Single-domain antibodies and their use in cancer treatment

Abstract

The present application relates to a fully humanized anti-FGFR4 single domain antibody (sdAb) and variants thereof. The present invention further relates to functionalized drug nanocarriers, nucleic acids, vectors, host cells, immune cells, and compositions containing the sdAb, as well as their use for treatment.

Description

[Technical Field]

[0001] This disclosure relates to anti-FGFR4 monodomain antibodies (sdAbs) and their use in diagnostics or cancer treatment. The anti-FGFR4-sdAbs may also be incorporated into chimeric antigen receptors and used in cancer cell therapy, particularly in cellular cancer therapy. [Background technology]

[0002] Fibroblast growth factor receptor 4 (FGFR4) belongs to the FGF receptor family, which also includes FGFR1, FGFR2, and FGFR3. Like the other members of the FGF receptor family, the transmembrane receptor FGFR4 contains a signal peptide, an extracellular ligand-binding domain (ECD), a transmembrane domain, an intracellular protein tyrosine kinase domain (TKD), and a C-terminal phosphorylation domain (Klint P et al., 1998). Similar to the other three FGFR members, the extracellular domain of FGFR4 consists of three immunoglobulin-like domains (IgI, IgII, and IgIII) that are essential for specific ligand binding.

[0003] As an important mediator of hepatic homeostasis, FGFR4 function is required for the maintenance of both lipid and glucose metabolism under normal dietary conditions, in addition to its established role in cholesterol (Huang X et al., Diabetes. 2007;56:2501~2510). The FGF6 / FGFR4 pathway also plays an important role in myoblast differentiation and myotube regeneration (Floss T et al., Genes Dev. 1997;11:2040~2051; Zhao P et al., Dev. Dyn. 2004;229:380~392).

[0004] FGFR4 is activated by FGF1, FGF2, FGF4, FGF6, FGF8, and FGF9, albeit with reduced efficiency (Ornitz et al., 1996); all of these also activate other family members, but FGF19 is specific to FGFR4 (Xie et al., 1999). Classical FGFs bind to and activate FGFR4 using heparin / heparin sulfate (HS) (Lin BC et al., J. Biol. Chem. 2007;282:27277~27284). As a specific ligand for FGFR4, FGF19 can bind to and activate FGFR4 using the β-Klotho (KLB) coreceptor. As an endocrine ligand, FGF19 exhibits a more specific selective affinity for FGFR4 than other FGFR members (Ornitz DM et al., J. Biol. Chem. 1996;271:15292~15297; Zhang X et al., J. Biol. Chem. 2006;281:15694~15700).

[0005] Fibroblast growth factor receptors (FGFRs) have been found to play a crucial role in tumorigenesis and cancer progression through increased cell proliferation, metastasis, and survival (Babina IS et al., Nat. Rev. Cancer. 2017;17:318-332; Porta R et al., Crit. Rev. Oncol. / Hematol. 2017;113:256-267). Elevated FGFR4 levels are closely correlated with cancer development and progression, making them an attractive target for developing novel and effective anticancer therapies. Recently, one study evaluated FGFR gene alterations in various cancer types (Helsten T et al., Clin. Cancer Res. 2016;22:259-267) and showed that FGFR gene alterations occurred in 7.1% of 4853 solid tumors. Although gene alterations are relatively infrequent, FGFR4 overexpression has been further reported in many types of cancer. Increased FGFR4 mRNA expression has been detected in one-third of hepatocellular carcinomas (HCC) (Ho HK et al., J. Hepatol. 2009;50:118-127) and 32% of breast cancer samples (Penault-Llorca F et al., Int. J. Cancer. 1995;61:170-176). FGFR4 overexpression has also been observed in 64% of oropharyngeal squamous cell carcinomas and 41% of oral squamous cell carcinomas (Koole K et al., Pathobiology. 2015;82:280-289). Overexpressed FGFR4 has also been found in pancreatic cancer and derived cell lines mediated by intron enhancers activated by hepatocyte nuclear factor 1 alpha (Shah RN et al., Oncogene. 2002;21:8251-8261). Furthermore, high levels of FGFR4 expression were detected in rhabdomyosarcoma (see Taylor JG et al., J. Clin. Investig. 2009;119:3395-3407, and also Crose, LES et al., Clin. Cancer Res. 18, pp. 3780-3790 (2012)).

[0006] Amplification of the FGF19 gene has been found in liver cancer, breast cancer, lung cancer, bladder cancer, head and neck squamous cell carcinoma (HNSCC), and esophageal cancer (Huang X. et al., Proc. Natl. Acad. Sci. USA. 2002;99:pp. 11369-11374; Sawey ET et al., Cancer Cell. 2011;19:pp. 347-358; Tiong KH et al., Oncotarget. 2016;7:pp. 57633; Zhang X. et al., Thorac. Cancer. 2017;8:pp. 655-665; Hoover H. et al., J. Proteome Res. 2015;14:pp. 3670-3679).

[0007] Mechanistic studies have shown that phosphorylated FGFR4 recruits and phosphorylates two key intracellular targets, phospholipase γ (PLCγ) and FGFR substrate 2 (FRS2) [4]. MAPK can then be stimulated by activated protein kinase C (PKC) via PLCγ. Meanwhile, the MAPK and PI3K-AKT pathways can be triggered by activated FRS2 through the recruitment of growth factor receptor binding 2 (GRB2). Upregulated activity of AKT and ERK1 / 2 leads to enhanced cell proliferation and survival in HCC when FGF19 / FGFR4 signaling is activated. The FGF19-FGFR4 axis has also been associated with metastasis and low survival rates (Touat M. et al., Clin. Cancer Res. 2015;21:2684~2694).

[0008] Research is focused on developing selective inhibitors that target FGFR4, which are particularly promising as monotherapy or adjunctive treatment for cancer. Three strategies for targeting FGFR4 have been specifically developed, including neutralizing antibodies, antisense oligonucleotides, and small molecule inhibitors.

[0009] However, the unavoidable on-target toxicity and off-target activity resulting from the use of nonspecific FGFR inhibitors leads to several side effects (Dieci MV et al., Cancer Discov. 2013;3:264-279). Such drawbacks ultimately limit their use in cancer patients. [Prior art documents] [Patent Documents]

[0010] [Patent Document 1] EP0368684 [Patent Document 2] WO06 / 030220 [Patent Document 3] WO06 / 003388 [Patent Document 4] WO89 / 12624 [Patent Document 5] WO2012059882 [Patent Document 6] US5663149 [Patent Document 7] U.S. Patent No. 5,635,483 [Patent Document 8] U.S. Patent No. 5,780,588 [Patent Document 9] U.S. Patent No. 6,214,345 [Patent Document 10] WO02088172 [Patent Document 11] WO2004010957 [Patent Document 12] WO2005081711 [Patent Document 13] WO2005084390 [Patent Document 14] WO2006132670 [Patent Document 15] WO03026577 [Patent Document 16] WO200700860 [Patent Document 17] WO207011968

Patent document 18

Patent document 19

Patent document 20

Patent document 21

Patent document 22

Patent document 23

Patent document 24

Patent document 25

Patent document 26

Patent document 27

Patent document 28

Patent document 29

Patent document 30

Patent document 31

Patent document 32

Patent document 33

Patent document 34

Patent document 35

Patent document 36

Patent document 37

Patent document 38

Non-licensed literature

[0011] [Non-licensed Document 1] Huang Xら, Diabetes. 2007;56:2501~2510 pages [Non-licensed Document 2] Floss Tら、Genes Dev. 1997;11:2040~2051 pages [Non-licensed Document 3] Zhao Pら、Dev. Dyn. 2004;229:380~392 pages [Non-licensed Document 4] Lin BCら, J. Biol. Chem. 2007;282:27277~27284 pages [Non-licensed Document 5] Ornitz DM, J. Biol. Chem. 1996;271:15292~15297 [Non-licensed Document 6] Zhang Xら, J. Biol. Chem. 2006;281:15694~15700 pages [Non-licensed Document 7] Babina ISら、Nat. Rev. Cancer. 2017;17:318~332 pages [Non-licensed Document 8] Porta Rら、Crit. Rev. Oncol. / Hematol. 2017;113:256~267 pages [Non-licensed Document 9] Helsten Tら、Clin. Cancer Res. 2016;22:259~267 pages [Non-licensed Document 10] Ho HKら、J. Hepatol. 2009;50:118~127 pages [Non-licensed Document 11] Penault-Llorca Fら、Int. J. Cancer. 1995;61:170~176 pages [Non-licensed Document 12] Koole Kら, Pathobiology. 2015;82:280~289 pages [Non-licensed Document 13] Shah RNら, Oncogene. 2002;21:8251~8261 pages [Non-licensed Document 14] Taylor JGら, J. Clin. Investig. 2009;119:3395~3407 pages [Non-licensed Document 15] Crose, LESらClin. Cancer Res. 18, pages 3780~3790 (2012) [Non-licensed Document 16] Huang X.ら、Proc. Natl. Acad. Sci. USA. 2002;99:11369~11374 pages [Non-licensed Document 17] Sawey ETら, Cancer Cell. 2011;19:347~358 pages [Non-licensed Document 18] Tiong KHら, Oncotarget. 2016;7:57633 pages [Non-licensed Document 19] Zhang X.ら、Thorac. Cancer. 2017;8:655~665 pages [Non-licensed Document 20] Hoover H., J. Proteome Res. 2015;14:3670~3679 pages [Non-licensed Document 21] Touat M., Clin. Cancer Res. 2015;21:2684~2694 pages [Non-licensed Document 22] Dieci MVら、Cancer Discov. 2013;3:264~279 pages [Non-licensed Document 23] Y. Guo, Yら, Chimeric antigen receptor-modified T cells for solid tumors: challenges and prospects, J Immunol Res, 2016 [Non-licensed Document 24] J. Liら, Chimeric antigen receptor T cell (CAR-T) immunotherapy for solid tumors: lessons learned and strategies for moving forward; J Hematol Oncol, 11 (2018), page 22 [Non-licensed Document 25] Smith and Waterman, Adv. Appl. Math. 2:482c (1970) [Non-licensed Document 26] Needleman and Wunsch, J. Mol. Biol. 48:443 pages (1970) [Non-licensed Document 27] Pearson and Lipman, Proc. Natl. Acad. Sci. USA 85: 2444 pages (1988) [Non-licensed Document 28] Brent, Current Protocols in Molecular Biology, 2003 [Non-licensed Document 29] Altschulla, Nuc. Acids Res. 25:3389~3402, 1977 [Non-licensed Document 30] Altschul, J. Mol. Biol. 215:403~410 pages, 1990 [Non-licensed Document 31] Henikoff and Henikoff (1989) Proc. Natl. Acad. Sci. USA 89:10915 pages [Non-licensed Document 32] Karlin and Altschul, Proc. Natl. Acad. Sci. USA 90: 5873~5787 pages, 1993 [Non-licensed Document 33] E. Meyers and W. Miller, Comput. Appl. Biosci. 4:11~17 pages, 1988 [Non-licensed Document 34] Ward et al. (Nature 1989 Oct 12;341(6242):544-546) [Non-Patent Document 35] Holt et al., Trends Biotechnol, 2003, 21(11):484-490. [Non-Patent Document 36] Kabat et al. (1971) Ann. NY Acad. Sci. 190:382-391. [Non-Patent Document 37] Kabat et al., (1991) Sequences of Proteins of Immunological Interest, 5th edition, US Department of Health and Human Services, NIH Publication No. 91-3242. [Non-Patent Document 38] Harlow et al., Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1988. [Non-Patent Document 39] Coligan et al., eds., Current Protocols in Immunology, Greene Publishing Assoc. and Wiley Interscience, NY, 1992, 1993. [Non-Patent Document 40] Muller, Meth. Enzymol. 92:589-601, 1983 [Non-Patent Document 41] Rich RL et al., Anal Biochem, 2001. [Non-Patent Document 42] Moutel S et al., eLife 2016;5:e16228 p. [Non-Patent Document 43] Ternynck and Avrameas 1987 “Techniques immunoenzymatiques” Ed. INSERM, Paris;Hermanson, 2010, Bioconjugate Techniques, Academic Press [Non-Patent Document 44] WONG, Chemistry of protein conjugation and crosslinking, CRC Press (1991) [Non-Patent Document 45] Arnon et al., "Monoclonal Antibodies For Immunotargeting Of Drugs In Cancer Therapy" in Monoclonal Antibodies And Cancer Therapy (edited by Reisfeld et al., Alan R. Liss, Inc., 1985) [Non-Patent Document 46] Hellstrom et al., "Antibodies For Drug Delivery" in Controlled Drug Delivery (Robinson et al., eds., Marcel Deiker, Inc., 2nd edition 1987) [Non-Patent Document 47] Thorpe, "Antibody Carriers Of Cytotoxic Agents In Cancer Therapy: A Review" in Monoclonal Antibodies '84: Biological And Clinical Applications (Pinchera et al., eds., 1985). [Non-Patent Document 48] "Analysis, Results, and Future Prospective of the Therapeutic Use of Radiolabeled Antibody In Cancer Therapy" in Monoclonal Antibodies For Cancer Detection And Therapy (Baldwin et al., Academic Press, 1985) [Non-Patent Document 49] Thorpe et al., 1982, Immunol. Rev. 62: pp. 119-158 [Non-Patent Document 50] Axup, JY, Bajjuri, KM, Ritland. M., Hutchins. BM, Kim. CH, Kazane. SA, Haider. R., Forsyth. JS, Santidrian. AF, Stafin. K. et al. (2012). Synthesis of site-specific antibody-drug conjugates using unnatural amino acids. Proc. Natl. Acad. Sci. USA 109, pp. 16101-16106 [Non-Patent Document 51] Junutula, JR, Flagella, KM, Graham, RA, Parsons, KL, Ha, E., Raab, H., Bhakta, S., Nguyen, T., Dugger, DL, Li, G. et al. (2010) Engineered thio-trastuzumab-DMl conjugate with an improved therapeutic index to target human epidermal growth factor receptor 2-positive breast cancer. Clin. Cancer Res.16, pp. 4769-4778 [Non-Patent Document 52] Ferrari, M. Cancer nanotechnology:Opportunities and challenges. Nat. Rev. Cancer 5, pp. 161-171 (2005) [Non-Patent Document 53] Kumari, P., Ghosh, B. & Biswas, S. Nanocarriers for cancertargeted drug delivery. J. Drug Target. 24, pp. 179-191 (2016) [Non-Patent Document 54] Villaraza et al. 2010 Chem Rev., 110, pp. 2921-2959 [Non-Patent Document 55] Senapati, S., Mahanta, AK, Kumar, S. et al. Controlled drug delivery vehicles for cancer treatment and their performance. Sig Transduct Target Ther 3, p. 7 (2018) [Non-Patent Document 56] Bolotin, EM et al. Ammonium sulfate gradients for efficient and stable remote loading of amphipathic weak bases into liposomes and ligandoliposomes. J. Liposome. Res. 4, pp. 455-479 (1994) [Non-Patent Document 57] Boman, NL et al., Liposomal vincristine which exhibits increased drug retention and increased circulation longevity cures mice bearing P388 tumors. Cancer Res. 54, pp. 2830-2833 (1994) [Non-Patent Document 58] O'Brien, MERら, Ann. Oncol. 15, pages 440~449 (2004) [Non-licensed Document 59] Gill, PS, J. Clin. Oncol. 14, pp. 2353-2364 (1996) [Non-licensed Document 60] Shah, NNら, Pediatr. Blood Cancer 63, pages 997~1005 (2016) [Non-licensed Document 61] Bulbake, Upendraら「Liposomal Formulations in Clinical Use:An Updated Review.」Pharmaceutics vol. 9,2 12. 27 Mar. 2017 [Non-licensed Document 62] Roveri, M. et al., Nanomedicine nnm-2017-0430(2017) [Non-licensed Document 63] Woyke(2001) Antimicrob. Agents and Chemother. 45(12):3580~3584 pages [Non-licensed Document 64] Pettit, (1998) Antimicrob. Agents and Chemother. 42:2961~2965 pages [Non-licensed Document 65] Hartley JAら, Cancer Res 2010;70(17): pages 6849~6858 [Non-licensed Document 66] Antonow D., Cancer J 2008;14(3): 154-169 [Non-licensed Document 67] Howard PW, Bioorg Med ChemLett 2009;19:6463~6466 pages [Non-licensed Document 68] Sagnou, Bioorg Med ChemLett 2000;10(18): pages 2083~2086 [Non-Patent Document 69] B. Van de Broek et al., ACSNano, Vol. 5, No. 6, pp. 4319-4328, 2011. [Non-Patent Document 70] A. Sukhanova et al., 2012, Nanomedicine, 8, pp. 516-525. [Non-Patent Document 71] Wolf E, Hofmeister R, Kufer P, Schlereth B, Baeuerle PA. "BiTEs: bispecific antibody constructs with unique anti-tumor activity." Drug Discov Today. September 15, 2005;10(18):1237~44. Review [Non-Patent Document 72] Ellwanger K, Reusch U, Fucek I, et al. Redirected optimized cell killing (ROCK®): A highly versatile multispecific fit-for-purpose antibody platform for engaging innate immunity. MAbs. 2019;11(5):899~918 [Non-Patent Document 73] Chen X, Bai F, Sokol L et al. A critical role for DAPl0 and DAP12 in CD8+ T cell-mediated tissue damage in large granular lymphocyte leukemia. Blood. 2009;113(14):3226~3234 [Non-Patent Document 74] Jaspers JE, Brentjens RJ. “Development of CAR T cells designed to improve antitumor efficacy and safety” (Pharmacol Ther. 2017;178:83~91 [Non-Patent Document 75] Ying, Z. (A safe and potent anti-CD19 CAR T cell therapy. Nat. Med. 25, pages 947~953 (2019)) [Non-licensed Document 76] June, CH, O'Connor, RS, Kawalekar, OU, Ghassemi, S. & Milone, MC(CAR T cell immunotherapy for human cancer. Science(80-. ). 359, pp. 1361~1365 (2018)) [Non-licensed Document 77] Miyoshi H, 1998, J Virol. 72(10):8150~7 pages [Non-licensed Document 78] Zufferey, 1998, JV / ro / 72(12):9873~80 pages [Non-licensed Document 79] Kesslerら, 2007, Leukemia, 21(9):1859~74 pages [Non-licensed Document 80] Paschenら, 2004, Cnacer Immunol Immunother 12(6):196~203 pages [Non-licensed Document 81] Merten OW, Hebben M, Bovolenta C. Production of lentiviral vectors. Mol Ther Methods Clin Dev. 2016 Apr 13;3:16017 [Non-licensed Document 82] Graham, Cells. October 2018; 7(10): 155 pages [Non-licensed Document 83] Torikai, Blood. 2013;122:1341~1349 pages [Non-licensed Document 84] Renら, Clin. Cancer Res. 2017;23:2255~2266 pages [Non-licensed Document 85] Remington's Pharmaceutical Sciences (Ed. Maack Publishing Co, Easton, Pa.) [Non-licensed Document 86] Remington: The Science and Practice of Pharmacy, Mack Publishing Co., 20th Edition, 2000 [Non-licensed Document 87] Sustained and Controlled Release Drug Delivery Systems, edited by J R. Robinson, Marcel Dekker, Inc., New York, 1978 [Non-licensed Document 88] EW Martinによる「Remington's Pharmaceutical Sciences」 [Non-licensed Document 89] Prezado Y, Jouvion G, Guardiola C, Gonzalez W, Juchaux M, Bergs J, Nauraye C, Labiod D, De Marzi L, Pouzoulet F, Patriarca A, Dendale R. Tumor Control in RG2 Glioma-Bearing Rats: A Comparison Between Proton Minibeam Therapy and Standard Proton Therapy Int J Radiat Oncol Biol Phys. 2019 Jun 1;104(2):266~271 pp. doi:10.1016 / j.ijrobp.2019.01.080 [Non-licensed Document 90] Prezado Y, Jouvion G, Patriarca A, Nauraye C, Guardiola C, Juchaux M, Lamirault C, Labiod D, Jourdain L, Sebrie C, Dendale R, Gonzalez W, Pouzoulet F. Proton minibeam radiation therapy widens the therapeutic index for high-grade gliomas. Sci Rep. 2018 Nov 7;8(1):16479 pages. doi:10.1038 / s41598-018-34796-8 [Non-Patent Document 91] Favaudon V, Fouillade C, Vozenin MC. The radiotherapy FLASH to save healthy tissues. Med Sci(Paris) 2015 ;31 :121~123. DOI:10.1051 / medsci / 20153102002);Patriarca A., Fouillade CM, Martin F., Pouzoulet F., Nauraye C., et al. Experimental set-up for FLASH proton irradiation of small animals using a clinical system. Int J Radiat Oncol Biol Phys, 102(2018), pp. 619-626. doi:10.1016 / j.ijrobp.2018.06.403. Epub July 11, 2018 [Overview of the project] [Problems that the invention aims to solve]

[0012] To provide further products for diagnostic and / or therapeutic applications, it is highly desirable to have a high-affinity FGFR4 antibody that specifically binds to the extracellular domain and blocks FGFR4-mediated signaling.

[0013] Therefore, one of the fundamental technical problems underlying the present invention was to provide a novel FGFR4 antibody and a method of using it suitable for the diagnosis, prevention, and / or treatment of diseases associated with FGFR4 expression. In particular, since single-domain antibody scaffolds have many advantages for therapeutic use, such as better tissue penetration, faster clearance in the kidney, and reduced specificity or immunogenicity, the object of this disclosure is to provide a high-affinity single-domain antibody against FGFR4 that can therefore be used in a variety of therapeutic and diagnostic strategies.

[0014] Adoptive transfer therapy with chimeric antigen receptor T cells (CAR-T) is typically one of the promising immunotherapies that has shown great promise as a treatment for hematological malignancies, with a series of dramatic successes in clinical trials. Unfortunately, the breakthroughs achieved with CAR-T cell therapy in the treatment of hematological malignancies have not yet been fully replicated in solid tumors (Y. Guo, Y et al., Chimeric antigen receptor-modified T cells for solid tumors: challenges and prospects, J Immunol Res, 2016; J. Li et al., Chimeric antigen receptor T cell (CAR-T) immunotherapy for solid tumors: lessons learned and strategies for moving forward, J Hematol Oncol, 11(2018), p. 22). Furthermore, scFv, the most commonly used scFv in the design of chimeric antigen receptors, exhibits several characteristics that may negatively impact the therapeutic efficacy of CAR-T. In fact, scFv is characterized in particular by insufficient expression and stability, and is prone to unfolding and aggregation. Therefore, there remains a constant need to improve and diversify current treatment tools in oncology to cover not only the diversity of patient profiles but also the remarkable diversity of tumors. This is especially important for high-grade tumors associated with FGFR4 overexpression, such as rhabdomyosarcoma. [Means for solving the problem]

[0015] This application provides synthetic humanized single-domain antibodies that specifically bind to FGFR4 with nano and picomolar affinity. These sdAbs have been further shown to have the ability to block activation of the FGFR4 downstream MAPK pathway in FGFR4-mediated cancer cells and in particular RMS cells. The inventors have further shown that liposomes functionalized with the FGFR4 sdAbs specifically bind to and are taken up inside FGFR4-positive cancer cells. These results provide strong evidence that the FGFR4-targeted nanocarrier (and in particular liposome) formulations according to this disclosure will be a specific drug delivery platform for FGFR4-overexpressing cancer cells, characterized by rapid and specific receptor-mediated intracellular uptake. Finally, the inventors have generated FGFR4-CAR T cells that have been shown to mediate significant antitumor activity against FGFR4-expressing cancer cells in vitro, and thus represent a promising targeted therapeutic option.

[0016] Therefore, this disclosure relates to a single-domain antibody (sdAb) against FGFR4, wherein the humanized anti-FGFR4 sdAb has the following formula FRW1-CDR1-FRW2-CDR2-FRW3-CDR3-FRW4, and CDR is CDR1 of sequence number 1; CDR2 of sequence number 2 and CDR3 of sequence number 3, CDR1 of sequence number 4; CDR2 of sequence number 5 and CDR3 of sequence number 6, CDR1 of sequence number 7; CDR2 of sequence number 8 and CDR3 of sequence number 9, CDR1 of SEQ ID NO: 10; CDR2 of SEQ ID NO: 11; and CDR3 of SEQ ID NO: 12 Regarding sdAb for FGFR4, selected from the above.

[0017] In some embodiments, the framework region consists of FRW1 selected from SEQ ID NO: 13 or SEQ ID NO: 17, FRW2 selected from SEQ ID NO: 14 or SEQ ID NO: 18, FRW3 selected from SEQ ID NO: 15 or SEQ ID NO: 19, FRW4 selected from SEQ ID NO: 16 or SEQ ID NO: 20, or functional variants thereof having 0, 1, 2, or 3 or fewer conserved amino acid substitutions in each of FRW1, FRW2, FRW3, and FRW4. In more specific embodiments, the framework region consists of FRW1 of SEQ ID NO: 13, FRW2 of SEQ ID NO: 14, FRW3 of SEQ ID NO: 15, and FRW4 of SEQ ID NO: 16, or FRW1 of SEQ ID NO: 17, FRW2 of SEQ ID NO: 18, FRW3 of SEQ ID NO: 19, and FRW4 of SEQ ID NO: 20, or functional variants thereof having 0, 1, 2, or 3 or fewer conserved amino acid substitutions in each of FRW1, FRW2, FRW3, and FRW4.

[0018] In more specific embodiments, the present disclosure intends to provide a humanized anti-FGFR4 sdAb having the sequence described in any one of SEQ ID NOs: 41, 42, 43, and 44.

[0019] The humanized anti-FGFR4 sdAb of this disclosure may be directly or indirectly, covalently or asynchronously, conjugated to a compound of interest selected from nucleic acids, polypeptides or proteins, viruses, toxins, and chemicals. In some embodiments, the humanized anti-FGFR4 sdAb is directly or indirectly, covalently or asynchronously conjugated to a diagnostic compound selected from enzymes, fluorophores, NMR or MRI contrast agents, radioisotopes, and nanoparticles. In some embodiments, the humanized anti-FGFR4 sdAb is directly or indirectly, covalently or asynchronously conjugated to a compound selected from cytotoxic substances, chemotherapeutic agents, radioisotopes, targeted anticancer agents, immunotherapeutic agents (such as immunosuppressants or immunostimulants), and soluble peptides. In some embodiments, the humanized anti-FGFR4 sdAb is directly or indirectly, covalently or asynchronously conjugated to a drug nanocarrier, optionally an organic nanocarrier. Typically, the organic nanocarrier may be selected from polymer nanoparticles, liposomes, micelles, and protein-based nanocarriers such as albumin.

[0020] FGFR4 sdAb can also fuse to the immunoglobulin domain, particularly the Fc domain.

[0021] The disclosure also includes multispecific conjugation compounds comprising at least a first sdAb composed of the FGFR4 sdAb described herein, and further comprising another sdAb that binds to a second antigen, wherein optionally the first sdAb is located at the N-terminus of the second sdAb, or the first sdAb is located at the C-terminus of the second sdAb.

[0022] The disclosure also includes a chimeric antigen receptor (CAR) comprising (a) an antigen-binding domain comprising at least a first sdAb composed of an FGFR4 sdAb as defined herein, and optionally a second sdAb that specifically binds to a second antigen, (b) a transmembrane domain, and (c) an intracellular domain.

[0023] Typically, the second antigen is PSMA, PSCA, BCMA, CS1, GPC3, CSPG4, EGFR, fetal acetylcholine receptor subunit gamma (fAChRγ), HER3, IGF1R, SLC19A1, ACVR2A, EPHB4, CA125, IL-13R, CD278, CD123, NCAM, 5T4, CD2, CD3, CD16 (FcγRIII), CD23, MART-1, L1 CAM, MUC16, ROR1, SLAMF7, cKit, CD38, CD53, CD56, CD71, CD74, CD92, CD100, CD123, CD138, CD148, CD150, CD200, CD261, CD262, CD276, CD362, gp100, ROR1, Mesothelin, CD33 / IL3Ra, c-Met, Glycolipid F77, EGFRvlll, GD-2, NKp46 receptor, NY-ESO-1 TCR or MAGE A3 TCR, Human telomerase reverse transcriptase (hTERT), Survivin, Cytochrome P450 1 B1 (CY1 B) Selected from the group consisting of HER2, Wilms tumor gene 1 (WT1), livin, alpha-fetoprotein (AFP), carcinoembryonic antigen (CEA), mucin 16, MUC1, p53, cyclins, immune checkpoint targets, or combinations thereof.

[0024] The transmembrane domain can be selected from the transmembrane domains of cell surface targeting proteins, including the CD3 zeta transmembrane domain, CD28 transmembrane domain, CD8 alpha transmembrane domain, DAP10 transmembrane domain, or DAP12 transmembrane domain.

[0025] The intracellular domain may include one or more domains derived from the CD28, OX40, CD3 zeta, 4-1BB, DAP10, and / or DAP12 intracellular domains.

[0026] This disclosure also includes isolated nucleic acids comprising nucleic acid sequences encoding humanized anti-FGFR4 sdAb or CAR as described herein, which are advantageously conjugated to heterologous regulatory sequences.

[0027] This disclosure also includes vectors containing the nucleic acids disclosed herein, host cells containing them, isolated cells or cell populations expressing the humanized anti-FGFR4 sdAb or CAR disclosed herein. Typically, such cells are allogeneic or autologous cells and can be selected from macrophages, NK cells and T cells, particularly CD4+ / CD8+, TIL / tumor-derived CD8 T cells, central memory CD8+ T cells, Treg, MAIT, and Yδ T cells.

[0028] The therapeutic agents of this disclosure, comprising defined humanized anti-FGFR4 sdAbs, CARs, nucleic acids, vectors, host cells, isolated cells, or cell populations, may be used in therapies, particularly in the treatment of cancer. They may be used particularly in cancer cell therapy and / or in combination with other therapies (in particular chemotherapeutic agents and / or immunotherapeutic agents, in particular other cancer therapies such as one or more checkpoint inhibitors).

[0029] Finally, this disclosure includes the use of previously defined humanized anti-FGFR4 sdAbs for molecular imaging, particularly for the detection or monitoring of FGFR4-mediated cancers. Particularly described herein are in vitro or ex vivo methods for diagnosing or monitoring FGFR4-mediated cancers in subjects. a) A step of contacting a suitable sample derived from the subject with a previously defined diagnostic agent in vitro, b) A step of determining the expression of FGFR4 in the sample The method includes the above. [Modes for carrying out the invention]

[0030] Definition: The terms used herein are intended solely to describe specific embodiments and are not exhaustive. It should be noted that, as used herein and in the appended claims, the singular forms “a,” “an,” and “the” refer to multiple subjects unless the context specifically indicates otherwise.

[0031] As used herein, the term “comprising” is synonymous with “including” or “containing,” and is comprehensive or open-ended, not excluding any further members, elements, or methods or processes not cited.

[0032] Unless otherwise specifically stated or evident from the context, the term “about” as used herein should be understood to mean within the normal tolerance range in the art, for example, within two standard deviations from the mean. “About” can be understood to mean within 20%, 15%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.5%, 0.1%, 0.05%, or 0.01% of the stated value. Unless otherwise specifically evident from the context, all numerical values ​​provided herein are modified by the term “about.”

[0033] As used herein, the term “isolated” means (1) a substance or entity that has been separated from at least some of the components to which it was originally associated (whether naturally or in an experimental setting) and (2) a substance or entity that has been produced, prepared, and / or manufactured by human hands. Isolated substances and / or entities may be separated from at least about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, or more of the other components to which they were originally bound. In some embodiments, the isolated active substance is about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or more than 99% pure. As used herein, a substance is “pure” if it is substantially free of other components.

[0034] The “isolated” products of this disclosure, including isolated nucleic acids, proteins, polypeptides, and antibodies, are not natural products (i.e., “not naturally occurring”). Rather, the “isolated” nucleic acids, proteins, polypeptides, and antibodies of this disclosure are “artificial” products. The “isolated” products of this disclosure may be “significantly different” or “quite different” from natural products. As a non-limiting example, isolated nucleic acids may be purified, recombinant, synthesized, labeled, and / or conjugated to a solid substrate. Such nucleic acids may be significantly different or quite different from naturally occurring nucleic acids. As a further non-limiting example, the “isolated” proteins, polypeptides, and antibodies of this disclosure may be purified, recombinant, synthesized, labeled, and / or conjugated to a solid substrate. Such proteins, polypeptides, and antibodies may be significantly different or quite different from naturally occurring proteins, polypeptides, and antibodies.

[0035] The terms “polynucleotide,” “nucleic acid molecule,” “nucleic acid,” or “nucleic acid sequence” refer to nucleotides in polymeric form with a length of at least 10 nucleotides. These terms include DNA molecules (e.g., cDNA or genomic DNA or synthetic DNA) and RNA molecules (e.g., mRNA or synthetic RNA), as well as DNA or RNA analogs containing unnatural nucleotide analogs, unnatural nucleoside bonds, or both. Nucleic acids may be in any topological conformation. For example, nucleic acids may be single-stranded, double-stranded, triple-stranded, quadruple-stranded, partially double-stranded, branched, hairpin-shaped, cyclic, or padlock-shaped conformations. Examples of nucleic acids (also called polynucleotides) include RNA, cDNA, both sense and antisense strands of genomic DNA, and the synthetic and mixed polymers described above. As will be readily apparent to those skilled in the art, they may be chemically or biochemically modified, or may contain unnatural or derivatized nucleotide bases. Such modifications include, for example, labeling, methylation, substitution of one or more naturally occurring nucleotides with analogs, internucleotide modifications such as uncharged bonds (e.g., methylphosphonates, phosphotriesters, phosphoramidates, carbamates, etc.), charged bonds (e.g., phosphorothioates, phosphorodithioates, etc.), pendant moieties (e.g., polypeptides), intercalators (e.g., acridines, psoralens, etc.), chelating agents, alkylating agents, and modified bonds (e.g., alpha-anomeric nucleic acids, etc.). Also included are synthetic molecules that mimic polynucleotides in their ability to bind to sequences indicated by hydrogen bonds and other chemical interactions. Such molecules are known in the art, for example, those in which peptide bonds are replaced by phosphate bonds in the molecular backbone. Other modifications include, for example, analogs in which the ribose ring contains a crosslinking moiety or other structures, such as modifications found in "locked" nucleic acids.

[0036] "Synthetic" RNA, DNA, or mixed polymers are those produced outside of cells, for example, by chemical synthesis.

[0037] As used herein, the term “nucleic acid fragment” refers to a nucleic acid sequence having deletions, such as 5' or 3' terminal deletions, compared to a full-length reference nucleotide sequence. In one embodiment, a nucleic acid fragment is a continuous sequence in which the nucleotide sequence of the fragment is identical to the corresponding position in a naturally occurring sequence. In some embodiments, the fragment is at least 10, 15, 20, or 25 nucleotides long, or at least 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, or 150 nucleotides long. In some embodiments, the nucleic acid sequence fragment is a fragment of an open reading frame sequence. In some embodiments, such a fragment encodes a polypeptide fragment (as defined herein) of a protein encoded by the open reading frame nucleotide sequence.

[0038] Nucleic acids can be purified. Preferably, purified nucleic acids are 50%, 75%, 85%, 90%, 95%, 97%, 98%, or 99% ultrapure. In the context of this disclosure, purified nucleic acids that are at least 50% pure mean a purified nucleic acid sample that contains less than 50% of other nucleic acids. For example, a plasmid sample can be at least 99% pure if it contains less than 1% contaminating bacterial DNA.

[0039] In the context of nucleic acids, the term "operably linked" refers to a functional relationship between two or more polynucleotide (e.g., DNA) segments. Typically, the term refers to the functional relationship of a transcriptional regulatory sequence to a transcribed sequence. For example, if a promoter or enhancer sequence stimulates or modulates the transcription of a coding sequence in a suitable host cell or other expression system, then the promoter or enhancer sequence is operably linked to the coding sequence. Generally, promoters and transcriptional regulatory sequences operably linked to a transcribed sequence are physically adjacent to the transcribed sequence, i.e., cis-acting. However, some transcriptional regulatory sequences, such as enhancers, do not need to be physically adjacent to or near the coding sequence they enhance transcription of.

[0040] The terms “polypeptide” and “protein” are used interchangeably herein to refer to polymers of amino acid residues. These terms apply to amino acid polymers, in which one or more amino acid residues are artificial chemical mimics of corresponding naturally occurring amino acids, as well as to naturally occurring and non-naturally occurring amino acid polymers. Unless otherwise specified, a particular polypeptide sequence implicitly includes its conservatively modified variants. Furthermore, a polypeptide may contain several different domains, each having one or more distinct activities. To avoid misunderstanding, a “polypeptide” may be of any length greater than two amino acids.

[0041] As used herein, the term "peptide" refers to short polypeptides, such as those typically containing fewer than 50 amino acids, and more typically fewer than 30 amino acids. As used herein, the term includes analogues and mimetic compounds that mimic structural and functional properties, and therefore biological properties.

[0042] The term “isolated protein” or “isolated polypeptide” refers to a protein or polypeptide that, depending on its origin or source of origin, (1) is not bound to its naturally associated naturally binding component in its native state, (2) exists in a purity not found in nature, where purity can be judged in relation to the presence of other cellular material (e.g., not containing other proteins from the same species), (3) is expressed by cells of a different species, or (4) does not exist in nature (e.g., it is a fragment of a naturally occurring polypeptide, or contains amino acid analogs or derivatives not found in nature, or binding other than standard peptide bonds). Therefore, a polypeptide that is chemically synthesized or synthesized in a cell system different from the cells from which the polypeptide originates is “isolated” from its naturally binding component. A polypeptide or protein may also be substantially free of its naturally binding component by isolation using protein purification methods well known in the art. Where thus defined, “isolated” does not necessarily require that the protein, polypeptide, peptide, or oligopeptide described as such has been physically removed from the synthesized cell.

[0043] The protein or polypeptide may be purified. Preferably, the purified protein or polypeptide is 50%, 75%, 85%, 90%, 95%, 97%, 98%, or 99% ultrapure. In the context of this disclosure, a purified protein that is 50% or more ultrapure means a purified protein sample that contains less than 50% or more of other proteins. For example, a protein sample may be 99% pure if it contains less than 1% of contaminating host cell proteins.

[0044] As used herein, the term “polypeptide fragment” refers to a polypeptide having deletions, such as amino-terminal and / or carboxyl-terminal deletions compared to a full-length polypeptide, such as a naturally occurring protein. In one embodiment, a polypeptide fragment is a continuous sequence in which the amino acid sequence of the fragment is identical to the corresponding positions in the naturally occurring sequence. Fragments are typically at least 5, 6, 7, 8, 9, or 10 amino acid lengths, or at least 12, 14, 16, or 18 amino acid lengths, or at least 20 amino acid lengths, or at least 25, 30, 35, 40, or 45 amino acid lengths, or at least 50 or 60 amino acid lengths, or at least 70 amino acid lengths, or at least 100 amino acid lengths.

[0045] In the context of two or more nucleic acid or polypeptide sequences, the terms “percent identical” or “percent identity” refer to the degree to which two or more sequences or subsequences are the same. Two sequences are “identical” if they have the same sequence of amino acids or nucleotides across the regions being compared. Two sequences are “substantially identical” if, when compared and aligned for the greatest match across a comparison window or across a specified region as measured by one of the following sequence comparison algorithms or by manual alignment and visual inspection, they have a specified percentage of identical amino acid residues or nucleotides (i.e., across the specified region or across the entire sequence if not specified), 60% identity, or optionally 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity). Optionally, identity may exist over a region of at least approximately 30 nucleotides (or 10 amino acids) in length, or more preferably over a region of 100 to 500 nucleotides or 1000 or more nucleotides (or 20, 50, 200 or more amino acids) in length.

[0046] In sequence comparison, typically one sequence serves as the reference sequence compared to the sequence under comparison. When using a sequence comparison algorithm, the sequence under comparison and the reference sequence are input into the computer, subsequence coordinates are specified if necessary, and sequence algorithm program parameters are specified. Default program parameters may be used, or alternative parameters may be specified. The sequence comparison algorithm then calculates the sequence identity percentage of the sequence under comparison compared to the reference sequence based on the program parameters.

[0047] When used herein, a "comparison window" includes a reference to one segment of a number of consecutive positions selected from a group consisting of 20 to 600, typically about 50 to about 200, and more typically about 100 to about 150, within which an array can be compared to a reference array of the same number of consecutive positions after the two arrays have been optimally aligned. Methods for aligning arrays for comparison are well known in the art. Optimal alignment of sequences for comparison can be achieved, for example, by the local homology algorithm of Smith and Waterman, Adv. Appl. Math. 2:482c (1970), the homology alignment algorithm of Needleman and Wunsch, J. Mol. Biol. 48:443 (1970), the similarity search method of Pearson and Lipman, Proc. Natl. Acad. Sci. USA 85:2444 (1988), computer implementations of these algorithms (Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, WI's GAP, BESTFIT, FASTA, and TFASTA), or by manual alignment and visual inspection (see, for example, Brent et al., Current Protocols in Molecular Biology, 2003).

[0048] Two examples of algorithms suitable for determining sequence identity and sequence similarity percentages are the BLAST and BLAST 2.0 algorithms, described in Altschul et al., Nuc. Acids Res. 25:3389-3402, 1977; and Altschul et al., J. Mol. Biol. 215:403-410, 1990, respectively. Software for performing BLAST analysis is available through the National Center for Biotechnology Information. This algorithm involves initially identifying high-scoring sequence pairs (HSPs) by identifying short words of length W in the query sequence that, when aligned with words of the same length in the database sequence, match or satisfy a certain positive threshold score T. T is called the adjacent word score threshold (Altschul et al., ibid.). These initial adjacent word hits serve as a species to initiate a search for longer HSPs that contain them. Word hits are extended bidirectionally along each sequence as long as the cumulative alignment score can be increased. The cumulative score is calculated for nucleotide sequences using the parameters M (reward score for a pair of matching residues; always > 0) and N (penalty score for mismatched residues; always < 0). For amino acid sequences, a score matrix is ​​used to calculate the cumulative score. The extension of word hits in each direction stops when the cumulative alignment score decreases by an amount X from its maximum achieved value; when the cumulative score becomes zero or less due to the accumulation of one or more negative-scoring residue alignments; or when the end of either sequence is reached. The BLAST algorithm parameters W, T, and X determine the sensitivity and speed of alignment. The BLASTN program (for nucleotide sequences) uses word length (W) 11, expected value (E) 10, M=5, N=-4, and comparison of both strands as defaults.For amino acid sequences, the BLASTP program uses, by default, a word length of 3, an expected value (E) of 10, and a BLOSUM62 score matrix (see Henikoff and Henikoff, (1989) Proc. Natl. Acad. Sci. USA 89:10915), alignment (B) of 50, an expected value (E) of 10, M=5, N=-4, and a comparison of both strands. The BLAST algorithm also performs statistical analysis of the similarity between two sequences (see, e.g., Karlin and Altschul, Proc. Natl. Acad. Sci. USA 90:5873-5787, 1993). One measure of similarity provided by the BLAST algorithm is the minimum sum probability (P(N)), which provides an indicator of the probability that a match between two nucleotide sequences or amino acid sequences occurs by chance. For example, if the minimum summation probability of comparing the test nucleic acid to the reference nucleic acid is less than approximately 0.2, more preferably less than approximately 0.01, and most preferably less than approximately 0.001, then the nucleic acid is considered to be similar to the reference sequence.

[0049] The percentage of identity between two amino acid sequences can also be determined using the algorithm of E. Meyers and W. Miller, Comput. Appl. Biosci. 4:11-17, 1988), which is incorporated into the ALIGN program (version 2.0), using the PAM120 weighted residue table, gap length penalty 12, and gap penalty 4. Furthermore, the percentage of identity between two amino acid sequences may also be determined using the algorithm of Needleman and Wunsch, J. Mol. Biol. 48:444-453, 1970), which is incorporated into the Gap Program of the GCG software package (available at www.gcg.com), using either the Blossom 62 matrix or the PAM250 matrix, as well as gap weights 16, 14, 12, 10, 8, 6, or 4 and length weights 1, 2, 3, 4, 5, or 6.

[0050] In addition to the percentage of sequence identity described above, another indicator that two nucleic acid sequences or polypeptides are substantially identical is that the polypeptide encoded by the first nucleic acid is immunologically cross-reactive with an antibody produced against the polypeptide encoded by the second nucleic acid, as described below. Therefore, the polypeptide is typically substantially identical to the second polypeptide, differing only in two peptides, for example, by a conservative substitution. Another indicator that two nucleic acid sequences are substantially identical is that the two molecules or their complements hybridize with each other under stringent conditions, as described below. A further indicator that two nucleic acid sequences are substantially identical is that the same primers can be used to amplify the sequences.

[0051] As used herein, “functional variant” or a given protein includes wild-type versions of the protein that preserve the functionality of the given protein, variant proteins belonging to the same family, homologous proteins, or cleaved versions. Typically, a functional variant exhibits at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, or 99% amino acid identity with a given protein.

[0052] As used herein, the term “mammal” refers to any member of the taxonomic classification of mammals, including placental mammals and marsupials. Thus, “mammal” includes humans, primates, domesticated animals, and laboratory mammals. Exemplary mammals include rodents, mice, rats, rabbits, dogs, cats, sheep, horses, goats, llamas, cattle, primates, pigs, and any other mammals. In some embodiments, the mammal is at least one of transgenic mammals, genetically modified mammals, and cloned mammals.

[0053] According to this disclosure, the term “disease” means any pathological condition, including cancerous diseases, and in particular any form of cancerous disease described herein.

[0054] The term "normal" refers to a healthy state or the state of a healthy subject or tissue, i.e., a non-pathological state, while "healthy" preferably means non-cancerous.

[0055] The term “malignancy” refers to a non-benign tumor or cancer. As used herein, the term “cancer” includes malignancy characterized by uncontrolled or uncontrolled cell proliferation.

[0056] The term "cancer" includes primary malignant tumors (for example, those in which the cells have not migrated to any other part of the body of the subject) and secondary malignant tumors (for example, those resulting from metastasis, i.e., the migration of tumor cells to secondary sites other than the site of the primary tumor).

[0057] Cancers are classified according to the type of cells that resemble tumors and, therefore, the tissue from which the tumor is thought to originate. These are the histological features and location, respectively.

[0058] The term "cancer" as used in this disclosure includes, in particular, leukemia, seminoma, melanoma, teratoma, lymphoma, neuroblastoma, glioma, and sarcoma. The term cancer also includes, in particular, rectal cancer, endometrial cancer, kidney cancer, adrenal cancer, thyroid cancer, hematological cancer, skin cancer, brain cancer, cervical cancer, intestinal cancer, liver cancer, colon cancer, stomach cancer, intestine cancer, head and neck cancer, gastrointestinal cancer, lymph node cancer, esophageal cancer, colorectal cancer, pancreatic cancer, ENT cancer, breast cancer, prostate cancer, uterine cancer, ovarian cancer, and lung cancer, soft tissue tumors, and their metastases. The term cancer as used in this disclosure also includes cancer metastases and cancer relapses.

[0059] "Tumor growth" or "tumor proliferation" as used in this disclosure refers to the tendency of a tumor to increase in size, and / or the tendency of tumor cells to proliferate.

[0060] For the purposes of this disclosure, the terms “cancer” and “cancer disease” are used interchangeably with the terms “tumor” and “tumor disease.”

[0061] "Treat" means administering the compounds or compositions described herein to a subject for the purpose of preventing or eliminating a disease, including reducing the size or number of tumors in the subject; stopping or delaying a disease in a subject; inhibiting or delaying the onset of a new disease in a subject; reducing the frequency or severity of symptoms and / or recurrences in a subject that currently has or has previously had a disease; and / or extending, i.e., increasing, the lifespan of the subject. In particular, the term "treatment of disease" includes the cure, reduction in duration, improvement, prevention, slowing or inhibiting the progression or worsening of a disease or its symptoms, or the prevention or delaying of its onset.

[0062] The therapeutically active agents or products, vaccines and compositions described herein may be administered by any conventional route, including injection or infusion.

[0063] The drugs described herein are administered in effective doses. “Effective dose” refers to the amount that achieves the desired response or effect, either alone or in combination with additional doses. In the case of treatment of a particular disease or condition, the desired response preferably relates to inhibiting the course of the disease. This includes slowing the progression of the disease, and in particular interrupting or reversing its progression. The desired response in the treatment of a disease or condition may also be delaying or preventing the onset of the disease or condition. The effective dose of the drugs described herein will depend on the condition to be treated, the severity of the disease, the patient's individual parameters including age, physiological state, size, and weight, the duration of treatment, the type of accompanying treatment (if any), the specific route of administration, and similar factors. Therefore, the dose administered of the drugs described herein may depend on some of these parameters. If the response in the patient is insufficient with the initial dose, a higher dose (or an effective higher dose achieved by a different, more localized route of administration) may be used.

[0064] The pharmaceutical compositions described herein preferably contain an effective amount of a sterile and therapeutically active substance to produce a desired reaction or effect.

[0065] The pharmaceutical compositions described herein are generally administered in pharmaceutically appropriate amounts and pharmaceutically appropriate preparations. The term “pharmaceutically appropriate” refers to non-toxic substances that do not interact with the action of the active ingredient of the pharmaceutical composition. These preparations may typically contain salts, buffers, preservatives, carriers, adjuvants, such as CpG oligonucleotides, cytokines, chemokines, saponins, GM-CSF and / or RNA, and, if necessary, other therapeutically active compounds. When used in pharmaceuticals, salts should be pharmaceutically appropriate.

[0066] Single-domain antibodies and their variants As used herein, the term “FGFR4” has its general meaning in the art and includes human FGFR4 (also referred to as “fibroblast growth factor receptor 4”), in particular the native sequence polypeptides, isoforms, chimeric polypeptides, all homologs, fragments, and precursors of human FGFR4. The amino acid sequence of native FGFR4 includes UniProt reference number P22455(FGFR4_HUMAN). More specifically, the term "FGFR4" includes the human FGFR4 of sequence number 45 below.

[0067] >sp|P22455|FGFR4_HUMAN Fibroblast Growth Factor Receptor 4 OS=Human (Homo sapiens) OX=9606 GN=FGFR4 PE=1 SV=2

[0068] [ka]

[0069] The term “antibody” broadly refers to any immunoglobulin (Ig) molecule, or its antigen-binding portion, or any functional fragment, variant, variant, or derivative thereof that retains the essential epitope-binding properties of the Ig molecule, consisting of four polypeptide chains, two heavy chains (H), and two light chains (L). Such variant, variant, or derivative antibody formats are known in the art. In full-length antibodies, each heavy chain consists of a heavy chain variable region (hereinafter abbreviated as HCVR or VH) and a heavy chain constant region. The heavy chain constant region consists of three domains, CH1, CH2, and CH3. Each light chain consists of a light chain variable region (hereinafter abbreviated as LCVR or VL) and a light chain constant region. The light chain constant region consists of one domain, CL. The VH and VL regions can be further subdivided into hypervariable regions called complementarity-determining regions (CDRs), which are interspersed with more conserved regions called framework regions (FRs). Each VH and VL consists of three CDRs and four FRs arranged from the amino terminus to the carboxyl terminus in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4. Immunoglobulin molecules can be of any type (e.g., IgG, IgE, IgM, IgD, IgA, and IgY), class (e.g., IgG1, IgG2, IgG3, IgG4, IgAI, and IgA2), or subclass.

[0070] Antibody fragments are portions of an antibody, such as F(ab')2, Fab, Fv, sFv, etc. Functional fragments of full-length antibodies retain the target specificity of the full-length antibody. Recombinant functional antibody fragments such as Fab (fragment, antibody), scFv (single-chain variable-chain fragment), and single-domain antibodies (dAb) are therefore used to develop therapeutics as alternatives to mAb-based therapeutics. The scFv fragment (approximately 25 kDa) consists of two variable domains, VH and VL. In nature, the VH and VL domains are non-covalently bonded by hydrophobic interactions and tend to dissociate. However, stable fragments can be modified by linking the domains with a hydrophilic, flexible linker to create a single-chain Fv (scFv). The smallest antigen-binding fragment is a single variable fragment, i.e., the VH or VL domain. Binding to a light-chain / heavy-chain partner is not required for target binding, respectively. Such fragments are used in single-domain antibodies. Single-domain antibodies (approximately 12-15 kDa) therefore possess either a VH domain or a VL domain.

[0071] As used herein, the terms “single-domain antibody” (sdAb) or Nanobody® (a trademark of Ablynx) have their general meanings in the art and refer to antibody fragments with a molecular weight of only 12-15 kDa consisting of a single monomeric variable antibody domain derived from a heavy chain. Such single-domain antibodies (referred to as VHHs) can be found in camelid mammals and naturally lack a light chain. For an overview of (single) domain antibodies, see the prior art listed above, as well as EP0368684, Ward et al. (Nature 1989 Oct 12;341(6242):544-546), Holt et al., Trends Biotechnol, 2003, 21(11):484-490; and WO06 / 030220, WO06 / 003388. The amino acid sequence and structure of a single-domain antibody can be considered to consist of four framework regions or "FRWs" referred to in the Art and in this Specified Specification as "framework region 1" or "FRW1"; "framework region 2" or "FRW2"; "framework region 3" or "FRW3"; and "framework region 4" or "FRW4," respectively, and the framework regions are blocked by three complementarity-determining regions or "CDRs" referred to in the Art as "complementarity-determining region 1" or "CDR1"; "complementarity-determining region 2" or "CDR2"; and "complementarity-determining region 3" or "CDR3," respectively. Therefore, a single-domain antibody can be defined as an amino acid sequence having the general structure: FRW1-CDR1-FRW2-CDR2-FRW3-CDR3-FRW4 (where FRW1-FRW4 refer to framework regions 1-4, respectively, and CDR1-CDR3 refer to complementarity-determining regions 1-3). In the context of this disclosure, the amino acid residues of single-domain antibodies are numbered according to the general numbering for VH domains provided by the International Immunogenetics Information System amino acid numbering (http: / / imgt.cmes.fr / ).

[0072] As used herein, “isolated sdAb” refers to a single-domain antibody (sdAb) that is substantially free from other antibodies, particularly other sdAbs with different antigen specificities (for example, an isolated antibody that specifically binds to FGFR4 substantially does not contain antibodies that specifically bind to antigens other than FGFR4). Furthermore, an isolated antibody may be substantially free from other cellular material and / or chemical substances.

[0073] As used herein, the term “synthetic” means that such antibodies are not obtained from fragments of naturally occurring antibodies, but are made from recombinant nucleic acids containing an artificial coding sequence.

[0074] The term "CDR" refers to the complementarity-determining region within an antibody variable sequence. Each variable region in the heavy and light chains has three CDRs, which are named CDR1, CDR2, and CDR3 for each variable region. The term "CDR set" refers to a group of three CDRs that occur in a single variable region capable of binding to an antigen. The precise boundaries of these CDRs are defined separately according to different systems. The system described by Kabat is used herein. The terms "Kabat numbering," "Kabat definition," and "Kabat labeling" are used interchangeably herein. In the art, these terms refer to a system for numbering amino acid residues that are more variable (i.e., hypervariable) than other amino acid residues in the heavy and light chain variable regions of an antibody or its antigen-binding moiety (Kabat et al., (1971) Ann. NY Acad. Sci. 190:382-391, and Kabat et al., (1991) Sequences of Proteins of Immunological Interest, 5th edition, US Department of Health and Human Services, NIH Publication No. 91-3242).

[0075] The sdAb affinity refers to the strength with which an sdAb binds to an epitope presented on an antigen such as FGFR4 in the present disclosure through its antigen-binding site (paratope). The affinity can be evaluated based on the evaluation of the K D value.

[0076] The term "K D ", as used herein, refers to the ratio of k off to k on (i.e., k off / k on ), and is taken to refer to the equilibrium dissociation constant expressed as molar concentration (M). The K D value is related to the concentration of the antibody (the amount of antibody required for a particular experiment), and thus the lower the K D value (the lower the concentration), the higher the affinity of the antibody. The K D value of an antibody can be determined using methods well established in the art. Methods for determining the K D value of a mAb can be found in Harlow et al., Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1988; Coligan et al., Current Protocols in Immunology, Greene Publishing Assoc. and Wiley Interscience, N.Y., 1992, 1993, and Muller, Meth. Enzymol. 92:589-601, 1983, the references of which are hereby incorporated by reference in their entirety. Methods for determining the K D of an antibody can be by using surface plasmon resonance or a biosensor system such as Biacore® (see also Rich RL et al., Anal Biochem, 2001 for detailed information on affinity evaluation, and for further details on the specific implementation of sdAb affinity measurement, see also Moutel S et al., eLife 2016;5:e16228). Affinity measurements are generally performed at 25°C. The term "k assoc" or "ka", or "k on When used herein, "k" refers to the binding rate of a particular antibody-antigen interaction, whereas the term "k" refers to the binding rate of a particular antibody-antigen interaction. dis " or "kd", or k off Where used herein, sdAb refers to the dissociation rate of a particular antibody-antigen interaction. Simply put, since sdAb is a protein smaller than its respective antigen, sdAb can be captured by a sensor tip from a Biocore biosensor instrument, while recombinant antigen (i.e., typically rFGFR4) can be used as the analyte. The analyte may be injected continuously, increasing in concentration from 3.125 nM to 50 nM in a single cycle, for example, without regenerating the sensor tip between injections. Binding parameters can be obtained by fitting an overlay sensorgram using a 1:1 Langmuir binding model in the BIAevaluation software.

[0077] Typically, the single-domain antibodies of this disclosure are approximately 10- 6 M or less, 10 -7 M or less, 10 -8 M or less, 10 -9 M or less, 10 -10 M or less, or 10 -11 K below M D Binding occurs due to binding affinity. In some embodiments, K D Binding affinity is particularly 10 -7 ~10 -12 M, especially 10 -8 ~10 -12 , especially 10 -8 ~10 -10 It is located in the nano / picomolar range and consists of [components].

[0078] The inventors isolated four reference single-domain antibodies (sdAbs) that possess the required properties, particularly the required affinity, and are characterized by the following sequences.

[0079] [Table 1]

[0080] Therefore, this disclosure encompasses a single-domain antibody having at least three CDRs of one of the four reference single-domain antibodies defined in Table 1.

[0081] In some embodiments, the sdAb according to this disclosure includes an sdAb having at least 60, 70, 80, 90, 95, 96, 97, 98, 99, or 100 percent identity with the amino acid sequence described in any one of SEQ ID NOs: 41-44.

[0082] The sdAbs provided in this disclosure include, in particular, humanized anti-FGFR4 SdAbs having a framework region sequence that has at least 60, 70, 80, 90, 95, 96, 97, 98, 99, or 100 percent identity with one or more of the sequences of SEQ ID NOs.

[0083] The three CDR regions of the humanized anti-FGFR4 sdAb disclosed herein may be 100% identical to the three CDR regions of one of the reference humanized sdAb (hsdAb) defined in Table 1. Alternatively, in some embodiments, the hsdAb according to this disclosure may be mutated by amino acid deletions, insertions, or substitutions and nevertheless have an amino acid sequence that is at least 60, 70, 80, 90, 95, 96, 97, 98, 99, or 100 percent identical to the CDR regions of the sdAb in Table 1. Typically, according to this disclosure, the antibody may have amino acid variations (including deletions, insertions, or substitutions) between one, two, three, or four in one or more CDRs compared to the respective CDR sequences of the sdAb in Table 1.

[0084] In some embodiments, the single-domain antibody of this disclosure is a variant variant of one of the reference single-domain antibodies in Table 1, which has three CDR regions that are 100% identical to the three corresponding CDR regions of the reference sdAb, and which, when compared to the corresponding framework region of the corresponding reference sdAb, has one, two, three, four, or five or fewer amino acids mutated by amino acid deletion, insertion, or substitution in one or more of the FRW1, FRW2, FRW3, and / or FRW4 regions.

[0085] In some embodiments, the sdAb of this disclosure has one or more amino acid substitutions, deletions, insertions, or other modifications compared to SEQ ID NOs. 41-44, selected from SEQ ID NOs. 41-44, and retains the biological function of the single-domain antibody. Modifications may include one or more substitutions, deletions, or insertions of one or more codons encoding the single-domain antibody or polypeptide, resulting in a change in the amino acid sequence compared to the sequence of the reference single-domain antibody or polypeptide. Amino acid substitutions may be the result of conservative amino acid substitutions, such as substituting one amino acid with another amino acid having similar structural and / or chemical properties (e.g., leucine with serine). Insertions or deletions may optionally range from about one to five amino acids. A given variation can be determined by systematically creating amino acid insertions, deletions, or substitutions in the sequence and testing the resulting variants with respect to the activity indicated by the full-length sequence or mature native sequence.

[0086] In some embodiments, the modifications are conservative sequence modifications. As used herein, the term “conservative sequence modification” refers to amino acid modifications that do not significantly affect or alter the binding characteristics of an antibody containing an amino acid sequence. Such conservative modifications include amino acid substitutions, additions, and deletions. Modifications can be introduced into the single-domain antibodies described herein by standard techniques known in the art, such as site-directed mutagenesis and PCR-mediated mutagenesis. Conservative amino acid substitutions involve the substitution of an amino acid residue with an amino acid residue having a similar side chain. Families of amino acid residues having similar side chains are defined in the art. These families include amino acids having basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), non-loading side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine, tryptophan), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine), beta-branched side chains (e.g., threonine, valine, isoleucine), and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine). Therefore, one or more amino acid residues within the CDR region of a single-domain antibody of this disclosure can be substituted with other amino acid residues from the same side-chain family, and the modified antibody can be tested for retained function (i.e., the functions described in (c) to (I) above) using the functional assays described herein.

[0087] In some embodiments, a single-domain antibody is selected from one of SEQ ID NOs: 41-44, but contains one or more amino acid substitutions, e.g., 1-20, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acid substitutions. The one or more amino acid substitutions may be located in one or more framework regions. Alternatively, the one or more amino acid substitutions may be located in one or more CDRs. In some embodiments, the amino acid substitutions are located in the framework and CDR sequences.

[0088] In some embodiments, the humanized single-domain antibody is a variant of a single-domain antibody selected from those having SEQ ID NOs: 41-44, the variant comprising one or more sequence modifications, which improve one or more properties such as binding affinity, specificity, thermal stability, expression level, effector function, glycosylation, reduced immunogenicity, or solubility compared to the unmodified single-domain antibody.

[0089] In preferred embodiments, the sdAb according to this disclosure has strict specificity for FGFR4. By having strict specificity for FGFR4, it is intended herein that the sdAb according to this disclosure does not exhibit detectable binding to other FGFR molecules, such as FGFR1, FGFR2, or FGFR3. Binding assays can be performed, as illustrated in the results, by detecting sdAb bound to cells expressing non-diverse FGFR molecules on their surface. Typically, the assay can be performed by flow cytometry to detect surface-bound single-domain antibodies using a labeled antibody (e.g., FITC-labeled anti-iXHis-tag antibody).

[0090] In some embodiments, the sdAb, typically the single-domain antibody according to this disclosure, is at least 10 -7 M, especially at least 10 -8 M, at least 10 -9 Affinity of M for FGFR4 (K D ) has but has no affinity for other FGFR molecules (FGFR1, FGFR2 and / or FGFR3, etc.), or 10 -3 It has an extremely low affinity of less than M. In some embodiments, sdAb specific to FGFR4 has no affinity for FGFR1 and FGFR3, but has a high affinity for FGFR2 (1.10). 6 ~1.10 8 , especially 1.10 6 ~1.10 7 Save ).

[0091] In preferred embodiments, the sdAb according to this disclosure inhibits FGFR4 signaling. Analysis of this property can be carried out as illustrated in the results contained herein. Typically, an FGFR4 activation assay is performed in Rh30 cells, and ERK1:2 phosphorylation may be used as a readout. Rh30 cells can therefore be incubated with FG19, a specific ligand for FGFR4, with or without the antibody to be tested. An increase in phosphorylator ERK1 / 2 levels indicates that the test antibody activates the FGFR4 downstream pathway according to this disclosure.

[0092] Those skilled in the art will see that there are different methods for identifying, obtaining, and optimizing the antigen-binding molecules described herein, including in vitro and in vivo expression libraries. Optimization methods known in the art, such as display (e.g., ribosome and / or phage display) and / or mutagenesis (e.g., error-prone mutagenesis), may be used. This disclosure therefore also includes sequence-optimized variants of the single-domain antibodies described herein.

[0093] In some embodiments of this disclosure, the isolated humanized single-domain antibodies described herein may be conjugated directly or indirectly, covalently or non-covalently, to a compound of interest. The substance or compound of interest as defined above can be conjugated directly and covalently or non-covalently to a single-domain antibody as defined herein, either at one of its terminal ends (N or C-terminus) or to one of the side chains of the amino acids of the single-domain antibody. The substance of interest can also be conjugated indirectly and covalently or non-covalently to a single-domain antibody using a spacer (or linker), either at one of its terminal ends or to one of the side chains of the amino acids of the single-domain antibody. Conventional methods of conjugating the substance of interest to peptides, particularly antibodies, are known in the art (see, for example, Ternynck and Avrameas 1987, "Techniques immunoenzymatiques," Ed. INSERM, Paris; Hermanson, 2010, Bioconjugate Techniques, Academic Press).

[0094] In some embodiments, the single-domain antibodies described herein may be in particular in the form of an "antibody-drug conjugate" of the formula sdAb-(L-(D)m)n or a pharmaceutically acceptable salt thereof; where sdAb is a previously disclosed single-domain antibody; L is a linker; D is the compound of interest; m is an integer from 1 to 8; and n is an integer from 1 to 10, typically 3 or 4.

[0095] As used herein, the term “antibody-drug conjugate” refers to the binding of a single-domain antibody to another drug, such as a chemotherapeutic agent, toxin, immunotherapy agent, imaging probe, etc. The binding may be covalent or a non-covalent interaction, such as electrostatic force. Various linkers known in the art can be used to form an immunoconjugate. The linker (L) may be selected from the group consisting of, for example, cleavage linkers, non-cleavage linkers, hydrophilic linkers, procharged linkers, and dicarboxylic acid-based linkers.

[0096] In some embodiments, the single-domain antibodies of this disclosure are conjugated or covalently bonded to the compound of interest. As used herein, the term “conjugation” has its general meaning in the art and refers to chemical conjugation or chemical crosslinking. Many chemical crosslinking methods are also known in the art. Crosslinking reagents may be homobifunctional (i.e., having two functional groups that undergo the same reaction) or heterobifunctional (i.e., having two different functional groups). Numerous crosslinking reagents are commercially available. Detailed instructions for their use are readily available from commercial suppliers.General references regarding polypeptide crosslinking and conjugate preparation are as follows: WONG, Chemistry of protein conjugation and crosslinking, CRC Press (1991), and Arnon et al., "Monoclonal Antibodies For Immunotargeting Of Drugs In Cancer Therapy" in Monoclonal Antibodies And Cancer Therapy (Reisfeld et al., Alan R. Liss, Inc., 1985); Hellstrom et al., "Antibodies For Drug Delivery" in Controlled Drug Delivery (Robinson et al., Marcel Deiker, Inc., 2nd edition 1987); Thorpe, "Antibody Carriers Of Cytotoxic Agents In Cancer Therapy: A Review" in Monoclonal Antibodies '84: Biological And Clinical Applications (Pinchera et al., 1985); Monoclonal Antibodies For Cancer Detection And See also "Analysis, Results, and Future Prospective of the Therapeutic Use of Radiolabeled Antibody In Cancer Therapy" in Therapy (Baldwin et al., Academic Press, 1985), and Thorpe et al., 1982, Immunol. Rev. 62: pp. 119-158. Also see, for example, PCT publication WO89 / 12624). Typically, nucleic acid molecules are covalently bonded to lysine or cysteine ​​on the antibody via N-hydroxysuccinimide ester or maleimide functionality, respectively.Methods of conjugation using modified cysteine ​​or incorporating unnatural amino acids have been reported to improve the uniformity of conjugates (Axup, JY, Bajjuri, KM, Ritland, M., Hutchins, BM, Kim, CH, Kazane, SA, Haider, R., Forsyth, JS, Santidrian, AF, Stafin, K. et al. (2012). Synthesis of site-specific antibody-drug conjugates using unnatural amino acids. Proc. Natl. Acad. Sci. USA 109, pp. 16101-16106; Junutula, JR, Flagella, KM, Graham, RA, Parsons, KL, Ha, E., Raab, H., Bhakta, S., Nguyen, T., Dugger, DL, Li, G. et al. (2010) Engineered thio-trastuzumab-DMl conjugate with An improved therapeutic index to target human epidermal growth factor receptor 2-positive breast cancer. Clin. Cancer Res. 16, pp. 4769-4778. Junutula et al. (2008) developed a cysteine-based site-directed conjugation called "THIOMAB" (TDC), which is claimed to show an improvement in therapeutic index compared to conventional conjugation methods. Those skilled in the art may also conceive of polypeptides modified with endogenous glutamine, which are made reactive by acyl-donor glutamine-containing tags (e.g., gin-containing peptide tags or Q tags) or polypeptide modification (e.g., by amino acid deletion, insertion, substitution, or mutation in the polypeptide).Subsequently, transglutaminase can covalently crosslink with an amine donor (e.g., a small molecule containing a reactive amine or a small molecule bound to a reactive amine) to form a stable and homogeneous population of modified Fc-containing polypeptide conjugates with an amine donor that is site-specifically conjugated to an Fc-containing polypeptide via an acyl-donor glutamine-containing tag or accessible / exposed / reactive endogenous glutamine (WO2012059882). The term "transglutaminase," used interchangeably with "TGase" or "TG," refers to an enzyme that can crosslink proteins through an acyl transfer reaction between the γ-carboxamide group of peptide-bonded glutamine and lysine or a structurally related primary amine (e.g., an aminopentyl group), such as the ε-amino group of peptide-bonded lysine, resulting in an ε-(γ-glutamyl)lysine isopeptide bond. Examples of TGases include, in particular, bacterial transglutaminases (BTGs), such as enzymes having EC reference EC 2.3.2.13 (protein-glutamine-γ-glutamyltransferase). In some embodiments, the single-domain antibodies of this disclosure are conjugated to a heterogeneous portion by a linker molecule. As used herein, the term “linker molecule” refers to any molecule that binds to the single-domain antibody of this disclosure. The binding is typically covalent. In some embodiments, the linker molecule is flexible and does not hinder the binding of the single-domain antibody of this disclosure.

[0097] The compounds or substances intended for use in this specification may be selected without limitation from nucleic acids, polypeptides or proteins, viruses, toxins, and chemical substances.

[0098] In some embodiments, the compound of interest may be an antigen-binding domain agent, such as an antibody, its variants and fragments, particularly the same or another single-domain antibody, aptamer, or enzyme.

[0099] The compounds or substances described above may be therapeutic or diagnostic compounds. Examples of therapeutic compounds include those having anticancer activity and / or cytotoxic activity (i.e., cytotoxic compounds), while examples of diagnostic compounds typically include imaging probes.

[0100] Chemotherapy drugs often lack specificity and may affect healthy tissue. To overcome this problem, nanovehicles can be used to actively deliver drugs to tumor sites. The use of nanotechnology in the field of chemotherapy may improve intracellular distribution by increasing drug concentrations at tumor sites and reduce toxicity to normal cells (see Ferrari, M. Cancer nanotechnology: Opportunities and challenges. Nat. Rev. Cancer 5, pp. 161-171 (2005); and for a detailed review, see Kumari, P., Ghosh, B. & Biswas, S. Nanocarriers for cancer-targeted drug delivery. J. Drug Target. 24, pp. 179-191 (2016)). Therefore, in some embodiments, the substance of interest is a drug nanocarrier, which may be an organic substance such as a liposome or polymer entity, or an inorganic substance containing or encapsulating a diagnostic or therapeutic compound (Villaraza et al. 2010 Chem Rev., 110, pp. 2921-2959). Thus, nanobodies are extremely useful tools for delivering toxic cargo to cancer cells and are well suited to chemical conjugation into different nanoparticle or nanocarrier formats. Examples of organic carriers (or cargoes) include liposomes or micelles, albumin-based nanoparticles, and polymer-based polymerosomes, among other polymer nanoparticles. Examples of inorganic supports include quantum dots, carbon nanotubes, layered double hydroxides, mesoporous silica, and magnetic nanoparticles (see, in particular, Senapati, S., Mahanta, AK, Kumar, S. et al., Controlled drug delivery vehicles for cancer treatment and their performance. Sig Transduct Target Ther 3, p. 7 (2018)).

[0101] Polymer nanoparticles are solid, biocompatible, colloidal, and often biodegradable systems with nanoscale dimensions. Polymer nanoparticles can be made from synthetic polymers, such as poly(lactic acid) (PLA), poly(ε-caprolactone) (PCL), poly(lactic acid-co-glycolic acid), N-(2-hydroxypropyl)-methacrylamide copolymer (HPMA), and poly(styrene-maleic anhydride) copolymer, or from natural polymers, such as gelatin, dextran, guar gum, chitosan, and collagen. Drugs can be readily encapsulated by dispersing them in a polymer matrix or by conjugation / adhesion to the polymer for controlled delivery by surface or bulk erosion, diffusion through a polymer matrix, expansion and subsequent diffusion, or in response to local irritation.

[0102] Albumin is a protein available in soybeans, milk, and grains, and can be obtained from various sources including egg white (ovalbumin), bovine serum (bovine serum albumin, BSA), and human serum (human serum albumin, HSA). Albumin-based nanocarriers have several advantages, including ease of preparation, high binding ability to various drugs, non-toxicity, non-immunogenicity, biocompatibility, and biodegradability, as well as a long half-life in circulating plasma. The presence of functional groups (amino and carboxyl groups) on the surface of albumin nanoparticles facilitates binding to targeted ligands and other surface modifications.

[0103] A micelle is a spherical or spherical colloidal nanoscale system formed by the self-assembly of amphiphilic block copolymers in aqueous solution, resulting in a hydrophobic core and a hydrophilic shell. Micelles belong to a group of amphiphilic colloids that can spontaneously form at certain concentrations (critical micelle concentrations; CMCs) and temperatures. The hydrophobic core functions as a reservoir for hydrophobic drugs, while the hydrophilic shell stabilizes the hydrophobic core, making both the polymer and the hydrophobic drug water-soluble and making the particles suitable for intravenous administration. Drugs are incorporated into polymer micelles through physical, chemical, or electrostatic interactions.

[0104] Liposomes are small, spherical, self-closing structures that possess at least one concentric lipid bilayer, encapsulating an aqueous phase within their core. Due to their biocompatibility and biodegradability, and their unique ability to encapsulate hydrophilic drugs (hydrophilic drugs, DNA, RNA, etc.) in their inner aqueous core and hydrophobic drugs within their lamellae, liposomes have been widely used as drug delivery vehicles since their discovery in 1965, making them a versatile therapeutic carrier. Furthermore, amphipathic drugs can also be loaded into the inner aqueous core of liposomes using remote loading methods, such as the ammonium sulfate method for doxorubicin or the pH gradient method for vincristine (see Bolotin, EM et al., Ammonium sulfate gradients for efficient and stable remote loading of amphipathic weak bases into liposomes and ligandoliposomes. J. Liposome. Res. 4, pp. 455-479 (1994), and Boman, NL et al., Liposomal vincristine which exhibits increased drug retention and increased circulation longevity cures mice bearing P388 tumors. Cancer Res. 54, pp. 2830-2833 (1994)). Ligand-targeted liposomes have been found to promote the internal transfer of liposome-drug conjugates to specific target cells both in vitro and in vivo. Liposomal formulations of some chemotherapeutic drugs have been moved to clinical practice, demonstrating improvements in the safety and pharmacokinetic properties of these drugs.Notable examples include liposomal doxorubicin (Doxil®), daunorubicin (DaunoXome®), and VCR (Marqibo®), which contribute to a reduction in side effects compared to free-release drugs (see O'Brien, MER et al., Ann. Oncol. 15, pp. 440-449 (2004); Gill, PS et al., J. Clin. Oncol. 14, pp. 2353-2364 (1996); and Shah, NN et al., Pediatr. Blood Cancer 63, pp. 997-1005 (2016)).

[0105] For a recent review on liposome technology for delivering therapeutic compounds, see Bulbake, Upendra et al., "Liposomal Formulations in Clinical Use: An Updated Review," Pharmaceutics vol. 9,2 12. 27 Mar. 2017. Typical examples of targeted liposomes (i.e., those bound to the FGFR4 sdAb described above) are described in particular in the Results section (but also see Roveri, M. et al., Nanomedicine nnm-2017-0430 (2017)). Exemplary liposomes include, in particular, egg sphingomyelin, cholesterol, PEG-ceramide (typically N-palmitoyl-sphingosine-1-[succinyl[methoxyPEG-2000]]), DSPE-PEG-maleimide (typically 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-N-[maleimide(polyethylene glycol)-2000]) (both from Avanti Polar Lipids), and DiR (1,1'-dioctadecyl-3,3,3',3'-tetramethylindotricarbocyanine iodide) (Thermo Fisher). This includes combinations of lipids (Scientific). The favorable ratios of the aforementioned lipids are typically 49.8:45:4:1:0.2 mol%, respectively. A total lipid concentration of around 70 mM is achieved in the lipid membrane.

[0106] To create active targeting liposomes, a reactive maleimide group was introduced to the distal end of a DSPE-PEG lipid. A single-domain antibody with free cysteine ​​at its C-terminus was then bound to the liposome surface. Typical therapeutic agents that can be encapsulated in liposomes include doxorubicin (Doxil®, Myocet®), daunorubicin (DaunoXome®), VCR (Marqibo®), and vinorelbine (TCL178).

[0107] The compounds listed below may be directly conjugated to the single-domain antibodies disclosed herein or encapsulated in the carriers described above.

[0108] The terms “toxin,” “cytotoxic,” or “cytotoxic compound,” as used herein, refer to any agent that is harmful to the growth and proliferation of cells and that may act to reduce, inhibit, or destroy cells or malignant tumors.

[0109] As used herein, the term “anticancer compound” refers to any agent that can be used to treat a cell proliferation disorder such as cancer, including but not limited to cytotoxic agents, chemotherapeutic agents, radioisotopes, targeted anticancer agents, immunotherapeutic agents (such as immunosuppressants or immunostimulants), and soluble peptides.

[0110] Therapeutic compounds having anticancer or cytotoxic activity can be selected from the group consisting of, for example, V-ATPase inhibitors, apoptosis promoters, Bcl2 inhibitors, MCL1 inhibitors, HSP90 inhibitors, IAP inhibitors, mTor inhibitors, microtubule stabilizers, microtubule destabilizers, auristatin, drastatin, mytansinoids, MetAP (methionine aminopeptidase), inhibitors of nuclear export of protein CRM1, DPPIV inhibitors, proteasome inhibitors, inhibitors of mitochondrial phosphate transfer reactions, protein synthesis inhibitors, kinase inhibitors, CDK2 inhibitors, CDK9 inhibitors, kinesin inhibitors, HDAC inhibitors, DNA damaging agents, DNA alkylating agents, DNA intercalators, DNA minor groove binding agents, and DHFR inhibitors.

[0111] Cytotoxic compounds include, for example, Taxol; Cytochalasin B; Gramicidin D; Ethidium bromide; Emetine; Mitomycin; Etoposide; Teniposide; Vincristine; Vinblastine; Colchicine; Doxorubicin; Daunorubicin; Dihydroxyanthracindione; Tubulin inhibitors, such as Mytansine or its analogs or derivatives; Mitosis inhibitors, such as Monomethyl Auristatin E or F or its analogs or derivatives; Dorastatin 10 or 15 or its analogs; Irinotecan or its analogs; Mitoxantrone; Mitramycin; Actinomycin D; 1-Dehydrotestosterone; Glucocorticoids; Procaine; Tetracaine; Lidocaine; Propranolol; Puromycin; Kalicheamicin or its analogs or derivatives; Antimetabolites, such as Methotrexate, 6-Mercaptopurine, 6-Thio Guanine, cytarabine, fludarabine, 5-fluorouracil, dacarbazine, hydroxyurea, asparaginase, gemcitabine, or cladribine; alkylating agents, e.g., mechloretamine, thiotepa, chlorambucil, melphalan, carmustine (BSNU), lomustine (CCNU), cyclophosphamide, busulfan, dibromomannitol, streptozotocin, dacarbazine (DTIC), procarbazine, mitomycin C; platinum derivatives Conductors, e.g., cisplatin or carboplatin; duocalmycin A, duocalmycin SA, racermycin (CC-1065), or analogs or derivatives thereof; antibiotics, e.g., dactinomycin, bleomycin, daunorubicin, doxorubicin, idarubicin, mitramycin, mitomycin, mitoxantrone, plicamycin, anthramycin (AMC)); pyrrolo[2,1-c][1,4]-benzodiazepine (PDB);Diphtheria toxins and related molecules, such as diphtheria A chain and its active fragments and hybrid molecules; lysine toxins, such as lysine A or deglycosylated lysine A chain toxins; cholera toxins; Shiga-like toxins, such as SLT I, SLT II, ​​SLT IIV, LT toxin, C3 toxin, Shiga toxin, pertussis toxin, tetanus toxin, soybean Bowman-Birk protease inhibitors, Pseudomonas exotoxin, alorin, saporin, modesin, geranin, abrin A chain, modesin A chain, alpha-sarcin, Aleuritesfordii protein, dianthin protein, Phytolacca americana protein, e.g., PAPI, PAPII, and PAP-S, bitter melon (momordicacharantia) inhibitors, curcin, crocin, sapaonaria officinalis inhibitors, geronin, mitogellin, restrictosin, phenomycin, and enomycin toxins; ribonuclease (RNase); DNase I. The group may be selected from the following: Staphylococcus enterotoxin A; pokeweed antiviral protein; diphtheria toxin; and Pseudomonas endotoxin.

[0112] In some embodiments, therapeutic compounds conjugated to or encapsulated in nanocarriers functionalized with the sdAbs disclosed herein include auristatin or its peptide analogues, derivatives, or prodrugs. Auristatin has been shown to inhibit microtubule dynamics, GTP hydrolysis, and nuclear and cell division (Woyke et al. (2001) Antimicrob. Agents and Chemother. 45(12): pp. 3580-3584), and to possess anticancer activity (US5663149) and antifungal activity (Pettit et al., (1998) Antimicrob. Agents and Chemother. 42: pp. 2961-2965). For example, auristatin E can react with paraacetylbenzoic acid or benzoylvaleric acid to produce AEB and AEVB, respectively. Other typical auristatin derivatives include AFP, MMAF (monomethyl auristatin F), and MMAE (monomethyl auristatin E). Suitable auristatins and auristatin analogs, derivatives, and prodrugs, as well as linkers suitable for conjugation of auristatin to its abs, are described, for example, in U.S. Patents 5,635,483, 5,780,588, and 6,214,345, and in International Patent Application Publications WO02088172, WO2004010957, WO2005081711, WO2005084390, WO2006132670, WO03026577, WO200700860, WO207011968, and WO205082023.

[0113] In some embodiments, therapeutic compounds conjugated to or encapsulated in nanocarriers functionalized with the sdAbs disclosed herein include meltansine (also known as emtansine or DM1), or its peptide analogs, derivatives, or prodrugs. Meltansine is a tubulin inhibitor, meaning it binds to tubulin and inhibits microtubule assembly.

[0114] In some embodiments, therapeutic compounds conjugated to or encapsulated in nanocarriers functionalized with the sdAbs disclosed herein include pyrrolo[2,1-c][1,4]-benzodiazepines (PDBs) or their analogues, derivatives, or prodrugs. Suitable PDBs and PDB derivatives, as well as related technologies, are described, for example, in Hartley JA et al., Cancer Res 2010;70(17):6849-6858; Antonow D. et al., Cancer J 2008;14(3):154-169; Howard PW et al., Bioorg Med ChemLett 2009;19:6463-6466; and Sagnou et al., Bioorg Med ChemLett 2000;10(18):2083-2086.

[0115] In some embodiments, therapeutic compounds conjugated to or encapsulated in nanocarriers functionalized with the sdAbs disclosed herein include anthracyclines, mytansine, calicheamicin, duocalmycin, rakelmycin (CC-1065), drastatin 10, drastatin 15, irinotecan, monomethyl auristatin E, monomethyl auristatin F, PDB, or any analogues, derivatives, or prodrugs thereof.

[0116] In some embodiments, therapeutic compounds conjugated to or encapsulated in nanocarriers functionalized with sdAbs disclosed herein include anthracyclines or their analogues, derivatives, or prodrugs. In some embodiments, a single-domain antibody is conjugated to mytansin or its analogues, derivatives, or prodrugs. In some embodiments, a single-domain antibody is conjugated to calicheamycin or its analogues, derivatives, or prodrugs. In some embodiments, a single-domain antibody is conjugated to duocalmycin or its analogues, derivatives, or prodrugs. In some embodiments, a single-domain antibody is conjugated to rakelmycin (CC-1065) or its analogues, derivatives, or prodrugs. In some embodiments, the antibody is conjugated to drastatin 10 or its analogues, derivatives, or prodrugs. In some embodiments, the antibody is conjugated to drastatin 15 or its analogues, derivatives, or prodrugs. In some embodiments, the antibody is conjugated with monomethyl auristatin E or its analogues, derivatives, or prodrugs. In some embodiments, the single-domain antibody is conjugated with monomethyl auristatin F or its analogues, derivatives, or prodrugs. In some embodiments, the antibody is conjugated with pyrrolo[2,1-c][1,4]-benzodiazepine or its analogues, derivatives, or prodrugs. In some embodiments, the single-domain antibody is conjugated with irinotecan or its analogues, derivatives, or prodrugs.

[0117] In some embodiments, therapeutic compounds conjugated to or encapsulated on nanocarriers functionalized with the sdAbs disclosed herein include nucleic acids or nucleic acid-binding molecules. In one such embodiment, the conjugated nucleic acid is a cytotoxic ribonuclease (RNase) or deoxyribonuclease (e.g., DNase I), an antisense nucleic acid, an inhibitory RNA molecule (e.g., an siRNA molecule), or an immunostimulatory nucleic acid (e.g., an immunostimulatory CpG motif-containing DNA molecule). In some embodiments, an antibody is conjugated to an aptamer or ribozyme.

[0118] In some embodiments, therapeutic compounds conjugated to or encapsulated in nanocarriers functionalized with the sdAbs disclosed herein (e.g., as fusion proteins) include soluble peptides such as CLIP, Magainin 2, Melittin, Seclopine, and PI 8.

[0119] In some embodiments, therapeutic compounds conjugated to or encapsulated in nanocarriers functionalized with the sdAbs disclosed herein (e.g., as fusion proteins) include, for example, cytokines such as IL-2, IL-4, IL-6, IL-7, IL-10, IL-12, IL-13, IL-15, IL-18, IL-23, IL-24, IL-27, IL-28a, IL-28b, IL-29, KGF, IFNa, IFN3, IFNy, GM-CSF, CD40L, Flt3 ligand, stem cell factors, ancestim, and TNFα.

[0120] In some embodiments, therapeutic compounds conjugated to or encapsulated on nanocarriers functionalized with sdAbs disclosed herein include radioisotopes or radioisotope-containing chelates. For example, an antibody may be conjugated to a chelating linker, such as DOTA, DTPA, or tiuxetan, which allows the antibody to form a complex with a radioisotope. A single-domain antibody may also or may contain, or be conjugated to, one or more radiolabeled amino acids or other radiolabeled molecules. Non-limiting examples of radioisotopes include: 3 H, 14 C, 15 N, 35 S, 90 Y, 99 Tc, 125 I, 131 I, 186 Re, 213 Bi, 225 Ac, and 227 Th is one example. For therapeutic purposes, radioactive isotopes that emit beta or alpha particle radiation, such as 1311, 90Y, 211At, 212Bi, 67Cu, 186Re, 188Re, and 212Pb may be used.

[0121] Diagnostic compounds can be selected from enzymes, fluorophores, NMR or MRI contrast agents, radioisotopes, or nanoparticles. For example, diagnostic compounds may be selected from the group consisting of the following: - Enzymes, such as horseradish peroxidase, alkaline phosphatase, glucose-6-phosphatase, or beta-galactosidase; - Fluorophores, for example, green fluorescent protein (GFP) visualized using electron detectors (CCD cameras, photomultiplier tubes), blue fluorescent dyes excited by wavelengths in the ultraviolet (UV) portion of the spectrum (e.g., AMCA(7-amino-4-methylcoumarin-3-acetic acid); Alexa Fluor® 350), green fluorescent dyes excited by blue light (e.g., FITC, Cy2, Alexa Fluor® 488), red fluorescent dyes excited by green light (e.g., rhodamine, Texas Red, Cy3, Alexa Fluor dyes 546, 564 and 594), or dyes excited by near-infrared light (e.g., Cy5); - Radioisotopes, for example, 18F, nC, 13N, 150, 68Ga, 82Rb, 44Sc, 64Cu, 86Y, 89Zr, 124I, 152Tb, which can be used for PET imaging, or 67Ga, 81mKr, 99mTc, mIn, 123I, 125I, 3Xe, 201T1, 155Tb, 195mPt, which can be used for SPECT / scintigraphy testing, or 14C, 3H, 35S, 3P, 125I, which may be used for autoradiography or in situ hybridization, or At-, Bi-, Br-, Br-, I-, In, 177Lu-, 212Pb-, 186Re-, 188Re-, 153Sm-, 0Y, which can be used to label compounds; - NMR or MRI contrast agents, such as paramagnetic agents gadolinium (Gd), dysprosium (Dy), and manganese (Mn), as well as superparamagnetic agents based on iron oxide (MION, SPIO, or USPIO, etc.) or iron-platinum (SIPP), and X nuclei such as 18F, 13C, 23Na, 170, 15N; - Nanoparticles, for example, gold nanoparticles (B. Van de Broek et al., ACSNano, Vol. 5, No. 6, pp. 4319-4328, 2011) or quantum dots (A. Sukhanova et al., 2012 Nanomedicine, Vol. 8, pp. 516-525).

[0122] In preferred embodiments, the diagnostic compound is a fluorophore, more preferably Alexa Fluor® 488, or an MRI contrast agent, more preferably gadolinium.

[0123] When a diagnostic agent is used for detection, the diagnostic agent may include a radioactive atom for scintigraphy testing, such as 99Tc or 123I, or a spin label for nuclear magnetic resonance (NMR) imaging (also known as MRI), such as 13C, 9F, Fe, Gd, 123I, 111In, Mn, 15N, or 7O.

[0124] The substances for which this disclosure pertains may or may not cross the mammalian or human blood-brain barrier.

[0125] In some embodiments, if the compound of interest is a heterologous polypeptide, the single-domain antibody of this disclosure may be fused to (or further to) one or more heterologous polypeptides to form a fusion protein (also referred to herein as “fusion polypeptide” or “polypeptide”). A “fusion” or “chimeric” protein or polypeptide comprises a first amino acid sequence linked to a second amino acid sequence that is not naturally linked. Amino acid sequences that normally exist in separate proteins can be linked in the fusion polypeptide. The fusion protein or polypeptide may be produced, for example, by chemical synthesis, or by creating and translating polynucleotides in which the polypeptide region is encoded in the desired relationship.

[0126] According to this disclosure, the fusion protein may therefore include at least one isolated humanized single-domain antibody (hsbAb) according to this disclosure that is fused either directly or via a spacer at its C-terminus and / or N-terminus, in particular, fused at its C-terminus to the N-terminus of a heterologous polypeptide and / or fused at its N-terminus to the C-terminus of a heterologous polypeptide. As used herein, the term “direct” means that the (first or last) amino acid at the terminal (N or C-terminus) of the humanized single-domain antibody is fused to the (first or last) amino acid at the terminal (N or C-terminus) of the heterologous polypeptide. In other words, in this embodiment, the last amino acid at the C-terminus of the sdAb is directly linked by covalent bond to the first amino acid at the N-terminus of the heterologous polypeptide, or the first amino acid at the N-terminus of the sdAb is directly linked by covalent bond to the last amino acid at the C-terminus of the heterologous polypeptide. As used herein, the term “spacer,” also called “linker,” refers to a sequence of at least one amino acid linking the sdAb of this disclosure to the heterologous polypeptide. Such spacers may be useful in preventing steric hindrance. Examples of linkers disclosed herein have the following sequences: (Gly3-Ser)4, (Gly3-Ser), Ser-Gly, or (Ala-Ala-Ala).

[0127] In some embodiments, the compound of interest may be one or more polypeptides containing different or the same antigen-binding domains. In particular, the compound of interest may or may not be one or more single-domain antibodies disclosed herein. A fusion protein or polypeptide obtained that contains two or more antigen-binding domains, in particular containing or essentially consisting of two or more single-domain antibodies, is referred to herein as a “polyvalent” polypeptide or antigen-binding compound. In some embodiments, the fusion protein or polypeptide may contain the first binding domain described herein and at least one single-domain antibody having at least one other binding domain (e.g., for the same or a different epitope, antigen, target, protein, or polypeptide), which is typically also a single-domain antibody. A “multispecific” (fusion) polypeptide refers to a polypeptide containing at least two different antigen-binding domains (i.e., targeting different epitopes, antigens, or targets), in contrast to a polypeptide containing similar antigen-binding domains, in particular a polypeptide containing the same single-domain antibody (a “single-specific” (fusion) polypeptide).

[0128] Therefore, in some embodiments, the fusion proteins described herein may also provide at least a second antigen-binding domain to any desired protein, polypeptide, antigen, antigenic determinant, or epitope. The binding domain may be a binding domain to FGFR4, particularly to the same or different FGFR4 epitopes, or it may be a binding domain to any other antigen, polypeptide, or protein.

[0129] The “bispecific” fusion proteins of this disclosure are fusion polypeptides comprising at least one single-domain antibody of this disclosure against a first antigen (i.e., FGFR4) and at least one further binding domain against a second FGFR4 epitope or antigen (i.e., different from FGFR4), whereas the “triplespecific” polypeptides of this disclosure are polypeptides comprising at least one single-domain antibody of this disclosure against a first antigen (i.e., FGFR4), at least one further binding domain against a second FGFR4 epitope or antigen (i.e., different from FGFR4), and at least one further binding domain against a third FGFR4 epitope or antigen (i.e., different from both, i.e., different from the first and second antigens).

[0130] Examples of antigens other than FGFR4 include PSMA, PSCA, BCMA, CS1, GPC3, CSPG4, EGFR, fetal acetylcholine receptor subunit gamma (fAChRγ), HER3, IGF1R, SLC19A1, ACVR2A, EPHB4, CA125, IL-13R, CD278, CD123, NCAM, 5T4, CD2, CD3, CD16 (FcγRIII), CD23, MART-1, and L1. CAM, MUC16, ROR1, SLAMF7, cKit, CD38, CD53, CD56, CD71, CD74, CD92, CD100, CD123, CD138, CD148, CD150, CD200, CD261, CD262, CD276, CD362, gp100, ROR1, Mesothelin, CD33 / IL3Ra, c-Met, Glycolipid F77, EGFRvlll, GD-2, NKp46 receptor, NY-ESO-1 TCR or MAGE A3 TCR, Human telomerase reverse transcriptase (hTERT), Survivin, Cytochrome P450 1 B1 (CY1 B) The following can be selected: HER2, Wilms tumor gene 1 (WT1), livin, alpha-fetoprotein (AFP), carcinoembryonic antigen (CEA), mucin 16, MUC1, p53, cyclin, immune checkpoint targets, or combinations thereof.

[0131] In some embodiments, at least one further antigen of the multispecific fusion polypeptide typically includes at least immune cell antigens such as one or more T cell antigens, one or more macrophage antigens, one or more NK cell antigens, one or more neutrophil antigens, and / or one or more eosinophil antigens, as exemplified with respect to bispecific T cell or NK cell engager molecules (in particular, Wolf E, Hofmeister R, Kufer P, Schlereth B, Baeuerle PA. "BiTEs: bispecific antibody constructs with unique anti-tumor activity." Drug Discov Today. September 15, 2005; 10(18): pp. 1237-44. See Review), one or more T cell antigens, one or more macrophage antigens, one or more NK cell antigens, one or more neutrophil antigens, and / or one or more eosinophil antigens. With respect to T cell antigens, CD2 and framework sequences of T cell receptor α and β chains, particularly CD2 or CD3, especially the ε chain of the CD3 complex, may be used. For example, with respect to NK cell antigens, fragments derived from FcγRIII and / or NKp46 receptor may be used.

[0132] The aforementioned multispecific polypeptides can be used in immune cell redirection immunotherapy using the same principles as CAR therapy (for an exemplary review, see Ellwanger K, Reusch U, Fucek I, et al., Redirected optimized cell killing (ROCK®: A highly versatile multispecific fit-for-purpose antibody platform for engaging innate immunity. MAbs. 2019;11(5):899-918).

[0133] In some embodiments, the additional binding domain may be a binding domain to a serum protein so as to increase the half-life of the single-domain antibody. Typically, the serum protein is albumin.

[0134] In some embodiments, the additional binding domain may be a binding domain to a receptor on the vascular endothelium of the blood-brain barrier, allowing the single-domain antibody of this disclosure to cross the blood-brain barrier. Targeted receptors include, in particular, transferrin receptors, insulin receptors, and IGF-I and IGF-II receptors.

[0135] In some embodiments, one or more additional binding domains may comprise one or more portions, fragments, or domains of conventional chain antibodies (and particularly human antibodies) and / or heavy chain antibodies. For example, a single-domain antibody as defined herein may optionally be linked to a conventional (typically human) VH or VL via a linker sequence.

[0136] In some embodiments, the polypeptides or fusion proteins of the Disclosure may include a single-domain antibody of the Disclosure linked to an immunoglobulin domain. For example, the polypeptide or fusion protein may include a single-domain antibody of the Disclosure linked to an Fc moiety (such as human Fc). The Fc moiety may be useful in increasing the half-life of the single-domain antibody of the Disclosure, and even increasing its production. For example, the Fc moiety can bind to serum proteins, thus increasing the half-life in the single-domain antibody. In some embodiments, at least one single-domain antibody may also be optionally linked to one or more (typically human) hinge and / or CHI, and / or CH2 and / or CH3 domains via a linker sequence. For example, a single-domain antibody linked to a suitable CHI domain may be used—together with a suitable light chain—to produce an antibody fragment / structure similar to, for example, a conventional Fab fragment or F(ab')2 fragment (where one or both of the conventional VH domains (in the case of the F(ab')2 fragment) are replaced by a single-domain antibody as defined herein). In some embodiments, one or more single-domain antibodies of the Disclosure may be linked to one or more antibody moieties, fragments, or domains (optionally via appropriate linker or hinge regions) that can confer one or more effector functions to the polypeptide of the Disclosure and / or the ability to bind to one or more Fc receptors, e.g., two or three constant domains that can be used as part of / to form an Fc moiety, e.g., an Fc moiety, and / or an ability to bind to one or more Fc receptors. For example, for this purpose, and not limited thereto, one or more further amino acid sequences may include one or more CH2 and / or CH3 domains of the antibody, e.g., derived from a heavy chain antibody, and more typically from a conventional human chain antibody; and / or may form an Fc region, e.g., derived from IgG (e.g., IgG1, IgG2, IgG3, or IgG4), IgE, or another human Ig, e.g., IgA, IgD, or IgM.

[0137] Chimeric antigen receptor The terms “chimeric antigen receptor,” “CAR,” or “CARs,” as used herein, refer to a modified receptor that implants antigen specificity into a cell (e.g., T cells such as naive T cells, central memory T cells, effector memory T cells, or combinations thereof), thereby linking the antigen-binding properties of the antigen-binding domain to the lytic ability and self-renewal of the T cell. CARs are also known as artificial T cell receptors, chimeric T cell receptors, or chimeric immune receptors. The terms “antigen-binding domain” or “antigen-specific targeting domain,” as used herein, refer to the region of a CAR that targets and binds to a specific antigen. When a CAR is expressed in a host cell, this domain forms an extracellular domain (ectodomain).

[0138] The CAR in this disclosure is of general formula: sdAb(n)-transmembrane domain-intracellular signal transduction domain The formula includes a numerator (where n is 1 or greater).

[0139] In some embodiments, n is at least 2, for example, 2, 3, 4, or 5. When expressed in cells, sdAb(n) forms an antigen-binding domain located extracellularly.

[0140] Typically, the CARs described herein preferably comprise one or more antigen-binding domains, particularly at least two, that target one or more antigens (each containing a single-domain antibody). The antigen-binding domains of the CARs of this disclosure may include two or at least two sdAbs, both of which are specific to FGFR4 and therefore result in a bivalent binding molecule. In some embodiments, the antigen-binding domain comprises two or at least two VH single-domain antibodies, both of which are specific to FGFR4 but bind to different epitopes. In other embodiments, the antigen-binding domain comprises a first single-domain antibody that binds to a first epitope of FGFR4, and a second single-domain antibody that binds to a second epitope of FGFR4. The epitopes may overlap. Thus, the antigen-binding domain is biparatopely oriented. In other embodiments, the antigen-binding domain comprises two single-domain antibodies, both of which are specific to FGFR4 and bind to the same epitope.

[0141] In preferred embodiments, the antigen-binding domain comprises one single-domain antibody specific to and therefore specific to FGFR4, and another antigen-binding domain specific to another antigen, thus resulting in a bispecific antigen-binding domain. In other words, the antigen-binding domain comprises a first single-domain antibody that binds to a first target comprising FGFR4, and a second single-domain antibody that binds to a second target. Thus, in certain embodiments, this disclosure relates to a bispecific CAR.

[0142] As used herein, the terms “bispecific CAR” or “bispecific antigen-binding domain” therefore refer to polypeptides having specificity for two targets, including FGFR4. Accordingly, the bispecific binding molecules described herein can selectively and specifically bind to cells expressing (or presenting on their cell surface) FGFR4 and a second target.

[0143] In other embodiments, the binding molecule comprises two or more antigen-binding domains that provide a multispecific binding molecule. The multispecific antigen-binding domains described herein can therefore bind one or more additional targets in addition to binding to FGFR4. That is, the multispecific polypeptide can bind to at least two, at least three, at least four, at least five, at least six, or more targets, and each multispecific polypeptide agent has at least two, at least three, at least four, at least five, at least six, or more target-binding sites.

[0144] In some embodiments, additional antigens that may be bound by the multispecific CARs according to this disclosure include tumor antigens. In some embodiments, tumor antigens are associated with hematological malignancies or solid tumors. For example, tumor antigens include PSMA, PSCA, BCMA, CS1, GPC3, CSPG4, EGFR, fetal acetylcholine receptor subunit gamma (fAChRγ), HER3, IGF1R, SLC19A1, ACVR2A, EPHB4, CA125, IL-13R, CD278, CD123, NCAM, 5T4, CD2, CD3, CD16 (FcγRIII), CD23, MART-1, L1 CAM, MUC16, ROR1, SLAMF7, cKit, CD38, CD53, CD56, CD71, CD74, CD92, CD100, CD123, CD138, CD148, CD150, CD200, CD261, CD262, CD276, CD362, gp100, ROR1, Mesothelin, CD33 / IL3Ra, c-Met, Glycolipid F77, EGFRvIII, GD-2, NKp46 receptor, NY-ESO-1 TCR or MAGE A3 TCR, Human telomerase reverse transcriptase (hTERT), Survivin, Cytochrome P450 1 B1 (CY1 B) The target may be selected from the group consisting of HER2, Wilms tumor gene 1 (WT1), livin, alpha-fetoprotein (AFP), carcinoembryonic antigen (CEA), mucin 16, MUC1, p53, cyclin, immune checkpoint targets, or combinations thereof. However, those skilled in the art will understand that other tumor antigens may also be targeted within the scope of this disclosure.

[0145] In addition to the binding domains described in detail above, the CARs of this disclosure further comprise transmembrane domains. As used herein, “transmembrane domain” (TMD) refers to a region of the CAR that crosses the cell membrane and is linked to (in the latter case, optionally via a hinge) an endoplasmic reticulum signaling domain and an antigen-binding domain. In one embodiment, the transmembrane domain of the CAR of this disclosure is a transmembrane region of a transmembrane protein (e.g., a type I transmembrane protein), an artificial hydrophobic sequence, or a combination thereof. In some embodiments, the transmembrane domain includes a CD3 zeta domain, a CD28 transmembrane domain, a CD8 alpha transmembrane domain, a DAP10 transmembrane domain, or a DAP12 transmembrane domain. Other transmembrane domains will be apparent to those skilled in the art and may be used in connection with alternative embodiments of this disclosure.

[0146] DAP10 and DAP12 are adapters that partner with most activated NKRs expressed on NK cells and all NKRs expressed on T cells (see Chen X, Bai F, Sokol L et al. A critical role for DAP10 and DAP12 in CD8+ T cell-mediated tissue damage in large granular lymphocyte leukemia. Blood. 2009;113(14):3226~3234).

[0147] In some embodiments, the extracellular domain is fused to a hinge that is fused to the binding domain. The hinge may be any linker amino acid sequence containing 2 to 50 amino acids, such as a CD8 hinge.

[0148] The CARs of this disclosure further include intracellular signaling domains. “Intracellular signaling domain,” “cytoplasmic domain,” or “endodomain” is a domain that transmits activation signals to T cells, instructing T cells to perform their specialized functions. Examples of domains that transmit effector function signals and may be used by this disclosure include, but are not limited to, intracellular domains derived from the ζ chain of the T cell receptor complex or any homolog thereof (e.g., η chain, FcsRIy and β chain, MB 1(Iga) chain, B29(Ig) chain, etc.), human CD3 zeta chain, CD3 polypeptides (Δ, δ and ε), syk family tyrosine kinases (Syk, ZAP 70, etc.), src family tyrosine kinases (Lck, Fyn, Lyn, etc.), and other molecules involved in T cell transmission, such as CD2, CD5, OX40, CD28, DAP10 and DAP12. Other intracellular signaling domains will be apparent to those skilled in the art and may be used in connection with alternative embodiments of this disclosure. In some embodiments, the intracellular domain is particularly selected from the intracellular domains of DAP10, DAP12, CD28, 4-1BB, or the human CD3 zeta chain.

[0149] Typically, the CARs according to this disclosure may include a CD3 zeta chain and an intracellular domain of 4-1BB.

[0150] In some embodiments, the CAR may include an additional activation domain (or intracellular domain) comprising at least 50, 60, 70, 80, 90, 100, 110, 120, 150, or 200 amino acid fragments of at least one additional activation domain selected from the cytoplasmic domains of the CD3-ζ chain (also simply referred to as ζ) and the costimulatory receptor CD28, 4-1 BB (CD137), OX40 (CD134), LAG3, TRIM, HVEM, ICOS, CD27, or CD40L. In various embodiments, the CAR may include an additional activation domain comprising at least 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 150, or 200 amino acid fragments that share at least 90%, preferably more than 95%, and more than 99% identity with the amino acid sequence of the additional activation domain described above.

[0151] In some embodiments, the CARs of the Disclosure further include one or more costimulatory domains that enhance CAR-T cell activity after antigen-specific binding. By including these domains in the CARs of the Disclosure, the proliferation, survival, and / or growth of memory cells are enhanced. The costimulatory domains are located intracellularly. The costimulatory domains are functional signaling domains obtained from proteins selected from the following group: CD3 zeta, CD28, CD137 (4-IBB), CD134 (OX40), DapIO, CD27, CD2, CD5, ICAM-1, LFA-1 (CD1 la / CD18), Lck, TNFR-I, TNFR-II, Fas, CD30, CD40, LAG3, TRIM, HVEM, ICOS, CD40L, or combinations thereof. Other costimulatory domains (e.g., derived from other proteins) will be apparent to those skilled in the art. Multiple costimulatory domains may be included in a single CAR to recruit multiple signaling pathways. In one embodiment, the costimulatory domain is obtained from 4-1BB. The term "4-1BB" refers to the amino acid sequence provided as GenBank accession number AAA62478.2, or a member of the TNFR superfamily having equivalent residues from non-human species, such as rodents (e.g., mice or rats), monkeys, or apes. The term "4-1BB costimulatory domain" refers to amino acid residues 214-255 of GenBank accession number AAA62478.2, or equivalent residues from non-human species, such as mice, rodents, monkeys, or apes.

[0152] In some embodiments, the CAR of the Disclosure further includes a hinge or spacer region connecting the extracellular antigen-binding domain and the transmembrane domain. This hinge or spacer region can be used to obtain different lengths and flexibility of the resulting CAR. Examples of hinge or spacer regions that may be used by the Disclosure include, but are not limited to, Fc fragments of antibodies or fragments or derivatives thereof, hinge regions of antibodies or fragments or derivatives thereof, CH2 regions of antibodies, CH3 regions of antibodies, artificial spacer sequences, such as peptide sequences, or combinations thereof. Other hinge or spacer regions will be apparent to those skilled in the art and may be used in conjunction with alternative embodiments of the Disclosure. In one embodiment, the hinge is an IgG4 hinge or a CD8A hinge.

[0153] In some embodiments, the CARs of this disclosure further include a “linker domain” or “linker region” that links different domains of the CAR. This domain includes an oligopeptide or polypeptide region approximately 1 to 100 amino acids in length. Suitable linkers will be obvious to those skilled in the art and may be used in conjunction with alternative embodiments of this disclosure.

[0154] In some embodiments, the CAR of the Disclosure further includes a “leader sequence.” In one embodiment, the leader sequence is a CD8A domain.

[0155] The CARs of this disclosure may further include labels or tags, for example, labels that facilitate imaging, such as fluorescent labels or other tags (such as myc). These can be used, for example, in methods for imaging tumor binding. The labels may be conjugated to the antigen-binding domain.

[0156] The CARs described herein may be synthesized as a single polypeptide chain. In this embodiment, the antigen-specific targeting region is located at the N-terminus, arranged in series, and separated by a linker peptide.

[0157] Examples of CAR designs are provided, in particular, in Jaspers JE and Brentjens RJ, “Development of CAR T cells designed to improve antitumor efficacy and safety” (Pharmacol Ther. 2017;178:83-91). Well-suited CAR designs according to this disclosure include those described by Ying, Z. et al. (A safe and potent anti-CD19 CAR T cell therapy. Nat. Med. 25, pp. 947-953 (2019)) and June, CH, O'Connor, RS, Kawalekar, OU, Ghassemi, S. & Milone, MC (CAR T cell immunotherapy for human cancer. Science (80-). 359, pp. 1361-1365 (2018)). Further suitable CAR constructs according to this disclosure are disclosed, in particular, in WO2019077165. Advantageously, according to this disclosure, the scFv-binding domain described herein is replaced with one or more single-domain antibodies, comprising at least one anti-FGFR4 single-domain antibody as described herein.

[0158] The results included in this study showed that FGFR4-CAR T cells, composed of myc-tagged A8 followed by CD8 alpha hinge and transmembrane domains, and intracellular signaling domains of 4-1BB and CD3 zeta, mediated significant antitumor activity against FGFR4-expressing RMS cells in vitro, thus representing a promising further targeted therapeutic option.

[0159] nucleic acids, vectors, host cells The present disclosure also provides an isolated nucleic acid encoding a single domain antibody or variant thereof or the aforementioned CAR, and a nucleic acid construct containing the same. The nucleic acids according to the present disclosure can be obtained by well-known methods of recombinant DNA technology and / or chemical DNA synthesis. Also within the scope of the present disclosure are sequences having at least 60%, 70%, 80% or 90% sequence identity thereto.

[0160] "Nucleic acid", "polynucleotide", or "nucleic acid molecule" refers to deoxyribonucleic acid (DNA) or ribonucleic acid (RNA), or a combination of DNA or RNA. Examples of RNA include in vitro transcribed RNA or synthetic RNA; mRNA sequences encoding the CAR polypeptides described herein. The nucleic acid may further contain a suicide gene. The construct may be in the form of a plasmid, vector, transcription or expression cassette.

[0161] The present disclosure thus also provides a recombinant expression cassette containing the nucleic acid according to the present disclosure under the control of a transcription promoter that enables regulation of transcription of the nucleic acid in a host cell. The nucleic acid can also be ligated to appropriate control sequences that enable regulation of its translation in the host cell.

[0162] The present disclosure also provides a recombinant vector (e.g., a recombinant expression vector) containing the nucleic acid according to the present disclosure. Advantageously, the recombinant vector is a recombinant expression vector containing the expression cassette according to the present disclosure.

[0163] The term "vector" as used herein refers to a nucleic acid molecule capable of propagating another nucleic acid to which it is ligated. The term includes vectors as self-replicating nucleic acid structures, as well as vectors that are integrated into the genome of a host cell into which the vector has been introduced. A particular vector can direct the expression of a nucleic acid to which it is operably linked. Such a vector is referred to herein as an "expression vector".

[0164] The vectors according to this disclosure are preferably suitable for stable gene delivery and long-term gene expression in mammalian cells, including replication of the target sequence, expression of the sequence, maintenance of the sequence in an extrachromosomal form, or integration into the host chromosome. Recombinant vectors are constructed using standard recombinant DNA techniques and prepared using conventional methods known in the art.

[0165] In some embodiments, the vectors of the Disclosure are embedded vectors, such as embedded viral vectors, such as retroviruses or AAV vectors. Preferably, the viral vectors are lentiviral vectors, most preferably embedded viral vectors.

[0166] In the context of this disclosure, “lentiviral vector” means a non-replicating, non-pathogenic virus that has been modified to deliver genetic material to cells and requires trans-provided lentiviral proteins (e.g., Gag, Pol, and / or Env). In practice, lentiviral vectors lack the expression of functional Gag, Pol, and Env proteins. Lentiviral vectors are advantageously self-inactivating vectors (SIN vectors). Lentiviral vectors advantageously include a central polyprint lact / DNA FLAP sequence (cPPT-FLAP) and / or an insulator sequence such as a chicken betaglobin insulator sequence that enhances the expression of the gene of interest. Lentiviral vectors are advantageously pseudotyped with another envelope protein, preferably another viral envelope protein, preferably a vesicular stomatitis virus (VSV) glycoprotein. In some preferred embodiments, the lentiviral vector is a human immunodeficiency virus (HIV) vector.

[0167] Lentiviral vectors are derived from lentiviruses, particularly human immunodeficiency virus (HIV-1 or HIV-2), simian immunodeficiency virus (SIV), equine infectious encephalitis virus (EIAV), canine arthritis encephalitis virus (CAEV), bovine immunodeficiency virus (BIV), and feline immunodeficiency virus (FIV). These are modified to remove genetic determinants involved in pathogenicity and introduce novel determinants useful for achieving therapeutic effects.

[0168] The lentiviral vector may exist in the form of an RNA or DNA molecule, depending on the stage of the retroviral vector's preparation or development. The lentiviral vector may be in the form of a recombinant DNA molecule such as a plasmid, or in the form of a lentiviral vector particle (hereinafter referred to interchangeably as a lentiviral particle) such as an RNA molecule within a complex of a lentivirus and other proteins.

[0169] Such vectors are based on the separation of cis and trans-acting sequences. To generate replication-deficient vectors, the trans-acting sequences (e.g., gag, pol, tat, rev, and env genes) may be deleted and replaced with an expression cassette encoding the transgene.

[0170] Efficient integration and replication into non-dividing cells generally require the presence of two cis-acting sequences, namely a central polyprint lacte (cPPT) and a central termination sequence (CTS), in the central region of the lentiviral genome. These result in the formation of a triple-stranded DNA structure called a central DNA "flap," which acts as a signal for the uncoating of the pre-integration complex at the nuclear pore and for the efficient transfer of the expression cassette into the nucleus of non-dividing cells such as dendritic cells. In one embodiment, this disclosure encompasses a lentiviral vector containing a central polyprint lacte and a central termination sequence, referred to as a cPPT / CTS sequence, particularly as described in European Patent Application EP2169073.

[0171] Further sequences, such as long-terminal repeats (LTRs), involved in the integration of the vector proviral DNA sequence into the host cell genome are usually present in cis. Vectors can be obtained, for example, by mutating the LTR sequence in the U3 domain of the LTR (AU3) (Miyoshi H et al., 1998, J Virol. 72(10):8150-77; Zufferey et al., 1998, JV / ro / 72(12):9873-80). Preferably, the vector does not contain an enhancer. In one embodiment, the disclosure includes a lentiviral vector comprising an LTR sequence which preferably has a mutated U3 region (AU3) in which the promoter and enhancer sequences in the 3' LTR are removed.

[0172] The packaging sequence Ψ (psi) may also be incorporated into the vector particle to assist in the capsid formation of the polynucleotide sequence (Kessler et al., 2007, Leukemia, 21(9): pp. 1859-74; Paschen et al., 2004, Cancer Immunol Immunother 12(6): pp. 196-203). In one embodiment, the present disclosure encompasses a lentiviral vector comprising the lentiviral packaging sequence Ψ (psi).

[0173] Further additional functional sequences, such as transport RNA binding sites or primer binding sites (PBS) or woodchuck post-transcriptional regulatory elements (WPREs), may be advantageously included in the lentiviral vector polynucleotide sequences of this disclosure to obtain more stable expression of the transgene in vivo. In some embodiments, this disclosure encompasses lentiviral vectors comprising PBS. In some embodiments, this disclosure encompasses lentiviral vectors comprising WPREs and / or IRESs.

[0174] Therefore, in a preferred embodiment, the lentiviral vector comprises an expression cassette containing at least one cPPT / CTS sequence, one Ψ sequence, one (preferably two) LTR sequences, and the transgene under transcriptional control of a β2ηη or class I MHC promoter.

[0175] In some embodiments of the present disclosure, the vector of the present disclosure (i.e., recombinant gene transfer vector) is an expression vector comprising appropriate means for the expression of a target fusion protein in a host cell.

[0176] Various promoters can be used to drive the high expression of nucleic acid sequences encoding target fusion proteins. Promoters may be tissue-specific promoters, ubiquitous promoters, homeostatic or inducible promoters. Preferred promoters are particularly functional in T cells and / or NK cells, preferably human T cells and human NK cells. In particular, preferred promoters can drive the high expression of target fusion proteins (in particular, previously defined CARs) from lenti vectors in T cells or NK cells, preferably human T cells or NK T cells. For example, promoters according to this disclosure may be selected from phosphoglycerate kinase promoters (PGK), spleen focus-forming virus (SFFV) promoters, elongation factor-1 alpha (EF-1 alpha) promoters including truncated forms of the promoter (EFS), viral promoters such as cytomegalovirus (CMV) pre-early enhancer and promoter, retroviral 5' and 3' LTR promoters including hybrid LTR promoters, human ubiquitin promoters, MHC class I promoters, MHC class II promoters, and β2 microglobulin (β2ηη) promoters. The promoter is advantageously a human promoter, i.e., a promoter derived from human cells or a human virus such as spleen focus-forming virus (SFFV). Human ubiquitin promoters, MHC class I promoters, MHC class II promoters, and β2 microglobulin (β2ηη) promoters are particularly preferred. Preferably, the MHC class I promoter is an HLA-A2 promoter, HLA-B7 promoter, HLA-Cw5 promoter, HLA-F, or HLA-E promoter. In some embodiments, the promoter is not a CMV promoter / enhancer, or not a dectin-2 or MHCII promoter. Such promoters are well known in the art, and their sequences are available in sequence databases.

[0177] Typically, a lentiviral particle refers to the extracellular infection form of a virus, consisting of genetic material made of either DNA or RNA (most preferably single-stranded RNA), surrounded by a protein coat called a capsid and, in some cases, a lipid envelope surrounding the capsid. Therefore, a lentiviral vector particle (or lentiviral particle) includes a lentiviral vector, as previously defined in relation to viral proteins. The vector is preferably an embedded vector.

[0178] The RNA sequence of lentiviral particles can be obtained by transcription from a double-stranded DNA sequence inserted into the host cell genome (proviral vector DNA), or by transient expression of plasmid DNA (plasmid vector DNA) in transformed host cells. Suitable methods for designing and preparing lentiviral particles, particularly for therapeutic purposes, are well known in the art, for example, as described in Merten OW, Hebben M, and Bovolenta C. Production of lentiviral vectors. Mol Ther Methods Clin Dev. 2016 Apr 13;3:16017.

[0179] Preferably, the lentiviral particle has the ability to be incorporated. Therefore, the lentiviral particle contains a functional integrase protein. The non-incorporated vector particle has one or more mutations that eliminate most or all of the lentiviral vector particle's ability to be incorporated. For example, the non-incorporated vector particle may contain a mutation in the integrase encoded by the lentiviral pol gene that causes a decrease in its ability to be incorporated. In contrast, the incorporated vector particle contains a functional integrase protein that does not contain any mutations that eliminate most or all of the lentiviral vector particle's ability to be incorporated.

[0180] In some embodiments, this disclosure is, (a) Nucleic acid containing a nucleic acid sequence that encodes a previously defined chimeric antigen receptor A vector system comprising one or more vectors, wherein nucleic acids (a) and (b) are located in the same or separate vectors is included.

[0181] Preferred nucleic acids are those described in the previous section.

[0182] When the vector system comprises more than one vector, typically two or more vectors, the vectors are typically of the same type (e.g., lentiviral vector). In the following sections, a vector may also be intended as "one or more vectors" or "vector system". Preferably, the present disclosure includes lentiviral vector systems and particularly lentiviral particle systems.

[0183] According to the present disclosure, the vector may be an expression vector. The vector may be a plasmid vector.

[0184] Thus, in one embodiment, the present disclosure includes a vector comprising a nucleic acid encoding a CAR protein as previously defined, and particularly an expression vector, most preferably a lentiviral vector.

[0185] The present disclosure also includes a viral particle system in which one or more viral particles comprise a viral vector, typically an integrating viral vector, as previously defined. Preferably, the viral vector is a lentiviral vector and the viral particle is a lentiviral particle.

[0186] This disclosure also provides host cells containing the nucleic acid constructs disclosed herein, in particular the recombinant expression cassettes or recombinant vectors disclosed herein. The host cells are either prokaryotic or eukaryotic host cells. The term “host cell” means a cell into which an exogenous nucleic acid has been introduced, including the offspring of such a cell. Host cells include “transformers” and “transformed cells,” and include primary transformed cells and their offspring regardless of passage number. Offspring may contain mutations, but their nucleic acid content may not be exactly the same as that of the parent cells. Mutant offspring having the same function or biological activity as those screened or selected from the initially transformed cells are included herein.

[0187] This disclosure also relates to a method for producing a polypeptide consisting of or containing a previously defined single-domain antibody or CAR in a host cell as defined above, - A step of providing host cells containing a nucleic acid construct, recombinant expression cassette, or recombinant vector according to this disclosure, - A step of culturing the host cells, - A step of optionally purifying the single-domain antibody or CAR of this disclosure. The method including the above is also provided.

[0188] Methods for purifying polypeptides, such as chromatography (e.g., ion exchange chromatography, gel permeation chromatography, and reversed-phase chromatography), are well known in the art.

[0189] This disclosure also includes compositions comprising the nucleic acid constructs disclosed herein.

[0190] Immune cells and methods for obtaining them The disclosure also provides isolated cells, populations of cells, cell lines, or cell cultures comprising the aforementioned nucleic acid constructs, particularly vectors, and more specifically, viral vector particles encoding at least one or more of the aforementioned CARs.

[0191] In one embodiment, the cell contains a vector and / or viral vector particles integrated into the cell genome. In one embodiment, the cell contains a vector that stably expresses CAR. In one embodiment, the cell produces lentiviral vector particles encoding CAR.

[0192] The cells are preferably mammalian cells, particularly human cells. Human non-dividing cells are especially preferred. Preferably, the cells are immune cells. As used herein, the term “immune cells” includes cells of hematopoietic origin that play a role in the immune response. Examples of immune cells include lymphocytes such as B cells and T cells, natural killer cells (NK cells), monocytes, macrophages, eosinophils, mast cells, basophils, and granulocytes.

[0193] As used herein, the term “T cell” includes cells having a T cell receptor (TCR), and the T cells according to this disclosure may be selected from the group consisting of inflammatory T lymphocytes, cytotoxic T lymphocytes, regulatory T lymphocytes, mucosa-associated invariant T cells (MAITs), Υδ T cells, tumor-infiltrating lymphocytes (TILs), or helper T lymphocytes, including both type 1 and type 2 helper T cells and Th17 helper cells. In another embodiment, the cells may be derived from the group consisting of CD4+ T lymphocytes and CD8+ T lymphocytes.

[0194] The immune cells may be derived from a healthy donor or a subject suffering from cancer.

[0195] Immune cells may be extracted from blood or derived from stem cells. Stem cells may be adult stem cells, embryonic stem cells, more specifically non-human stem cells, umbilical cord blood stem cells, progenitor cells, bone marrow stem cells, induced pluripotent stem cells, totipotent stem cells, or hematopoietic stem cells. A typical human cell is the CD34+ cell.

[0196] T cells can be obtained from a number of non-limiting sources, including peripheral blood mononuclear cells, bone marrow, lymph node tissue, umbilical cord blood, thymic tissue, tissue from the site of infection, ascites, pleural fluid, splenic tissue, and tumors. In certain embodiments, T cells can be obtained from units of blood collected from a subject using any number of techniques known to those skilled in the art, such as FICOLL® isolation. In one embodiment, cells derived from the circulating blood of a subject are obtained by apheresis. In certain embodiments, T cells are isolated from PBMCs. PBMCs may be isolated from a buffy coat obtained by density gradient centrifugation of leukocytes, e.g., LYMPHOPREP® gradient, PERCOLL® gradient, or FICOLL® gradient. T cells may be isolated from PBMCs by monocyte depletion using, for example, CD14 DYNABEADS®. In some embodiments, erythrocytes may be lysed before density gradient centrifugation.

[0197] In another embodiment, the cells may be derived from a healthy donor, specifically from a subject diagnosed with cancer, particularly Ewing's sarcoma. The cells may be autologous or allogeneic.

[0198] In allogeneic immunotherapy, immune cells are harvested from a healthy donor rather than the patient. Typically, these are HLA-matched to reduce the likelihood of graft-versus-host disease. Alternatively, common "off-the-shelf" products that do not require HLA matching include modifications designed to reduce graft-versus-host disease, such as the destruction or removal of the TCRαβ receptor. See Graham et al., Cells. 2018 Oct;7(10):155 for a review. Because a single gene encodes the alpha chain (TRAC) rather than the two genes encoding the beta chain, the TRAC locus is a typical target for the removal or destruction of TCRαβ receptor expression. Alternatively, repressors of TCRαβ signaling may be expressed; for example, cleaved CD3ζ can act as a TCR repressor. Destruction or removal of HLA class I molecules has also been used. For example, Torikai et al., Blood. 2013;122:1341-1349, used ZFN to knock out the HLA-A locus, while Ren et al., Clin. Cancer Res. 2017;23:2255-2266, knocked out beta-2 microglobulin (B2M), which is required for HLA class I expression. Ren et al. simultaneously knocked out TCRαβ, B2M, and the immune checkpoint PD1. Generally, immune cells are activated and enlarged for use in adoptive cell therapy. The immune cells disclosed herein can be enlarged in vivo or ex vivo. Immune cells, particularly T cells, can generally be activated and enlarged using methods known in the art. Generally, T cells are enlarged by contact with a surface bound to a drug that stimulates CD3 / TCR complex-related signaling and a ligand that stimulates a costimulatory molecule on the T cell surface.

[0199] Typically, immune cells are modified to express the chimeric antigen receptors disclosed herein. Expression of multiple tumor-specific targets may reduce the opportunity for antigen evasion by mutating or reducing the expression of target antigens. As stated above, the CARs of this disclosure may be multispecific CARs (i.e., for more than one antigen to FGFR4 and for at least one other antigen). Furthermore, or or otherwise, the immune cells described herein may express one or more CARs as defined herein, and at least one other CAR targeting one or more other antigens.

[0200] Methods for genetically modifying immune cells to express recombinant antigen receptors are well known in the art. Nucleic acid molecules encoding antigen receptors can be introduced into cells in the form of, for example, vectors or any other suitable nucleic acid constructs. Vectors and their required components are well known in the art. Nucleic acid molecules encoding antigen receptors can be generated using any method known in the art, such as molecular cloning using PCR. Antigen receptor sequences can be modified using commonly used methods, such as site-directed mutagenesis.

[0201] In another aspect, the disclosure relates to an ex vivo method for generating a population of cells for use in adoptive immunotherapy, comprising the step of transforming cells with CAR as described herein.

[0202] Compositions and kits disclosed herein This disclosure also encompasses pharmaceutical compositions comprising one or more isolated cells or cell populations comprising one or more anti-FGFR4 monodomain antibodies, CARs, nucleic acid constructs encoding them, and / or CARs disclosed herein, either alone or in combination with at least one other agent such as a stabilizing compound, the pharmaceutical compositions may be administered on any sterile biocompatible pharmaceutical carrier and may optionally be formulated with sterile pharmaceutically acceptable buffers, diluents, and / or excipients. Pharmaceutically acceptable carriers can typically be used to enhance or stabilize the composition and / or to facilitate the preparation of the composition. Examples of pharmaceutically acceptable carriers include physiologically compatible, and in some embodiments, pharmaceutically inert solvents, dispersions, coatings, antimicrobial and antifungal agents, isotonic agents, and absorption retarders. In some embodiments, the pharmaceutical compositions according to this disclosure comprise the anti-FGFR4 monodomain antibody disclosed herein, linked to a previously disclosed drug nanocarrier. Typically, the drug nanocarrier functionalized with the anti-FGFR4 sdAb disclosed herein is encapsulated in a therapeutic (such as a cytotoxic compound) or diagnostic compound. In certain embodiments, the drug nanocarrier is a liposome.

[0203] The pharmaceutical compositions containing sdAb disclosed herein can be administered orally or parenterally. Methods of parenteral delivery include topical, intra-arterial (directly into the tumor), intramuscular, spinal, subcutaneous, intramedullary, intrathecal, intraventricular, intravenous, intraperitoneal, or intranasal administration.

[0204] The gene-modified cells or pharmaceutical compositions of this disclosure may be administered by any convenient route, including parenteral administration. Parenteral administration may include, for example, intravenous, intramuscular, intra-arterial, intraperitoneal, intranasal, rectal, intravesical, intradermal, topical, or subcutaneous administration. The compositions may take the form of one or more dose units.

[0205] Therefore, in addition to the active ingredient, these pharmaceutical compositions may contain a suitable pharmaceutically acceptable carrier, including excipients and adjuvants that facilitate the processing of the active compound into a pharmaceutically usable preparation. Further details regarding formulation and administration methods can be found in the latest edition of Remington's Pharmaceutical Sciences (Ed. Maack Publishing Co., Easton, Pa.).

[0206] Depending on the route of administration, a single-domain antibody or its variant may be coated in a material that protects the compound from the action of acids that can inactivate the compound and from other natural conditions.

[0207] The composition is typically sterile and preferably fluid. Appropriate fluidity can be maintained, for example, by the use of a coating agent such as lecithin, by maintaining the required particle size in the case of a dispersion, and by the use of a surfactant. In many cases, it is preferable to include isotonic agents, such as sugars, polyhydric alcohols such as mannitol or sorbitol, and sodium chloride in the composition. Long-term absorption of the injectable composition can be achieved by including absorption-delaying agents, such as aluminum monostearate or gelatin, in the composition.

[0208] Pharmaceutical compositions for oral administration can be formulated using pharmaceutically acceptable carriers well known in the art in doses suitable for oral administration. Such carriers enable the formulation of pharmaceutical compositions as tablets, pills, sugar-coated tablets, capsules, liquids, gels, syrups, slurries, suspensions, etc., for ingestion by patients.

[0209] Oral pharmaceutical preparations can be obtained by combining an active compound with a solid excipient, optionally grinding the resulting mixture, adding suitable adjuvants if desired, and then processing the granular mixture to obtain a tablet or sugar-coated tablet core. Suitable excipients include carbohydrate or protein fillers, such as sugars containing lactose, sucrose, mannitol, or sorbitol; starches derived from corn, wheat, rice, potato, or other plants; celluloses such as methylcellulose, hydroxypropyl methylcellulose, or sodium carboxymethylcellulose; gums containing gum arabic and tragacanth; and proteins such as gelatin and collagen. If desired, disintegrants or solubilizers, such as cross-linked polyvinylpyrrolidone, agar, alginic acid, or salts thereof, may be added.

[0210] The sugar-coated tablet core is provided with a concentrated sugar solution, lacquer solution, and a suitable organic solvent or solvent mixture, which also contains a suitable coating agent, such as gum arabic, talc, polyvinylpyrrolidone, Carbopol gel, polyethylene glycol, and / or titanium dioxide. Dyes or pigments may be added to the tablet or sugar-coated tablet coating for product identification or to characterize the amount of the active compound, i.e., the dosage.

[0211] Pharmaceutical preparations that can be used orally include push-fit capsules made of gelatin, and soft-seal capsules made of gelatin and a coating agent such as glycerol or sorbitol. Push-fit capsules may contain an active ingredient mixed with a filler or binder, such as lactose or starch, a lubricant, such as talc or magnesium stearate, and optionally a stabilizer. In soft capsules, the active compound may be dissolved or suspended in a suitable liquid such as fatty oil, liquid paraffin, or liquid polyethylene glycol with or without a stabilizer.

[0212] Pharmaceutical formulations for parenteral administration contain an aqueous solution of the active compound. For injection, the pharmaceutical compositions of this disclosure may be formulated in an aqueous solution, preferably a physiologically compatible buffer, such as Hanks' solution, Ringer's solution, or physiological buffered saline. The aqueous injection suspension may contain a substance that increases the viscosity of the suspension, such as sodium carboxymethylcellulose, sorbitol, or dextran. Furthermore, the suspension of the active compound may be prepared as a suitable oily injection suspension. Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, synthetic fatty acid esters such as ethyl oleate or triglycerides, or liposomes. Optionally, the suspension may also contain a suitable stabilizer or an agent that increases the solubility of the compound, enabling the preparation of high-concentration solutions.

[0213] For topical or nasal administration, a penetrating agent suitable for the specific barrier to be penetrated is used in the formulation. Such penetrating agents are generally known in the art.

[0214] The pharmaceutical compositions described herein can be prepared according to methods well known and routinely practiced in the art. See, for example, Remington: The Science and Practice of Pharmacy, Mack Publishing Co., 20th edition, 2000; and Sustained and Controlled Release Drug Delivery Systems, edited by J. R. Robinson, Marcel Dekker, Inc., New York, 1978. The pharmaceutical compositions are preferably manufactured under GMP conditions.

[0215] The amount of the pharmaceutical composition of this disclosure that is effective / active in treating a particular disorder or condition depends on the nature of the disorder or condition and can be determined by standard clinical methods. Furthermore, in vitro or in vivo assays may be optionally used to help identify the optimal dosage range. The exact dose to be used in the composition also depends on the route of administration and the severity of the disease or disorder and should be determined according to the judgment of the practicing physician and the circumstances of each patient.

[0216] The compositions disclosed herein contain an effective amount of the binding molecule (e.g., a single-domain antibody or its variant or a chimeric antigen receptor) to obtain an appropriate dose. The correct dose of the compound will vary depending on the specific formulation, method of application, and the specific site, host, and disease being treated. Other factors such as age, weight, sex, diet, timing of administration, elimination rate, host condition, drug combination, response sensitivity, and disease severity will be taken into consideration. Administration may be carried out continuously or periodically within the maximum tolerated dose.

[0217] Typically, this amount is at least about 0.01% by mass of the binding molecule of the present disclosure in the composition. Preferred compositions of the present disclosure are prepared such that parenteral administration units contain about 0.01% to about 2% by mass of the binding molecule of the present disclosure.

[0218] With regard to intravenous administration, the composition may typically contain about 0.1 mg / kg to about 250 mg / kg of the animal's body weight, preferably about 0.1 mg / kg to about 20 mg / kg of the animal's body weight, and more preferably about 1 mg / kg to about 10 mg / kg of the animal's body weight.

[0219] This composition may take the form of a suitable carrier, such as an aerosol, spray, or suspension, or any other form suitable for use. Other examples of suitable pharmaceutical carriers are described in "Remington's Pharmaceutical Sciences" by E.W. Martin.

[0220] The pharmaceutical compositions disclosed herein can be administered concurrently with other therapeutic agents, such as anticancer agents.

[0221] medical use This disclosure also relates to anti-FGFR4 single-domain antibodies or variants thereof as described herein, CARs or variants against FGFR4 as described herein, nucleic acids encoding the anti-FGFR4 single-domain antibodies or CARs, or cells, lines, or cell populations containing the CARs as described herein, for use in therapeutic use, particularly in the treatment of cancer. This disclosure also relates to anti-FGFR4 single-domain antibodies or variants thereof as described herein, CARs or variants against FGFR4 as described herein, nucleic acids encoding the anti-FGFR4 single-domain antibodies or CARs, or cells, lines, or cell populations containing the CARs as described herein, in the manufacture of pharmaceuticals (particularly for the treatment of cancer).

[0222] The Disclosure also includes a method for the prevention and / or treatment of cancer, comprising the step of administering to a subject, a CAR or variant against FGFR4 as described herein, a nucleic acid encoding the anti-FGFR4 monodomain antibody or CAR, or cells, a line or cell population containing the CAR as described herein, the method further comprising the step of administering to a subject in need thereof a pharmaceutically active amount of the anti-FGFR4 monodomain antibody or variant thereof, the CAR, cells, a line or cell population containing the CAR as described herein, and / or a pharmaceutical composition of the Disclosure. The method may further include the step of identifying a subject having cancer.

[0223] The Disclosure also includes the use of one or more of the following in targeted immunotherapy: an anti-FGFR4 single-domain antibody or variant thereof, a CAR or variant thereof against FGFR4, a nucleic acid encoding the anti-FGFR4 single-domain antibody or CAR, or a cell line or cell population containing the CAR described herein. For example, the sdAb and in particular its variants in the form of a multispecific polypeptide may further target immune cell antigens, and CARs expressing immune cells (particularly CAR T cells) may be used in immune cell redirection immunotherapy.

[0224] In another aspect, the present disclosure relates to a method for stimulating a T cell-mediated immune response against a target cell population or tissue in a subject, the method comprising administering to the subject an effective amount of cells or cell population expressing a CAR for FGFR4 as described herein.

[0225] In another aspect, the present disclosure relates to a method for inducing antitumor immunity in a subject, comprising the steps of administering an effective amount of cells or a population of cells genetically modified to express a CAR for FGFR4 as described herein to a mammal, thereby inducing antitumor immunity in the subject.

[0226] This disclosure also relates to an anti-FGFR4 single-domain antibody (including its variants), a CAR against FGFR4 as described herein, or a nucleic acid construct encoding the humanized anti-FGFR4 SdAb or CAR, or to immune cells expressing the previously defined CAR, for use in adoptive cell or CAR-T cell therapy in a subject. Typically, the immune cells for use in the methods of this disclosure are redirected T cells, e.g., redirected CD8+ and / or CD4+ T cells.

[0227] In some embodiments, anti-FGFR4 monodomain antibodies (including variants thereof), CARs against FGFR4 as described herein, and nucleic acid constructs encoding such CARs, as well as cells containing such CARs, are useful for inhibiting tumor growth, inducing differentiation, reducing tumor volume, and / or reducing tumor oncogenicity. The method of use may be in vitro, ex vivo, or in vivo.

[0228] In certain embodiments of the medical use described herein, the anti-FGFR4 sdAb is ligated to a drug nanocarrier, such as a liposome, as described above. The drug nanocarrier, in particular such as a liposome, functionalized with one or more anti-FGFR4 sdAbs described herein typically encapsulates a therapeutic compound (such as a cytotoxic compound) or a diagnostic compound.

[0229] In certain embodiments, the subjects are human patients, particularly pediatric patients. In certain embodiments, the subjects have tumors or have had tumors removed. The subjects may also be at risk of developing cancer.

[0230] Cancer can be a solid tumor or a liquid tumor. Cancers that can be treated by the methods, uses and compositions described herein include, but are not limited to, cancer cells originating from the bladder, blood, bone, bone marrow, brain, breast, colon, esophagus, gastrointestinal tract, gingiva, head, kidney, liver, lung, nasopharynx, neck, ovary, prostate, skin, stomach, testis, tongue, or uterus. Furthermore, cancer can specifically be, but is not limited to, the following histological types: neoplasm, malignant; carcinoma; carcinoma, undifferentiated; giant spindle cell carcinoma. Carcinoma; small cell carcinoma; papillary carcinoma; squamous cell carcinoma; lymphoepithelial carcinoma; basal cell carcinoma; calcifying epithelial carcinoma; transitional cell carcinoma; papillary transitional cell carcinoma; adenocarcinoma; gastrinoma, malignant; cholangiocarcinoma; hepatocellular carcinoma; mixed hepatocellular carcinoma and cholangiocarcinoma; cord-like adenocarcinoma; adenoid cystic carcinoma; adenocarcinoma of adenomatous polyps; adenocarcinoma, familial adenomatous polyposis; solid tumors; carcinoid tumors, malignant; bronchiolar-alveolar adenocarcinoma; papillary adenocarcinoma; pigmentophilic carcinoma; eosinophilic carcinoma; eosinophilic adenoma; basophilic carcinoma; clear cell adenocarcinoma; granular cell carcinoma; follicular adenocarcinoma; papillary and follicular adenocarcinoma; non-encapsulated sclerosing carcinoma; adrenocortical carcinoma; Serous cystadenocarcinoma; mucinous cystadenocarcinoma; mucinous adenocarcinoma; signet ring cell carcinoma; invasive ductal carcinoma; medullary carcinoma; lobular carcinoma; inflammatory carcinoma; Paget's disease, breast; acinar cell carcinoma; adenosquamous carcinoma; adenocarcinoma with squamous metaplasia; thymoma, malignant; ovarian stroma malignant tumors; malignant theca cell tumors; malignant granulosa cell tumors; and malignant olfactory neuroblastomas; Sertoli cell carcinoma; malignant Leydig cell tumors; malignant lipid cell tumors; malignant paragangliomas; malignant extramammary paragangliomas; pheochromocytoma; angioglobular angiosarcoma; malignant melanoma; achromatic malignant melanoma; superficial spreading melanoma; malignant melanoma of giant pigmented nevi; epithelioid cell malignant melanoma; malignant blue nevi; sarcoma; fibrosarcoma; malignant fibrous histiocytoma; myxosarcoma; liposarcoma Leiomyosarcoma; Rhabdomyosarcoma (RMS); Embryonic rhabdomyosarcoma; Alveolar rhabdomyosarcoma; Stromal sarcoma; Mixed tumor, malignant; Müllerian duct mixed tumor; Nephroblastoma; Hepatoblastoma; Carcinosarcoma; Mesenchymal tumor, malignant; Brenner tumor, malignant; Phyllodes tumor, malignant; Synovial sarcoma; Mesothelioma, malignant; Undifferentiated germ cell tumor; Embryonic carcinoma; Teratoma, malignant; Ovarian goiter, malignant; Choriocarcinoma; Mesonephroma, malignant; Angiosarcoma; Hemangioendothelioma, malignant; Kaposi's sarcoma; Hemangioexocytoma, malignant; Lymphangiosarcoma; Osteosarcoma;Paraospheric osteosarcoma; chondrosarcoma; chondroblastoma, malignant; mesenchymal chondrosarcoma; giant cell tumor of bone; Ewing's sarcoma; odontogenic tumor, malignant; ameloblastoma; ameloblastoma, malignant; ameloblastoma; pineal glandoma, malignant; chordoma; glioma, malignant; ependymoma; astrocytoma; protoplasmic astrocytoma; fibrous astrocytoma; astroblastoma; glioblastoma; oligodendroglioma; oligodendroblastoma; primitive neuroectodermal; cerebellar sarcoma; ganglioblastoma; neuroblastoma; retinoblastoma; olfactory neurotum; meningioma, malignant; neurofibrosarcoma; schwannoma, malignant; granular cell tumor Scars, malignant; malignant lymphoma; Hodgkin's disease; Hodgkin's lymphoma; lateral granuloma; small lymphocytic lymphoma; large cell lymphoma, diffuse; follicular lymphoma; mycosis fungoides; other designated non-Hodgkin lymphomas; malignant histiocytosis; multiple myeloma; mast cell sarcoma; immunoproliferative bowel disease; leukemia; lymphocytic leukemia; plasma cell leukemia; erythroleukemia; lymphosarcoma cell leukemia; myeloid leukemia; basophilic leukemia; eosinophilic leukemia; monocytic leukemia; mast cell leukemia; megakaryoblastic leukemia; myelosarcoma; and hairy cell leukemia.

[0231] More specific cancers that can be treated and / or prevented by this disclosure include FGFR4-mediated cancers. Typically, FGFR4-mediated cancers are cancers in which FGFR4 is expressed or overexpressed. Typical cancers in which FGFR4 is expressed and / or overexpressed include hepatocellular carcinoma (HCC), breast cancer, oropharyngeal squamous cell carcinoma, oral squamous cell carcinoma, pancreatic cancer and derived cell lines, and rhabdomyosarcoma (RMS).

[0232] In some embodiments, the cancer treatments and / or adoptive cell carcinoma therapies described above are administered in combination with additional cancer treatments. In some embodiments, the cancer treatments and / or adoptive cell carcinoma therapies described above are administered in combination with targeted therapies, immunotherapies, such as immune checkpoint therapy and immune checkpoint inhibitors, costimulatory antibodies, chemotherapy and / or radiotherapy.

[0233] Examples of immune checkpoint therapies, such as checkpoint inhibitors, include, but are not limited to, programmed death 1 (PD-1) inhibitors, programmed death ligand 1 (PD-L1) inhibitors, programmed death ligand 2 (PD-L2) inhibitors, lymphocyte activation gene 3 (LAG3) inhibitors, T cell immunoglobulin and mucin domain-containing protein 3 (TIM-3) inhibitors, T cell immune receptor (TIGIT) inhibitors containing Ig and ITIM domains, B and T lymphocyte attenuators (BTLA) inhibitors, T cell activation V domain Ig suppressor (VISTA) inhibitors, cytotoxic T lymphocyte-associated protein 4 (CTLA4) inhibitors, indoleamine 2,3-dioxygenase (IDO) inhibitors, killer immunoglobulin-like receptor (KIR) inhibitors, KIR2L3 inhibitors, KIR3DL2 inhibitors, and carcinoembryonic antigen-associated cell adhesion molecule 1 (CEACAM-1) inhibitors. In particular, checkpoint inhibitors include antibodies against PD1, PD-L1, CTLA-4, TIM-3, and LAG3. Co-stimulatory antibodies deliver positive signals through immunomodulatory receptors, including but not limited to ICOS, CD137, CD27, OX-40, and GITR.

[0234] Examples of anti-PD1 antibodies include nivolumab, semiprimab (REGN2810 or REGN-2810), tislerizumab (BGB-A317), tislerizumab, spartalizumab (PDR001 or PDR-001), ABBV-181, JNJ-63723283, and BI. Examples of antibodies include, but are not limited to, 754091, MAG012, TSR-042, AGEN2034, pidilizumab, nivolumab (ONO-4538, BMS-936558, MDX1106, GTPL7335, or Opdivo), pembrolizumab (MK-3475, MK03475, lambrolizumab, SCH-900475, or Keytruda), and antibodies described in international patent applications WO2004004771, WO2004056875, WO2006121168, WO2008156712, WO2009014708, WO2009114335, WO2013043569, and WO2014047350.

[0235] Examples of anti-PD-L1 antibodies include, but are not limited to, LY3300054, atezolizumab, durvalumab, and avelumab.

[0236] Examples of anti-CTLA-4 antibodies include, but are not limited to, ipilimumab (see, e.g., U.S. Patents US6,984,720 and US8,017,114), tremelimumab (see, e.g., U.S. Patents US7,109,003 and US8,143,379), single-chain anti-CTLA4 antibodies (see, e.g., International Patent Applications WO1997020574 and WO2007123737), and the antibodies described in U.S. Patent US8,491,895.

[0237] An example of an anti-VISTA antibody is described in U.S. Patent Application US20130177557.

[0238] An example of an inhibitor of the LAG3 receptor is described in U.S. Patent US5,773,578.

[0239] An example of a KIR inhibitor is IPH4102-targeted KIR3DL2.

[0240] As used herein, the term “chemotherapy” has its general meaning in the art and refers to a procedure consisting of administering chemotherapeutic agents to a patient. As used herein, a chemotherapeutic entity refers to an entity that is destructive to cells, i.e., an entity that reduces the viability of cells. A chemotherapeutic entity may be a cytotoxic drug. Examples of chemotherapeutic agents include alkylating agents, e.g., thiotepa and cyclophosphamide; alkyl sulfonates, e.g., busulfan, improsulfan and piposulfan; aziridines, e.g., benzodopa, carbocon, meturedopa, and uredopa; ethyleneimines and methylamelamines, including altoretamine, triethylenemelamine, triethylenethiophosphoramide, trimethylolmelamine; acetogenins (especially bratacin and bratacinone); and camptothecin (synthetic analogue to topotecan). Including); bryostatin; calistatin; CC-1065 (including its synthetic analogues adzelesin, carzelsin and biceresin); cryptophycin (especially cryptophycin 1 and cryptophycin 8); dorastatin; duocalmycin (including synthetic analogues, KW-2189 and CB1-TM1); eryuterobin; pancratistatin; sarcodictiin; spongstatin; nitrogen mustard, e.g., chlorambucil, chlornafadin, cholophosphamide, estramustine, ifosfamide, mechloretamine, mechloretamine oxide hydrochloride. (oxide hydrochloride), melphalan, nobembichin, fenestrine, prednimustine, trophosphamide, uracil mustard; nitrosourea, e.g., carmustine, chlorozotocin, photemustine, lomustine, nimustine, and ranimustine; antibiotics, e.g., engine antibiotics (e.g., calicheamicin, especially calicheamicin gamma II and calicheamicin omega II; dynemicin including dynemicin A; bisphosphonates, e.g., clodronate; esperamicin;Furthermore, neocardinostatin chromophore and related pigment protein enediin antibiotic chromophore, acrasinomycin, actinomycin, anthramycin, azaserin, bleomycin, kactinomycin, carabicin, caminomycin, cardinophilin, chromomycin, dactinomycin, daunorubicin, detorubicin, 6-diazo-5-oxo-L-norleucine, doxorubicin (including morpholino-doxorubicin, cyanomorpholino-doxorubicin, 2-pyrrolino-doxorubicin and deoxydoxorubicin), epirubicin, esorubicin, idarubicin, marcelomycin, mitomycin, e.g., mitomycin C, mycophenolic acid, nogaramycin, olibomycin, peplomycin, potophyllomycin, puromycin, que Lamycin, rhodorubicin, streptonigrin, streptozocin, tubercidine, ubenimex, dinostatin, zolubicin; antimetabolites, e.g., methotrexate and 5-fluorouracil (5-FU); folate analogs, e.g., denopterin, methotrexate, pteropterin, trimethrexate; purine analogs, e.g., fludarabine, 6-mercaptopurine, thiamiprine, thioguanine; pyrimidine analogs Body, e.g., ancitabine, azacitidine, 6-azauridine, carmofur, cytarabine, dideoxyuridine, doxifluridine, enocitabine, phloxuridine; androgens, e.g., carsterone, dromostanolone propionate, epithiostanol, mepitiostane, testolactone; anti-adrenal drugs, e.g., aminoglutethimide, mitotane, trilostane; folic acid supplements, e.g., frolinic acid acid); acegraton; aldofamide glycoside; aminolevulinic acid; enyluracil; amsacrin; bestrabusil; bisanthren; edatrexate; defofamine; demecoltin; diazicone; elformithine; eriptinium acetate; epotilon; etogluside; gallium nitrate; hydroxyurea; lentinan; ronidamine; mytansinoids, e.g., mytansine and anthamitosine; mitogwazone; mitoxantrone; mopidanmol;Nitraerine; pentostatin; fenamet; pirarubicin; losoxantrone; podophyllic acid; 2-ethylhydrazide; methylhydrazine derivatives including N-methylhydrazine (MIH) and procarbazine; PSK polysaccharide complex; razoxane; lyzoxin; sizofuran; spirogermanium; tenuazonic acid; triadicone; 2,2',2"-trichlorotriethylamine Trichothecenes (especially T-2 toxin, beraclin A, loridine A and anguidin); urethanes; vindesine; dacarbazine; mannomustine; mitobronitol; mitractol; pipobromane; gacytosine; arabinoside ("Ara-C"); cyclophosphamide; thiotepa; taxoids, e.g., paclitaxel and docetaxel; chlorambucil; gemcitabine; 6-thioguanine; mercapto Purines; methotrexate; platinum-coordinated complexes, e.g., cisplatin, oxaliplatin, and carboplatin; vinblastine; platinum; etoposide (VP-16); ifosfamide; mitoxantrone; vincristine; vinorelbine; novantrone; teniposide; edatrexate; daunomycin; aminopterin; xeloda; ibandronate; irinotecan (e.g., CPT-11); topoisomerase inhibitor RFS200 0; Difluoromethylornithine (DMFO); Retinoids, e.g., retinoic acid; Capecitabine; Anthracyclines, nitrosoureas, antimetabolites, epipodophyllotoxin, enzymes, e.g., L-asparaginase; Anthracendions; Adrenocortical steroid antagonists, e.g., prednisone and equivalents, dexamethasone and aminoglutethimide, and other hormones and antagonists. Progestins, e.g., hydroxyprogesterone caproate, medroxyprogesterone acetate, and megestrol acetate; estrogens, e.g., diethylstilbestrol, and ethinylestradiol equivalents; antiestrogens, e.g., tamoxifen; androgens, including testosterone propionate and fluoxymesterone / equivalents; antiandrogens, e.g., flutamide, gonadotropin-releasing hormone analogs, and leuprolide; and nonsteroidal antiandrogens, e.g., flutamide;Examples include, but are not limited to, biological response modifiers such as IFNa, IL-2, G-CSF, and GM-CSF; and pharmaceutically acceptable salts, acids, or derivatives of any of the above.

[0241] Appropriate examples of radiotherapy include, but are not limited to, external beam radiation therapy (e.g., surface X-ray therapy, conventional voltage X-ray therapy, ultra-high voltage X-ray therapy, radiosurgery, stereotactic radiotherapy, fractionated stereotactic radiotherapy, cobalt beam therapy, electron beam therapy, fast neutron therapy, neutron capture therapy, proton beam therapy, intensity-modulated radiation therapy (IMRT), three-dimensional conformal radiation therapy (3D-CRT), etc.); brachytherapy; unsealed source radiation therapy; tomotherapy, etc. Gamma rays are another form of photon used in radiotherapy. Gamma rays are naturally produced when certain elements (such as radium, uranium, and cobalt-60) decompose or decay and emit radiation. In some embodiments, radiotherapy may be proton radiation therapy or proton minibeam radiation therapy. Proton radiotherapy is an ultra-precision form of radiotherapy that uses proton beams (Prezado Y, Jouvion G, Guardiola C, Gonzalez W, Juchaux M, Bergs J, Nauraye C, Labiod D, De Marzi L, Pouzoulet F, Patriarca A, Dendale R. Tumor Control in RG2 Glioma-Bearing Rats:A Comparison Between Proton Minibeam Therapy and Standard Proton Therapy Int J Radiat Oncol Biol Phys. 2019 / 06 / 1;104(2):266~271. doi:10.1016 / j.ijrobp.2019.01.080;Prezado Y, Jouvion G, Patriarca A, Nauraye C, Guardiola C, Juchaux M, Lamirault C, Labiod D, Jourdain L, Sebrie C, Dendale R, Gonzalez. W, Pouzoulet F. Proton minibeam radiation therapy widens the therapeutic index for high-grade gliomas. Sci Rep. November 7, 2018; 8(1): 16479. doi: 10.1038 / s41598-018-34796-8).Radiation therapy may be FLASH® radiation therapy (FLASH-RT) or FLASH® proton irradiation. FLASH® radiotherapy requires ultra-high-speed delivery of radioactive materials at dose rates several orders of magnitude higher (ultra-high dose rates) than those currently used in routine clinical practice (Favaudon V, Fouillade C, Vozenin MC. The radiotherapy FLASH to save healthy tissues. Med Sci(Paris) 2015;31:121~123. DOI:10.1051 / medsci / 20153102002); Patriarca A., Fouillade CM, Martin F., Pouzoulet F., Nauraye C. et al. Experimental set-up for FLASH proton irradiation of small animals using a clinical system. Int J Radiat Oncol Biol Phys, 102(2018), pp. 619~626. doi:10.1016 / j.ijrobp.2018.06.403. Epub July 11, 2018).

[0242] "In combination" may refer to the administration of additional treatments before, concurrently with, or after the administration of the T cell composition according to this disclosure.

[0243] In addition to, or as an alternative to, combinations with checkpoint blockade, the T cell compositions of this disclosure may also be genetically modified to make them resistant to immune checkpoints using gene editing technologies, including but not limited to TALENs and Crispr / Cas. Such methods are known in the art; see, for example, US20140120622. Gene editing technologies can be used to prevent the expression of immune checkpoints expressed by T cells (see checkpoint inhibitors listed above), more specifically including but not limited to PD-1, Lag-3, Tim-3, TIGIT, BTLA, CTLA-4, and combinations thereof. The T cells discussed herein may be modified by any of these methods.

[0244] The T cells described herein may also be genetically modified to express molecules that increase tumor homing, including but not limited to cytokines, soluble immunomodulatory receptors, and / or ligands, and / or to deliver inflammatory mediators to the tumor microenvironment.

[0245] While various embodiments of this disclosure have been described herein, it should be noted by those skilled in the art that this disclosure is merely illustrative, and various other alternatives, adaptations, and modifications can be made within the scope of this disclosure. Therefore, this disclosure is not limited to the specific embodiments illustrated herein.

[0246] Molecular imaging and diagnostic tools The nanobodies disclosed herein are of great interest in molecular imaging and molecular diagnostics (both in vitro and in vivo) that typically target imaging agents, such as radionuclides, to cells of interest in vivo. Therefore, nanobodies targeted imaging can be used by the present invention for a variety of purposes, including disease diagnosis, monitoring of disease progression, and prediction of responses to specific therapeutic agents, particularly anti-FGFR4 agents such as the anti-FGFR4 sdAb disclosed herein.

[0247] Nanobodies can be useful in early diagnosis and cancer prevention by detecting or clarifying biomarkers. Their high specificity can improve current mAb-based diagnostic methods. Furthermore, their high stability under extreme temperatures, pH levels, or ionic intensities ensures that applications under harsh conditions can still occur.

[0248] The small size of nanobodies is particularly advantageous in the field of molecular imaging because it enables rapid tumor accumulation and uniform distribution, as well as efficient blood clearance, contributing to a high tumor-to-background ratio.

[0249] The nanobodies described herein, intended for use in molecular imaging and / or as diagnostic tools, can be readily conjugated with several imaging agents, and their high specificity makes their use relatively safe.

[0250] In some embodiments, the nanobodies disclosed herein can be conjugated to radionuclides for use in radiation imaging. Single-photon emission computed tomography (SPECT) is based on gamma rays, and the sdAb of this disclosure is therefore 99m Tc, 177 Lu, 123 I, 125 I and 111 It can be linked to longer-lived radionuclides such as in. On the other hand, 68 Ga, 124 I or 89 Zr, 64 Cu, 18 F, or 15 Shorter-lived radionuclides, such as 0, can be used for positron emission tomography (PET). Scintigraphy can use the same radionuclides as SPECT.

[0251] Other imaging agents usable in nanobody targeting-based imaging according to this disclosure include absorbent low molecular weight dyes, metal nanoparticles (photoacoustic imaging, PAI), and small synthetic fluorescent probes. Common imaging agents include near-infrared fluorophores, such as IRDye 800CW, Ag2S quantum dots, and FDA-approved indocyanine green, or fluorescent protein expression genes (fluorescence tomography), luciferase expression genes (bioluminescence imaging), superparamagnetic iron oxide (SPIO), gadolinium-DTPA (magnetic resonance imaging), and nanoparticle-based contrast agents (computed tomography).

[0252] Due to their small size and rapid clearance, sdAbs are typically highly relevant to molecular imaging strategies. Because of their small size and relatively simple 3D structure, sdAbs also possess high chemical and thermal tolerance. This is advantageous for molecular imaging methods and conjugation chemistry (production).

[0253] The anti-FGFR4 sdAb according to this disclosure can also be used in cell-based ELISA assays. For sandwich ELISA, both capture and detection of nanobodies that preferably target different epitopes on the antigen are used.

[0254] In certain embodiments of this disclosure, the anti-FGFR4 single-domain antibodies described herein are therefore useful for detecting the presence of FGFR4 in a biological sample. The term “detect” as used herein includes quantitative or qualitative detection. In certain embodiments, the biological sample comprises one or more cells or tissues. In certain embodiments, such tissues include normal tissues and / or cancerous tissues that express FGFR4, in particular, express FGFR4 at a high level compared to other tissues or similar tissues from a control subject or a control population of the subject.

[0255] Furthermore, methods for diagnosing disorders associated with increased FGFR4 expression, typically FGFR4-related cancers or tumors. In certain embodiments, the methods include: - A step of contacting test cells with the anti-FGFR4 single-domain antibody of this disclosure, - A step of detecting the binding of the humanized anti-FGFR4 sdAb to HER and determining the level of FGFR4 expression in test cells (either quantitatively or qualitatively), - A step of comparing the level of FGFR4 expression in test cells with the level of FGFR4 expression in control cells (e.g., normal cells of the same tissue origin as the test cells, or cells that express FGFR4 at a level comparable to such normal cells). High levels of FGFR4 expression in test cells compared to control cells indicate the presence of a disorder associated with increased FGFR4 expression. In certain embodiments, test cells are obtained from individuals suspected of having a disorder associated with increased FGFR4 expression. In certain embodiments, the disorder is a cell proliferation disorder such as cancer or tumor.

[0256] In certain embodiments, diagnostic or detection methods, such as the methods described above, include the step of detecting the binding of an anti-FGFR4 single-domain antibody expressed on the surface of a cell or in a membrane preparation obtained from cells expressing FGFR4 on that surface. An exemplary assay for detecting the binding of a humanized anti-FGFR4 sdAb to FGFR4 expressed on the surface of a cell is the "FACS" assay.

[0257] Certain other methods can be used to detect the binding of the humanized anti-FGFR4 SDAB disclosed herein to FGFR4. Such methods include, but are not limited to, antigen-binding assays well known in the art, such as Western blotting, radioimmunoassays, ELISA (enzyme-linked immunosorbent assay), "sandwich" immunoassays, immunoprecipitation assays, fluorescence immunoassays, protein A immunoassays, and immunohistochemistry (IHC). Advantageously, in these embodiments, the humanized anti-FGFR4 SDAB disclosed herein is bound to the aforementioned diagnostic compounds, in particular to detectable labels.

[0258] In some embodiments of the methods described herein, the anti-FGFR4 SDAB disclosed herein is ligated to a drug nanocarrier such as a liposome. Typically, the drug nanocarrier functionalized with the anti-FGFR4 SDAB disclosed herein encapsulates a diagnostic compound.

[0259] In the following, the present invention is illustrated with the following examples and figures. [Brief explanation of the drawing]

[0260] [Figure 1] Schematic diagram of phage display biopanning and pre-selection of FGFR4-binding nanobody sequences. Phage display selection was performed with biotinylated and dynabead-binding FGFR4 using two different synthetic nanobody phage display libraries. Enriched phage clones were tested for their binding to cell surface FGFR4 on Rh4-FR4wt cells, yielding 40 unique binding agents. Eight nanobodies were selected and expressed in E. coli (E. coli), and ultimately four candidates A8, B1, B5 and F8 bound to Rh4-FR4wt cells but not to Rh4-FR4ko cells. [Figure 2]In vitro validation of nanobody binding. A) Nanobodies were tested for their binding selectivity to cell surface FGFR4 by flow cytometry. Histograms show single-cell living populations of each nanobody bound to Rh4-FR4wt cells compared to Rh4-FR4ko cells. A secondary FITC-labeled anti-HIS-tag antibody (secondary antibody) was used as a background control, and mCherry (mCh) was used as a negative control. Mean fluorescence intensity (MFI) was determined by FlowJo™10 software. B) FGFR4 activation assays in Rh30 cells were performed with recombinant FGF19 and in combination with nanobodies. Cells were incubated with 10 μM nanobodies (A8, B1, B5, F8, mCh) for 1 hour, and then FGFR4 was stimulated with 50 nM FGF19 for 10 minutes. Control cells (C) were either unstimulated or stimulated by FGF19 in the absence of nanobodies. Cell lysates were analyzed by Western blotting with an anti-phospho-ERK1 / 2 antibody. Total Erk1 / 2 levels are shown as a loading control. [Figure 3] Affinity of nanobodies to recombinant proteins was determined by surface plasmon resonance spectroscopy. Single-cycle kinetic analysis was performed on FGFR4 immobilized by covalent amine bonds on a dextran-based sensor chip. Analytes A8, B1, B5, F8, and mCh were injected at five different concentrations, followed by the dissociation phase. A final dissociation step was added after the last injection step to determine the Koff rate for KD calculation. The black curve represents the measured data, and the red curve shows the fit analysis (heteroligand model) performed by BIA evaluation software. [Figure 4] Characterization of vincristine-loaded targeted liposomes. A) Size distribution of nanobody-coated liposomes measured by dynamic light scattering. B) Western blot analysis of coupled nanobodies. Liposome suspensions (L) equivalent to 100 ng of nanobodies were loaded under reducing and denaturing conditions for gel electrophoresis, and 100 and 50 ng of uncoupled protein were loaded as controls. Nanobodies were detected by anti-His6-tagged antibody. [Figure 5] In vitro binding validation of FGFR4-targeted liposomes. Liposomes decorated with FGFR4-targeted nanobodies A8, B1, B5, and F8, or mCh-negative controls, were tested for their binding selectivity to cell surface FGFR4 by flow cytometry. Attached cells were incubated at 37°C and 5% CO2 at a total lipid concentration of 0.5 mM for 2 hours. The histogram shows the single-cell living population of liposomes binding to Rh4-FR4wt cells compared to Rh4-FR4ko cells. Untreated cells represent the control population. Mean fluorescence intensity (MFI) was determined using FlowJo™10 software. [Figure 6] Internal migration of FGFR4-targeted liposomes. Confocal microscopy analysis of Rh4-FR4 wt cells incubated with nanobody-coated fluorescent liposomes at 37°C and 5% CO2 for 2 hours. Total lipid concentration was 3 mM. Cells were washed, fixed, and mounted in DAPI-containing medium. [Figure 7]Cytotoxicity of FGFR4-CAR T cells against RMS cells. A) Schematic diagram of the CAR-VHHaFR4 construct. The CAR consists of a nanobody A8 with a CD8 alpha single peptide sequence and a C-terminal myc tag followed by a CD8 alpha hinge and transmembrane (TM) domain. The intracellular signaling domains are 4-1BB and CD3 zeta, followed by a streptavidin-binding peptide (SBP). B) CD8+ T cell transduction efficiency from donor A and donor B was determined by flow cytometry analysis of BFP signaling. C) Cytotoxicity determined by luciferase activity of Rh4 cells co-cultured with effector T cells from donor A and donor B for 72 hours. Relative cell death was highest in Rh4-FR4wt cells incubated with FGFR4-CAR T cells at the specified effector:target (E:T) cell ratio in both donors. In Rh4-FR4ko cells, nonspecific cell death was observed in co-cultures of all CAR T cells and non-transduced CD8+ T cells. D) Real-time cell death analysis of Rh4 cells co-cultured with effector T cells from donor B using xCELLigence RTCA DP. FGFR4-CAR T cells showed higher killing activity in Rh4-FR4wt at the specified E:T cell ratio compared to nonspecific CD19-CAR T cells or non-transduced CD8+ T cells. No specific cytotoxicity was observed in Rh4-FR4ko cells. Asterisks indicate the time of effector T cell addition. [Examples]

[0261] Materials and methods Plasmids and cloning For recombinant protein expression, nanobodies encoding the sequence on the pHEN2 phagemide vector are FX cloned into pSB_init (kindly provided by M. Seeger lab at the University of Zurich). 54PCR amplification was performed using SapI-transfer primers. The expression vector has a ccdB suicide cassette, C-terminal cysteine, and 6×His tag. Successful cloning of the nanobody sequence replaced ccdB, and the construct was amplified in E. coli MC1061. The CAR T cell construct was created using the A8 nanobody sequence and cloned by ligation to pTRIP-BFP-2a-scFvCD19-myc-41BB-CD3zeta-SBP (pTRIP-BFP-2a-vHH-FGFR4-myc-41BB-CD3zeta-SBP) by substitution of scFvCD19 with A8. The gene pTRIP-BFP-2a-scFvCD19-myc-41BB-CD3zeta-SBP was previously created by gene synthesis of a sequence consisting of a single peptide CD8 alpha-CD19-single-stranded variable fragment-myc tag-CD8 alpha-hinge and transmembrane domain-stimulatory domain 4-1BB and CD3 zeta domain-streptavidin-binding peptide (SBP). This gene was created by Nicolas Manel (Institut Curie, Paris). 55 I cloned it into pTRIP-SFFV-tagBFP-2A.ape, which was kindly provided by [the developer / organization].

[0262] cell line Cell lines Rh4 (kindly provided by Peter Houghton, Research Institute at Nationwide Children's Hospital, Columbus, OH), Rh30, HEK293ft, and HEK293T (purchased from ATCC, LGC Promochem) were maintained at 37°C in 5% CO2 in DMEM (Sigma-Aldrich) supplemented with 10% FBS (Sigma-Aldrich), 2 mM L-glutamine, and 100 U / ml penicillin / streptomycin (both Thermo Fisher Scientific). RMS cell lines were tested and validated by 2014 / 2015 cell line typing analysis (STR profiling) and positively matched. 48 All cell lines tested were negative for mycoplasma.

[0263] Generation of CRISPR / Cas9 FGFR4 knockout cells Rh4 FGFR4 knockout clones were generated using CRISPR / Cas9 technology. Complementary single-stranded oligonucleotides encoding the FGFR4 knockout sgRNA sequence (TTGCACATAGGGGAAACCGT) were annealed and cloned into the lentiCRISPRv2 puro vector (#98290, Addgene) via Esp3I (ER0451, Thermo Fisher Scientific) restriction and T4 ligation (15224017, Thermo Fisher Scientific). The lentiviral vector was produced in HEK293T cells. Cells were transiently transfected with pMDL, pREV, pVSV-G, and lentiCRISPRv2-sgFR4Ex14 using JetPrime (Polyplus Transfection). After 24 hours, the medium was replaced, and after a further 48 hours, the viral supernatant was collected. The supernatant was filtered, concentrated 20-fold (Amicon Ultra 15, Merck Millipore, 4000g, 15 minutes), and stored at -80°C. Transduction of RMS cells was performed using the concentrated viral supernatant in the presence of 10 μg / ml polyblen (Merck Millipore). After 24 hours, the medium was changed, and selection with 1 μg / ml puromycin was initiated after 72 hours and continued for 7 days. Single-cell cloning was performed using the selected cells in a 96-well plate, and FGFR4 knockout was confirmed at the protein level by Western blotting. All experiments were performed with knockout clone #8.

[0264] Production of lentiviral vectors for CAR T cell construction Lentiviral particles were produced by cotransfection of HEK293ft with a plasmid containing the target gene (BFP-2a-scFvCD19 / sdAB-FGFR4-myc-41BB-CD3zeta-SBP), packaging plasmid psPAX2, and envelope plasmid pVSVG using a polyethyleneimine (PEI) precipitation protocol. Cells were incubated in 5% CO2 at 37°C, and after 48 hours, the supernatant was collected and stored, followed by the addition of fresh medium for a further 24 hours of lentiviral production. After 72 hours, the supernatants were pooled together and filtered using a 0.2 μm pore size filter. To concentrate the lentiviral particles, 20% sucrose in PBS was applied to the filtered supernatant, and the mixture was centrifuged at 100,000 g for 1.5 hours at 4°C. The pellet was collected in 1 mL of frozen medium (DMEM complete medium + 0.1 mM β-mercaptoethanol (Gibco) and 1 mM HEPES (GIBCO)) and stored at -80°C until use. Lentiviral titers were determined by flow cytometry by detecting the fluorescent protein (mtagBFP) in HEK293ft cells 72 hours after transduction.

[0265] T cell isolation and transduction Peripheral blood mononuclear cells (PBMCs) were collected using density gradient Lymphoprep (StemCells). CD8+ T cells were collected using CD8 +T cells were isolated by negative selection using a cocktail containing antibodies against CD4, CD15, CD16, CD19, CD34, CD36, CD56, CD123, TCRγ / δ, and CD235a (glycofolin A), according to the instructions for the Human T Cell Isolation Kit (Miltenyi). The isolated CD8+ T cells were then cultured in X-VIVO medium (Lonza) supplemented with 50 μM β-mercaptoethanol (Merck Millipore) and 5% human serum (Merck Millipore), and activated using human T activator CD3 / CD28 Dynabeads (Gibco) according to the manufacturer's instructions. Approximately 24 hours after T cell activation, the T cells were transduced with lentiviral particles mixed with 4 μg / mL polyblen (Merck Millipore) at an MOI of approximately 5 or higher. Two days later, the culture medium was replaced with fresh medium supplemented with 5 ng / mL recombinant human interleukin-2 (IL2; R&D Biosystem). Transduction efficiency was assessed at 6 or 7 days post-transduction by flow cytometry to detect mtagBFP-expressing cells. Healthy adult blood donors (Saint-Louis Etablissement Francais du sang (EPS) or Saint-Antoine Crozatier EFS at Paris, France) agreed to provide their blood for research purposes.

[0266] Phage display selection FGFR4 screening is 3 × 10 9 Nali-H1 library composed of individual synthetic humanized sdAbs 24 and 1.6 × 10 9 Using the Gimli library, which consists of individual synthetic fully humanized sdAbs, as described above. 56 This was performed using biotinylated extracellular FGFR4 under natural conditions (G&P Biosciences).

[0267] Protein expression and purification Nanobody periplasmic expression was performed in E. coli MC1061 carrying a pSB_init vector enabling protein production with a C-terminal cysteine ​​and a 6×His tag. 20 ml of pre-culture, grown overnight in Terrific Broth medium (25 μg / ml chloramphenicol), was diluted in 2000 ml of fresh medium and grown at 37°C for 2 hours. The temperature was then reduced to 25°C, and protein expression was induced with 0.02% L-arabinose after 1 hour. Bacterial cultures were grown overnight at 25°C, and cells were harvested by centrifugation (12000 g, 15 minutes). Protein extraction from the periplasm was performed by osmotic shock. Cells were resuspended in 50 ml of lysis buffer 1 (50 mM Tris / HCl, pH 8.0, 20% sucrose, 0.5 mM EDTA, 5 μg / ml lysozyme, 2 mM DTT) and incubated on ice for 30 minutes. After adding ice-cold lysis buffer 2 (PBS, pH 7.5, 1 mM MgCl2, 2 mM DTT), cell fragments were collected by centrifugation (3800 g, 15 min), and imidazole at a final concentration of 10 mM was added to the protein-containing supernatant. 10 ml of Co 2+ - The bead slurry (HisPur Cobalt Resin, Thermo Fisher Scientific) was washed with washing buffer (PBS, pH 7.5, 30 mM imidazole, 2 mM DTT), and the supernatant was added to the beads. After incubation at 4°C for 1 hour, the beads were washed with 20 ml of washing buffer, and the bound protein was eluted with 20 ml of elution buffer (PBS, pH 7.5, 300 mM imidazole, 2 mM DTT). Prior to size exclusion chromatography (SEC), the protein eluate was dialyzed overnight to PBS, pH 7.5, 2 mM DTT, and concentrated by spin-filter centrifugation (Amicon Ultra 15, 3 kDa, Merck Millipore).

[0268] Flow cytometry Binding validation of selected phages, recombinant nanobodies, and decorated liposomes was performed in Rh4-FR4wt and Rh4-FR4ko cells. Specificity of selected phage clones binding to FGFR4 was determined by flow cytometry in a 96-well plate (Becton Dickinson). Cell surface staining of Rh4-FR4wt or Rh4-FR4ko cells was performed on ice in PBS supplemented with 1% FBS. 80 μL phage + 20 μL PBS / 1% milk was stained on ice for 1 hour at a rate of 1 × 10⁶ 5 Cells were incubated individually. After two washes in PBS, phage binding was detected with a 1:250 dilution of anti-M13 antibody (27-9420-01; GE Healthcare) for 1 hour on ice, followed by a 1:400 dilution of A488 conjugate anti-mouse antibody (715-545-151; Jackson ImmunoResearch, Europe Ltd) for 45 minutes. After two washes, samples were analyzed by flow cytometry using a MACSQuant cytometer (Miltenyi), and the results were analyzed using FlowJo software (BD Biosciences, France). Phage display anti-mCherry nanobodies were used as a negative control. 24 For the positive control, the inventors used an anti-FGFR4 antibody (BT53, kindly provided by J. Khan lab, NCI, Bethesda, MD). For the recombinant nanobody binding test, cells were detached with Accutase (Stemcell Technologies) and washed with PBS. All subsequent steps were performed on ice: 4 × 10 5Cells were incubated with nanobodies at a concentration of 30 μg / ml for 1 hour, washed once with PBS, and then incubated for a further 30 minutes with anti-His-tagged FITC-labeled antibody (LS-C57341, LSBioscience, 1:10 dilution). Cells were washed again with PBS and analyzed. Targeted liposomes were added to cells in a 96-well plate at a final lipid concentration of 0.5 mM and incubated at 37°C and 5% CO2 for 2 hours. Cells were washed twice with PBS and detached with Accutase. All flow cytometry measurements were performed using a Fortessa flow cytometer (BD Biosciences), and data were analyzed using FlowJo® 10.4.1 software.

[0269] Receptor activation assay To test the effect of nanobodies on FGFR4 activation, 6 × 10 4 Nine Rh30-FR4 wt and Rh30-FR4 ko cells were plated in 24-well plates. The following day, cells in FBS-free medium were added to nanobodies at a concentration of 10 μM and incubated at 37°C for 1 hour before stimulation with 50 nM recombinant human FGF19 (Peprotech) for 10 minutes. Cells were immediately washed with ice-cold PBS and lysed in Tris / RIPA buffer (50 mM Tris HCl, pH 7.5, 150 mM NaCl, 1% NP40, 0.5% Na-deoxycholate, 0.1% SDS, 1 mM EGTA, and standard protease and phosphatase inhibitors). Whole cell extracts were then analyzed by Western blotting.

[0270] Western blotting SDS-PAGE samples were separated on 4-12% NuPAGE Bis-Tris gels (Thermo Fisher Scientific) and blotted onto Trans-Blot Turbo Transfer Blot membranes (Biorad). After blocking the membranes with blocking buffer (5% milk / TBST) for 1 hour at room temperature, primary antibody was added at a 1:1000 dilution and incubated overnight at 4°C. HRP conjugate secondary antibody was diluted 1:10,000 with blocking buffer and added to the washed membranes at room temperature for 1 hour. Chemiluminescence was detected using a ChemiDoc® Touch Imaging system (BioRad) after incubation with Amersham® ECL® detection reagent (GE Healthcare) or SuperSignal® West Femto Maximum Sensitivity Substrate (Thermo Fisher Scientific). The primary antibodies used were phospho-p44 / 42 MAPK Thr202 / Tyr204 (#9101), β-tubulin D3U1W (#86298), FGF receptor 1 D8E4 (#9740) (all from Cell Signaling Technology), FGF receptor 2 C-17 (sc-122), FGF receptor 3 B9 (sc13121), and FGF receptor 4 A-10 (sc-136988) (all from Santa Cruz Biotechnology). The secondary antibodies were anti-rabbit IgG (#7074, Cell Signaling Technology) and anti-mouse IgG (#7076, Cell Signaling Technology).

[0271] surface plasmon resonance spectroscopy Single-cycle kinetic analysis was performed using a BIAcore T200 instrument (GE Healthcare) on a CMD200M sensor chip (XanTec bioanalytics GmbH) activated with a mixture of 300 mM NHS (N-hydroxysuccinimide) and 50 mM EDC (N-ethyl-N'-(dimethylaminopropyl)carbodiimide). Recombinant FGFR1, FGFR2, FGFR3, and FGFR4 (G&P Biosciences) were activated in biosensors (800-12,000 RU; 1 RU = 1 pg / mm³). 2 The nanobodies were immobilized on a surface and followed by a blocking step with 1M ethanolamine. One channel per tip was used as a reference to provide background correction. The nanobodies were injected at five different concentrations and followed by a dissociation phase. off The rate was determined from the final dissociation step after the last injection. FGFR4 measurements were performed on each nanobody on the newly immobilized protein due to strong binding and incomplete dissociation from the surface. The immobilization flow rate was 5 μl / min, and the binding test was performed at 30 μl / min. Binding parameters were determined by heterologous ligand model fitting using BIA evaluation software. The black curve represents the measured data, and the red curve shows the fitted analysis performed.

[0272] Preparation of fluorescently labeled VCR-loaded liposomes Liposome production and vincristine loading were carried out as described, with slight modifications. 23Liposomes were produced by film hydration / extrusion using egg-derived sphingomyelin (Lipoid GmbH), cholesterol (Sigma Aldrich), PEG-ceramide (N-palmitoyl-sphingosine-1-[succinyl[methoxyPEG-2000]]), DSPE-PEG-maleimide (1,2-distearoyl-sn-glycero-3-phosphoethanolamine-N-[maleimide(polyethylene glycol)-2000]) (both from Avanti Polar Lipids) and DiR (1,1'-dioctadecyl-3,3,3',3'-tetramethylindotricarbocyanine iodide) (Thermo Fisher Scientific) in a ratio of 49.8:45:4:1:0.2 mol%, respectively. The lipid films were hydrated with citrate buffer (250 mM, pH 3) to produce total lipids at a concentration of 70 mM. Next, six freeze-thaw cycles and ten extrusion processes were performed using a LIPEX® Thermobarrel extruder (Evonik Nutrition and Care GmbH) and a 100 nm pore size polycarbonate membrane (Whatman). A transmembrane pH gradient was generated via gel exclusion chromatography using a PD MidiTrap® Sephadex G-25 column (GE Healthcare Lifesciences). The column was prepared with coupling buffer (PBS, pH 7.0), and the eluted liposome suspension (14 mM) was used for vincristine encapsulation. Due to a drug-to-lipid molar ratio of 0.05, 1 ml of liposomes were mixed with 1 ml of 0.7 mM VCR (VincristineTeva, Teva Pharma AG) diluted in coupling buffer and incubated at 65°C for 1 hour. The unencapsulated VCR was removed by spin-filter centrifugation (Amicon Ultra 0.5, 100 kDa, Merck Millipore), and the encapsulation reaction was concentrated into an 11.2 mM suspension.

[0273] Liposome decoration using nanobodies For coupling nanobodies to the liposome surface, the protein was buffer-exchanged to coupling buffer (PBS, pH 7.0) using a PD MiniTrap® Sephadex G-25 column (GE Healthcare Lifesciences). The ratio of nanobodies to lipids was 0.4 nmol / μmol. 45 Selective analysis was performed to generate approximately 30 nanobodies per liposome. The reaction was incubated overnight at 4°C, and uncoupled nanobodies were removed by two steps: washing and filtration using spin filter centrifugation (Amicon Ultra 0.5, 100 kDa, Merck Millipore). The mean diameter and polydispersity index (PDI) of the liposomes were measured by dynamic light scattering (Litesizer 500, Anton Paar). To estimate the amount of nanobodies coupled to the liposomes, gel electrophoresis was performed on labeled liposomes and a specified amount of corresponding nanobodies under denaturing and reducing conditions. Sample separation, Western blotting, and imaging were performed as described above using His-tagged antibody (ab 18184, Abcam).

[0274] VCR quantitative The quantification of vincristine concentration was performed using HPLC (Ultimate 3000 HPLC system, Thermo Fisher Scientific) with an RP-18 (5 μm, 4.6 × 250 mm) LiChrospher® 100 column (Merck). Calibration curves for vincristine in the range of 890 μg / ml to 13.9 μg / ml were prepared, and liposome samples were destroyed with methanol for analysis. Doxorubicin was mixed with all samples and served as an internal standard. Dipotassium phosphate buffer (50 mM, pH 3.2) was used as the mobile phase (68%) with a mixture of acetonitrile / UPW 90 / 10 (v / v; 32%) at a flow rate of 1.5 ml / min for 30 minutes. 20 μl of each sample was injected, and detection was performed at 230 nm using a UV-VIS detector. Drug loading efficiency was determined by analyzing the vincristine concentration in spin-filtered liposome suspensions and aqueous flow-throughs. Encapsulation efficiency was expressed as the percentage of vincristine in the liposome suspension compared to the combined amount of vincristine from filtered liposomes and flow-through.

[0275] Confocal microscope Cell binding and internal migration of fluorescent liposomes were detected using a confocal laser scanning microscope (CLSM-Leica SP8 inverse) in Rh4 wild-type and Rh4-FGFR4-knockout cells. 40,000 cells were seeded onto 4-well microscope slides (Falcon® Chambered Cell Culture Slides, Fisher Scientific). The following day, targeted or control liposomes were added to the cells at a final lipid concentration of 3 mM, and incubated at 37°C and 5% CO2 for 2 hours. The wells were then washed twice with PBS, and the cells were fixed with 4% formaldehyde solution for 15 minutes. After two further washes with PBS, the slides were removed from the chamber case and mounted in DAPI-containing medium (VECTASHIELD® Hardset Antifade Mounting Medium with Phalloidin, Vector Laboratories). Microscopic imaging was performed using a 63x objective lens (HC PL APO CS2 63x / 1.30) and DAPI and DiR excitation, respectively, with lasers Diode405 and Diode638. All images were processed using ImageJ.

[0276] CAR T cell cytotoxicity assay Two methods were used to evaluate the cytotoxicity of T cells against RMS cells. For bioluminescence assays, Rh4-FR4wt and Rh4-FR4ko cells were transduced with lentiviral particles and co-expressed three proteins, mtag BFP, red firefly luciferase, and puromycin resistance gene (BFP-P2A-Luciferase-P2A-Puromycin), as the operon (P2A). In short, target cells were plated in 96-well ViewPlate Black (Perkin-Elmer) DMEM complete medium (4000 cells / well), and the following day, effector cells (CD8) were expressed in X-ViVO medium (twice the volume compared to DMEM) at the effector-to-target ratio (E:T). +T cells were added. After incubation at 37°C and 5% CO2 for approximately 72 hours, the wells were washed twice with PBS, and 1-2 mg / mL of luciferin substrate (Perkin Elmer) in PBS was added for 10 minutes (37°C) before luminescence measurement using FLUOstar OPTIMA (BMG LabTech). The percentage of cell viability was calculated by taking the luminescence value at each point and dividing it by the highest luminescence value obtained. Real-time cell death measurement was performed using the xCELLigence real-Time Analyzer System (ACEA Biosciences). In short, target cells were plated in DMEM complete medium in a 16-well E-plate (ACEA Biosciences) (10,000 cells / well), and the following day, effector cells were added in X-Vivo medium (twice the volume compared to DMEM) at the specified E:T ratio. Cell index (relative impedance) was monitored in real time every 15 minutes for approximately 4 days at 37°C and 5% CO2. The horizontal line in the curve indicates the standard deviation (SD) of the double wells used during the assay.

[0277] result Phage display selection of FGFR4-specific nanobody Screening of FGFR4-bound nanobodies involved two synthetic phage display libraries and a humanized sdAb library, NaLi-H1. 24The same procedure was performed using the fully humanized sdAb library Gimli. The inventors performed two independent phage display selections by three biopannings against recombinant FGFR4 (Figure 1). To verify binding specificity to FGFR4, the inventors created FGFR4 knockout cell RMS cells by CRISPR / Cas9 and tested 80 phage clones from their respective screenings for binding to Rh4 FGFR4 wild-type cells (Rh4-FR4wt) and Rh4 FGFR4 knockout cells (Rh4-FR4ko). Flow cytometry analysis revealed 24 phage clones from the NaLi-H1 library and 55 from the Gimli library that bound only to Rh4-FR4wt cells. Sanger sequencing of the 79 phage clones identified 12 unique nanobodies from the NaLi-H1 library and 28 from the Gimli library. Next, four phage clones from each library (i.e., NaLi-H1: A8, B1, B5, C3; Gimli: A4, F8, F11, H2) were recombinantly expressed, which were shown to bind most strongly to Rh4-FR4wt by flow cytometry (data not shown). As a negative control, the inventors used anti-mCherry nanobody (mCh) 24 The recombinant nanobody, approximately 17 kDa in size, was engineered to express a C-terminal Myc / 6×His tag and additional cysteine ​​for maleimide coupling to the liposome surface. Purification of the 6×His tag and size exclusion chromatography yielded high-purity protein in yields ranging from 3 to 16 mg per liter of bacterial culture (Appendix, Figure 2).

[0278] The selected nanobodies bind to RMS cells and inhibit receptor signaling. The binding of recombinant nanobodies to FGFR4 expressed on the cell surface was validated by flow cytometry in Rh4-FR4wt and Rh4-FR4ko cells. Surface-bound nanobodies were detected using a FITC-labeled anti-6×His-tagged antibody. The four recombinant nanobodies tested did not show significant binding to Rh4-FR4wt cells (C3, A4, F11, H2; data not shown), but recombinant nanobodies A8, B1, B5, and F8 showed specific binding to Rh4-FR4wt cells but not to Rh4-FR4ko cells (Figure 2A). As expected, the anti-mCherry-negative control nanobodies did not bind to either Rh4-FR4wt or Rh4-FR4ko cells. The mean fluorescence intensity (MFI) of the four FGFR4 conjugates incubated with Rh4-FR4wt cells ranged from 400, with only the anti-mCherry negative control or anti-6×His tag antibody showing an MFI of 200 (Figure 2B), and the slightly higher value of candidate B5 was similar to that of binding to Rh4-FR4ko cells.

[0279] The extracellular domain of FGFR4 exhibits high amino acid homology with FGFR1, 2, and 3. For optimal targeting of RMS tumors, the inventors aimed to identify a binding agent specific to FGFR4 only. Both Rh4-FR4wt and Rh4-FR4ko cells express FGFR1 and FGFR2, and even when Rh4-FR4ko levels were slightly lower than Rh4-FR4wt (Appendix, Figure 1), the inventors concluded that the nanobodies were specific to FGFR4 and did not bind to FGFR1 or FGFR2. Combined, binding validation of nanobodies on RMS cells revealed four candidate FGFR4-targeting nanobodies.

[0280] Abnormal FGFR signaling is associated with various types of cancer. In RMS, in addition to overexpression, FGFR4 was shown to have activating mutations in over 6% of all tumors, leading to constitutive tumors that promote intracellular signaling. 3,32 FGFR4 is involved in four major signaling pathways: RAS-MAPK, PI3K-AKT, PLCγ, and STAT 33Therefore, we investigated the effects of selected nanobodies on FGFR4 activation and downstream signaling. The FGFR4 activation assay was performed in Rh30 cells, with ERK 1 / 2 phosphorylation used as readout. We incubated Rh30 cells with FGF19, a specific ligand for FGFR4, with or without pre-addition of nanobodies (Figure 2C). As expected, FGF19 resulted in a rapid increase in phospho-ERK1 / 2 levels. Notably, when Rh30 cells were pre-incubated with selected nanobodies, kinase activation was absent, but the negative control anti-mCherry did not block ERK 1 / 2 phosphorylation. These data indicate that selected nanobodies have the ability to block the activation of the FGFR4 downstream MAPK pathway in RMS cells.

[0281] High affinity binding of nanobodies to FGFR4 To determine the binding affinity of nanobodies to FGFR4, the inventors performed surface plasmon resonance (SPR) spectroscopy using recombinant FGFR4. As previously mentioned above, FGFR1 and FGFR2 were expressed on Rh4-FR4ko cells, and flow cytometry analysis did not show binding of nanobodies to the cells. To further confirm FGFR4 specificity, the inventors also performed affinity measurements using recombinant FGFR1, FGFR2, and FGFR3. Nanobodies A8, B1, B5, F8, and mCh were injected into FGFR-coated chips at five different concentrations. K for FGFR4 binding was calculated, excluding the negative control mCh. D The values ​​were in the nano and picomolar ranges (Figure 3; Table 2). The affinity parameters could not be fitted to the 1:1 binding model, and the best fit was obtained by the heterogeneous ligand model of the BIAevaluation software, with two K values ​​for each candidate. D Values ​​were obtained. As expected, the measurement of affinity to receptor family isoforms FGFR1 and FGFR3 did not show binding of the analytes. SPR data confirmed strong binding of all candidates to FGFR4, suggesting that B1 and F8 have tight FGFR4 specificity.

[0282] [Table 2]

[0283] Preparation and Characterization of VCR Load Targeted Liposomes In previous research, the inventors optimized the formulation of liposomal VCR. 23 In this specification, to produce actively targeted liposomes, the inventors introduced DSPE-PEG lipids having a reactive maleimide group at the tip. Nanobodies with free cysteine ​​at the C-terminus were then coupled to the liposome surface. Fluorescent liposomes composed of egg-derived sphingomyelin, cholesterol, PEG-ceramide, DSPE-PEG-maleimide, and DiR (49.8:45:4:1:0.2 mol%) were prepared by film hydration / extrusion molding, followed by VCR encapsulation and nanobodies coupling. Dynamic light scattering measurements of the decorated liposomes L-A8, L-B1, L-B5, L-F8, and L-mCh revealed hydrodynamic diameters of approximately 120–135 nm and low PDI values ​​of 0.03–0.13 (Figure 4A, Table 2).

[0284] Nanobodies coupled to liposomes were analyzed by Western blotting with an anti-6×His tag antibody. Liposome suspension samples were prepared with 100 ng of theoretical nanobodies. To estimate coupling efficiency, the inventors loaded 100 ng and 50 ng of corresponding recombinant nanobodies onto Western blot gels (Figure 4B). All liposome suspensions showed electrophoresis of a predominant fraction with an apparent size of 25 kDa, corresponding to one nanobody molecule (17 kDa) bound to DSPE-PEG-maleimide (2.9 kDa). Two additional bands appeared at larger sizes, indicating the formation of complexes of two or three lipid molecules per nanobody. In addition to the C-terminal cysteine, the nanobodies possessed two additional cysteines, forming intermolecular disulfide bonds and indicating possible reaction sites for the maleimide group. Notably, only a small number of bands corresponding to free nanobodies were present in all liposome samples.

[0285] To determine the encapsulation efficiency of VCR, the inventors performed HPLC analysis on all targeted liposomes after the VCR encapsulation reaction and final purification. The VCR encapsulation efficiency was high, with 97.8% of the drug encapsulated in nanovesicles, and the VCR concentration in the targeted liposomes was in the range of 250-320 μg / ml (Table 3).

[0286] In combination, the inventors were able to produce fluorescently labeled VCR loads and nanobody-coated liposomes with similar drug concentrations and size distributions across samples.

[0287] [Table 3]

[0288] FGFR4-targeted liposomes specifically bind to and move into FGFR4-positive RMS cells. Next, the inventors tested whether nanobodies on the liposome surface could still bind to RMS cells expressing FGFR4. Rh4-FR4wt cells and Rh4-FR4ko cells were incubated with FGFR4-targeted liposomes or mCherry-targeted control liposomes for 2 hours under normal cell culture conditions. DiR fluorescence was subsequently analyzed by flow cytometry (Figure 5). Rh4-FR4wt cells incubated with FGFR4-targeted liposomes showed an increase in fluorescence signal, indicating binding to FGFR4, but no increase in fluorescence was observed in Rh4-FR4ko cells incubated with FGFR4-targeted liposomes. Rh4-FR4wt cells incubated with control mCherry-targeted liposomes showed an MFI of less than 50, similar to untreated cells. Among the FGFR4-targeted liposomes, the MFI values ​​for L-A8, L-B1, L-B5, and L-F8 ranged from 300, 600, 1700, and 1400, respectively, and were thus 6, 12, 34, and 28 times higher than the MFI value for L-mCh. These results indicate that while nanobodies can still specifically bind to Rh4-FR4wt when coupled to the surface of VCR-loaded liposomes, the binding strength differed among the four nanobodies.

[0289] Receptor-mediated internal transfer of drug-loaded liposomes increases intracellular drug levels and therefore enhances their therapeutic effects. 34This is a well-known phenomenon. Therefore, we investigated the internal migration of FGFR4-targeted liposomes using confocal microscopy. The liposomes were incubated on Rh4-FR4 wt cells and Rh4-FR4 ko cells for 2 hours. Subsequently, images of the fixed cells revealed clear intracellular uptake of all liposomes coated with FGFR4-targeted nanobodies. Notably, no fluorescence signal was detected when Rh4-FR4 wt cells were incubated with L-mCh (Figure 6). Consistent with flow cytometry data, L-A8 and L-B1 showed weak intracellular fluorescence. Notably, no fluorescence was observed in Rh4-FR4 ko cells, supporting their specificity to FGFR4 (Appendix, Figure 4). Therefore, FGFR4-targeted liposome formulations represent a specific drug delivery platform for RMS tumor cells overexpressing FGFR4, characterized by their rapid and specific receptor-mediated intracellular uptake.

[0290] RMS cells targeting FGFR4-CAR T cells To investigate the therapeutic potential of selected nanobodies, the inventors generated chimeric antigen receptors (CARs) and produced T cells against FGFR4. Using the A8 nanobodies, the inventors created CD19-CAR T constructs currently used in the treatment of hematological cancers. 25,35 The CD19-targeted single-chain antibody fragment (scFv) in (Celgene, Juno Therapeutics and Kymriad, Novartis) was substituted. The resulting CAR (CAR-sdAbaFGFR4) consists of a myc-tagged A8 followed by a CD8 alpha hinge and transmembrane domain, as well as intracellular signaling domains of 4-1BB and CD3 zeta (Figure 7A). CD8 +T cells were isolated from four healthy donors (donors A, B, C, and D) and transduced with FGFR4 or CD19-targeted CAR. Transduction efficiency was measured by mtagBFP expression, showing approximately 80% FGFR4-CAR-positive cells and approximately 60% CD19-CAR-positive cells (Figure 7B, Supplementary, Figure 5A). To evaluate the cytotoxic performance of CAR T cells against Rh4-FR4wt cells and Rh4-FR4ko cells, the inventors applied bioluminescence and real-time cell death assays (Figure 7C, D). RMS cells were co-cultured with CAR T cells at different ratios (E:T - effector T cell to target RMS cells), and as a further control, the inventors used non-transduced CD8 + T cells. The bioluminescence assay was performed with T cells from donors A and B, revealing specific killing of Rh4-FR4wt by FGFR4-CAR T cells (Figure 7C). T cells from donor B showed a high cytotoxic efficiency of almost 100% dead cells at the lowest E:T ratio of 4:1. By comparing cell death at an E:T ratio of 32:1 between T cells, the inventors were able to confirm the selective cytotoxic effect of FGFR4-CAR T cells with almost 100% dead cells. CD19-CAR T cells and CD8 + control T cells reached only values of approximately 20 - 35% dead cells. T cell-mediated toxicity against Rh4-FR4ko cells was similar for both CAR and CD8 + control T cells. Real-time analysis of cell death by CAR from donors B, C, and D showed similar results due to selective cell death of Rh4-FR4wt by FGFR4-CAR T, but the cytotoxicity of Rh4-FR4ko cells was absent or reduced (Figure 7D, Supplementary, Figure 5B). Taken together, these data indicate that the selected nanobody A8 can generate FGFR4-CAR T cells that mediate significant anti-tumor activity against FGFR4-expressing RMS cells in vitro, thus presenting a promising further targeted treatment option.

[0291] Discussion In this specification, the inventors reported the development of two therapeutic strategies for RMS by targeting FGFR4 with nanobodies and verified them in RMS cells. The inventors selected four FGFR4-binding nanobodies and tested them in vitro for active drug delivery and cell-mediated immunotherapy. VCR-loaded fluorescently labeled FGFR4-targeted liposomes showed selective binding and internalization when incubated with RMS cells. Furthermore, the inventors were able to generate FGFR4-CAR T cells with one nanobody candidate that produced specific cytotoxicity against FGFR4-expressing RMS cells.

[0292] The four selected nanobodies A8, B1, B5, and F8 not only bind to FGFR4-expressing RMS cells but can also block the FGFR4-FGF19 MARK signaling axis. The inventors' aim was to select nanobodies that target FGFR4 for active drug delivery rather than their function, but it should be noted that receptor signaling can also present a therapeutic target in RMS. 32,36 In ARMS, FGFR4 is the direct target gene of the fusion protein PAX3-FOXO1 37 and in ERMS, FGFR4 is frequently amplified by 12% of tumors with activating mutations of the receptor. 38~40 Furthermore, FGFR4 is not only involved in RMS tumorigenesis. FGFR4 drives tumor progression in FGF19-expressing hepatocellular carcinoma and head and neck squamous cell carcinoma 41~43 and is estimated to be abnormal in 0.5% of all tumors. 44 The selected nanobodies may therefore also contribute as possible therapeutic approaches in other cancers.

[0293] Surface plasmon resonance spectroscopy of nanobodies bound to FGFR4 revealed strong affinity from approximately nano to picomolar levels. The measured data could not be fitted to a 1:1 binding model. The best fit was obtained by a heteroligand model exhibiting two separate binding affinity parameters for nanobodies to FGFR4. The inventors had to directly immobilize recombinant FGFR4 onto the activated carboxyl group on the sensor chip via amine group bonding, as other approaches did not correspond to their measurements. Therefore, non-directional binding of FGFR4 to the sensor chip can result in complete or partial steric hindrance at the nanobody binding site, giving rise to heterobinding parameters. This is represented by R, which indicates the maximum nanobody binding signal. max A comparison of the values ​​clearly shows that, for affinity measurement of A8, the inventors were able to immobilize 800 RU FGFR4 onto a sensor chip. With an estimated ligand molecular weight of 40 kDa and a nanobody molecular weight of 17 kDa, the inventors were able to immobilize 340 RU of R max I predicted ((MW FGFR4 / MW NB ) * (800 RU), in practice, only a value of 44 RU was achieved. Since the inventors were unable to fully regenerate the cells that leached out after nanobody binding, they performed all measurements with newly immobilized FGFR4 for each nanobody. This resulted in different amounts of immobilized FGFR4. Analysis of A8, B1, and B5 was performed with approximately 800 RU of FGFR4, while for F8 and mCh, the inventors immobilized 9,000 and 12,000 RU, respectively. Measurement of negative control mCh at such high ligand densities resulted in nonspecific interactions at high nanobody concentrations. This resulted in lower calculated affinity compared to the nanobody candidates.

[0294] Both the free and liposome-conjugated nanobodies specifically bound to Rh4-FR4wt cells but did not bind to Rh4-FR4ko cells.

[0295] The liposomal VCR formulation was modified by introducing 1 mol% DSPE-PEG-maleimide. As previously described, the inventors 23 This allowed us to produce liposomes of equivalent quality, size, and drug loading efficiency. Nanobody coupling to the surface was achieved by 0.4 nmol of nanobody per μmol of total lipid, according to Oliveira and colleagues. 45 The procedure was carried out as described, resulting in high coupling efficiency. The inventors also tested a high ratio of nanobodies to lipids in the coupling reaction, but this resulted in liposome precipitation. The small number of uncoupled nanobodies in the liposome suspension were negligible and did not interfere with the inventors' binding verification in cells.

[0296] Fluorescent FGFR4-targeted liposomes exhibited highly specific internal migration in Rh4-FR4wt cells, represented by intracellular dot-like structures not present in Rh4-FR4ko cells, as observed by confocal microscopy. The images, taken 2 hours after incubation, show a rapid internal migration process that may be advantageous as a drug delivery platform to highly angiogenic tumors.

[0297] In vitro cell assays are not suitable for predicting and comparing the therapeutic effects of drug-loaded nanovesicles, as they enhance penetration and retention effects. 13 The inventors incubated RMS Rh4-FR4wt cells and Rh4-FR4ko cells with increased concentrations of targeted liposomes and L-mCh, but no significant differences in cytotoxic effects were observed between liposomes and cell lines (data not shown). These results were obtained even after incubation for 1 or 2 hours on cells with attached liposomes, followed by culture, or even after washing to prevent nonspecific uptake of liposomes within 3 days of drug release. Nonspecific binding of liposomes to the cell culture plate may explain this. Therefore, the therapeutic potential of FGFR4-targeted drug delivery to RMS needs to be further studied in vivo.

[0298] The inventors were able to verify the selective cell-mediated cytotoxicity of nanobody-based FGFR4-CAR T cells against Rh4-FR4wt. The inventors also verified the selective cell-mediated cytotoxicity of three CD8 T cells. + While some differences were observed in the cytotoxicity of T cell donors A, B, and C, all FGFR4-CAR T cells showed the same specificity trend. Real-time cell analysis presented an excellent tool for monitoring the cytotoxic performance of CAR T cells, revealing that the effect of FGFR4-CAR T cells on Rh4-FR4ko was no longer significant or reduced compared to CD19-CAR T cells. The inventors believe that RMS tumors exhibit abnormally high FGFR4 expression compared to healthy tissue. 39 Therefore, we believe that immune-based treatment of RMS with FGFR4-CAR T cells holds promising potential. It has been shown that high antigen densities exceeding a certain threshold level are required for effective CAR T cell activation, enabling a therapeutic concentration range for RMS treatment. 46,47 .

[0299] Since the identification of abnormal FGFR4 expression and signaling in RMS, it has been investigated as a possible therapeutic target. Targeting the receptor with the small molecule inhibitor PD173074 has been reported to induce tumor regression in ARMS-carrying mice, but with toxic side effects. 48 Li and colleagues investigated the therapeutic effects of the multitarget kinase inhibitor ponatinib. 36 In vitro experiments using ERMS and ARMS showed low nanomolar ICs. 50 The cells showed high sensitivity to inhibitors with specific values. Furthermore, they were able to demonstrate that the inhibitors delayed tumor growth only in mice carrying RMS with FGFR4 mutations. Further studies showed that the FGFR4 downstream signaling pathways PI3K-AKT-mTOR and RAS-MEK-ERK were simultaneously targeted in RMS and exhibited synergistic effects in vitro and in vivo. 49 Treatment of RMS based on FGFR4 antibodies involves antibody drug conjugates (ADCs). 50~52 The antigen-binding domain, which is used as, or transplanted onto a chimeric antigen receptor (CAR) to generate CAR T cells.53 Promising results were obtained through the study. Based on our research, we present hereby demonstrate a novel and promising strategy for nanobody-based FGFR4 targeting through active drug delivery and T cell recruitment.

[0300] In summary, the inventors selected FGFR4-specific nanobodies that have an inhibitory effect on receptor signaling. Furthermore, the inventors developed an effective drug delivery platform for RMS treatment using targeted liposomal VCRs and were able to demonstrate effective cell-mediated cytotoxicity by FGFR4-CAR T cells in vitro. The tumor-targeting approach needs to be tested in an RMS in vivo model and further applied to other FGFR4-expressing tumors. [References] TIFF0007888470000005.tif58166TIFF0007888470000006.tif240166TIFF0007888470000007.tif242166 TIFF0007888470000008.tif242166TIFF0007888470000009.tif238170TIFF0007888470000010.tif146170

[0301] Sequence List [Table 4]

[0302] [Table 5]

[0303] [Table 6]

Claims

1. A humanized synthetic single-domain antibody (sdAb) against FGFR4 (anti-FGFR4 sdAb), wherein the anti-FGFR4 sdAb has the following formula FRW1-CDR1-FRW2-CDR2-FRW3-CDR3-FRW4, CDR - CDR1 of sequence number 1; CDR2 of sequence number 2 and CDR3 of sequence number 3, - CDR1 of sequence number 4; CDR2 of sequence number 5 and CDR3 of sequence number 6, - CDR1 of SEQ ID NO: 7; CDR2 of SEQ ID NO: 8 and CDR3 of SEQ ID NO: 9, - CDR1 of SEQ ID NO: 10; CDR2 of SEQ ID NO: 11 and CDR3 of SEQ ID NO: 12 A humanized sdAb for FGFR4, selected from the group consisting of the following.

2. The framework domain is - FRW1 selected from sequence number 13 or sequence number 17, - FRW2 selected from sequence number 14 or sequence number 18, - FRW3 selected from sequence number 15 or sequence number 19, - FRW4 selected from Sequence ID No. 16 or Sequence ID No. 20, or The humanized anti-FGFR4 sdAb according to claim 1, comprising functional variants thereof, each having zero, one, two, or three or fewer conservative amino acid substitutions in FRW1, FRW2, FRW3, and FRW4.

3. The humanized anti-FGFR4 sdAb according to claim 2, comprising a sequence selected from the group consisting of SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, and SEQ ID NO:

44.

4. A humanized anti-FGFR4 sdAb according to any one of claims 1 to 3, which is directly or indirectly covalently or non-covalently bound to a compound of interest selected from the group consisting of nucleic acids, polypeptides or proteins, viruses, toxins and chemical substances.

5. The humanized anti-FGFR4 sdAb according to claim 4, wherein the anti-FGFR4 sdAb is directly or indirectly covalently or non-covalently bound to a diagnostic compound selected from the group consisting of enzymes, fluorophores, NMR or MRI contrast agents, radioisotopes, and nanoparticles.

6. The humanized anti-FGFR4 sdAb according to claim 4, wherein the anti-FGFR4 sdAb is directly or indirectly covalently or non-covalently bound to a therapeutic compound selected from the group consisting of cytotoxic substances, chemotherapeutic agents, radioisotopes, targeted anticancer agents, immunotherapy agents (such as immunosuppressants or immunostimulants), and soluble peptides.

7. A humanized anti-FGFR4 sdAb according to any one of claims 1 to 4, wherein the drug nanocarrier is optionally directly or indirectly, covalently or non-covalently, bound to an organic nanocarrier.

8. The humanized anti-FGFR4 sdAb according to claim 7, wherein the organic nanocarrier is selected from the group consisting of polymer nanoparticles, liposomes, micelles, and protein-based nanocarriers such as albumin, and optionally the organic nanocarrier is a liposome.

9. The humanized anti-FGFR4 sdAb according to claim 7 or 8, wherein the drug encapsulated on a nanocarrier comprises a therapeutic compound or a diagnostic compound, and optionally the therapeutic compound is a cytotoxic compound.

10. A humanized anti-FGFR4 sdAb according to any one of claims 1 to 4, wherein it is fused to an immunoglobulin domain and optionally to an Fc domain.

11. A multispecific conjugation compound comprising at least a first sdAb composed of a humanized anti-FGFR4 sdAb as defined in any one of claims 1 to 10, and further comprising another sdAb that binds to a second antigen, wherein optionally, the first sdAb is located at the N-terminus of the second sdAb, or the first sdAb is located at the C-terminus of the second sdAb.

12. (a) an antigen-binding domain comprising at least a first sdAb composed of a humanized anti-FGFR4 sdAb as defined in any one of claims 1 to 4, and optionally a second sdAb that binds to a second antigen, (b) a transmembrane domain, and (c) an intracellular domain.

13. The CAR according to claim 12, wherein the transmembrane domain is selected from the transmembrane domains of CD3 zeta, CD28, CD8 alpha, DAP10, or DAP12.

14. The CAR according to claim 12 or 13, wherein the intracellular domain comprises one or more domains derived from the CD28, OX40, CD3 zeta, 4-1BB, DAP10, and / or DAP12 intracellular domains, and optionally the intracellular domain comprises the CD3 zeta and 4-1BB intracellular domains.

15. The CAR according to any one of claims 12 to 14, wherein the transmembrane domain is a CD8 alpha transmembrane domain and the intracellular domain comprises a CD3 zeta and a 4-1BB intracellular domain.

16. A CAR according to any one of claims 12 to 15, further comprising a spacer and / or hinge domain located between the C-terminal domain of the extracellular antigen-binding domain and the N-terminus of the transmembrane domain, wherein the hinge is optionally a CD8 alpha hinge.

17. The CAR according to any one of claims 12 to 16, further comprising a signal peptide located at the N-terminus of the polypeptide.

18. An isolated nucleic acid comprising a nucleic acid sequence encoding a humanized anti-FGFR4 sdAb according to any one of claims 1 to 3, or an antigen-binding domain comprising (a) at least a first sdAb composed of the humanized anti-FGFR4 sdAb and optionally a second sdAb that specifically binds to a second antigen, (b) a transmembrane domain, and (c) an intracellular domain, thereby encoding a chimeric antigen receptor (CAR).

19. The isolated nucleic acid according to claim 18, wherein a humanized anti-FGFR4 sdAb or CAR is bound to a heterologous regulatory sequence.

20. A vector comprising the nucleic acid according to claim 18 or 19.

21. A host cell comprising the nucleic acid described in claim 18 or 19 or the vector described in claim 20.

22. Isolated cells or populations of cells expressing a humanized anti-FGFR4 sdAb or CAR according to any one of claims 1 to 17.

23. The isolated cells or cell population according to claim 22, wherein the cells are allogeneic or autologous cells selected from macrophages, NK cells, CD4+ / CD8+, TIL / tumor-derived CD8 T cells, central memory CD8+ T cells, Treg, MAIT, and Yδ T cells.

24. A humanized anti-FGFR4 sdAb, CAR, nucleic acid, vector, host cell, isolated cell or cell population as defined in any one of claims 1 to 23, for use in therapeutic purposes.

25. A humanized anti-FGFR4 sdAb, CAR, nucleic acid, vector, host cell, isolated cell or cell population as defined in any one of claims 1 to 23, for use in the treatment of cancer in a subject requiring such treatment.

26. Isolated cells or cell populations according to claim 22 or 23 for use in cancer cell therapy.

27. A humanized anti-FGFR4 sdAb, CAR, nucleic acid, vector, host cell, isolated cell or cell population as defined in any one of claims 1 to 23, for use in the treatment described in claim 24 or 26 or for use in the treatment of cancer described in claim 25, wherein the humanized anti-FGFR4 sdAb, CAR, nucleic acid, vector, host cell, isolated cell or cell population is used in combination with at least one further therapeutic agent, the at least one further therapeutic agent being an anticancer agent, optionally a chemotherapeutic agent, or an immunotherapy agent, optionally a checkpoint inhibitor.

28. A pharmaceutical composition for in vitro detection of FGFR4-mediated cancer, comprising the humanized anti-FGFR4 sdAb described in Claim 4, 5, or 9.

29. A drug for use in an in vitro or ex vivo method for diagnosing or monitoring FGFR4-mediated cancer in a subject, comprising a diagnostic compound as defined in claim 5 or 9, The method described above is a) A step of bringing a suitable sample derived from the subject into contact with the drug in vitro, b) A step of determining the expression of FGFR4 in the sample The aforementioned drug, including the above.

Images