months, as described above for the hamster model. However, in any event, restriction after an interval of approximately 2 months was small and not statistically significant. [Table 11]

[0205] To investigate potential limitations in AGM related to the packaging of RSV F protein into vector virions, post-boosted replication of the DS-Cav1 / B3TMCT vector (which efficiently packages RSV F) was compared to that of the DS-Cav1 vector (which is highly inefficient for packaging) in AGM experiment number 2 (approximately 6 months after priming). The replication of the DS-Cav1 / B3TMCT vector was hypothetically reduced compared to the DS-Cav1 vector due to (i) interference in vector replication resulting from the packaging of RSV F protein into vector virions, and / or (ii) limitations resulting from RSV-specific immunization targeting the packaged RSV F protein, as previously described. The replication kinetics of the DS-Cav1 / B3TMCT vector were slightly slower than those of the DS-Cav1 vector, but the difference was moderate and significant only on days 2 and 4 in the TL, and the peak titers for the two vectors were similar. The inventors found that RSV-specific hamster antiserum inhibited the replication of the DS-Cav1 / B3TMCT vector in cell culture (in the absence of complement), but not with DS-Cav1 or an empty vector. In this in vitro situation, the inhibition is presumably due to the binding of the antibody to RSV F packaged in the vector virion, and does not necessarily require the complete repetition of the one or more possible mechanisms that may operate in vivo.

[0206] Boosting with RSV 276 at intervals of approximately 2, 6, and 15 months resulted in peak mean serum RSV-PRNT increases of 22-fold, 78-fold, and 216-fold, measured with complement, leading to peak mean titers of 1:5,793, 1:4,973, and 1:7,132, respectively. When measured without complement, the respective increases in peak mean serum RSV-PRNT were 25-fold, 37-fold, and 171-fold, leading to peak mean titers of 1:294, 1:294, and 1:1,024, respectively. Thus, post-boosted serum RSV-PRNT was generally similar across different time intervals, except that the titer after the approximately 15-month interval was slightly higher compared to the other intervals (1-fold with complement and 3.5-fold without complement).

[0207] For the DS-Cav1 / B3TMCT vector, boosting at intervals of approximately 2, 6, and 15 months resulted in peak mean serum RSV-PRNT increases of 91-fold, 776-fold, and 926-fold, measured with complement, and peak mean post-boosted serum RSV-PRNTs of 1:23,170, 1:49,667, and 1:30,574, respectively. When measured without complement, the increases were 366-fold, 446-fold, and 1,274-fold, respectively, and peak mean post-boosted serum RSV-PRNTs of 1:4,390, 1:3,565, and 1:7,643, respectively. Thus, post-boosted titers were generally similar across different time intervals, with differences of less than twofold, and did not agree for any of the intervals.

[0208] In AGM Experiment No. 2, boosting with the DS-Cav1 / B3TMCT vector versus the DS-Cav1 vector induced a 3-fold increase in serum RSV-PRNT measured with complement and a 1.4-fold increase in titer measured without complement. In the hamster study, boosting with the DS-Cav1 / B3TMCT vector versus the DS-Cav1 vector was significant only for serum RSV-PRNT measured without complement, at only 2-fold.

[0209] In AGM experiments, peak mean post-boosted serum RSV-PRNT for the vectors were exceptionally high, up to 1:49,667 and 1:7,643, assayed with and without complement, respectively. This increases the possibility that some of the larger examples of boosting by the vectors may be blunted due to limitations in the magnitude of the immune response. Titers for the vectors were higher (3–10-fold) than for RSV 276 when assayed with complement, and the difference was even greater (7–15-fold) when assayed without complement. Both vectors also induced significantly larger responses in serum and mucosal IgA compared to RSV 276, with only slight differences between the two vectors. The greater immunogenicity of boosting by the vectors compared to RSV may reflect both their higher levels of replication (and the resulting greater antigen expression) and the DS-Cav1 and B3TMCT modifications to the RSV F protein.

[0210] Since the immune response to RSV decreases in infancy, boosting RSV-specific immunity after primary immunization with pediatric RSV vaccine may be important. In this study, boosting with an attenuated PIV vector expressing RSV F with DS-Cav1 and B3TMCT modifications was substantially more immunogenic than boosting with attenuated RSV, particularly for “high-quality” RSV neutralizing antibodies that neutralized in vitro without complement supplementation. The results were similar regardless of whether the interval between priming and boosting was approximately 2, 6, or 15 months. This suggests that PIV vectors may be effective for boosting during the same vaccination season or, instead, the following year. In addition, PIV-vectored RSV vaccines may be well-suited for primary immunization in young infants with passive serum RSV neutralizing antibodies from maternal transfer, including post-maternal immunization, or from passive antibody immunization, including the use of antibodies engineered for increased half-life. These passive antibodies may limit attenuated RSV but not PIV-vectored RSV vaccine. The use of attenuated PIV3 vectors also provides immunity against HPIV3, which is second only to RSV as a pathogen of severe acute respiratory illness in children.

[0211] Materials and Methods Virus. The RSV in this example was a recombinant (r) wild-type (wt) or attenuated version of subgroup A strain A2 (Genbank KT992094) prepared using reverse genetics (Collins et al. 1995. Production of infectious human respiratory syncytial virus from cloned cDNA confirms an essential role for the transcription elongation factor from the 5' proximal open reading frame of the M2 mRNA in gene expression and provides a capability for vaccine development. Proc Natl Acad Sci USA 92:11563-7). Attenuated RSV is described in the results. One additional RSV was rRSV A / Maryland / 001 / 11, a recombinant version of wt subgroup A strain RSV A / Maryland / 001 / 11 isolated from nasal lavage fluid collected in 2011 from adults with acute respiratory illness. The F and G proteins of the Maryland / 001 / 11 strain have 97% and 86% amino acid sequence identity with strain A2, respectively. The rB / HPIV3 construct, previously described (Liang et al. 2017. Improved Prefusion Stability, Optimized Codon Usage, and Augmented Virion Packaging Enhance the Immunogenicity of Respiratory Syncytial Virus Fusion Protein in a Vectored-Vaccine Candidate. J Virol 91), expresses a modified version of the F protein of RSV strain A2 (Genbank KT992094) derived from the addition of a gene at the second gene position.The vector constructs were (i) an empty vector, rB / HPIV3; (ii) rB / HPIV3 / DS-Cav1 (abbreviated as DS-Cav1 vector) expressing the RSV F protein with increased pre-F conformational stability due to DS and Cav1 mutations (McLellan et al. 2013 Structure-based design of a fusion glycoprotein vaccine for respiratory syncytial virus. Science 342:592-8); and (iii) rB / HPIV3 / DS-Cav1 / B3TMCT (abbreviated as DS-Cav1 / B3TMCT vector) expressing RSV F having its TM and CT domains replaced by the DS-Cav1 mutation and those of BPIV3 F. In addition, as previously described, the RSV F ORF used in the vector construct was modified by codon optimization (GenScript, Piscataway, NJ) and further modified by two amino acid substitutions called HEK (K66E and Q101P) that create an F identical at the amino acid level to the initial passage of RSV strain A2.

[0212] RSV and rB / HPIV3 vectors were grown in Vero cells and LLC-MK2 cells at 32°C, respectively. The complete genome sequences of all viruses were confirmed to be free of exogenous mutations detectable above the background by automated Sanger sequencing analysis of uncloned RT-PCR products (with the exception of approximately 30 and 120 nucleotides at the 3' and 5' ends, respectively, which included primer binding sites and had not been sequenced).

[0213] Titration of infectious virus and serum antibodies. The titer of the RSV preparation was determined by plaque assay in Vero cells by immunostaining using a mixture of three F-specific monoclonal antibodies as previously described (Luongo et al. 2013. Respiratory syncytial virus modified by deletions of the NS2 gene and amino acid S1313 of the L polymerase protein is a temperature-sensitive, live-attenuated vaccine candidate that is phenotypically stable at physiological temperature. J Virol 87:1985-96), and the titer was reported as log 10 plaque-forming units (PFU) per milliliter or gram. The titer of the rB / HPIV3 vector was determined by limiting dilution in LLC-MK2 cells by virus-positive wells detected by hemadsorption using guinea pig erythrocytes as previously described (Durbin et al. 1999. Mutations in the C, D, and V open reading frames of human parainfluenza virus type 3 attenuate replication in rodents and primates. Virology 261:319-30), and the titer was reported as log 10 50% tissue culture infectious dose (TCID 50 ).

[0214] The titers of serum RSV or HPIV3 neutralizing antibodies were determined by a 60% plaque reduction neutralization (PRN) assay in Vero cells using RSV or HPIV3 expressing green fluorescent protein (GFP) (Liang et al. 2014. Chimeric bovine / human parainfluenza virus type 3 expressing respiratory syncytial virus (RSV) F glycoprotein: effect of insert position on expression, replication, immunogenicity, stability, and protection against RSV infection. J Virol 88:4237-50). The assay was performed in the presence (RSV) or absence (RSV, HPIV3) of 5% supplemented guinea pig complement (Cedarlane, Burlington, NC) as described. The 60% plaque reduction neutralization titer (PRNT) is reported in log2 and / or arithmetic values. Prior to primary infection, animals were confirmed to be RSV or HPIV3 seronegative by complement-enhanced PRN assay or hemagglutination inhibition assay using guinea pig erythrocytes (Coates et al. 1966. An antigenic analysis of respiratory syncytial virus isolates by a plaque reduction neutralization test. Am J Epidemiol 83:299-313; van Wyke Coelingh et al. 1988. Attenuation of bovine parainfluenza virus type 3 in nonhuman primates and its ability to confer immunity to human parainfluenza virus type 3 challenge. J Infect Dis 157:655-62).

[0215] Animal research. Animal research was conducted in accordance with the National Institutes of Health's guidelines for the management and use of laboratory animals and was approved by the NIAID Animal Management and Use Committee.

[0216] A single-prime-boost experiment was performed in Syrian golden hamsters as described in the legend of Figure 14 and in the attached results section.

[0217] Three prime-boost experiments were conducted in African green monkeys (AGM experiment numbers 1-3, Tables 8-10, and Figures 15-17, respectively). Primary AGM infection with RSV was performed using many different RSV strains, most of which were attenuated derivatives of RSV strain A2, and the results are described in Tables 8-10. In these studies, RSV was used in 1 ml of L-15 medium. 6 PFU was administered at a site-specific dose via a combination of the IN / intratracheal (IT) pathway. In this study, booster infections in AGM with RSV or DS-Cav1 / B3TMCT or DS-Cav1 vector were administered in 1 ml of L-15 medium. 6 PFU(RSV) or 10 6 TCID 50 The (vector) was administered in the same manner, using a combination of IN / IT routes, at the site-specific dose. After inoculation, nasopharyngeal swabs (NPs) and tracheal lavage fluid (TLs) were collected daily and every other day for 10 days, rapidly frozen on dry ice, and stored at -80°C until titration. Serum was collected every 7 days before inoculation on the boost day and for the following four consecutive weeks.

[0218] In AGM experiment number 2, nasal mucosal endothelium was sampled on the day of boosting and on days 14, 21, and 28 post-boosting using synthetic adsorption matrix (SAM) strips (Nasosorption FXi, Hunt Developments, UK). The SAM strips were gently placed on the nasal mucosa in the subturbinate region of one nostril, held for 30 seconds, and placed in microtubules pre-filled with 300 μl of phosphate-buffered saline (PBS) containing 3% bovine serum albumin (BSA) and 0.1% Tween® 20. The samples were rapidly frozen on dry ice and kept at -80°C until use. Mucosal and serum IgA titers were determined by dissociation-enhanced lantanide fluorescence immunoassay (DELFIA) as described below.

[0219] The copy number of RSV RNA in AGM TL samples was quantified by reverse transcription-quantitative PCR (RT-qPCR) that was specific to both positive and negative sense RSV M gene sequences. Frozen AGM TL samples were briefly thawed in a 37°C water bath and immediately kept on ice. After clarification by centrifugation at 800g, 4°C for 5 minutes, total RNA in the TL samples was extracted using the QIAamp Viral RNA Mini kit (Qiagen). cDNA was prepared by reverse transcription using the Applied Biosystem RT kit (ThermoFisher Scientific) with random hexamer primers and analyzed by M-specific qPCR. For comparison, a standard curve was prepared using a DNA plasmid encoding the full genome of wt RSV A2 strain (LID) analyzed by the same qPCR assay. The copy number of reverse-transcribed RSV RNA in the TL samples was interpolated from the standard curve. Statistical analysis was performed using GraphPad Prism version 8, GraphPad Software, San Diego, California, USA.

[0220] Detection of IgA antibodies using dissociation-enhanced lantanide fluorescence immunoassay (DELFIA). Serum and mucosal IgA were detected by DELFIA immunoassay. Briefly, recombinant RSV DS-Cav1 F protein was expressed and purified in HEK293 cells as previously described (McLellan et al. 2013. Structure-based design of a fusion glycoprotein vaccine for respiratory syncytial virus. Science 342:592-8). 96-well DELFIA yellow plates (Perkin Elmer, Waltham MA) were coated with purified RSV DS-Cav1 F protein diluted in 100 μl of carbonate-bicarbonate buffer (Millipore Sigma, St. Louis MO) at 100 ng / well and incubated overnight at 4°C. All washings in the assay were performed once with 200 μl / well of washing buffer (1× DELFIA washing concentrate, Perkin Elmer, Waltham MA). After overnight antigen coating, the plates were washed and incubated at 37°C for 1 hour with 100 μl / well of blocking solution (PBS containing 0.1% Tween-20 and 3% BSA). The plates were washed, 100 μl of serum samples in a 4-fold dilution series in blocking solution were added, and incubated overnight at 4°C. After washing, 100 μl / well of anti-monkey IgA biotin conjugate (Alpha Diagnostic, San Antonio, TX), diluted 1:5000, was added to the blocking solution and incubated at 37°C for 1 hour. The plates were washed, and 100 μl / well of europium (Eu) conjugate streptavidin, diluted 1:2000 in DELFIA assay buffer (Perkin Elmer, Waltham, MA), was added. After incubation at 37°C for 1 hour, the plates were washed and incubated with 100 μl / well of DELFIA-enhanced solution (Perkin Elmer) at room temperature for 20 minutes with gentle shaking.Fluorescence was measured using the Eu-specific time-resolved fluorescence (TRF) program (340 nm excitation, 615 nm emission) on a Synergy Neo 2 plate reader (BioTek, Winooski, VT). A blocking solution was used to generate blank values, and the mean plus 3 standard deviations of 24 blank values were used as the cutoff (corresponding to 400 fluorescence units). Test sample dilutions corresponding to 400 fluorescence units were interpolated from a sigmoid standard curve using GraphPad Prism version 8 (GraphPad Software, San Diego, California USA) and expressed as log2 values.

[0221] It is clear that the exact details of the methods or compositions described may be changed or modified without departing from the spirit of the described embodiments. The inventors claim all such modifications and variations that fall within the scope and spirit of the following claims. In certain embodiments, for example, the following items are provided: (Item 1) A method for inducing an immune response to RSV in a subject, comprising administering an effective amount of prime-boost immunization to the subject, The Prime comprises intranasal administration of RSV ΔNS2 / Δ1313 / I1314L virus, RSV LID / ΔNS2 / 1030s virus, or RSV 276 virus. The boost includes intranasal administration of B / HPIV3 DS-Cav1 / B3TMCT virus, or B / HPIV3 DS-Cav1 virus. method. (Item 2) The subject is 5 years old or younger, and the prime and boost are approximately 5.0 log 10 PFU ~ approximately 6.0 log 10 The method according to item 1, wherein the PFU is administered intranasally to the subject at a dose. (Item 3) Recombinant human respiratory syncytial virus (RSV), (A) A genome comprising the RSV F, G, NS2, N, P, M, SH, M2, and L genes located at gene positions 1-9, wherein the F and G genes located at gene positions 1 and 2 have been moved from native gene positions 8 and 7, respectively, the genome contains a deletion of the sequence encoding the NS1 protein, and the recombinant RSV is infectious, attenuated, and self-replicating, or (B) A genome comprising a deletion of a sequence encoding the NS1 protein, wherein the deletion is at positions 99-627 corresponding to the reference RSV sequence shown in Sequence ID No. 1, and the recombinant RSV is infectious, attenuated, and self-replicating. Recombinant human respiratory syncytial virus, including [specifically, a type of virus]. (Item 4) (A) The SH gene includes a deletion at positions 4499-4610 corresponding to the reference RSV sequence shown in SEQ ID NO: 1, and substitutions C4489T, C4492T, A4495T, A4497G, and G4498A corresponding to the reference RSV sequence shown in SEQ ID NO: 1, or (B) The genome of the recombinant RSV includes an SH gene containing a deletion at positions 4499-4610 corresponding to the reference RSV sequence shown in SEQ ID NO: 1, and C4489T, C4492T, A4495T, A4497G, and G4498A substitutions corresponding to the reference RSV sequence shown in SEQ ID NO: 1. Recombinant RSV as described in item 3. (Item 5) (A) The deletion in the sequence encoding the NS1 protein includes the deletion at positions 99-627 corresponding to the reference RSV sequence shown in SEQ ID NO: 1, Recombinant RSV as described in item 3 or item 4. (Item 6) The recombinant RSV described in any one of items 3 to 5, wherein the L gene encodes an L protein containing an S1313 residue encoded by a TCA codon and a Y1314K substitution encoded by an AAA codon, and the amino acid positions correspond to the reference L protein sequence shown in SEQ ID NO: 13. (Item 7) A recombinant RSV according to any one of items 3 to 5, wherein the L gene encodes an L protein containing a deletion at S1313 and an I1314L substitution, and the amino acid positions correspond to the reference L protein sequence shown in SEQ ID NO: 13. (Item 8) A recombinant RSV according to any one of items 3 to 7, wherein the nucleic acid sequence encoding the F protein includes SEQ ID NO: 14 (FWT) or SEQ ID NO: 15 (FBB). (Item 9) The genome described above is a recombinant RSV as described in any one of items 3 to 8, which does not contain any heterologous genes. (Item 10) Recombinant RSV according to any one of items 3 to 9, further comprising a deletion of the NS2 gene with or without the deletion of the NS1 gene. (Item 11) The recombinant RSV described in item 3, wherein the genome contains a nucleic acid sequence complementary to an antigenome sequence that is at least 99% identical to sequence number 2 (LID / ΔNS1), sequence number 3 (LID / F1G2 / ΔNS1), sequence number 4 (LID / F1BBG2 / ΔNS1), sequence number 6 (LID / F1G2 / ΔNS1 / 1030s), sequence number 7 (LID / F1BBG2 / ΔNS1 / 1030s), sequence number 9 (LID / F1G2 / ΔNS1 / Δ1313 / I1314L), or sequence number 10 (LID / F1BBG2 / ΔNS1 / Δ1313 / I1314L). (Item 12) The recombinant RSV described in item 11, wherein the genome contains a nucleic acid sequence complementary to the antigenome sequence shown in SEQ ID NO: 2 (LID / ΔNS1), SEQ ID NO: 3 (LID / F1G2 / ΔNS1), SEQ ID NO: 4 (LID / F1BBG2 / ΔNS1), SEQ ID NO: 6 (LID / F1G2 / ΔNS1 / 1030s), SEQ ID NO: 7 (LID / F1BBG2 / ΔNS1 / 1030s), SEQ ID NO: 9 (LID / F1G2 / ΔNS1 / Δ1313 / I1314L), or SEQ ID NO: 10 (LID / F1BBG2 / ΔNS1 / Δ1313 / I1314L). (Item 13) A nucleic acid molecule containing the nucleotide sequence of the recombinant RSV genome described in any one of items 3 to 12, or the antigenomic cDNA or RNA sequence of the RSV genome. (Item 14) A vector containing the nucleic acid molecule described in item 13. (Item 15) Cells containing nucleic acid molecules or vectors as described in item 13 or item 14. (Item 16) A method for producing recombinant RSV, Transfect the acceptable cell culture with the vector described in item 14. Incubating the cell culture for a sufficient amount of time to allow viral replication, and Purifying replicated recombinant RSV Methods that include... (Item 17) Recombinant RSV produced by the method described in item 16. (Item 18) An immunogenic composition comprising recombinant RSV as described in any of items 3-12 or 17. (Item 19) A method for inducing an immune response to RSV in a subject, comprising administering to the subject an effective amount of recombinant RSV described in any one of items 3 to 12 or 17. (Item 20) The effective dose includes a prime-boost dose, The Prime includes the administration of the recombinant RSV, The aforementioned boost includes the administration of a heterologous virus such as RSV 276 virus, B / HPIV3 DS-Cav1 virus, or B / HPIV3 DS-Cav1 / B3TMCT virus. The method described in item 19. (Item 21) The aforementioned RSV 276 virus contains the antigenome sequence shown in Sequence ID No. 12, The B / HPIV3 DS-Cav1 virus contains the antigenome sequence shown in Sequence ID No. 16, The aforementioned B / HPIV3 DS-Cav1 / B3TMCT virus contains the antigenome sequence shown in Sequence ID No. 17. The method described in item 20. (Item 22) A method for inducing an immune response to RSV in a subject, comprising administering an effective amount of immunogen to the subject, wherein the administration of the effective amount includes a prime-boost administration. The Prime comprises administration of live attenuated RSV viruses, such as RSV ΔNS2 / Δ1313 / I1314L virus, RSV LID / F1BBG2 / ΔNS1 virus, RSV LID / ΔNS1 virus, RSV LID / ΔNS2 / 1030s virus, RSV D46 / NS2 / N / ΔM2-2-HindIII virus, or RSV 276 virus; The boost includes administration of RSV 276 virus, B / HPIV3 DS-Cav1 virus, or B / HPIV3 DS-Cav1 / B3TMCT virus. The administration of the prime and the boost is not the RSV 276 virus. (Item 23) The Prime comprises intranasal administration of RSV ΔNS2 / Δ1313 / I1314L virus, RSV LID / ΔNS2 / 1030s virus, or RSV 276 virus. The boost includes intranasal administration of B / HPIV3 DS-Cav1 / B3TMCT virus or B / HPIV3 DS-Cav1 virus. The method described in item 22. (Item 24) The aforementioned RSV 276 virus contains the antigenome sequence shown in Sequence ID No. 12, The aforementioned B / HPIV3 DS-Cav1 / B3TMCT virus contains the antigenome sequence shown in Sequence ID No. 17, The B / HPIV3 DS-Cav1 virus contains the antigenome sequence shown in Sequence ID No. 16, The aforementioned RSV LID / F1BBG2 / ΔNS1 virus contains the antigenome sequence shown in Sequence ID No. 4, The RSV LID / ΔNS1 virus contains the antigenome sequence shown in Sequence ID No. 2, The RSV LID / ΔNS2 / 1030s virus contains the antigenome sequence shown in Sequence ID No. 18. The RSV LID / ΔNS2 / Δ1313 / I1314L virus contains the antigenome sequence shown in Sequence ID No. 19. The RSV D46 / ΔNS2 / N / ΔM2-2-HindIII virus contains the antigenome sequence shown in Sequence ID No. 11. The method described in item 22 or item 23. (Item 25) The method described in any one of items 19 to 24, wherein the subject is a human. (Item 26) A method for inducing an immune response to RSV in a human subject, comprising administering an effective amount of recombinant human respiratory syncytial virus (RSV) containing a genome including a deletion of a sequence encoding the NS1 protein, wherein the recombinant RSV is infectious, attenuated, and self-replicating. (Item 27) The method according to item 26, wherein the genome of the recombinant RSV comprises an SH gene containing a deletion at positions 4499-4610 corresponding to the reference RSV sequence shown in SEQ ID NO: 1, and C4489T, C4492T, A4495T, A4497G, and G4498A substitutions corresponding to the reference RSV sequence shown in SEQ ID NO: 1. (Item 28) The method according to item 26 or item 27, wherein the deletion in the sequence encoding the NS1 protein is a deletion at positions 99-627 corresponding to the reference RSV sequence shown in SEQ ID NO: 1. (Item 29) The method according to any one of items 26 to 28, wherein the genome of the recombinant RSV includes a nucleic acid sequence complementary to an antigenome sequence that is at least 99% identical to sequence number 2 (LID / ΔNS1). (Item 30) The method according to item 29, wherein the genome of the recombinant RSV includes a nucleic acid sequence complementary to the antigenome sequence shown in Sequence ID No. 2 (LID / ΔNS1). (Item 31) The method according to any one of items 19 to 30, wherein the recombinant RSV is administered intranasally. (Item 32) The method according to any one of items 19 to 31, wherein the recombinant RSV is administered by injection, aerosol delivery, nasal spray, or nasal dropper. (Item 33) The method described in any one of items 19-32, wherein the subject is 5 years of age or younger. (Item 34) The method described in item 33, wherein the subject is 2 years of age or younger. (Item 35) The method described in item 34, wherein the subject is 1 to 6 months old. (Item 36) The method according to any one of items 19 to 35, wherein the subject is seronegative for RSV. (Item 37) The method according to any one of items 19 to 35, wherein the subject is serologically positive for RSV. (Item 38) The aforementioned recombinant RSV is 3.0log 10 PFU~7.0log 10 The method according to any one of items 19 to 37, wherein the PFU is administered intranasally to the subject at a dose. (Item 39) The aforementioned recombinant RSV is approximately 5.0 log 10 PFU ~ approximately 6.0 log 10 The method according to item 38, wherein the PFU is administered intranasally to the subject at a dose. (Item 40) The aforementioned recombinant RSV is approximately 6.0 log 10 The method according to item 39, wherein the PFU is administered intranasally to the subject at a dose. (Item 41) The aforementioned recombinant RSV is 3.0log 10 ~7.0log 10 The method described in item 38, administered intranasally to RSV seropositive human subjects aged 5 years or younger at a dose of PFU. (Item 42) The method according to item 41, wherein the subject is an RSV seropositive human subject aged 2 years or younger. (Item 43) The method according to any one of items 19 to 42, wherein the immune response is a protective immune response. (Item 44) The method according to any one of items 19 to 43, wherein within the first month after administration, the subject exhibits a mild (grade 1) respiratory / febrile illness of the same type and severity as that of a comparable subject who did not exhibit respiratory / febrile illness or who had not been infected with the virus. (Item 45) The titer of recombinant RSV in nasal lavage fluid collected during the first two weeks after administration was 3.0log 10 The method described in any one of items 19 to 44, wherein the nasal irrigation solution is PFU / ml or less. (Item 46) The method according to any one of items 19 to 45, wherein administration of the recombinant RSV induces an increase in serum RSV-specific antibodies in ≥75% of recipients. (Item 47) Use of recombinant RSV as described in any one of items 3-12 or 17 to induce an immune response to RSV in the subject.

Claims

1. A combination for inducing an immune response to RSV in a target, comprising a prime composition and a boost composition, A combination wherein the prime composition comprises the RSV ΔNS2 / Δ1313 / I1314L virus; and the boost composition comprises the B / HPIV3 DS-Cav1 / B3TMCT virus.

2. The aforementioned prime composition is for intranasal administration, The boost composition is for intranasal administration. The combination described in claim 1.

3. The RSV ΔNS2 / Δ1313 / I1314L virus contains the antigenome sequence shown in Sequence ID No.

19. The B / HPIV3 DS-Cav1 / B3TMCT virus contains the antigenome sequence shown in Sequence ID No.

17. The combination according to claim 1 or 2.

4. The combination according to any one of claims 1 to 3, wherein the subject is a human being.

5. A prime composition for use in a method for inducing an immune response to RSV in a subject, comprising the RSV ΔNS2 / Δ1313 / I1314L virus, A prime composition characterized in that the prime composition is administered in combination with a boost composition containing the B / HPIV3 DS-Cav1 / B3TMCT virus.

6. A boost composition for use in a method for inducing an immune response to RSV in a subject, comprising the B / HPIV3 DS-Cav1 / B3TMCT virus, wherein the boost composition is administered in combination with a prime composition comprising the RSV ΔNS2 / Δ1313 / I1314L virus.

7. The composition according to claim 5 or 6, or the combination according to any one of claims 1 to 4, wherein the subject is 5 years of age or younger.

8. The composition or combination according to claim 7, wherein the subject is two years of age or younger.

9. The composition or combination according to claim 8, wherein the subject is 1 to 6 months old.

10. The composition according to any one of claims 5 to 9, or the combination according to any one of claims 1 to 4 and 7 to 9, wherein the subject is seronegative for RSV.

11. The composition according to any one of claims 5 to 9, or the combination according to any one of claims 1 to 4 and 7 to 9, wherein the subject is serologically positive for RSV.

12. The aforementioned RSV ΔNS2 / Δ1313 / I1314L virus is 3.0 log 10 PFU~7.0log 10 A composition according to any one of claims 5 to 11, or a combination according to any one of claims 1 to 4 and 7 to 11, administered intranasally to the subject in a dose of PFU.

13. The aforementioned RSV is approximately 5.0 log 10 PFU ~ approx. 6.0log 10 The composition or combination according to claim 12, administered intranasally to the subject in a dose of PFU.

14. The aforementioned RSV is approximately 6.0 log 10 The composition or combination according to claim 13, administered intranasally to the subject in a dose of PFU.

15. The aforementioned RSV ΔNS2 / Δ1313 / I1314L virus is 3.0 log 10 ~7.0log 10 A composition according to any one of claims 5 to 9, or a combination according to any one of claims 1 to 4 and 7 to 9, administered intranasally in a dose of PFU to an RSV seropositive human subject aged 5 years or younger.

16. The composition or combination according to claim 15, wherein the subject is an RSV seropositive human subject aged 2 years or younger.

17. The composition according to any one of claims 5 to 16, or the combination according to any one of claims 1 to 4 and 7 to 16, wherein the immune response is a protective immune response.

18. A composition according to any one of claims 5 to 17, or a combination according to any one of claims 1 to 4 and 7 to 17, wherein within the first month after administration, the subject exhibits a mild (grade 1) respiratory / febrile illness of the same type and severity as that of an equivalent subject who did not exhibit respiratory / febrile illness or who had not been infected with the virus.

19. The titer of the RSV ΔNS2 / Δ1313 / I1314L virus in nasal lavage fluid collected during the first two weeks after administration was 3.0 log. 10 A composition according to any one of claims 5 to 18, or a combination according to any one of claims 1 to 4 and 7 to 18, having a PFU / ml nasal irrigation solution or less.

20. The composition or combination according to any one of claims 5 to 19, wherein administration of the composition or combination induces an increase in serum RSV-specific antibodies in ≥75% of recipients.

Images