Modulators for gene expression of chromosome 9 open reading frame 72 and their use

Abstract

To provide effective treatment for a C9orf72-related disease such as amyotrophic lateral sclerosis (ALS) or frontotemporal dementia (FTD).SOLUTION: The present invention provides a fusion protein for inhibiting transcription of a mutant allele of the human C9orf72 gene in human cells.SELECTED DRAWING: None

Description

Technical Field

[0001] Cross - Reference to Related Applications This application claims priority to U.S. Patent Application No. 62 / 837,523, filed on April 23, 2019, and U.S. Patent Application No. 62 / 964,844, filed on January 23, 2020. The disclosures of these priority applications are hereby incorporated by reference in their entirety.

[0002] Sequence Listing This application is electronically filed in ASCII format and contains a sequence listing which is hereby incorporated by reference in its entirety. The ASCII copy created on April 21, 2020, is named 025297_WO017_SL.txt and is 19,880 bytes in size.

Background Art

[0003] The chromosome 9 open reading frame 72 (C9orf72) gene encodes a protein that is abundantly found in neurons. The C9orf72 protein is thought to play an important role in endosomal transport. Although the function of the C9orf72 protein is not fully understood, recent data suggest that it plays a role in membrane transport along the endolysosomal pathway by regulating the function of Rab proteins.

[0004] The C9orf72 gene contains a hexanucleotide segment (G4C2; SEQ ID NO: 1) in intron 1. This segment can be repeated in tandem up to 30 times without any discernible biological effect. However, more than 30 repeats, a phenomenon called hexanucleotide expansion, can lead to C9orf72-related disorders (Renton et al., Neuron (2011) 72:257-68; Douglas, Non-coding RNA Res. (2018) 3:178-87). This expansion results in an autosomal dominant phenotype, and patients are typically heterozygous for the expanded allele. Hexanucleotide expansion is thought to cause the formation of RNA foci within cells, which leads to the sequestration of RNA-binding proteins and disruption of RNA metabolism. Furthermore, non-AUG-dependent translation suggests that hexanucleotide expansion may potentially lead to the production of non-native proteins containing dipeptide repeats (DPRs) from all six frames in both sense and antisense directions (Freibaum and Taylor, Front Mol Neurosci. (2017) 10:35; Douglas, op. cit.). These proteins tend to aggregate (Gendron et al., Acta Neuropathol. (2013) 126:829). DPRs have been reported to be present in postmortem brain material from patients with C9orf72-related disease (Riemslagh et al., Acta Neuropathol Commun. (2019) 7:39).

[0005] C9orf72-associated disorders include amyotrophic lateral sclerosis (ALS) and C9 familial frontotemporal dementia (C9FTD). ALS is characterized by progressive muscle loss, decreased muscle mass, and a gradual decline in the ability to move, speak, swallow, and / or breathe. ALS has an annual incidence of 1 to 3 cases per 100,000 people and is the most common adult-onset motor neuron disorder. The disease is fatal for most patients within 3 to 5 years of the onset of symptoms. In the United States and Europe, mutations in the C9orf72 gene are involved in approximately 30 to 40 percent of familial ALS cases and account for 5 to 10 percent of sporadic ALS cases. Some patients with C9orf72-associated ALS also develop a neurodegenerative disorder affecting personality, behavior, and language, known as C9 frontotemporal dementia (FTD) or C9FTD (Benussi et al., Front Aging Neurosci. (2015) 7:171). Individuals exhibiting both conditions are diagnosed with ALS-FTD. [Overview of the project] [Problems that the invention aims to solve]

[0006] There have been no effective treatments for C9orf72-related disorders. Therefore, there is an urgent need to develop effective therapies for these disorders. [Means for solving the problem]

[0007] This disclosure provides zinc finger protein-based transcription modulators for human C9orf72 and the use of these modulators in the treatment of C9orf72-related disorders. In one embodiment, this disclosure comprises a zinc finger protein (ZFP) domain and a transcriptional repressor domain, the ZFP domain providing a fusion protein that binds to a target region in the intron segment between exons 1a and 1b (intron 1a) of a mutant allele of the human C9orf72 gene. The mutant allele has an expanded G4C2 (SEQ ID NO: 1) repeat region in intron 1a, and the fusion protein targets this expanded repeat region. The mutant allele may contain more than 30 tandem G4C2 repeats (e.g., more than 100, 200, 300, 400, 500, 600, 700, 800, 900, or 1000 repeats). Wild-type alleles may contain 30 or fewer such repeats (e.g., 25, 20, 15, 10, or 5 or fewer repeats).

[0008] In some embodiments, the fusion protein represses the transcription of repeat-containing RNA transcripts (e.g., mRNA) from the mutant allele but does not repress the transcription of wild-type RNA transcripts (e.g., mRNA) from that gene.

[0009] In some embodiments, the ZFP domain binds to a sense sequence in the target region, the sense sequence comprising 1-3 tandem repeats of the hexanucleotide GGGGCC (SEQ ID NO: 1), GGGCCG (SEQ ID NO: 2), GGCCGG (SEQ ID NO: 3), GCCGGG (SEQ ID NO: 4), CCGGGG (SEQ ID NO: 5), or CGGGGC (SEQ ID NO: 6). In certain embodiments, the fusion protein represses sense transcription from a mutant allele in human cells. In certain embodiments, the fusion protein represses sense transcription from the C9orf72 1a promoter but does not repress sense transcription from the C9orf72 1b promoter.

[0010] In some embodiments, the ZFP domain binds to an antisense sequence in the target region, the antisense sequence comprising one to three tandem repeats of the hexanucleotide GGCCCC (SEQ ID NO: 7), GCCCCG (SEQ ID NO: 8), CCCCGG (SEQ ID NO: 9), CCCGGC (SEQ ID NO: 10), CCGGCC (SEQ ID NO: 11), or CGGCCC (SEQ ID NO: 12). In certain embodiments, the fusion protein represses antisense transcription from mutant alleles in human cells.

[0011] In some embodiments, the fusion protein represses both sense and antisense transcription from the mutant C9orf72 allele in human cells. In some embodiments, the fusion protein preferentially represses the mutant C9orf72 allele compared to the wild-type C9orf72 allele.

[0012] In further embodiments, the fusion protein suppresses sense and / or antisense transcription from the mutant allele by at least about 30%, 40%, 75%, 90%, or 95%.

[0013] In some embodiments, the fusion protein has one or more ZFP domains, each of which may contain six zinc fingers that bind to the target sequence shown in Table 1 and / or contain six zinc fingers (ordered F1-F6), each zinc finger containing a DNA-binding (recognition) helix sequence shown in a single column in Table 1, and may contain one or more mutations in the residues outside the recognition helix region as shown in Table 1. In further embodiments, the fusion protein binds to the target sequence and contains zinc fingers corresponding to SBS numbers as shown in Table 1, each zinc finger containing a DNA-binding (recognition) helix sequence shown in a single column in Table 1 for the SBS number, where the SBS numbers are 78021, 75114, 75115, 74969, 79895, 79898, 74986, 79899, ​​79901, 79902, 79904, 79916, 75027, or 79921.

[0014] In some embodiments, the fusion protein has one or more transcriptional repressor domains, each of which may contain a human KOX1-derived KRAB domain amino acid sequence, for example, one of those further described below. In certain embodiments, a ZFP domain is linked to the transcriptional repressor domain via a peptide linker.

[0015] In another embodiment, the Disclosure provides a nucleic acid construct comprising one or more coding sequences from the fusion proteins described herein, the coding sequences being operably linked to a transcriptional regulatory element. In some embodiments, the transcriptional regulatory element comprises a mammalian promoter that is constitutively active or inducible in brain cells, the promoter may be a human synapsin I promoter. In some embodiments, the construct is a recombinant adeno-associated virus ("AAV" or "rAAV") construct. Also provided are rAAVs comprising a recombinant AAV construct and rAAVs comprising serotypes 1-10 and a capsid (e.g., AAV2, AAV6, or AAV9) or pseudotypes derived therefrom (e.g., AAV2 / 9, AAV2 / 6, or AAV2 / 6 / 9).

[0016] In another aspect, the present disclosure provides a host cell comprising one or more fusion proteins and / or one or more nucleic acid constructs as described herein. The host cell may be, for example, a human cell, such as a neuron or pluripotent stem cell (e.g., an embryonic stem cell or an induced pluripotent stem cell).

[0017] Also provided are pharmaceutical compositions, typically comprising one or more fusion proteins, one or more nucleic acid constructs (e.g., AAV constructs), recombinant viruses containing nucleic acid constructs (e.g., rAAV), and / or one or more host cells, in combination with one or more pharmaceutically acceptable excipients, as described herein.

[0018] In yet another embodiment, the Disclosure provides a method for inhibiting the transcription of a mutant C9orf72 allele in human cells (e.g., neurons, glial cells, ependymal cells, or neuroepithelial cells), wherein the mutant allele comprises an expanded G4C2 repeat region in an intron 1a, and the method comprises introducing into the cells one or more fusion proteins, one or more nucleic acid constructs (e.g., AAVs), one or more recombinant viruses, one or more host cells, and / or one or more pharmaceutical compositions, as described herein. In some embodiments, the cells are located in the brain or spinal cord of a patient suffering from a C9orf72-related disorder, e.g., ALS or C9FTD.

[0019] In a related aspect, the Disclosure provides a method for treating a patient suffering from a C9orf72-related disorder, which may be selected from amyotrophic lateral sclerosis (ALS) and C9 familial frontotemporal dementia (C9FTD), comprising introducing into the patient one or more fusion proteins, one or more nucleic acid constructs (e.g., AAVs), one or more host cells and / or one or more pharmaceutical compositions, as described herein.

[0020] In this treatment method, the fusion protein may be introduced using a recombinant virus expressing the fusion protein (e.g., an AAV vector). In some embodiments, the recombinant virus is administered to the patient via intraventricular, subarachnoid, intracranial, posterior orbital (RO), intravenous, intranasal, and / or intracisional routes. In some embodiments, two or more different fusion proteins of this disclosure may be introduced, and the coding sequences of the two or more fusion proteins may be held in the same or different recombinant viral vectors.

[0021] Also provided in this disclosure are one or more fusion proteins and / or one or more nucleic acid constructs, one or more recombinant viruses and one or more pharmaceutical compositions for use in the treatment methods described herein and for the manufacture of pharmaceuticals for use in the treatment methods described herein.

[0022] Other features, purposes, and advantages of the present invention will become apparent in the following detailed description. However, it should be understood that the detailed description illustrates, but is not limiting, embodiments and aspects of the present invention. Various modifications and alterations within the scope of the present invention will become apparent to those skilled in the art from the detailed description. [Brief explanation of the drawing]

[0023] [Figure 1-1] Figures 1A–C represent schematic diagrams of the C9orf72 gene and the transcripts it produces. Figure 1A shows the structures of both the wild-type C9orf72 allele and the enlarged mutant C9orf72 allele. The location of the G4C2 enlargement on the enlarged mutant allele is indicated (the genomic region between exons 1a and 1b, i.e., in intron 1a). Exons are shown as squares. Adapted from Douglas, op. cit.; see also Rizzu et al. (2016) Acta Neuropathologica Communications 4:37. [Figure 1-2] Figure 1B is a magnified view of the mutant enlarged C9orf72 allele region near the G4C2 enlargement, showing the enlarged allele and associated promoters and transcripts. The approximate locations of promoters involved in sense strand transcription (solid arrows) and antisense transcription (white arrows) are shown. The approximate locations and transcripts of the five different sense transcripts described so far, as well as those in the antisense direction, are also shown. [Figure 1-3]FIG. 1C shows a model of the suppression of the 1a promoter and the antisense promoter by a ZFP-TF targeting an enlarged region, where the ZFP-TF is downstream of both promoters and binds at a position optimal for promoter regulation. The 1b promoter in this model is not suppressed because the binding of the ZFP-TF is upstream of the 1b promoter. [Figure 2-1] FIGS. 2A-D show the suppression of C9orf72 expression ("total C9") in the indicated cell types using the indicated ZFP-TFs. Further, the figures show the suppression of the expression of the longer mRNA isoform (enlarged) containing intron 1a, which is mainly produced by the enlarged mutant allele ("repeat-containing isoform specific"). The enlarged isoform is mainly expressed in C9 patient strains. FIG. 2A illustrates the PCR assay used for the total C9 assay as well as the sense and antisense repeat-containing isoform specific assays. The upper part of the figure represents the genomic structures of the wild-type and enlarged alleles, and the lower part of the figure shows the mRNA products generated from each allele. The set of arrows on the mRNA diagram represents the PCR targets used in the total C9 assay. [Figure 2-2]Figures 2B–D are graphs showing the results of C9orf72 expression assays of different exemplary ZFP-TFs in wild-type cell lines derived from healthy individuals and the fibroblast cell line "C9" derived from ALS patients. The C9 cell line is characterized as "5 / 850," referring to the number of G4C2 repeats on the wild-type allele (5) and the expanded allele (850). Leftmost graph: Total C9orf72 expression ("Total C9") in wild-type cells in the third round of screening ("Round 3"). Second graph from the left: Total C9 in C9 cells in Round 3. Second graph from the right: Total C9 in C9 cells in the second round of screening ("Round 2"). Rightmost graph: Expression from the expanded C9orf72 allele as determined by the isoform-specific C9orf72 assay. Round 2 screening was performed in C9 cells to evaluate isoform (or disease)-specific C9orf72 transcript levels versus total C9 transcript levels after ZFP-TF treatment. In Round 3, total C9 was determined in C9 and wild-type cells to evaluate the effect of ZFP-TF on the wild-type (WT) allele of C9 cells. For each ZFP-TF, mRNA concentrations of 1, 3, 10, 30, 100, and 300 ng are shown from left to right. Figure 2B shows the results for ZFP-TFs 74949, 74951, 74954, 74955, and 74964 in the upper graph, and the results for 74969, 74971, 74973, 74978, and 74979 in the lower graph. Figure 2B discloses Sequence IDs 1, 1, and 3 in order of appearance, respectively. Figure 2C shows the results for ZFP-TF 74983, 74984, 74986, 74987, and 74988 in the upper graph, and the results for 74997, 74998, 75001, and 75003 in the lower graph. Figure 2C discloses sequence numbers 4 and 5 in order of appearance, respectively. Figure 2D shows the results for ZFP-TF 75023, 75027, 75031, 75032, 75055, and 75078 in the upper graph, and the results for 75090, 75105, 75109, 75114, and 75115 in the lower graph. Figure 2D discloses sequence numbers 8-11 in order of appearance, respectively. The sequence at the bottom of the graph represents the DNA binding motif of that ZFP-TF.Each ZFP-TF binds to three hexanucleotide repeats containing its motif. The transcript level was normalized to that of green fluorescent protein (GFP) expressed from GFP mRNA transfected together with ZFP-TF mRNA. The horizontal dotted line in the graph indicates 50% or 70% suppression as shown. For example, for ZFP-TF75115, in the C9 strain, approximately 50% of the total isoform transcripts were suppressed and approximately 70% of the repeat-containing isoform-specific transcripts were suppressed, while in the WT strain, there was minimal suppression of the total isoform. The graph shows that 30% of the transcripts remain, indicating that 70% were suppressed. [Figure 2-3] Same as above. [Figure 2-4] Same as above. [Figure 2-5] Same as above. [Figure 2-6] Same as above. [Figure 2-7] Same as above. [Figure 3] Figure 3 shows a diagram of the promoter regions of sense and antisense transcripts in the C9orf gene expanded allele. Primer pairs for the specific detection of sense, total, and antisense transcripts are shown. AS: Antisense. ddPCR: Droplet digital PCR. The figure discloses SEQ ID NO: 1, 1, and 7 in the order of appearance, respectively. [Figure 4] Figures 4A and 4B show that primers targeting intron 1b specifically detect antisense pre-mRNA. Strand-specific PCR was used to generate sense (S) or antisense (AS) cDNA templates from healthy controls (Con) or C9 cells (C9). For example, C9-AS shows the ddPCR results obtained using an antisense cDNA template generated from RNA isolated from C9 cells. Figure 4A shows that only the cDNA template C9-AS generates a PCR product, indicating the specificity of the primers for the detection of antisense pre-mRNA. Figure 4B extends the experiment in Figure 4A to cell lines derived from seven different C9orf72 patients with different G4C2 repeat lengths and six different healthy control lines. [Figure 5-1] Figures 5A–C are graphs showing transcript repression in C9 cells using repeat-containing isoform-specific assays. Figure 5A shows three experiments in which ZFP-TF74949, 74978, 75003, 75027, 75109, 75114, 75115, 74960, and 74967 were administered at three different doses (30, 100, or 300 ng), and the amount of disease-sense transcript was then measured. Figure 5B shows three experiments measuring disease-antisense transcript. Figure 5C shows three runs measuring total C9orf72 transcript. [Figure 5-2] Same as above. [Figure 5-3] Same as above. [Figure 6] Figure 6 shows the suppression of total C9 transcripts, along with expanded sense and antisense transcripts (disease isoforms), in three different fibroblast cell lines obtained from different ALS patients, each containing different G4C2 repeat counts (approximately 600, 800, and 850 repeats, respectively) in its expanded allele. After cells were exposed to 100 ng of ZFP-TF 75109, 75114, and 75115, the level of suppression was assessed using isoform-selective assays. All three ZFP-TFs maintained selective suppression in all three cell lines. [Figure 7] Figure 7 shows the repression of total C9 transcript in two cell lines obtained from healthy individuals, each with a higher-than-normal number of G4C2 repeats in its allele. Healthy individuals typically have 2–5 G4C2 repeats in each of their C9orf72 alleles. However, some healthy individuals contain more repeats. To ensure sufficient binding sites for ZFP-TF were provided, cell lines containing higher-than-normal repeat counts (5 / 8 and 5 / 20 repeats) were used. In these cell lines, total C9 transcript was minimally affected. [Figure 8-1]Figures 8A–8C show the results of microarray analysis in ALS patient-derived primary fibroblasts (also known as C921 and C9021), mouse primary neurons, and human primary neurons, illustrating the specificity of the indicated repressors (75027, 75109, 75114, and 75115). ZFP-TF75027 targets the repeated GCCCCG (SEQ ID NO: 8) motif, while ZFP-TF75109, 75114, and 75115 target the CCGGCC (SEQ ID NO: 11) motif in the antisense strand of the C9orf72 gene. Figure 8A shows the results of microarray analysis in patient-derived primary fibroblasts (C9021) using the Thermo Fisher Clariom® S assay, which contains 21,000 wells of annotated genes in its database. The analysis was performed 24 hours after administration of 300 ng of repressors in mRNA form to C9021 cells. The graph illustrates genes that are upregulated or downregulated depending on the indicated ZFP-TF. [Figure 8-2] Figure 8B shows the results of microarray analysis in mouse primary neurons using the Thermo Fisher Clariom® D assay, which contains 140,000 annotated and unannotated coding and non-coding transcripts in its database. The analysis was performed 7 days after AAV transduction. All cells were transduced at a MOI of 3,000. The graph illustrates genes that were upregulated or downregulated according to the indicated ZFP-TF. [Figure 8-3] Figure 8C shows the results of microarray analysis in human primary neurons using the Thermo Fisher Clariom® D assay. The analysis was performed 19 days after AAV transduction of cells at a MOI of 3,000. The graph illustrates genes that were upregulated or downregulated according to the indicated ZFP-TF. [Figure 9-1]Figure 9 shows the in vivo targeting involvement of ZFP in C9orf72 BAC transgenic mice. Panel A shows the AAV construct used for injection. The construct contains a synapsin promoter, a ZFP-KRAB coding sequence, and a Venus tag. Panels B and C show the study design in which AAVs containing the ZFP-KRAB expression construct were injected intraventricularly (ICV) into neonates and dismantled one month after injection for downstream analysis. Panel D shows the levels of sense, antisense, and total C9 RNA in animals injected with ZFP-KRAB(75027) in the hippocampus and cortex. Panel E shows representative images of sense and antisense RNA focus, as well as quantifications from the Ammon's horn (CA) and dentate gyrus (DG) regions of the hippocampus in animals injected with ZFP-KRAB(75027). [Figure 9-2] Same as above. [Modes for carrying out the invention]

[0024] This disclosure provides a zinc finger protein-based transcription factor (ZFP-TF) that preferentially targets human C9orf72 gene alleles having an expanded G4C2 repeat region and represses the transcription of these mutant alleles into RNA. Such expanded regions may have more than 30 G4C2 repeats. The ZFP-TF is a fusion protein comprising (i) at least one zinc finger protein (ZFP) domain that specifically binds to a DNA motif in either the sense or antisense strand repeat of a mutant allele, and (ii) at least one transcriptional repressor domain that reduces the transcription of the allele in either or both sense and antisense directions. By introducing the ZFP-TF into a patient's nervous system (e.g., brain and spinal cord), reducing the level of mutant C9orf72 transcripts in neurons is expected to inhibit (e.g., reduce or halt) the formation of disease-induced cytotoxic material within cells. This ZFP-TF may be used for the treatment of C9orf72-related disorders, such as ALS and C9FTD, including prevention and mitigation.

[0025] Methods and compositions for diagnosing, preventing and / or treating ALS and FTD are disclosed herein. In particular, methods and compositions for treating these diseases by modifying (e.g., regulating the expression of) specific genes, including the use of genetically engineered transcription factor repressors and nucleases, are provided herein. In some embodiments, the regulation of expression includes regulating both sense and / or antisense expression.

[0026] Therefore, methods (in vivo, ex vivo, and / or in vitro) for repressing sense and / or antisense transcription of mutant alleles with expanded repeats of the C9orf72 gene in cells (e.g., neurons) are described herein. The methods comprise treating cells with one or more repressors of the mutant C9orf72 gene allele, each comprising a transcriptional repression domain and a DNA-binding domain that binds to a target site in the mutant C9orf72 gene allele. The repressors may include one or more zinc finger protein transcription factors (ZFP-TFs including a ZFP DNA-binding domain), one or more TAL effector domain transcription factors (TALE-TFs including a TAL effector domain DNA-binding domain), and / or one or more CRISPR / Cas transcription factor systems (including a single guide RNA DNA-binding domain). In certain embodiments, two or more different repressors (e.g., one or more pharmaceutical compositions comprising two or more different repressors) are used. In certain embodiments, the C9orf72 gene comprises a mutant allele containing one or more (G4C2) repeats, and the target site bound by the DNA-binding domain of the repressor may be within one or more (G4C2) repeats. Accordingly, the present invention provides the use of one or more ZFP-TF, TALE-TF, or CRISPR / Cas TF repressors (e.g., formulated into one or more pharmaceutical compositions containing one or more repressors) that bind to the expanded mutant C9orf72 allele containing one or more (G4C2) repeats for sense and / or antisense transcription repressors (e.g., up to 50%, 70%, or more compared to untreated cells / subjects) for subjects requiring it (e.g., subjects having ALS and / or FTD, where the disease is treated and / or symptoms are remitted). In certain embodiments, sense and / or antisense transcription is not suppressed beyond 90% of normal (control) levels.In certain embodiments, both antisense and sense transcriptions are suppressed at the same or different levels (e.g., antisense and sense transcriptions are suppressed similarly); antisense transcriptions are suppressed more than sense transcriptions, or sense transcriptions are suppressed more than antisense transcriptions. In certain embodiments, certain sense transcripts are suppressed while others are not. In some embodiments, transcriptions from promoters in 1b intron segments are not suppressed, while transcriptions from promoters in 1a introns and antisense transcripts are suppressed. In certain embodiments, transcripts containing expanded repeats are selectively suppressed (e.g., antisense transcriptions are suppressed, sense transcriptions from 1a promoters are suppressed, and / or sense transcriptions from 1b promoters are not suppressed). In certain embodiments, one or more ZFP-TF repressors containing recognition helix regions, as shown in Table 1, are used, which may be combined with one or more different repressors (e.g., additional different ZFP-TFs, e.g., one or more additional ZFP-TFs containing ZFPs as shown in Table 1) in the methods and uses described herein. In certain embodiments, one or more repressors are administered to cells using one or more non-viral vectors (e.g., as mRNA) and / or viral vectors (e.g., AAVs such as AAV2 / 9). Multiple copies of one or more modulators (e.g., repressors) may be administered using the same or different forms (e.g., mRNA and / or AAVs). In certain embodiments, the same or different forms may be used to deliver one or more different modulators (e.g., repressors). In vivo methods and uses in living subjects (e.g., humans) may include, but are not limited to, administration by any suitable means, including intraventricular, subarachnoid, intracranial, posterior orbital (RO), intravenous, intranasal, and / or intracisional vein (e.g., one or more pharmaceutical compositions comprising repressors and / or polynucleotides encoding repressors). Cerebral administration may be unilateral or bilateral (e.g., to the hippocampus).Any amount (dosage), for example, 1E10 to 1E13 (e.g., 6E11) vg / hemisphere may be administered. Any method and use described herein treats ALS and / or FTD (and / or one or more symptoms of these diseases) in the subject.

[0027] Gene modulators for the C9orf72 gene are provided herein, comprising a DNA-binding domain (e.g., a zinc finger protein (ZFP), a TAL effector domain protein (TALE), or a single guide RNA) that binds to a target site of at least 12 nucleotides in the C9orf72 gene, and a transcriptional regulatory domain (e.g., a repressor domain). Also provided are one or more polynucleotides encoding one or more of the gene modulators described herein (e.g., viral or nonviral gene delivery media, e.g., AAV vectors). In other embodiments, pharmaceutical compositions comprising one or more polynucleotides and / or one or more gene delivery media, as provided herein, are described herein. In some embodiments, the gene modulator comprises a regulator domain, and the gene modulator (and a pharmaceutical composition comprising one or more gene modulators or polynucleotides encoding one or more gene modulators) modulates (e.g., represses or activates) the expression of the C9orf72 gene. The sense and / or antisense strands of the gene may be bound and / or regulated. Also provided herein are isolated cells (including cell populations), one or more polynucleotides, one or more gene delivery media, and / or one or more pharmaceutical compositions, each containing one or more gene modulators as described herein. Methods and uses for regulating the expression (e.g., repression) of the C9orf72 gene in cells [in vitro, in vivo, or ex vivo] are also provided, the methods comprising administering one or more gene modulators, one or more polynucleotides, one or more gene delivery media, and / or one or more pharmaceutical compositions as described herein to cells [but not limited to, by any method including, but not limited to, intraventricular, subarachnoid, intracranial, posterior orbital (RO), intravenous, or cisterna magna].The method may be used for the treatment and / or prevention of amyotrophic lateral sclerosis (ALS) or frontotemporal dementia (FTD) in subjects. The use of one or more gene modulators, one or more polynucleotides, one or more gene delivery media and / or one or more pharmaceutical compositions for the treatment and / or prevention of ALS or FTD in subjects is also provided. Furthermore, a kit is provided, including one or more gene modulators, one or more polynucleotides, one or more gene delivery media and / or one or more pharmaceutical compositions as described herein, and, where appropriate, instructions for use.

[0028] Accordingly, in one embodiment, genetically engineered (non-naturally occurring) gene modulators (e.g., repressors) of one or more genes are provided. These gene modulators may include systems (e.g., zinc finger proteins, TAL effector (TALE) proteins, or CRISPR / dCas-TFs) that regulate (e.g., repress) the expression of alleles. The expression of wild-type and / or mutant alleles may be regulated together or separately. In certain embodiments, the regulation of the mutant allele is at a greater level than that of the wild-type allele (e.g., the wild-type allele is repressed by less than 50% of normal, while the mutant allele is repressed by at least 70% compared to an untreated control). In some embodiments, the regulation of expression may include regulating both the sense and antisense transcripts of the C9orf72 gene. In some embodiments, the regulation of expression may primarily regulate the sense transcript, while in other embodiments, the regulation of expression may primarily regulate the antisense transcript.

[0029] Expanding mutations in the C9orf72 allele result in the expression of both sense and antisense RNA products associated with ALS and FTD. Therefore, in one embodiment, a genetically engineered transcription factor is provided that is designed to suppress the expression of these mutant C9orf72 alleles for the treatment of ALS or FTD. A genetically engineered zinc finger protein or TALE is a zinc finger or TALE protein that does not exist in nature (e.g., by selection and / or rational design) in which the DNA-binding domain (e.g., recognition helix or RVD) is modified to bind to a pre-selected target site. Any of the zinc finger proteins described herein may comprise one, two, three, four, five, six or more zinc fingers, each zinc finger having a recognition helix that binds to a target sub-site in a selected sequence (e.g., a gene). In certain embodiments, a ZFP-TF comprises a ZFP having a recognition helix region as shown in a single column of Table 1. Similarly, any of the TALE proteins described herein may comprise any number of TALE RVDs. In some embodiments, at least one RVD has nonspecific DNA binding. In some embodiments, at least one recognition helix (or RVD) is not naturally occurring. In certain embodiments, TALE-TF includes a TALE that binds to at least 12 base pairs of a target site as shown in Table 1. CRISPR / Cas-TF includes a single guide RNA that binds to a target sequence. In certain embodiments, a genetically engineered transcription factor binds to a target site containing at least 9 to 20 base pairs (e.g., 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more) including a target site of at least 9 to 12 base pairs in a disease-associated gene, e.g., a continuous or discontinuous sequence within these target sites (e.g., target sites as shown in Table 1).In certain embodiments, the gene modulator includes a DNA-binding molecule (ZFP, TALE, single guide RNA) as described herein, operably linked to a transcriptional repression domain (to form a gene repressor).

[0030] Therefore, zinc finger proteins (ZFPs), Cas proteins of the CRISPR / Cas system, or TALE proteins, as described herein, may be operably linked to a regulatory domain (or functional domain) as part of a fusion molecule. The functional domain may be, for example, a transcriptional activation domain, a transcriptional repression domain, and / or a nuclease (cleavage) domain. By selecting either the activation domain or the repression domain for use with a DNA-binding molecule, such molecules may be used to activate or repress gene expression. In certain embodiments, the functional or regulatory domain may play a role in histone post-translational modification. In some examples, the domain is a histone acetyltransferase (HAT), histone deacetylase (HDAC), histone methylase, or other enzyme domain that enables gene repression regulated by histone SUMOylation or biotinylation or post-translational histone modification [Kousarides, (2007) Cell 128:693-705]. In some embodiments, molecules are provided comprising a ZFP, dCas, or TALE targeting a gene (e.g., C9orf72) as described herein, fused to a transcriptional repression domain that can be used to downregulate gene expression. In some embodiments, the methods and compositions of the present invention are useful for treating eukaryotes. In certain embodiments, the activity of the regulatory domain is regulated by an exogenous small molecule or ligand, and as a result, interaction with the cellular transcription mechanism does not occur in the absence of the exogenous ligand. Such an exogenous ligand controls the degree of interaction between the ZFP-TF, CRISPR / Cas-TF, or TALE-TF with the transcription mechanism. The regulatory domain can be operably ligated to one or more arbitrary parts of the ZFP, dCas, or TALE, including between one or more ZFPs, dCas, or TALEs, outside one or more ZFPs, dCas, or TALEs, and any combination thereof. In preferred embodiments, the regulatory domain results in repression of the gene expression of the targeted gene (e.g., C9orf72).Any of the fusion proteins described herein can be formulated into pharmaceutical compositions.

[0031] In some embodiments, the artificial regulator binds to the promoter region upstream of the transcription start site (TSS) of the gene (e.g., at 5'). In some embodiments, the artificial regulator binds to the region downstream of the TSS. In preferred embodiments, the artificial regulator preferentially binds to the expanded repeat region in the C9orf72 gene. In some embodiments, binding of the artificial regulator to the C9orf72 gene represses promoter expression in the 1a intron. In some embodiments, binding of the artificial regulator to the C9orf72 gene represses promoter expression in the 1b intron. In some embodiments, binding of the artificial regulator represses expression from the 1a promoter and antisense promoter, but not from the 1b promoter. See also Figures 1B and 1C.

[0032] In some embodiments, the methods and compositions of the present invention involve the use of two or more fusion molecules, such as two or more C9orf72 modulators (artificial transcription factors), as described herein. The two or more fusion molecules may bind to different target sites and may contain identical or different functional domains. Alternatively, the two or more fusion molecules, as described herein, may bind to the same target site but contain different functional domains. In some examples, three or more fusion molecules are used, in others four or more fusion molecules are used, and in others five or more fusion molecules are used. In some embodiments, two or more, three or more, four or more, or five or more fusion molecules (or their components) are delivered to cells as nucleic acids. In preferred embodiments, the fusion molecules cause repression of the expression of a targeted gene. In some embodiments, the two fusion molecules are given in doses in which each molecule is active individually, but the combination results in additive repressive activity. In some embodiments, the two fusion molecules are given in doses in which neither is active individually, but the combination results in synergistic repressive activity.

[0033] In yet another embodiment, a polynucleotide encoding any of the DNA-binding domains described herein is provided.

[0034] In some embodiments, the polynucleotide encoding the DNA-binding protein is mRNA. In some embodiments, the mRNA may be chemically modified [e.g., Kormann et al., (2011) Nature Biotechnology 29(2):154-7]. In other embodiments, the mRNA may contain an ARCA cap (see U.S. Patents 7,074,596 and 8,153,773). In further embodiments, the mRNA may contain a mixture of unmodified and modified nucleotides (see U.S. Patent Publication 2012 / 0195936).

[0035] In yet another embodiment, gene delivery vectors comprising any of the polynucleotides (e.g., repressors) described herein are provided. In certain embodiments, the vector is an adenovirus vector (e.g., Ad5 / F35 vector), a lentiviral vector (LV) including an embedded competent or embedded defective lentivirus vector, or an adenovirus-associated virus vector (AAV). In certain embodiments, the AAV vector is an AAV2, AAV6, AAV8, or AAV9 vector or a pseudotype AAV vector, e.g., AAV2 / 8, AAV2 / 5, AAV2 / 9, and AAV2 / 6. In some embodiments, the AAV vector is a blood-brain barrier-penetrating AAV vector (e.g., U.S. Patent Publication 2015 / 0079038). In other embodiments, the AAV is a self-complementary AAV (sc-AAV) or single-stranded (ss-AAV) molecule. Also provided herein are adenovirus (Ad) vectors, LVs, or adenovirus-associated virus vectors (AAVs) comprising a sequence encoding at least one nuclease (ZFN or TALEN) and / or a donor sequence for targeted integration into a target gene. In certain embodiments, the Ad vector is a chimeric Ad vector, e.g., an Ad5 / F35 vector. In certain embodiments, the lentiviral vector is an integrase-deficient lentiviral vector (IDLV) or an integrated competent lentiviral vector. In certain embodiments, the vector is a pseudotype having a VSV-G envelope or other envelopes.

[0036] Furthermore, pharmaceutical compositions are also provided that include fusions of nucleic acids and / or artificial transcription factors (e.g., ZFP, Cas, or TALE or fusion molecules containing ZFP, Cas, or TALE). For example, a particular composition includes a nucleic acid comprising a sequence encoding one of the ZFP, Cas, or TALE described herein, operably linked to a regulatory sequence, combined with a pharmaceutically acceptable carrier or diluent, the regulatory sequence enabling the expression of the nucleic acid in a cell. In certain embodiments, the encoded ZFP, Cas, CRISPR / Cas, or TALE modulates wild-type and / or mutant alleles. In some embodiments, the mutant allele is preferentially modulated over the wild-type allele, e.g., repressed. In some embodiments, the pharmaceutical composition includes a ZFP, CRISPR / Cas, or TALE that preferentially modulates the mutant allele and a ZFP, CRISPR / Cas, or TALE that modulates neurotrophic factors. Protein-based compositions include one or more of the ZFP, CRISPR / Cas, or TALE disclosed herein and a pharmaceutically acceptable carrier or diluent.

[0037] In yet another embodiment, isolated cells comprising any of the proteins, fusion molecules, polynucleotides and / or compositions described herein are also provided. Isolated cells may be used for non-therapeutic uses such as providing cell or animal models for diagnostic and / or screening methods, and for therapeutic uses such as exovivo cell therapy.

[0038] In yet another embodiment, pharmaceutical compositions are also provided, comprising one or more gene modulators, one or more polynucleotides (e.g., gene delivery media), and / or one or more isolated cells (e.g., a population thereof), as described herein. In certain embodiments, the pharmaceutical composition comprises two or more gene modulators. For example, certain compositions comprise nucleic acids comprising sequences encoding one or more gene modulators of one of the genes associated with rare diseases as described herein (e.g., C9orf72). In certain embodiments, the gene modulators (e.g., ZFP, Cas, or TALE as described herein) are operably ligated to a regulatory sequence and combined with a pharmaceutically acceptable carrier or diluent, and the regulatory sequence enables the expression of nucleic acids in cells. In certain embodiments, the encoded ZFP, CRISPR / Cas, or TALE is specific to a mutant or wild-type allele (e.g., C9orf72). In some embodiments, the pharmaceutical composition comprises a ZFP-TF, CRISPR / Cas-TF, or TALE-TF that modulates a mutant and / or wild-type allele (e.g., C9orf72), and includes a TF that preferentially modulates (e.g., represses at a greater level) the mutant allele compared to the wild-type allele. The protein-based composition comprises one or more gene modulators and a pharmaceutically acceptable carrier or diluent, as disclosed herein. In certain embodiments, a composition comprising two or more gene modulators (held in the same or different types of vectors, e.g., an AAV vector) is used, one of which may include a ZFP-TF repressor containing a ZFP named 74949, 74978, 75027, or 75109.

[0039] The present invention also provides methods and uses for suppressing gene expression in subjects requiring it (e.g., subjects with rare diseases as described herein), comprising providing the subject with one or more polynucleotides, one or more gene delivery media and / or pharmaceutical compositions as described herein. In certain embodiments, the compositions described herein are used to suppress mutant C9orf72 expression in subjects, including for the treatment and / or prevention of ALS or FTD. The compositions described herein suppress gene expression for extended periods (4 weeks, 3 months, 6 months to 1 year or more) in the brain (including but not limited to the entorhinal cortex, hippocampus, brainstem, striatum, thalamus, midbrain, cerebellum, prefrontal cortex, parietal cortical lobe, occipital cortical lobe, temporal cortical lobe, and prefrontal cortical lobe) and spinal cord (including but not limited to the lumbar, thoracic, and cervical spinal cord regions). The compositions described herein may be provided to a target by any means of administration, including but not limited to intraventricular, subarachnoid, intracranial, intravenous, orbital [posterior orbital (RO)], intranasal, and / or cisterna magna administration. Kits are also provided that include one or more of the compositions described herein (e.g., gene modulators, polynucleotides, pharmaceutical compositions, and / or cells) and instructions for the use of these compositions.

[0040] In another embodiment, methods for treating and / or preventing CNS (e.g., ALS and / or FTD) using methods and compositions described herein are provided herein. In some embodiments, the methods involve compositions in which polynucleotides and / or proteins may be delivered using viral vectors, non-viral vectors (e.g., plasmids) and / or combinations thereof. In some embodiments, the methods involve compositions comprising a population of stem cells comprising artificial transcription factors (e.g., ZFP-TF, TALE-TF, or dCas-TF). Administration of compositions such as those described herein (proteins, polynucleotides, cells and / or pharmaceutical compositions comprising these proteins, polynucleotides and / or cells) results in therapeutic (clinical) effects including, but not limited to, remission or elimination of any of the clinical symptoms associated with ALS and / or FTD and an increase in the function and / or number of CNS cells (e.g., neurons, astrocytes, myelin, etc.). In certain embodiments, the compositions and methods described herein reduce the expression of sense and / or antisense transcripts of a target gene (e.g., C9orf72) by at least 30% or 40%, for example, at least 50%, at least 70%, at least 80%, at least 90%, at least 95%, or more than 95%, compared to a control that has not received an artificial repressor as described herein. In some embodiments, a reduction of at least 50% is achieved. In certain embodiments, the artificial repressor preferentially represses the mutant allele (e.g., an expanded allele) by at least 20% compared to the wild-type allele (e.g., repressing the wild-type allele by 50% or less and the mutant allele by at least 70%). In some embodiments, the repressor preferentially represses sense transcripts on the mutant allele, and in other embodiments, the repressor preferentially represses antisense transcripts on the mutant allele. In some embodiments, the repressor represses both sense and antisense transcripts on the mutant allele.

[0041] In further embodiments, methods for delivering gene repressors to the target brain using viral or nonviral vectors are described herein. In certain embodiments, the viral vector is an AAV9 vector. Delivery may be to any brain region, e.g., the hippocampus or entorhinal cortex, by any preferred means, including the use of a cannula. Any AAV vector that provides broad delivery of a gene modulator (e.g., a repressor) to the target brain, including by anterograde and retrograde axonal transport to brain regions, not by a directly administered vector (e.g., delivery to the putamen results in delivery to other structures such as the cortex, substantia nigra, thalamus, etc.). In certain embodiments, the subject is a human, and in other embodiments, the subject is a non-human primate. Administration may be a single dose, a series of doses given simultaneously, or multiple doses (at any time between doses).

[0042] Accordingly, in other embodiments, methods for preventing and / or treating a disease (e.g., ALS and / or FTD) in a subject, comprising administering a gene repressor to the subject using an AAV, are described herein. In certain embodiments, the repressor is administered to the CNS (e.g., hippocampus and / or entorhinal cortex) or PNS (e.g., spinal fluid) of the subject. In other embodiments, the repressor is administered intravenously. In certain embodiments, methods for preventing and / or treating ALS or FTD in a subject, comprising administering a repressor of the C9orf72 allele (wild-type and / or mutant) to the subject using one or more AAV vectors, are described herein. In certain embodiments, the AAV encoding the gene modulator is administered to the CNS (brain and / or CSF) by any delivery method, including, but not limited to, intraventricular, subarachnoid, intracranial, intravenous, intranasal, posterior orbital, or cisterna magna delivery. In other embodiments, the AAV encoding the repressor is administered directly into the target parenchyma tissue (e.g., the hippocampus and / or entorhinal cortex). In other embodiments, the AAV encoding the repressor is administered intravenously (IV). In any of the methods described herein, administration may be performed once (single dose) or multiple times at the same or different doses per dose (using any number of times between doses). If multiple doses are administered, the same or different doses and / or delivery media may be used (e.g., different AAV vectors administered IV and / or ICV). The methods all include methods for reducing loss of muscle function, loss of physical coordination, muscle stiffness, muscle spasms, loss of speech function, dysphagia, cognitive impairment, loss of motor function, and / or loss of one or more cognitive functions in ALS subjects, compared to subjects who have not received the method or to the subject themselves prior to receiving the method.Accordingly, the methods described herein result in a reduction of biomarkers and / or symptoms of rare diseases such as ALS or FTD, including: loss of muscle function, loss of physical coordination, muscle stiffness, muscle spasms, loss of speech function, dysphagia, cognitive impairment, changes in blood and / or cerebrospinal fluid chemicals associated with ALS, including G-CSF, IL-2, IL-15, IL-17, MCP-1, MIP-1α, TNF-α, and VEGF levels [see Chen et al., Front Immunol. (2018) 9:2122], and / or one or more other biomarkers known in the art. In certain embodiments, the methods may further include, for example, administering one or more gene repressors of tau (MAPT) to a subject having FTD. See, for example, U.S. Patent Publication 2018 / 0153921.

[0043] In any of the methods described herein, the target allele repressor may be a ZFP-TF, for example, a fusion protein comprising a ZFP that specifically binds to the allele and a transcriptional repression domain (e.g., KOX, KRAB). In other embodiments, the target allele repressor may be a TALE-TF, for example, a fusion protein comprising a TALE polypeptide that specifically binds to the gene allele and a transcriptional repression domain (e.g., KOX, KRAB). In some embodiments, the target allele repressor is a CRISPR / Cas-TF, in which the nuclease domain in the Cas protein is inactivated, resulting in the protein no longer cleaving DNA. The resulting Cas RNA-guided DNA-binding domain is fused to a transcriptional repressor (e.g., KOX, KRAB) to repress the target allele. In some embodiments, the genetically engineered transcription factor can repress the expression of the mutant allele but not the wild-type allele. In further embodiments, the DNA-binding molecule preferentially recognizes the hexamer GGGGCC (SEQ ID NO: 1) expansion.

[0044] In some embodiments, sequences encoding gene repressors (e.g., ZFP-TF, TALE-TF, or CRISPR / Cas-TF) as described herein are inserted (integrated) into the genome, while in other embodiments, the repressor-encoding sequences are maintained in the episome. In some examples, the nucleic acid encoding the TF fusion is inserted into a safe harbor site containing a promoter (e.g., by nuclease-mediated integration), resulting in an endogenous promoter driving expression. In other embodiments, the repressor (TF) donor sequence is inserted into a safe harbor site (by nuclease-mediated integration), and the donor sequence contains a promoter that drives the expression of the repressor. In some embodiments, the promoter sequence is broadly expressed, while in other embodiments, the promoter is tissue or cell / type specific. In preferred embodiments, the promoter sequence is specific to nerve cells. In other embodiments, the promoter sequence is specific to muscle cells. In some embodiments, the selected promoter is characterized by having low expression. Non-limiting examples of useful promoters include the neutral-specific promoters NSE, Synapsin, CAMKiia, and MECP. Non-limiting examples of ubiquitous promoters include CMV, CAG, and Ubc. Further embodiments include the use of self-regulating promoters, as described in U.S. Patent Publication 2015 / 0267205. Further embodiments include the use of self-regulating promoters, as described in U.S. Patent Publication 2015 / 0267205.

[0045] In any of the methods described herein, the method may result in suppression of a target allele (e.g., mutant or wild-type C9orf72) by about 50%, 55%, 60%, 65%, about 70%, about 75%, about 85%, about 90%, about 92%, or about 95%, 98%, or 99% or more in one or more neurons of a subject (e.g., a subject having ALS). In certain embodiments, the expression of the wild-type allele is suppressed by 50% or less in the subject (compared to an untreated subject), and the mutant allele is suppressed by at least 70% (70% or any value greater than that) in the subject (compared to an untreated subject). In some embodiments, the expression of the antisense promoter is suppressed by at least 70%. In a particular embodiment, the expression of the antisense promoter found in the C9orf72 intron 1a, 1b, and / or 1c regions is suppressed by at least 70%, while the expression of the sense promoter in the C9orf72 intron 1b region is suppressed by 50% or less.

[0046] In any of the methods described herein, the regulator (e.g., a repressor or activator) may be delivered to the target as a protein, a polynucleotide, or any combination of protein and polynucleotide. In certain embodiments, one or more repressors are delivered using an AAV vector. In other embodiments, at least one component of the regulator (e.g., a CRISPR / Cas system sgRNA) is delivered in RNA form. In other embodiments, the regulator is delivered using any combination of the expression constructs described herein, e.g., one repressor (or part thereof) on one expression construct (AAV9) and one repressor (or part thereof) on a separate expression construct (AAV or other viral or nonviral construct).

[0047] Furthermore, in any of the methods described herein, the regulator (e.g., repressor) may be delivered to cells at any concentration (dose) that provides the desired effect (ex vivo or in vivo). In some embodiments, the regulator is delivered using an adeno-associated virus (AAV) vector at 10,000 to 500,000 vector genomes / cell (or any value in between). In certain embodiments, the regulator is delivered using a lentiviral vector at an MOI between 250 and 1,000 (or any value in between). In other embodiments, the regulator is delivered using a plasmid vector at 0.01 to 1,000 ng / 100,000 cells (or any value in between). In other embodiments, the repressor is delivered as mRNA at 150 to 1,500 ng / 100,000 cells (or any value in between). Furthermore, for in vivo use, the gene modulator (e.g., repressor) may be delivered in any concentration (dose) that produces the desired effect in the target in which it is needed, using any of the methods described herein. In some embodiments, the repressor is delivered using an adeno-associated virus (AAV) vector at 10,000 to 500,000 vector genomes / cell (or any value in between). In certain embodiments, the repressor is delivered using a lentiviral vector at an MOI between 250 and 1,000 (or any value in between). In other embodiments, the repressor is delivered using a plasmid vector at 0.01 to 1,000 ng / 100,000 cells (or any value in between). In other embodiments, the repressor is delivered as mRNA at a concentration of 0.01–3000 ng / cell (e.g., 50,000–200,000 cells (e.g., 100,000) or any value in between). In other embodiments, the repressor is delivered to brain parenchymal tissue at a concentration of 1E11–1E14 VG / ml using a fixed-volume adeno-associated virus (AAV) vector of 1–300 μL.In other embodiments, the repressor is delivered to the CSF at a fixed volume of 0.5–10 ml of adeno-associated virus (AAV) vector at 1E11–1E14 VG / ml.

[0048] In any of the methods described herein, the method may result in regulation (e.g., suppression) of the targeted allele by about 50% or more, 55% or more, 60% or more, 65% or more, about 70% or more, about 75% or more, about 85% or more, about 90% or more, about 92% or more, or about 95% or more in one or more cells of interest. In some embodiments, wild-type and mutant alleles are regulated differently, for example, the mutant allele is preferentially modified compared to the wild-type allele (e.g., the mutant allele is suppressed by at least 70%, while the wild-type allele is suppressed by 50% or less).

[0049] In any of the methods described herein, the method may result in regulation (e.g., repression) of antisense expression of the targeted allele(s) in one or more cells of interest by about 50% or more, 55% or more, 60% or more, 65% or more, about 70% or more, about 75% or more, about 85% or more, about 90% or more, about 92% or more, or about 95% or more. In some embodiments, sense expression and antisense expression in mutant alleles are regulated differently, for example, the expression of antisense transcripts is preferentially regulated compared to the expression of sense transcripts in mutant alleles (e.g., antisense expression is repressed by at least 70%, and sense expression is repressed by 50% or less).

[0050] In further embodiments, one or more transcription factors described herein, such as zinc finger protein (ZFP-TF), TALE (TALE-TF), and CRISPR / Cas-TF, e.g., ZFP-TF, TALE-TF, or CRISPR / Cas-TF, are used to suppress the expression of mutant and / or wild-type alleles (e.g., C9orf72) in the brain (e.g., neurons) of interest. The suppression may be about 50% or more, 55% or more, 60% or more, 65% or more, 70% or more, about 75% or more, about 85% or more, about 90% or more, about 92% or more, or about 95% or more of the targeted allele in one or more cells of interest compared to untreated (wild-type) cells of interest. In certain embodiments, the suppression of the wild-type allele is 50% or less (compared to untreated cells or interest), and the suppression of mutants (affected or isoform variants) is at least 70% (compared to untreated cells or interest). In certain embodiments, antisense transcription is completely (sufficiently) repressed. In certain embodiments, the repression of sense transcripts is 50% or less (compared to untreated cells or control), and the repression of antisense transcripts is at least 70% (compared to untreated cells or control). In certain embodiments, modulation of a targeted transcription factor may be used to achieve one or more of the methods described herein.

[0051] Accordingly, methods and compositions for modulating the expression of genes associated with rare disorders disclosed herein, including suppression with or without the use of exogenous sequences (such as artificial TFs), are described herein. Compositions and methods may be for in vitro (e.g., for providing cells for the study of target genes, for drug discovery and / or for the creation of transgenic animals and animal models, by their modulation), in vivo, or ex vivo use, and may include administering an artificial transcription factor or nuclease containing a DNA-binding molecule that targets a gene associated with a rare disease, in the case of a nuclease having a donor that is incorporated into the gene after cleavage by the nuclease. In some embodiments, the donor gene (transgene) is maintained extrachromosomally in the cell. In certain embodiments, the cells are in a patient with the disease. In other embodiments, the cells are modified by any of the methods described herein, and the modified cells are administered to a subject in need (e.g., a subject with a rare disease). Also provided are genetically modified cells (e.g., stem cells, precursor cells, T cells, muscle cells, etc.) containing genetically modified genes (e.g., exogenous sequences), including cells produced by the methods described herein. These cells may be used to provide therapeutic proteins to subjects with rare diseases, for example, by administering the cells to a subject in need, or by isolating proteins produced by the cells and administering the proteins to a subject in need (enzyme substitution therapy).

[0052] Also provided are kits comprising one or more polynucleotides that include components of gene modulators (e.g., repressors) and / or target modulators (or their components) as described herein, and / or polynucleotides that encode target modulators (or their components). The kit may further include instructions for use, including cells (e.g., neurons or muscle cells), reagents (e.g., for detecting and / or quantifying proteins in CSF) and / or methods as described herein.

[0053] The method and composition are described in further detail below.

[0054] I. Zinc finger protein transcription factors This ZFP-TF is a fusion protein containing a DNA-binding zinc finger protein (ZFP) domain and a transcriptional repressor domain, the two domains of which may associate with each other directly by peptidyl linkage, via a peptide linker, or by dimerization (e.g., via a leucine zipper, STAT protein N-terminal domain, or FK506-binding protein). In this specification, “fusion protein” refers to a complex of polypeptides having covalently linked domains and polypeptides that are non-covalently associated with each other. The transcriptional repressor domain may associate with the ZFP domain at any suitable position, including the C-terminus or N-terminus of the ZFP domain.

[0055] In some embodiments, the ZFP-TF suppresses the transcription of the human mutant C9orf72 gene by 45% or more (e.g., 50%, 60%, 70%, 80%, 90%, or 95% or more). In some embodiments, two or more of the ZFP-TFs are used simultaneously in a patient, and the ZFP-TFs bind to different DNA motifs in the sense and / or antisense strands of the expanded C9orf72 region to achieve optimal suppression of mutant C9orf72 transcription.

[0056] Targets of the A.ZFP domain The ZFP domain of this fusion protein preferentially binds to the enlarged region in the mutant human C9orf72 gene allele. The human C9orf72 gene is located at position 21.2 (9p21.2) on the short (p) arm of chromosome 9. It spans base pairs 27,546,546 to 27,573,866 on the chromosome. The genome structure of human C9orf72 is shown in Figure 1A. The DNA-binding ZFP domain of the ZFP-TF directs the fusion protein to the enlarged repeat region of the mutant C9orf72 gene, bringing the transcriptional repressor domain of the fusion protein to the target region. The repressor domain then represses C9orf72 gene transcription by RNA polymerase.

[0057] In some embodiments, the target sequence in the expanded region is at least 8 bp long. For example, the target sequence may be 8 bp to 40 bp long, e.g., 12, 15, 16, 17, 18, 19, 20, 21, 24, 27, 30, 33, or 36 bp long. In certain embodiments, the target sequence of this ZFP-TF is 12 to 20 (e.g., 12 to 18, 15 to 19, 15, 18, or 19) bp long. In some embodiments, the target sequence includes non-contiguous subsequences.

[0058] The G4C2 repeat generates the following hexanucleotide DNA motifs in the sense and antisense strands of a gene: Sense C9orf72 motif in chain: (i) GGGGCC (Sequence ID 1) (ii) GGGCCG (Sequence No. 2) (iii) GGCCGG (Sequence No. 3) (iv) GCCGGG (Sequence 4) (v) CCGGGG (Sequence No. 5) (vi) CGGGGC (Sequence ID 6)

[0059] Antisense C9orf72 motif in chain: (vii) GGCCCC (Sequence No. 7) (viii) GCCCCG (Sequence No. 8) (ix) CCCCGG (Sequence ID 9) (x) CCCGGC (Sequence ID 10) (xi) CCGGCC (Sequence ID 11) (xii) CGGCCC (Sequence ID 12)

[0060] In some embodiments, the target sequence of the ZFP-TF includes one or more (e.g., two, three, or four) tandem repeats of these DNA motifs. In some embodiments, the target sequence consists of three tandem repeats of one of the motifs. In some embodiments, the target sequence includes one or more (e.g., two or three) tandem repeats of the motif and a small number of (e.g., one, two, three, four, or five) nucleotides (e.g., CC(G4C2)2GG) (SEQ ID NO: 75) from upstream and / or downstream adjacent sequences.

[0061] The target sequence may be located on either the sense strand or the antisense strand of a gene. In certain embodiments, the ZFP-TF used in a patient binds to both the sense and antisense strands of the mutant allele. To ensure targeting accuracy and reduce off-target binding by the ZFP-TF, the selected C9orf72 target region sequence preferably has less than 75% homology (e.g., less than 70%, less than 65%, less than 60%, or less than 50%) to sequences in other genes in the genome.

[0062] Other criteria for further evaluating target segments include the historical availability of ZFP bindings to such segments or related segments, the ease of designing novel ZFPs to bind to a given target segment, and the risk of off-target binding.

[0063] B. Zinc finger protein domain A "zinc finger protein" or "ZFP" refers to a protein that has a DNA-binding domain stabilized by zinc. ZFPs bind to DNA in a sequence-specific manner. Each DNA-binding domain is called a "finger." A ZFP has at least one finger, and each finger binds to 2-4 base pairs of DNA, usually 3 or 4 base pairs. Each zinc finger typically contains about 30 amino acids that chelate zinc. Genetically engineered ZFPs may have novel binding specificity compared to naturally occurring zinc finger proteins. Genetic engineering methods include, but are not limited to, rational design and various types of selection. Rational design includes, for example, using a database containing triplet (or quadruplet) nucleotide sequences and individual zinc finger amino acid sequences, where each triplet or quadruplet nucleotide sequence is associated with one or more amino acid sequences of zinc fingers that bind to a particular triplet or quadruplet sequence. For example, U.S. Patent Nos. 5,789,538, 5,925,523, 6,007,988, 6,013,453, 6,140,081, 6,200,759, 6,453,242, 6,534,261, 6,979,539, 8,586,526, 8,841,260, 8,956,828 and 9,234,016, as well as International Patents. See the ZFP design method described in detail in Public Publications WO95 / 19431, WO96 / 06166, WO98 / 53057, WO98 / 53058, WO98 / 53059, WO98 / 53060, WO98 / 54311, WO00 / 27878, WO01 / 60970, WO01 / 88197, WO02 / 016536, WO02 / 099084 and WO03 / 016496.

[0064] The ZFP domain of this ZFP-TF may contain at least three (e.g., 4, 5, 6, 7, 8, 9, 10, 11, 12, 13 or more) zinc fingers. A ZFP domain with three fingers typically recognizes target sites containing 9–12 nucleotides. A ZFP domain with four fingers typically recognizes target sites containing 12–15 nucleotides. A ZFP domain with five fingers typically recognizes target sites containing 15–18 nucleotides. A ZFP domain with six fingers can recognize target sites containing 18–21 nucleotides.

[0065] The target specificity of a ZFP domain can be improved by mutations in the ZFP backbone, for example, as described in U.S. Patent Publication 2018 / 0087072. Mutations include those made to residues in the ZFP backbone that can interact nonspecifically with phosphates on the DNA backbone but do not contribute to nucleotide target specificity. In some embodiments, these mutations include mutating cationic amino acid residues to neutral or anionic amino acid residues. In some embodiments, these mutations include mutating polar amino acid residues to neutral or nonpolar amino acid residues. In further embodiments, mutations are made at the (-5), (-9), and / or (-14) positions relative to the DNA-binding helix. In some embodiments, a zinc finger may include one or more mutations at the (-5), (-9), and / or (-14) positions. In further embodiments, one or more zinc fingers in a multifinger ZFP domain may include mutations at the (-5), (-9), and / or (-14) positions. In some embodiments, amino acids at positions (-5), (-9), and / or (-14) (e.g., arginine (R) or lysine (K)) are mutated to alanine (A), leucine (L), Ser (S), Asp (N), Glu (E), Tyr (Y), and / or glutamine (Q). In some embodiments, the R residue at position (-5) is mutated to Q.

[0066] Alternatively, the DNA-binding domain may be derived from a nuclease. For example, the recognition sequences of homing endonucleases and meganucleases such as I-SceI, I-CeuI, PI-PspI, PI-Sce, I-SceIV, I-CsmI, I-PanI, I-SceII, I-PpoI, I-SceIII, I-CreI, I-TevI, I-TevII, and I-TevIII are known. See also U.S. Patents 5,420,032 and 6,833,252; Belfort et al., Nucleic Acids Res. (1997) 25:3379-88; Dujon et al., Gene (1989) 82:115-8; Perler et al., Nucleic Acids Res. (1994) 22:1125-7; Jasin, Trends Genet. (1996) 12:224-8; Gimble et al., J. Mol Biol. (1996) 263:163-80; Argast et al., J. Mol Biol. (1998) 280:345-53; and the New England Biolabs catalog.

[0067] In some embodiments, the ZFP-TF comprises one or more zinc finger domains. The domains may be linked together via an expandable mobile linker, resulting in, for example, one domain comprising one or more (e.g., 4, 5, or 6) zinc fingers and another domain comprising an additional one or more (e.g., 4, 5, or 6) zinc fingers. In some embodiments, the linker is a standard interfinger linker, resulting in a finger array comprising one DNA-binding domain containing 8, 9, 10, 11, or 12 or more fingers. In other embodiments, the linker is an atypical linker, such as a mobile linker. For example, two ZFP domains may be linked to a transcriptional repressor TF in configuration (N-terminus to C-terminus) ZFP-ZFP-TF, TF-ZFP-ZFP, ZFP-TF-ZFP, or ZFP-TF-ZFP-TF (two ZFP-TF fusion proteins fused together via a linker).

[0068] In some embodiments, ZFP-TFs are "two-handed," meaning they contain two zinc finger clusters (two ZFP domains) separated by an intervening amino acid, resulting in the two ZFP domains binding to two discontinuous target sites. SIP1 is an example of a two-handed zinc finger-binding protein, where a cluster of four zinc fingers is located at the amino terminus of the protein, and a cluster of three fingers is located at the carboxyl terminus [see Remacle et al., EMBO J. (1999) 18(18):5073-84]. Each zinc finger cluster in these proteins can bind to a unique target sequence, and the space between the two target sequences can contain a large number of nucleotides.

[0069] In alternative embodiments, a protein functionally similar to ZFP-TF may be used in place of ZFP-TF. For example, instead of a ZFP domain, the transcriptional repressor fusion protein may include a DNA-binding domain derived from a transcriptional activator-like effector (TALE) DNA-binding domain. See, for example, U.S. Patents 8,586,526 and 9,458,205, U.S. Patent Publications 2013 / 0196373 and 2013 / 0253040, WO2010 / 079430, Schornack et al., J Plant Physiol (2006) 163(3):256-72), Kay et al., Science (2007) 318:648-51, Moscou and Bogdanove, Science (2009) 326:1501, and Boch et al., Science (2009) 326:1509-12. In yet another example, a transcriptional repressor fusion protein may contain a DNA-binding domain that is a single guide RNA of the CRISPR / Cas system. See, for example, U.S. Patent Publication No. 2015 / 0056705, Jinek et al., Science (2012) 337:816; Ramalingam et al., Genome Biol. (2013) 14:107; and Hwang et al., (2013) Nature Biotechnology 31(3):227.

[0070] C. Transcriptional repressor domain This ZFP-TF contains one or more transcriptional repressor domains that weaken the transcriptional activity of the mutant C9orf72 allele. Not limited examples of transcriptional repressor domains include the KRAB domain of KOX1, KAP-1, MAD, FKHR, EGR-1, ERD, SID, TGF-beta-inducible early gene (TIEG), v-ERB-A, MBD2, MBD3, members of the DNMT family (e.g., DNMT1, DNMT3A, DNMT3B), Rb, and MeCP2. See, for example, Bird et al., Cell (1999) 99:451-54; Tyler et al., Cell (1999) 99:443-46; Knoepfler et al., Cell (1999) 99:447-50; and Robertson et al., Nature Genet. (2000) 25:338-42. Further exemplary inhibitory domains, though not limited to these, include ROM2 and AtHD2A. See, for example, Chem et al., Plant Cell (1996) 8:305-21; and Wu et al., Plant J. (2000) 22:19-27.

[0071] In some embodiments, the transcriptional repressor domain contains a sequence derived from the Kruppel-associated box (KRAB) domain of human zinc finger protein 10 / KOX1 (ZNF10 / KOX1) (e.g., GenBank number NM_015394.4). An exemplary KRAB domain sequence is as follows: DAKSLTAWSR TLVTFKDVFV DFTREEWKLL DTAQQIVYRN VMLENYKNLV SLGYQLTKPD VILRLEKGEE PWLVEREIHQ ETHPDSETAF EIKSSV (Sequence ID 13)

[0072] Variants of this KRAB sequence can also be used, as long as they possess the same or similar transcriptional repressor function.

[0073] D. peptide linker The ZFP domain and transcriptional repressor domain of this ZFP-TF, and / or the zinc finger within the ZFP domain, can be linked via a peptide linker, for example, a non-cleavable peptide linker of about 5 to 200 amino acids (e.g., 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more amino acids). Some preferred linkers are mobile amino acid sequences synthesized as recombinant fusion proteins. See, for example, the above description and U.S. Patents 6,479,626, 6,903,185, 7,153,949, 8,772,453 and 9,163,245, and WO2011 / 139349. The proteins described herein may include any combination of suitable linkers. Examples of linkers that are not limited to this include DGGGS (sequence number 14), TGEKP (sequence number 15), LRQKDGERP (sequence number 16), GGRR (sequence number 17), GGRRGGGS (sequence number 18), LQRDGERP (sequence number 19), LRQKDGGGSERP (sequence number 20), LRQKD(G3S)2ERP (sequence number 21), TGSQKP (sequence number 22), LRQKDAARGS (sequence number 26), and LRQKDAARGSGG (sequence number 76).

[0074] In some embodiments, the peptide linker is 3 to 20 amino acid residues in length and is rich in G and / or S. An example of such a linker, though not limited to this, is a G4S type linker (disclosed as "G4S" in SEQ ID NO: 23), i.e., a linker containing one or more (e.g., two, three, or four) GGGGS (SEQ ID NO: 23) motifs or variations of the motif (e.g., having one, two, or three amino acid insertions, deletions, and substitutions in the motif).

[0075] In some embodiments, the ZFP-TF includes a nuclear localization signal (e.g., derived from the SV40 medium T antigen) and / or an epitope tag (e.g., FLAG and hemagglutinin).

[0076] II. Expression of ZFP-TF The ZFP-TFs of this disclosure may be introduced into a patient by a nucleic acid molecule encoding them. For example, the nucleic acid molecule may be an RNA molecule, which is introduced into the patient's brain by injection of a composition containing a lipid:nucleic acid complex (e.g., liposome). Alternatively, the ZFP-TFs may be introduced into a patient by a nucleic acid expression vector containing the coding sequence of the ZFP-TFs. The expression vector may contain expression regulatory sequences, such as a promoter, enhancer, transcription signal sequence, and transcription termination sequence, that enable the expression of the coding sequence of the ZFP-TFs in cells of the nervous system (e.g., the central nervous system). In some embodiments, the expression vector remains present in the cell as a stable episome. In other embodiments, the expression vector is incorporated into the cell's genome.

[0077] In some embodiments, the promoter on the vector for directing ZFP-TF expression in the brain is a constitutively active promoter or an inductive promoter. Suitable promoters, but not limited to, include the Roussarcoma virus (RSV) long terminal repeat (LTR) promoter (which may have an RSV enhancer), the cytomegalovirus (CMV) promoter (which may have a CMV enhancer), the CMV early promoter, the monkey virus 40 (SV40) promoter, the dihydrofolate reductase (DHFR) promoter, the β-actin promoter, the phosphoglycerate kinase (PGK) promoter, the EFLα promoter, and the Moloney's mouse leukemia virus (MoMLV) LTR promoter. Examples include creatine kinase-based (CK6) promoters, transthyretin promoters (TTR), thymidine kinase (TK) promoters, tetracycline-responsive promoters (TRE), hepatitis B virus (HBV) promoters, human α1-antitrypsin (hAAT) promoters, chimeric liver-specific promoters (LSP), factor E2 (E2F) promoters, human telomerase reverse transcriptase (hTERT) promoters, CMV enhancer / chicken β-actin / rabbit β-globin promoters (CAG promoters; Niwa et al., Gene (1991) 108(2):193-9), and RU-486-responsive promoters. Neuron-specific promoters, such as synapsin I promoters, calcium / calmodulin-dependent protein kinase II (CamKII) promoters, methyl CpG-binding protein 2 (MeCP2) promoters, choline acetyltransferase (ChAT) promoters, and calbindin (Calb) promoters, may also be used. Astrocyte-specific promoters, such as the glial fibrillary acidic protein (GFAP) promoter or the aldehyde dehydrogenase 1 family, member L1 (Aldh1L1) promoter, may also be used. Oligodendritic glial cell-specific promoters, such as the Olig2 promoter, may also be used.Furthermore, the promoter may include one or more autoregulatory elements that thereby bind to ZFP-TFs and suppress their expression levels to a preset threshold. See U.S. Patent No. 9,624,498.

[0078] However, any method for introducing nucleotide sequences into cells may be used, including but not limited to electroporation, calcium phosphate precipitation, microinjection, cationic or anionic liposomes, liposomes combined with nuclear localization signals, naturally occurring liposomes (e.g., exosomes), or viral transduction.

[0079] Viral transduction may be used for in vivo delivery of expression vectors. Various viral vectors known in the art, such as vaccinia vectors, adenovirus vectors, lentivirus vectors, poxvirus vectors, herpesvirus vectors, adeno-associated virus (AAV) vectors, retrovirus vectors, and hybrid viral vectors, may be adapted for use in this disclosure. In some embodiments, the viral vector used herein is a recombinant AAV (rAAV) vector. AAV vectors are particularly well-suited for central nervous system (CNS) gene delivery because AAV infects both dividing and non-dividing cells, has very low immunogenicity, and the viral genome exists as a stable episomal structure for long-term expression (Hadaczek et al., Mol Ther. (2010) 18:1458-61; Zaiss, et al., Gene Ther. (2008) 15:808-16). Any suitable AAV serotype may be used. For example, an AAV could be AAV1, AAV2, AAV3, AAV3b, AAV4, AAV5, AAV6, AAV7, AAV8, AAV8.2, AAV9, or AAVrh10, or a pseudotype (e.g., AAV2 / 8, AAV2 / 5, AAV2 / 6, AAV2 / 9, or AAV2 / 6 / 9). See, for example, U.S. Patents 7,198,951 and 9,585,971.

[0080] In some embodiments, the expression vector is an AAV vector, and is introduced into target human cells by recombinant AAV virions comprising a construct that includes having AAV reverse terminal repeat (ITR) sequences at both ends to enable the production of AAV virions in a production system, e.g., an insect cell / baculovirus production system or a mammalian cell production system. AAV can be genetically engineered so that its capsid protein has reduced immunogenicity or enhanced transduction ability in humans. In some embodiments, AAV9 is used. The viral vectors described herein can be generated using methods known in the art. Any suitable permissible or packaging cell type can be used to generate viral particles. For example, mammalian (e.g., 293) or insect (e.g., Sf9) cells can be used as packaging cell lines.

[0081] For methods of expressing therapeutic proteins containing ZFPs in the nervous system of patients who require them, refer to U.S. Patents 6,309,634, 6,453,242, 6,503,717, 6,534,261, 6,599,692, 6,607,882, 6,689,558, and 6,824,9 See also issues 78, 6,933,113, 6,953,575, 6,979,539, 7,013,219, 7,163,824, 7,182,944, 8,309,355, 8,337,458, 8,586,526, 9,050,299, and 9,089,667.

[0082] Western. Pharmaceutical application. This ZFP-TF can be used to treat patients who require downregulation of C9orf72 expression, particularly downregulation of the expression of mutant C9orf72 alleles. These patients have or are at risk of developing C9orf72-related neurodegenerative diseases, such as ALS and C9FTD. Patients at risk include those with a genetic predisposition, those with a history of repeated brain injury, such as concussions, and those exposed to environmental neurotoxins. This disclosure provides a method for treating C9orf72-related neurodegenerative diseases (e.g., ALS and C9FTD) in a subject in need, e.g., a human patient, comprising introducing a therapeutically effective amount of ZFP-TF (e.g., an rAAV vector expressing it) (e.g., an amount that allows for sufficient suppression of mutant C9orf72 allele expression) into the subject's nervous system (e.g., the CNS). The term “treat” encompasses symptom reduction, prevention of symptom onset, slowing of disease progression, improvement of quality of life, and increased survival.

[0083] This disclosure provides a pharmaceutical composition comprising a viral vector, e.g., rAAV, whose recombinant genome includes an expression cassette for ZFP-TF. The pharmaceutical composition may further comprise a pharmaceutically acceptable carrier, e.g., water, saline (e.g., phosphate-buffered saline), dextrose, glycerol, sucrose, lactose, gelatin, dextran, albumin, or pectin. Furthermore, the composition may contain auxiliary substances, e.g., wetting agents or emulsifiers, pH buffers, degradation inhibitors, or other reagents that enhance the efficacy of the pharmaceutical composition. The pharmaceutical composition may comprise a delivery medium, e.g., liposomes, nanocapsules, microparticles, microspheres, lipid particles, and vesicles.

[0084] Cells targeted by the therapeutic agents of this disclosure are, but are not limited to, cells in the brain and / or spinal cord, including nerve cells (e.g., motor neurons, sensory neurons, dopamine neurons, cholinergic neurons, glutamatergic neurons, GABAergic neurons, or serotonergic neurons), glial cells (e.g., oligodendrocytes, astrocytes, pericytes, Schwann cells, or microglial cells), ependymal cells, or neuroepithelial cells. Targeted brain regions may be cortical regions, frontotemporal regions, entorhinal cortex, hippocampus, cerebellum, pons, and medulla. These regions may be reached directly by intrahippocampal injection, intracerebral injection, intracisional (ICM) injection, or more commonly, by intraparenchymal injection, intraventricular (ICV) injection, subarachnoid injection, or intravenous injection. Other routes of administration, but are not limited to, include intracerebral, intraventricular, intranasal, or intraocular administration. In some embodiments, the viral vector spreads throughout the CNS tissue after direct administration into the cerebrospinal fluid (CSF), for example, by subarachnoid and / or intracerebral injection, or intracisional injection or intraventricular injection. In other embodiments, the viral vector crosses the blood-brain barrier after intravenous administration and achieves extensive distribution throughout the target CNS tissue. In other embodiments, the viral vector is delivered directly to the target region by intraparenchymal injection. In some cases, the viral vector may undergo retrograde or anterograde transport to other brain regions after intraparenchymal delivery. In some embodiments, the viral vector has distinct CNS tissue targeting ability (e.g., CNS tissue directivity), thereby achieving stable, non-toxic gene transfer with high efficiency.

[0085] For example, a pharmaceutical composition may be delivered to a patient via intracerebroventricular administration, for example, into the ventricular region of the patient's forebrain, such as the right ventricle, left ventricle, third ventricle, or fourth ventricle. A pharmaceutical composition may also be delivered to a patient via intracerebral administration, for example, by injection of the composition into or near the cerebrum, medulla, pons, cerebellum, intracranial cavity, meninges, dura mater, arachnoid mater, or pia mater of the brain. In some cases, intracerebral administration may involve the delivery of the drug into the cerebrospinal fluid (CSF) in the subarachnoid space around the brain.

[0086] In some cases, intracerebral administration involves injection using stereotactic fixation procedures. Stereotactic fixation procedures are well known in the art and typically involve the use of a computer and a three-dimensional scanning device used together to guide the injection to a specific intracerebral region, e.g., the ventricular region. Microinjection pumps (e.g., World Precision Instruments) may also be used. In some cases, microinjection pumps are used to deliver compositions containing viral vectors. In some cases, the injection rate of the composition is in the range of 1 μl / min to 100 μl / min. As will be understood by those skilled in the art, the injection rate varies depending on various factors, including, for example, the age of the subject, the weight / size of the subject, the serotype of AAV, the required dose, and the intracerebral region to be targeted. Therefore, those skilled in the art may consider other injection rates to be appropriate in certain situations.

[0087] Delivery of rAAV to the target can be achieved, for example, by intravenous administration. In certain cases, it may be desirable to deliver rAAV locally to brain tissue, spinal cord, cerebrospinal fluid (CSF), nerve cells, glial cells, meninges, astrocytes, oligodendrocytes, interstitial spaces, etc. In some cases, recombinant AAV (e.g., 10) may be used. 7 ~10 15 AAV (vg / dose) can be delivered directly to the CNS by injection into the ventricular region and / or into the hippocampus, cortex, cerebellar lobule or other brain regions. AAV can be delivered using neurosurgical techniques known in the art, for example, by stereotactic injection using a needle, catheter or related device. See, for example, Stein et al., J Vir. (1999) 73:3424-9; Davidson et al., PNAS. (2000) 97:3428-32; Davidson et al., Nat Genet. (1993) 3:219-223; and Alisky and Davidson, Hum. Gene Ther. (2000) 11:2315-29; U.S. Patent Nos. 7,837,668 and 8,092,429.

[0088] Unless otherwise defined herein, scientific and technical terms used in connection with this disclosure should have meanings generally understood by those skilled in the art. Exemplary methods and materials are described below, but similar or equivalent methods and materials may also be used in the practice or testing of this disclosure. In case of any conflict, this specification, including definitions, is in control. Generally, the nomenclature and techniques used in relation to neurology, medicine, medicinal chemistry, pharmaceutical chemistry, and cell biology described herein are well known and commonly used in the art. Enzyme reactions and purification techniques are carried out as generally achieved in the art or according to the manufacturer's specifications as described herein. Furthermore, unless otherwise required by context, singular terms should include plural forms, and plural terms should include singular forms. Throughout this specification and its embodiments, the words “have” and “comprise,” or variations such as “has,” “having,” “comprises,” or “comprising,” will be understood to imply that they include the integer or group of integers described, but not any other integer or group of integers. All publications and other references mentioned herein are incorporated by reference in their entirety. While several documents are cited herein, this reference does not constitute an acknowledgment that any of these documents form part of the common general knowledge in the art. In this specification, the terms “approximately” or “about,” as applied to one or more values ​​of interest, refer to a value that is similar to the reference value described. In certain embodiments, unless otherwise stated or otherwise evident from the context, the term refers to a range of values ​​that fall within 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less in either direction (greater than or less than) the reference value described.

[0089] To allow for a better understanding of the present invention, the following embodiments and examples are provided. These embodiments and examples are for illustrative purposes only and should not be understood as limiting the scope of the invention in any way.

[0090] IV. Exemplary Embodiments Examples of embodiments of this disclosure that are not limited to this disclosure are described below. 1. A method for repressing sense and / or antisense transcription of the C9orf72 gene in cells, comprising treating the cells with one or more repressors comprising one or more repressors of the C9orf72 gene, a transcriptional repression domain and a DNA-binding domain that binds to a target site in the C9orf72 gene, wherein one or more repressors may comprise one or more zinc finger protein transcription factors (ZFP-TFs), one or more TAL effector domain transcription factors (TALE-TFs), and / or one or more CRISPR / Cas transcription factors. 2. The method of claim 1, wherein the C9orf72 gene comprises a mutant allele containing one or more expanded (G4C2) repeats, and the target site may be within one or more (G4C2) repeats. 3. Use of one or more ZFP-TF, TALE-TF, and / or CRISPR / Cas TF repressors that bind to the mutant C9orf72 expanded allele containing one or more (G4C2) repeats for the suppression of sense and / or antisense transcription in subjects where it is required. 4. Any method or use of the above embodiments wherein antisense transcription is suppressed by at least 50% compared to untreated cells. 5. Any method or use of the above embodiments wherein antisense transcription is suppressed by at least 70% compared to untreated cells. 6. Any method or use of the above embodiments, wherein the transcript containing the expanded repeat is selectively suppressed, antisense transcription may be suppressed, sense transcription from promoter 1a may be suppressed, and / or sense transcription from promoter 1b may not be suppressed. 7. Any method or use of the above embodiments, wherein one or more ZFP-TF repressors include ZFPs having recognition helix regions in the order shown in Table 1. 8. One or more ZFP-TF repressors are administered to cells as mRNA or using a viral vector, according to any of the embodiments described above. 9. The method or use of Embodiment 8, wherein the viral vector is an Ad or AAV vector. 10. The method or use of Embodiment 9, wherein the AAV vector is an AAV2 / 9 vector. 11. Any method or use of the above embodiments, wherein cells are present in a viable subject, and one or more ZFP-TF repressors are administered to the subject. 12. The method or use of Embodiment 11, wherein one or more ZFP-TF repressors are administered to a subject intraventricular, subarachnoid, intracranial, posterior orbital (RO), intravenous, intranasal and / or intracisional venous. 13. The method or use of Embodiment 12, wherein the ZFP-TF repressor may be administered unilaterally or bilaterally to the hippocampus of the subject using an AAV vector at a dose of 1E10-1E13 (e.g., 6E11) vg / hemisphere. 14. Any method or use of the above embodiments wherein the cell is a neuron. 15. Any method or use of the prior embodiments, in which two or more ZFP-TF repressors are administered. 16. The method or use of Embodiment 15, wherein two or more ZFP-TF repressors are retained in the same or different non-viral or viral vectors. 17. Any method or use of the above embodiments wherein ALS and / or FTD are treated in the subject. 18. Any method or use of the above embodiments, wherein one or more symptoms of ALS and / or FTD are relieved in the subject. 19. A ZFP-TF fusion protein that binds to a target sequence and contains a zinc finger corresponding to an SBS number as shown in Table 1, wherein the zinc finger contains a DNA-binding (recognition) helix sequence shown in a single column in Table 1 for each SBS number, and the SBS number is 78021. 20. A ZFP-TF fusion protein that binds to a target sequence and contains a zinc finger corresponding to an SBS number as shown in Table 1, wherein the zinc finger contains a DNA-binding (recognition) helix sequence shown in a single column in Table 1 for each SBS number, and the SBS number is 75114. 21. A ZFP-TF fusion protein that binds to a target sequence and contains a zinc finger corresponding to an SBS number as shown in Table 1, wherein the zinc finger contains a DNA-binding (recognition) helix sequence shown in a single column in Table 1 for each SBS number, and the SBS number is 75115. 22. A ZFP-TF fusion protein that binds to a target sequence and contains a zinc finger corresponding to an SBS number as shown in Table 1, wherein the zinc finger contains a DNA-binding (recognition) helix sequence shown in a single column in Table 1 for each SBS number, and the SBS number is 74969. 23. A ZFP-TF fusion protein that binds to a target sequence and contains a zinc finger corresponding to an SBS number as shown in Table 1, wherein the zinc finger contains a DNA-binding (recognition) helix sequence shown in a single column in Table 1 for each SBS number, and the SBS number is 79895. 24. A ZFP-TF fusion protein that binds to a target sequence and contains a zinc finger corresponding to an SBS number as shown in Table 1, wherein the zinc finger contains a DNA-binding (recognition) helix sequence shown in a single column in Table 1 for each SBS number, and the SBS number is 79898. 25. A ZFP-TF fusion protein that binds to a target sequence and contains a zinc finger corresponding to an SBS number as shown in Table 1, wherein the zinc finger contains a DNA-binding (recognition) helix sequence shown in a single column in Table 1 for each SBS number, and the SBS number is 74986. 26. A ZFP-TF fusion protein that binds to a target sequence and contains a zinc finger corresponding to an SBS number as shown in Table 1, wherein the zinc finger contains a DNA-binding (recognition) helix sequence shown in a single column in Table 1 for each SBS number, and the SBS number is 79899. 27. A ZFP-TF fusion protein that binds to a target sequence and contains a zinc finger corresponding to an SBS number as shown in Table 1, wherein the zinc finger contains a DNA-binding (recognition) helix sequence shown in a single column in Table 1 for each SBS number, and the SBS number is 79901. 28. A ZFP-TF fusion protein that binds to a target sequence and contains a zinc finger corresponding to an SBS number as shown in Table 1, wherein the zinc finger contains a DNA-binding (recognition) helix sequence shown in a single column in Table 1 for each SBS number, and the SBS number is 79902. 29. A ZFP-TF fusion protein that binds to a target sequence and contains a zinc finger corresponding to an SBS number as shown in Table 1, wherein the zinc finger contains a DNA-binding (recognition) helix sequence shown in a single column in Table 1 for each SBS number, and the SBS number is 79904. 30. A ZFP-TF fusion protein that binds to a target sequence and contains a zinc finger corresponding to an SBS number as shown in Table 1, wherein the zinc finger contains a DNA-binding (recognition) helix sequence shown in a single column in Table 1 for each SBS number, and the SBS number is 79916. 31. A ZFP-TF fusion protein that binds to a target sequence and contains a zinc finger corresponding to an SBS number as shown in Table 1, wherein the zinc finger contains a DNA-binding (recognition) helix sequence shown in a single column in Table 1 for each SBS number, and the SBS number is 75027. 32. A ZFP-TF fusion protein that binds to a target sequence and contains a zinc finger corresponding to an SBS number as shown in Table 1, wherein the zinc finger contains a DNA-binding (recognition) helix sequence shown in a single column in Table 1 for each SBS number, and the SBS number is 79921. 33. A ZFP-TF fusion protein according to any one of embodiments 19 to 32, wherein the ZFP-TF fusion protein comprises a transcriptional repressor domain including SEQ ID NO: 13. 34. A ZFP-TF fusion protein according to any one of embodiments 19 to 33, wherein the zinc finger domain and the transcriptional repressor domain are linked by a peptide linker containing SEQ ID NO: 26. [Examples]

[0091] [Example 1] Artificial Transfer Repressor A panel of ZFP-TFs was created to target the expanded human C9orf72 allele. Exemplary ZFP-TFs are shown in Table 1 below. These ZFP-TFs each contained a ZFP domain with six fingers and a KRAB domain (SEQ ID NO: 13) as described above. The ZFP domain was linked to the KRAB domain using a peptide linker. The linker had the following amino acid sequence: LRQKDAARGS (SEQ ID NO: 26).

[0092] Table 1 shows the DNA sequences of the target sites in each ZFP-TF and the amino acid sequences of the DNA-binding helices of each zinc finger (F1-F6). Sequence numbers are shown in parentheses. Target sequences bound by the ZFP domain in the target site are shown in uppercase, and sequences at both ends are shown in lowercase. Sequence number 24 is the target site on the sense strand of the gene allele, and sequence number 25 is the target site on the antisense strand of the gene allele.

[0093] The DNA-binding helix is ​​a variable portion of the zinc finger and typically contains six or seven amino acid residues. The target specificity of the ZFP domain can be improved by mutations to the ZFP backbone, for example, as described in U.S. Patent Publication 2018 / 0087072. The symbol "^" in the table indicates that the arginine (R) residue at position 4 upstream of the first amino acid in the indicated helix is ​​changed to glutamine (Q). In each zinc finger helix sequence, the positions of the seven DNA-binding amino acids are numbered -1, +1, +2, +3, +4, +5, and +6. Therefore, the position of the R-to-Q substitution is numbered (-5).

[0094] [Table 1-1] [Table 1-2] [Table 1-3] [Table 1-4] [Table 1-5]

[0095] ZFP-TFs were evaluated by standard SELEX analysis (see, e.g., Miller et al., Nat Biotech. (2010) doi:10.1038 / nbt.1755; Wilen et al., PLoS (2011) 7(4):e1002020). All were shown to bind to their target sites.

[0096] The study used five human cell lines and one mouse cell line. The C9021 fibroblast cell line was obtained from the ALS Institute at Columbia University and derived from ALS-FTD patients. It contained five G4C2 repeats on its normal allele and approximately 850 repeats on its expanded allele. The wild-type fibroblast cell line (NDS00035), 353TRAD, and 204TDP fibroblast cell lines were obtained from the National Institute of Neurological Disorders and Stroke. The wild-type line contains two G4C2 repeats on each allele. The 353TRAD line contains five repeats on one allele and eight on the other. The 204TDP line has two repeats on one allele and 20 on the other. For all fibroblast experiments, human neurons were obtained from Cell Dynamics International (iCell GABANeurons kit, 01434; catalog number R1013; cell lot number 104901). Mouse cortical neurons were obtained from GIBCO (catalog number A15586). ZFP 74960, which binds to its target region but does not exhibit any observable inhibitory effect, was used as a negative control.

[0097] For all experiments performed in patient-derived fibroblasts, transfection of cells with ZFP-TF mRNA was carried out using a Lonza 96-well Shuttle Nucleofector system. ZFP-TF mRNA was transfected at doses of 1, 3, 10, 30, 100, and 300 ng per 40,000 cells using the Amaxa P2 Primary Cells Nucleofector kit with the CA-137 program. After overnight incubation, cDNA was generated from the transfected cells using the Cells-to-Ct kit (Thermo Fisher Scientific), followed by gene expression analysis using qRT-PCR.

[0098] ZFP was created in the AAV6 plasmid for neuronal transduction. Neurons were transduced using the AAV6-ZFP plasmid. All transductions were performed at 3,000 MOI. Mouse neurons were collected 7 days after transduction, while human neurons were collected 19 days after transduction. After cell collection, they were processed for microarray analysis.

[0099] Screening analyses were performed in multiple rounds. In each round, ZFPs were tested at multiple concentrations to identify ZFP-TFs with suitable on-target (selective repression) patterns. A second round of screening was performed in C9 (C9021) cells to evaluate the levels of expanded sense transcript (disease) C9orf72 versus total C9orf72 ("total C9") mature mRNA after ZFP-TF treatment. RT-PCR assays used primer / probe sets targeting intron region 1a. Enlarged sense C9orf72 transfer: Forward: 5' CCCTCTCTCCCCACTACTTG 3' (Sequence ID 61) Reverse: 5' CTACAGGCTGCGGTTGTTTCC 3' (Sequence No. 62) Probe: 5' TCTCACAGTACTCGCTGAGGGTGA 3' (Sequence ID 63)

[0100] G4C2 expansion leads to inefficient splicing and accumulation of expanded premRNA (Figure 2A). In contrast, efficiently spliced ​​wild-type (WT) premRNA is present at significantly lower levels. Using this assay in C9021 cells, we demonstrated that the tested ZFP-TF exhibited extensive repression of expanded sense (disease) C9022 transcripts (Figures 2B-D).

[0101] To evaluate the suppression of total C9 or f72 mRNA, we used different primer / probe sets labeled "Total C9" (Figure 2A): Total C9orf72 mRNA: Forward: 5' CTATGTGTGTGGTGGGATATGG 3' (Sequence number 58) Reverse: 5' CTCCAGGTTATGTGAAGCAGAA 3' (Sequence No. 59) Probe: 5' AGGCCTGCTAAAGGATTCAACTGGAA 3' (Sequence ID 60)

[0102] This primer / probe set was able to detect mRNA containing a region spanning exons 8 and 9. This region is present in all C9orf72 mRNA isoforms. As shown in Figure 2b, numerous ZFP-TFs showed moderate repression of total C9orf72 transcripts. For example, ZFP-TFs 75114 and 75115 repressed expanded sense (disease) transcripts by more than 70%, while preventing the expression of total C9orf72 mRNA by more than 50% (Figure 2D, Round 2 data).

[0103] In Round 3, total C9orf72 mRNA was evaluated and compared between C9021 cells and wild-type (WT) cells to further assess the effects of the tested ZFP-TFs on total C9orf72 mRNA levels. The data show that total C9orf72 mRNA levels were reduced much more dramatically in mutant cells than in WT cells, and were far less affected in wild-type cells treated with the same ZFP-TFs (Figures 2B-D). Overall data illustrate that for some ZFPs, e.g., 75109, 75114, and 75115, the expanded isoforms were significantly suppressed (approximately 70%) in C9 patient fibroblast cell lines, while approximately 50% of the total C9 transcript was maintained.

[0104] The isoform-selective inhibition of ZFP-TF75109, 75114, and 75115 was evaluated in fibroblasts from three different patients containing different G4C2 extended repeats (600, 800, and 850) on the extended allele (Figure 6). All three ZFPs exhibited similar behavior independently of the repeat extension length, illustrating that the selective inhibition of ZFP-TF is independent of the G4C2 repeat length.

[0105] The repression of total C9 transcript was evaluated in two cell lines obtained from healthy individuals with an allele having a greater number of G4C2 repeats than normal (Figure 7). In healthy cell lines, total C9 transcript was minimally affected. The PCR assay used to detect total C9 mRNA transcript targets exons 8 and 9 present in both expanded and unexpanded (WT) isoforms; therefore, ZFP-mediated repression of total C9 mRNA transcript in the patient-derived cell line (C9021) is not truly representative of the WT isoform level (Figure 2A). The repression of total C9 mRNA transcript in response to isoform-selective ZFP-TFs (75109, 75114, and 75115) was evaluated in two different healthy cell lines with different G4C2 repeat lengths on the allele (Figure 7). Cell line 353TREAD has 5 repeats on one allele and 8 repeats on the other, while cell line 204TDP has 2 repeats on one allele and 20 repeats on the other. In C9 strain C921 (5 repeats on the unexpanded allele and 850 repeats on the expanded allele), total C9 mRNA transcript was suppressed in a dose-dependent manner, but was minimally affected in the two other cell lines that did not have the expanded allele. This indicates that the suppression of total C9 isoforms in the disease strain (5 / 850) is a result of the suppression of the expanded isoform, and that the expression of the unexpanded isoform is unaffected by selective ZFP-TF (Figure 7).

[0106] While I don't want to be constrained by theory, it is possible that these ZFP-TFs work cooperatively to selectively repress alleles with a large number of repeats. This could be mediated by higher-order complexes, for example, through the replenishment of KAP1 corepressors that associate with ZFP-linked KRAB domains. Under this hypothesis, a KAP1 / KRAB "scaffold" across multiple ZFP-TFs enhances the stability of the transcriptional repression mechanism, enabling preferential repression of the expanded C9orf72 allele over the wild-type allele. [Example 2]

[0107] Specificity of C9orf72 inhibition The overall specificity of ZFP-TFs, as shown in Table 1, was evaluated by microarray analysis in three cell lines: C9021 fibroblasts, primary mouse cortical neurons, and human neurons. For C9021 cells, 150,000 C9021 cells were transfected in four strands with a ZFP-TF encoding 100 ng of mRNA. After 24 hours, total RNA was extracted and processed according to the manufacturer's protocol (Affymetrix Genechip MTA1.0). Robust multi-array mean (RMA) was used to normalize the raw signals from each probe set. The analysis was performed using Transcriptome Analysis Console 3.0 (Affymetrix) with the "Gene-Level Differential Expression Analysis" option. Samples transfected with ZFP-TFs were compared to samples treated with unrelated ZFP-TFs (those not binding to the C9orf72 target site). Changes were reported for transcripts (probe sets) that showed a >2-fold difference in mean signal compared to the control and a P-value < 0.05 (one-way ANOVA analysis, independent t-test for each probe set). For neurons, a similar procedure was followed, except that they were transduced with AAV6 at a MOI of 3000, cultured for 7 days for mouse neurons and 19 days for human neurons, and then harvested.

[0108] Exemplary data are shown in Figures 8A–8C. The data show that in both human and mouse fibroblasts and neurons, ZFP-TF75027 showed several off-targets in addition to C9orf72 (circled), while ZFP-TF75109, 75114, and 75115 suppressed only C9orf72 and had minimal off-targets. These results demonstrate that representative ZFP-TFs are highly specific to C9orf72. [Example 3]

[0109] Detection of antisense-specific suppression Since sense and antisense transcripts are encoded by overlapping regions of DNA, we developed a detection strategy based on differential processing of the transcripts. For sense mRNA derived from an enlarged allele, the intron containing the enlarged region (intron 1a) is misspliced ​​and retained, while all other introns, including intron 1b, are removed. In contrast, the intron 1b region is a predicted exon in the antisense mRNA transcript and should be retained. Therefore, we designed and tested primers located within intron 1b and demonstrated specific detection of antisense transcripts as further described below.

[0110] To detect C9orf72 transcripts, the inventors used droplet digital PCR (ddPCR). Briefly, to create sense or antisense cDNA templates, RNA was purified from C9orf72 patient and healthy control cells (C9orf72 strains: C9-3, C9-6, C9-7, C9-5, C9-10, C9-11, C9-2, C9-4; control strains: KinALS6, Con3, Kin1ALS17, Con8, Con10, Con1; see Lagier-Tourenne et al., PNAS (2013) 110(47):E4530-9), and cDNA was synthesized using the Superscript III (Thermo Fischer Scientific) first-strand synthesis system as follows:

[0111] 1) 0.5 μg of RNA, 0.5 μL of 10 mM strand-specific primers, and a dNTP mix were mixed and diluted with water to 10 μL. The primer 5'CTCTAGCGACTGGTGGAATTG3' (SEQ ID NO: 64) was used to create the sense template. The primer 5'GTGCATGGCAACTGTTTGAATA3' (SEQ ID NO: 65) was used to create the antisense template. 2) The reaction mixture was incubated at 65°C for 5 minutes to denaturate, and then placed on ice for at least 1 minute. 3) The following reagents were used to prepare the cDNA synthesis mix: 10×RT buffer (2 μL); 25 mM MgCl2 (4 μL); 0.1 M DTT (2 μL); RNase OUT (1 μL); and Superscript III (1 μL). 4) 10 μL of this reaction was added to the RNA mix and incubated at 50°C for 50 minutes. The reaction was then inactivated by incubation at 85°C for 5 minutes.

[0112] Next, the template was subjected to ddPCR using the labeled probe according to the manufacturer's protocol. Briefly, the PCR reaction was performed in an ABI PCR 96-well plate using dUTP-free ddPCR Supermix for the probe (Bio-Rad). The PCR master mix was prepared according to the manufacturer's instructions. The antisense primer-probe set located in the intron 1b region (Figure 3) is shown below. Forward: 5' CAAAGCCTGGTGGTGTTCAA 3' (Sequence No. 66) Reverse: 5' GGACATGACCTGGTTGCTTC 3' (Sequence ID 67) Probe: 5' CGCGGCCAGATAGACCCAATGAGCA 3' (Sequence ID 68)

[0113] The reactants were set as follows: 1) The complete master mix was evenly distributed among the eight wells of an ABI PCR plate. 2) 10 μL of 1:10 diluted RT reaction mixture or water was added to the sample well. 3) 15 μL of the master mix was transferred to the RT-containing well. 4) The plate was sealed, vortexed, and centrifuged for a short period of time.

[0114] To create droplets, the cartridge was used as follows: 1) 70 μL of probe oil was added to the well-labeled oil on the cartridge, and 20 μL of ddPCR reaction product was added to the well-labeled sample. 2) A rubber gasket was placed on top of the cartridge. 3) A 40 μL droplet was transferred to a new Eppendorf 96-well plate. The plate was sealed with aluminum foil, and PCR was performed according to the manufacturer's protocol.

[0115] The data show that in the C9orf72 fibroblast cell line, these primers amplified an exon in the expanded antisense premRNA (C9-AS) and the complementary region was not in the sense region (C9-S) (Figure 4A). Thus, the ddPCR antisense primers described herein specifically detected the antisense premRNA, which was clearly elevated in seven different C9 patient-derived fibroblasts compared to six different control fibroblasts (Figure 4B). [Example 4]

[0116] Expanded allelsense and antisense premRNA suppression To test the activity of ZFP-TF repressors in expanded alleles, cells were treated with ZFP-TF 74949, 74978, 75003, 75027, 75109, 75114, 75115, 74967 (Table 1) or 74960 (negative control) as described above. ZFP-TF-mediated repression was evaluated by researchers unaware of the sample order using two separate PCR assays. Each assay used different primers / probes (Figures 5A-5C).

[0117] For runs 1 and 2, the assays for measuring augmented sense, augmented antisense, and total C9 were performed as described above, except that amplification was carried out using a random hexamer and the primers shown below, in accordance with standard protocols in the art: Expanded antisense C9orf72 premRNA (Figure 5B): as shown in Example 3 above. Enlarged sense C9orf72 premRNA (Figure 5A): This primer / probe set was able to detect mRNA containing regions spanning exon 1a and intron 1a. Forward: 5' ACTACTTGCTCTCACAGTACTCG 3' (Sequence ID 69) Reverse: 5' TAGCGCGCGACTCCTGAGTTCC 3' (Sequence ID 70) Probe: 5' AGGGAAACAACCGCAGCCTGTAGCAAGCTC 3' (Sequence ID 71) Total C9orf72 mRNA (Figure 5C): This primer / probe set was able to detect mRNA containing regions within exon 2. Forward: 5' TGTGACAGTTGGAATGCAGTGA 3' (Sequence No. 72) Reverse: 5' GCCACTTAAAGCAATCTCTGTCTTG 3' (Sequence ID 73) Probe: 5' TCGACTCTTTGCCCACCGCCA 3' (Sequence ID 74)

[0118] Execution number 3 (Figures 5A and 5C) used the primers shown above in Example 1 (Figures 2B-2D). For antisense disease transcripts, the following primers / probes were used to detect intron region 1b (Figure 5B). Forward: 5' CAGCTTCGGTCAGAGAAATGAG 3' (Sequence No. 78) Reverse: 5' AAGAGGCGCGGGTAGAA 3' (Sequence ID 79) Probe: 5' CTCTCCTCAGAGCTCGACGCATTT 3' (Sequence ID 80)

[0119] Despite the use of different primer / probe sets and different PCR assays (runs 1 and 2 were performed using a similar assay, but different from run 3), the data were consistent and the levels of suppression were comparable.

[0120] In summary, all trials consistently demonstrated that some ZFP-TFs were able to strongly suppress all three types of transcripts (sense, antisense, and total) (e.g., ZFP-TF74978, 75003, and 75027), while some ZFP-TFs (e.g., ZFP-TF75109, 75114, and 75115) selectively suppressed sense and antisense disease transcripts while preserving total C9 transcripts (selective suppression). [Example 5]

[0121] Regulation of human C9orf72 in BAC C9orf72 transgenic mouse neurons All repressors targeting BAC mouse C9orf72 are cloned into the rAAV6 vector using a CMV promoter to drive expression. Recombinant AAV is produced in HEK293T cells according to methods known in the art, purified using a CsCl density gradient, and titrated by real-time qPCR. The purified virus is used to infect cultured primary mouse cortical neurons with 3E5, 1E5, 3E4, and 1E4 Vg / cell. After 7 days, total RNA is extracted, and the expression of C9orf72 sense and antisense transcripts as well as two reference genes (e.g., Atp5b and Eif4a2) is monitored using RT-qPCR.

[0122] All AAV vectors encoding ZFP-TFs efficiently suppress their targets in mouse cells across a wide range of infectious doses, and some ZFPs reduce targets by more than 95% at multiple doses. In contrast, no gene suppression is observed in CMV-GFP rAAV6 virus or sham-treated neurons tested at equivalent doses. [Example 6]

[0123] In vivo gene repression driven by ZFP-TF delivered by AAV The C9orf72 BAC transgenic mice used in the target involvement study contained a human transgene containing a full-length C9orf72 gene allele of 98kb with approximately 500 G4C2 repeats and sequences substantially located at both ends (Liu et al., Neuron (2016) 90(3):521-34). Two ZFP-TFs with varying potencies, ZFP-TF75027 or ZFP-TF75114 (ZFP-TF75027 is more potent; Figure 2D), were selected for this study. Expression cassettes of both fusion proteins were cloned into rAAV vectors containing the synapsin promoter driving expression and the coding sequence of a self-cleavable peptide (e.g., 2A peptide, e.g., T2A or P2A), followed by a Venus tag for measuring subsequent in vivo distribution (Figure 9, Panel A). rAAV was produced in HEK293T cells and titrated by ddPCR using primers on ITRs.

[0124] To evaluate the effect of ZFP-TF expression on the repression of sense and antisense transcripts containing expansion in vivo, ZFP-TF rAAV was delivered into P0 C9-BAC or WT mice by intraventricular (ICV) injection. Briefly, a medium (PBS) or ZFP-TF 75027 rAAV or ZFP-TF 75114 rAAV (total dose of 2E10 Vg per ventricle) was administered bilaterally (2 μl per ventricle) into neonatal C9-BAC mice (corresponding for repeat length) or WT mice (Figure 9, Panel C). Four weeks after injection, the animals were sacrificed, one hemisphere was embedded for RNA focus analysis, and the other hemisphere was microdissected into the cortex, hippocampus, and cerebellum for further analysis (Figure 9, Panel B). Quantification of the viral genome, Venus mRNA, and proteins revealed a broad in vivo distribution with equivalent transduction and expression of both ZFP-TF75027 and ZFP-TF75114.

[0125] Total RNA was extracted from cortical and hippocampal tissue, and cDNA was synthesized using the iScript cDNA synthesis kit (BioRad). ddPCR was performed to measure the expression of transcripts, including sense and antisense expansions, and total C9 mRNA levels normalized to mouse TBP levels. The primers used in this assay were as follows: Total C9 mRNA: Forward: 5'TGTGACAGTTGGAATGCAGTGA3' (Sequence ID 72) Reverse: 5'GCCACTTAAAGCAATCTCTGTCTTG3' (Sequence ID 73) Probe: 5'TCGACTCTTTGCCCACCGCCA3' (Sequence ID 74) Expanded sense premRNA: Forward: 5' ACTACTTGCTCTCACAGTACTCG 3' (Sequence ID 69) Reverse: 5' TAGCGCGCGACTCCTGAGTTCC 3' (Sequence ID 70) Probe: 5' AGGGAAACAACCGCAGCCTGTAGCAAGCTC 3' (Sequence ID 71) Expanded antisense premRNA: Forward: 5'AGTCGCTAGAGGCGAAAGC3' (Sequence No. 81) Reverse: 5'CGAGTGGGTGAGTGAGGAG3' (Sequence No. 82) Probe: 5'AAGAGGCGCGGGTAGAAGCGGGGGC3' (Sequence ID 83)

[0126] The data show that ZFP-TF75027 suppressed the levels of transcripts containing total C9 mRNA, sense, and antisense expansions in the hippocampus and cortex of C9-BAC animals compared to PBS-injected controls (Figure 9, Panel D). (Selective repression was not observed using this animal model because transgenic mice do not contain the WT human C9orf72 allele, and the mouse (moue) C9orf72 gene does not contain the G4C2 repeat). No repression was observed when using ZFP-TF75114.

[0127] Furthermore, fluorescence in situ hybridization was used to measure the levels of sense and antisense RNA aggregates (foci) found in the hippocampus after ZFP-TF injection (Figure 9, Panel E). Briefly, 10 μm sections were hybridized with fluorophore-labeled probes: sense RNA foci were measured using 5'GGCCCCGGCCCCGGCCCC-Cy3 (SEQ ID NO: 84), and antisense RNA foci were measured using 5'GGGGCCGGGGCCGGGGCC-Cy3 (SEQ ID NO: 85). Stack images were acquired at 40× zoom using a confocal microscope (LSM880). The number of sense and antisense RNA foci, normalized to the total number of cells, was quantified from the Ammon's horn (CA) region of the hippocampus. A smaller percentage of antisense RNA foci was observed in animals injected with ZFP-TF75027.

[0128] These results indicate that ZFP-TFs targeting C9orf72 can efficiently suppress the expression of the disease-causing C9orf72 allele in vivo, and that differences in the efficacy of ZFP-TFs may be observed.

Claims

1. A fusion protein for inhibiting transcription of a mutant allele of the C9orf72 gene in human cells, wherein the fusion protein comprises a zinc finger protein (ZFP) domain and a transcriptional repressor domain, wherein the ZFP domain binds to a target region in the intron segment between exons 1a and 1b on the mutant allele of the human C9orf72 gene, wherein the target region has more than 30 G ４ C ２ A fusion protein comprising a tandem repeat of (SEQ ID NO: 1), where the ZFP domain comprises six recognition helix regions, each containing SEQ ID NOs: 46, 41, 46, 41, 46, and 41, respectively.

2. The fusion protein according to claim 1, which suppresses the transcription of repeat-containing mRNA from the mutant allele and does not suppress the transcription of wild-type mRNA from the gene.

3. A fusion protein according to claim 1 or 2, which suppresses sense transcription from the mutant C9orf72 allele in human cells.

4. The fusion protein according to claim 3, which suppresses sense transcription from the C9orf72 1a promoter and does not suppress sense transcription from the C9orf72 1b promoter.

5. The fusion protein according to claim 1 or 2, wherein the ZFP domain binds to an antisense sequence in the target region, the antisense sequence comprising one to three tandem repeats of hexanucleotide GCCCCG (SEQ ID NO: 8).

6. The fusion protein according to claim 5, wherein the ZFP domain is bound to Sequence ID No.

25.

7. A fusion protein according to any one of claims 1 to 6, which suppresses antisense transcription from the mutant C9orf72 allele in human cells.

8. A fusion protein according to any one of claims 1 to 7, which suppresses both sense transcription and antisense transcription from the mutant C9orf72 allele in human cells.

9. A fusion protein according to any one of claims 1 to 8, which suppresses sense transcription and / or antisense transcription from the mutant C9orf72 allele by at least 30%.

10. The fusion protein according to claim 9, which suppresses sense transcription and / or antisense transcription from the mutant C9orf72 allele by at least 40%.

11. The fusion protein according to claim 10, which suppresses sense transcription and / or antisense transcription from the mutant C9orf72 allele by at least 75%.

12. The fusion protein according to claim 11, which suppresses sense transcription and / or antisense transcription from the mutant C9orf72 allele by at least 90%.

13. The fusion protein according to claim 12, which suppresses sense transcription and / or antisense transcription from the mutant C9orf72 allele by at least 95%.

14. The fusion protein according to claim 9, which does not suppress sense transcription from the C9orf72 1b promoter.

15. The fusion protein according to any one of claims 1 to 14, wherein the transcriptional repressor domain comprises a KRAB domain amino acid sequence derived from human KOX1.

16. The fusion protein according to any one of claims 1 to 15, wherein the ZFP domain is linked to the transcriptional repressor domain via a peptide linker.

17. The fusion protein according to claim 1 or 2, wherein the human cell is a neuron, glial cell, ependymal cell, or neuroepithelial cell.

18. The fusion protein according to claim 17, wherein human cells are found in the brain or spinal cord of a patient suffering from C9orf72-related disorder.

19. The fusion protein according to claim 18, wherein the C9orf72-related disorder is selected from amyotrophic lateral sclerosis (ALS) and C9 familial frontotemporal dementia (C9FTD).

20. The fusion protein according to claim 19, which is introduced via a recombinant adeno-associated virus (rAAV) expressing the fusion protein.

21. The fusion protein according to claim 20, wherein rAAV is serotype 9 AAV or pseudotype AAV2 / 9 or AAV2 / 6 / 9.

22. The fusion protein according to claim 21, wherein rAAV is in a form suitable for administration to a patient via intraventricular, subarachnoid, intracranial, posterior orbital (RO), intravenous, intranasal and / or intracisional routes.

Images