Novel biomarkers for diagnosing uremic cardiomyopathy and uses thereof
Patent Information
- Application Number
- KR1020250077252
- Authority / Receiving Office
- KR · KR
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2025-02-03
- Filing Date
- 2025-06-12
- Publication Date
- 2026-08-12
Smart Images

Figure PAT00008_ABST
Abstract
Description
Technology Field
[0001] The present invention relates to a novel biomarker for the diagnosis of uremic cardiomyopathy and its use. Background Technology
[0002] Uremic cardiomyopathy refers to cardiovascular diseases (such as left ventricular hypertrophy, diastolic dysfunction, pericarditis, and heart failure) that occur due to the excessive accumulation of uremic toxins in the blood resulting from renal dysfunction caused by chronic kidney disease. In particular, heart failure is a critical prognostic factor determining the survival rate of patients with chronic kidney disease. However, due to the variability of individual patient phenotypes, accurate diagnosis and therapeutic approaches are challenging, highlighting the need for systematic research to understand the pathogenesis and develop diagnostic and therapeutic methods.
[0003] Appropriate disease models are essential for discovering and evaluating disease-predictive biomarkers. Existing models of uremic cardiomyopathy have relied on animal models, such as rodents (PLoS One. 2011;6(11):e27861; Sci Rep. 2021 Sep 1;11(1):17495), and the markers proposed from these models have not been sufficiently validated in human-derived cells. Induced pluripotent stem cells (iPSCs) are suitable for disease modeling because they are produced by reprogramming patient-derived somatic cells, which can resolve interspecies differences and reflect the patient's genetic characteristics. However, no uremic cardiomyopathy-related markers discovered using human iPSC-based uremic cardiomyopathy models have been reported to date.
[0004] Meanwhile, existing biomarkers used to evaluate kidney function (such as NGAL and KIM-1) are not suitable for reflecting reciprocal dysfunction between the kidneys and the heart, as seen in uremic cardiomyopathy; furthermore, due to a lack of clear guidelines, the current drug treatment of cardiovascular and renal diseases relies on the experience of clinicians.
[0005] Therefore, there is an urgent need to identify disease-specific biomarkers in order to rapidly and accurately diagnose uremic cardiomyopathy and establish appropriate treatment strategies. Prior art literature
[0006] Korean Registered Patent No. 10-1657881, Japanese Published Patent No. 2005-531321 The problem to be solved
[0007] The present invention aims to provide a composition and kit for diagnosing uremic cardiomyopathy.
[0008] In addition, the present invention aims to provide a method for providing information for diagnosing uremic cardiomyopathy. means of solving the problem
[0009] One aspect of the present invention provides a composition for diagnosing uremic cardiomyopathy comprising a preparation for detecting the expression of one or more genes or proteins selected from the group consisting of ATF5, ASNS, PSAT1, C5AR1, CCL21, ITGA11, and ACTA1.
[0010] The term “uremic cardiomyopathy” as used in this invention refers to a cardiovascular disease caused by the excessive accumulation of uremic toxins in the blood due to renal dysfunction resulting from chronic kidney disease, and manifests in various phenotypes such as left ventricular hypertrophy, diastolic dysfunction, pericardial effusion or pericarditis, and heart failure.
[0011] The term “diagnosis” as used in this invention refers to confirming the presence or characteristics of a pathological state in an individual that has not yet been diagnosed or has been diagnosed. The diagnosis in this invention may involve confirming the presence or possibility of progression to uremic cardiomyopathy using biomarkers. Here, the term “biomarker” generally refers to a substance detectable in biological samples and includes all organic biomolecules capable of identifying biological changes, such as polypeptides, proteins, nucleic acids, genes, lipids, glycolipids, glycoproteins, sugars, etc.
[0012] The composition for diagnosing uremic cardiomyopathy according to the present invention requires a preparation for detecting the expression level of one or more genes selected from the group consisting of ATF5, ASNS, PSAT1, C5AR1, CCL21, ITGA11, and ACTA1, or proteins encoded therefrom.
[0013] According to one embodiment of the present invention, the preparation may be one or more selected from the group consisting of primers, probes, antisense nucleotides, antibodies, oligopeptides, ligands, PNAs (peptide nucleic acid), and aptamers that bind to each gene or protein.
[0014] The term "primer" used in the present invention refers to a single-strand oligonucleotide having a short free 3-terminal hydroxyl group, capable of forming base pairs with a complementary template, and functioning as a starting point for template strand replication. The primer can initiate DNA synthesis in the presence of a reagent for a polymerization reaction (i.e., DNA polymerase or reverse transcriptase) and four different nucleoside triphosphates at an appropriate buffer solution and temperature. The primer pair consists of sense and antisense oligonucleotides having a sequence of 7 to 50 nucleotides, and may have a sequence of 15 to 30 nucleotides at a level that does not alter the basic properties of the primer acting as a starting point for DNA synthesis.
[0015] The term "probe" used in the present invention refers to a linear oligomer of natural or modified monomer or linkages, comprising deoxyribonucleotide and ribonucleotide, capable of specifically hybridizing to a target nucleotide sequence, and is naturally occurring or artificially synthesized.
[0016] These primers, probes, and antisense nucleotides may include a label that is detectable directly or indirectly by spectroscopic, photochemical, biochemical, immunochemical, or chemical means if necessary. The detectable label is a labeling substance capable of generating a detectable signal, and is a labeling substance capable of generating a detectable signal including a fluorescent substance, for example, Cy3, Cy5, etc. The detectable label can confirm the hybridization results of the nucleic acid.
[0017] The term “antibody” as used in the present invention refers to a specific protein molecule directed toward an antigenic site. In the present invention, it refers to an antibody that specifically binds to a protein biomarker, and includes monoclonal antibodies, polyclonal antibodies, and recombinant antibodies. Here, “specifically binding” means having a superior binding affinity to a target substance compared to other substances, to the extent that the presence of the target substance can be detected by binding. Furthermore, the antibody includes not only a complete form having two full-length light chains and two full-length heavy chains, but also functional fragments of the antibody molecule. A functional fragment of the antibody molecule refers to a fragment possessing at least an antigen-binding function, and may be Fab, F(ab'), F(ab')2, Fv, etc.
[0018] The above antibodies can be easily manufactured using techniques known in the art. For example, monoclonal antibodies can be manufactured using the hybridoma method (see Kohler and Milstein (1976) European Journal of Immunology 6:511-519), which is widely known in the art, or phage antibody libraries (Clackson et al, Nature, 352:624-628, 1991; Marks et al, J. Mol. Biol., 222:58, 1-597, 1991). Polyclonal antibodies can be produced by a method of injecting a target protein antigen into an animal and collecting blood from the animal to obtain serum containing antibodies. Such polyclonal antibodies can be manufactured from animals such as goats, rabbits, sheep, monkeys, horses, pigs, cattle, and dogs.
[0019] The antibody prepared by the above method can be separated and purified using methods such as gel electrophoresis, dialysis, salt precipitation, ion exchange chromatography, and affinity chromatography.
[0020] The composition for diagnosing uremic cardiomyopathy according to the present invention may include a preparation for detecting at least one gene or protein among ATF5, ASNS, PSAT1, C5AR1, CCL21, ITGA11, and ACTA1, or a preparation for detecting all of these genes or proteins.
[0022] In addition, one aspect of the present invention provides a kit for diagnosing uremic cardiomyopathy comprising the above composition.
[0023] The “kit for diagnosing uremic cardiomyopathy” used in the present invention refers to a substance capable of diagnosing uremic cardiomyopathy through a biological sample isolated from a test subject, specifically an individual who has not been diagnosed with uremic cardiomyopathy or an individual suspected of having uremic cardiomyopathy, thereby enabling rapid, accurate, and convenient diagnosis of whether the test subject has uremic cardiomyopathy.
[0024] The above kit may include, without limitation, diagnostic kits based on conventional gene and / or protein quantification analysis.
[0025] The above kit may be one or more selected from the group consisting of PCR (polymerase chain reaction) kits, RT-PCR (reverse transcription PCR) kits, DNA or DNA chip kits, NGS (next generation sequencing) kits, protein chip kits, and protein array kits, but is not limited thereto.
[0026] For example, when the above kit is applied to a PCR amplification process, the kit of the present invention may optionally include reagents necessary for PCR amplification, such as buffer, DNA polymerase, DNA polymerase cofactor, and dNTPs; and when the above kit is applied to an immunoassay, the kit of the present invention may optionally include a secondary antibody and a substrate for labeling. Furthermore, the kit according to the present invention may be manufactured into a plurality of separate packages or compartments containing the above-mentioned reagent components, and the kit of the present invention may be a diagnostic kit containing essential elements necessary for performing DNA chip operations. The DNA chip kit may include a substrate to which cDNA corresponding to a gene or a fragment thereof is attached as a probe, and reagents, preparations, enzymes, etc., for producing a fluorescently labeled probe. Additionally, the substrate may include cDNA corresponding to a quantitative control gene or a fragment thereof.
[0028] Another aspect of the present invention provides a method for providing information for diagnosing uremic cardiomyopathy, comprising: a) detecting the expression of one or more genes or proteins selected from the group consisting of ATF5, ASNS, PSAT1, C5AR1, CCL21, ITGA11, and ACTA1 in a biological sample isolated from a subject; and b) comparing the expression level of the detected genes or proteins with a control group.
[0029] Steps a) and b) above will be examined in detail below, and details common to the previously mentioned content will be omitted to avoid excessive complexity.
[0030] Step a) above is a process of collecting biological samples from individuals or subjects requiring testing for the diagnosis of uremic cardiomyopathy and measuring the expression levels of the seven genes or proteins mentioned above.
[0031] According to one embodiment of the present invention, the subject of step a) may be an individual with suspected symptoms of uremic cardiomyopathy.
[0032] According to one embodiment of the present invention, the biological sample of step a) may be one or more selected from the group consisting of blood, plasma, serum, lymph fluid, saliva, urine, and tissue.
[0033] According to one embodiment of the present invention, the gene expression of step a) may be detected by one or more methods selected from the group consisting of fluorescence in situ hybridization, chromatin immunoprecipitation, next generation sequencing (NGS), polymerase chain reaction (PCR), reverse transcription polymerase chain reaction (RT-PCR), competitive RT-PCR, real-time PCR, real-time RT-PCR, nuclease protection assay, in situ hybridization, DNA or RNA microarray, and Northern blot.
[0034] The aforementioned NGS possesses the multiplexing capability to perform hundreds of thousands of reactions simultaneously and enables sequencing with small sample volumes. While specific application techniques vary slightly depending on the commercially available technology, NGS generally utilizes clonal amplification, massively parallel sequencing, and novel sequencing methods with mechanisms of action different from the Sanger method. Commercialized technologies include the FLX model sequencer, an improved version of the 454 GS released by Roche in 2007; the Genome Analyzer HiSeq released by Illumina in 2006; and SOLiD released by Applied Biosystems in 2007. These three platforms commonly adopt clonal amplification technology, abandoning complex library construction and cloning processes; utilize massively parallel sequencing technology capable of processing large volumes at once; and eliminate the cumbersome electrophoresis process by determining base sequences through sequencing by synthesis via cyclic sequencing. It also uses an algorithm that arranges short reads obtained using the shotgun method to find duplicate parts and complete the whole.NGS can be clinically used for gene panel testing, exome sequencing, whole-genome sequencing, single nucleotide polymorphism detection, blood-based tumor diagnostics, noninvasive prenatal testing, human leukocyte antigen testing, immunoglobulin rearrangement testing, RNA sequencing, DNA methylation testing, chromatin immunoprecipitation (ChIP) sequencing, single-cell sequencing, etc.
[0035] In addition, according to one embodiment of the present invention, the protein expression of step a) may be detected by one or more methods selected from the group consisting of enzyme-linked immunosorbent assay, western blot, radioimmunoassay, radioimmunodiffusion, immunoprecipitation, flow cytometry, immunohistochemistry, immunofluorescence, and protein microarray.
[0036] Step b) above is a process of predicting whether a subject has uremic cardiomyopathy based on the expression levels of the seven genes or proteins measured in the biological sample.
[0037] According to one embodiment of the present invention, step b) may involve determining or diagnosing uremic cardiomyopathy when the expression level of one or more genes or proteins selected from the group consisting of ATF5, ASNS, and PSAT1 is low compared to a control group, or when the expression level of one or more genes or proteins selected from the group consisting of C5AR1, CCL21, ITGA11, and ACTA1 is high. Effects of the invention
[0038] In this invention, by discovering novel biomarkers for the diagnosis of uremic cardiomyopathy, it is possible to diagnose uremic cardiomyopathy early and provide appropriate treatment methods, thereby contributing to the improvement of patient prognosis and the reduction of medical costs. Brief explanation of the drawing
[0039] Figure 1 illustrates a method for producing a uremic cardiomyopathy model (UCM) using patient-derived induced pluripotent stem cells and cardiomyocytes according to one embodiment of the present invention. Figure 2 shows (a) the expression of pluripotency marker genes NANOG, OCT4, and SOX2 in induced pluripotent stem cells and (b) the expression of cardiomyocyte marker genes TNNT2 and MYH7 in cardiomyocytes derived from induced pluripotent stem cells according to one embodiment of the present invention. Figure 3 shows a gene expression pattern including PI3K-Akt phosphorylation in induced pluripotent stem cell-derived cardiomyocytes on day 38 of differentiation according to one embodiment of the present invention. Figure 4 shows a change in heart rate of myocardial cells by treatment with a uremic toxin mixture according to one embodiment of the present invention. Figure 5 shows (a) cell viability and (b) total glutathione (GSH) and total glutathione / oxidized glutathione (GSH / GSSG) ratios of myocardial cells treated with a uremic toxin mixture according to one embodiment of the present invention. Figure 6 shows the size of myocardial cells in patient groups (UCM2 and UCM3) treated with a uremic toxin mixture according to one embodiment of the present invention. Figure 7 shows a gene expression pattern by uremic mixture treatment according to one embodiment of the present invention. Figure 8 shows the expression levels of genes C5AR1, CCL21, ITGA11, ACTA1, ATF5, ASNS, and PSAT1 having different expression levels due to uremic toxin mixture treatment according to one embodiment of the present invention. Specific details for implementing the invention
[0040] The present invention will be described in more detail below. However, this description is provided merely as an example to aid in understanding the invention, and the scope of the invention is not limited by this exemplary description.
[0042] 1. Experimental Method
[0043] 1-1. Reprogramming and Cell Culture
[0044] Peripheral blood mononuclear cells (PBMCs) isolated from patients were thawed and centrifuged at 300 ×g for 10 minutes with 1 mL of blood basal media (BBM) (StemPro™-34 SFM, Gibco). After removing the supernatant, 2 × 10⁶ 6Cells were resuspended in 1 mL of complete blood media (CBM) (StemPro™-34 SFM supplemented with SCF 100 ng / mL, Flt3 100 ng / mL, IL3 20 ng / mL, IL-6 20 ng / mL, and EPO 2 U / mL) and seeded into uncoated Matrigel 24-well plates. Cells were cultured overnight under normal oxygen conditions. Half of the medium was replaced with fresh CBM every two days. After 7 days, the Sendai virus vector cocktail was prepared. When the cells were ready for transduction, they were vigorously washed with 1 mL of CBM, transferred to a 15 mL tube, and counted. 2×10⁶ 5Cells were collected and transduction was performed by adding a Sendai virus vector cocktail. The next day, the cells were vigorously washed with 1 mL of BBM to remove the Sendai virus, and the cells were transferred to a 15 mL tube. After centrifugation at 300 ×g for 7 minutes, the cell pellet was resuspended in 1 mL of CBM and transferred to a Matrigel-coated 12-well plate. On days 3 and 5, each well was replaced with 1 mL of fresh BBM. On day 7, 1 mL of essential 8 medium (E8, Gibco) was added to the BBM, and the medium was replaced daily with 1 mL of fresh E8. Around 15 days after Sendai virus transduction, colonies were formed and selected. Using a p10 pipette tip, colonies were transferred to Matrigel-coated 12-well plates containing E8 supplemented with 10 μM of a Rho-kinase inhibitor (passage 1, P1). After 7–10 days, when the colonies had grown enough to be passaged, the cells were passaged into new Matrigel-coated 6-well plates using EDTA. When the cells reached 90% capacity at P5, 5 vials of cells were frozen using CryoStor® CS10 (Stemcell), and the cells were continued to be cultured at a 1:6 ratio. At P10, RT-PCR and immunofluorescence were performed to characterize the induced pluripotent stem cells (iPSCs).
[0046] 1-2. Differentiation of human induced pluripotent stem cell-derived cardiomyocytes
[0047] On day 0, 4-6 μM of the GSK-3 inhibitor CHIR99021 (TOCRIS) was added to RPMI1640 medium (cardiomyocyte differentiation medium, CBM) supplemented with B27 minus insulin (Gibco). On days 1-2, 1 mL of B27 (Gibco) was added to the CBM to gradually decrease the intracellular concentration of CHIR99021. On day 3, the previous medium was removed, and 5 μM of the Wnt inhibitor endo-IWR1 (Tocris) was added to the new CBM. On days 5 and 7, the previous medium was removed and replaced with new CBM. On day 9, the previous medium was removed and replaced with RPMI1640 medium (cardiomyocyte maintenance medium, CMM) supplemented with B27 (Gibco). Metabolic purification was performed on days 11–15 to remove undifferentiated cells. On day 15, the previous medium was removed and replaced with a new CMM. On day 17, beating cardiomyocytes were treated with phenol red-free TrypLE Select Enzyme 10× (Gibco) and cultured at 37°C for 10–30 minutes. The culture medium was transferred to a 15 mL conical tube containing RPMI1640, and the cells were centrifuged at 300 ×g for 4 minutes. After removing the supernatant, the cell pellet was resuspended in RPMI1640 supplemented with 10% Knock Out Serum Replacement (Gibco) and 10 μM of the ROCK inhibitor Y-27632 (Biogems) for further analysis.
[0049] 1-3. Preparation of Uremic Mixture
[0050] Urea, creatinine, and indoxyl sulfate (Sigma-Aldrich) were dissolved in PBS, and uric acid (Sigma-Aldrich) was dissolved in 0.25N NaOH. Each solution was filtered using a 0.2 μm pore size filter before further experiments.
[0051] A uremic toxin mixture was used to simulate the uremic environment in the body of patients with chronic kidney disease and was prepared by mixing urea 50 mM, creatinine 1 mM, uric acid 0.8 mM, and indoxyl sulfate 1 mM to achieve final concentrations in the medium. Cells were treated with the uremic toxin mixture 15 times at 2 days for a total of 30 days.
[0053] 1-4. Flow Cytometry
[0054] Cells were fixed in 4% paraformaldehyde (Thermo Fisher Scientific) for 15 minutes at room temperature, washed once with wash buffer (1% FBS / PBS), and centrifuged at 300 ×g for 4 minutes. Cells were permeated with 0.1% Triton X-100 / PBS for 15 minutes at room temperature, washed twice with wash buffer, and centrifuged at 300 ×g for 4 minutes. Incubated with diluted primary antibody (1:20 dilution in 3% BSA / PBS) on ice in a dark room for 1 hour. Cells were washed twice with wash buffer and centrifuged at 300 ×g for 4 minutes at 4°C. The cell pellet was resuspended in 500 μL of 3% BSA / PBS and filtered through a cell strainer tube (Falcon). Samples were analyzed using a FACS Aria3 SORP flow cytometer (Becton Dickinson). More than 10,000 cells were analyzed for each experiment.
[0056] 1-5. qRT-PCR
[0057] Total RNA was extracted using the easy-BLUE™ Total RNA Extraction Kit (iNtRON). Reverse transcription was performed on 1 μg of total RNA using Maxime™ RT Premix (iNtRON). qPCR was performed using the KAPA SYBR® FAST Master Mix 2Х Universal (KAPA BIOSYSTEMS) according to the manufacturer's instructions on the CFX86® Real-Time System (Bio-Rad) or CFX Connect® Real-Time System (Bio-Rad). The normalized expression level (ΔΔCT) of each gene was calculated based on the levels of the housekeeping genes GAPDH or RNA18S1. The primer sequences used are shown in Table 1 below.
[0058] gene primer Primer sequence (5'-3') Sequence number RNA18S1 Forward GGCCCTGTAATTGGAATGAGTC 1 Reverse CCAAGATCCAACTACGAGCTT 2 GAPDH Forward CATGAGAAGTATGACAACAGCCT 3 Reverse AGTCCTTCCACGATACCAAAGT 4 NANOG Forward TGAACCTCAGCTACAAACAGGTG 5 Reverse AACTGCATGCAGGACTGCAGAG 6 SOX2 Forward TTCACATGTCCCAGCACTACCAGA 7 Reverse TCACATGTGTGAGAGGGGCAGTGT 8 OCT4 Forward CTTGCTGCAGAAGTGGGTGGAGGAA 9 Reverse CTGCAGTGTGGGTTTCGGGCA 10 cTnT Forward TGGAGGCAGAGAAGTTCGAC 11 Reverse CCTGTTTCGGAGAACATTGAT 12 MYH7 Forward CGAAGGGCTTGAATGAGGAGT 13 Reverse TCCTCCCAAGGAGCTGTTAC 14
[0060] 1-6. Sample Preparation for Bulk mRNA Sequencing
[0061] Cells were collected for bulk RNA sequencing. Briefly, induced pluripotent stem cell-derived cardiomyocytes (iPSC-CMs) were thawed and collected in PBS. For RNA sequencing, total RNA was isolated using the miRNeasy Mini Kit (QIAGEN) according to the manufacturer's instructions. The RNA integrity number (RIN) of each sample was determined using an Agilent 2100 BioAnalyzer (Agilent), and all samples with a RIN > 6 were selected for RNA sequencing. For RNA sequencing, a library was constructed using the NEBNext Ultra II RNA library prep kit for Illumina (NEB), which included mRNA purification using poly-T oligo-attached magnetic beads. The library was sequenced using the NovaSeq platform (Macrogen Co., Ltd.).
[0063] 1-7. mRNA Sequencing Analysis
[0064] Paired-end reads obtained from bulk mRNA sequencing were aligned to the Gencode GRCh37.p13 reference genome (https: / / www.gencodegenes.org) using STAR (v.2.7.3a) set to the default. The number of genes was quantified using FeatureCounts based on the hg19 GenCode annotation reference. Before starting the primary analysis, batch correction was performed using SVAseq to remove unwanted variables from high-throughput experiments. To adjust for differences in sequencing depth between samples, counts normalized by DESeq2 were generated through size factor estimation. Then, differential expression analysis was performed using the likelihood ratio test (LRT) in DESeq2. For exploratory data analysis, a variance-stabilizing transformation was performed on the count table, followed by PCA and unsupervised hierarchical clustering using Euclidean distance from the pheatmap package. PCA plots were generated by combining these datasets with RNA sequencing data. After verifying the data types and composition, subgroup analyses were performed. DEGs were defined as having an adjusted P-value (Padj) < 0.05 and log2|Fold Change (FC)| > 1. GO profiling was performed using the ClusterProfiler package from org.HS.eg.db. GO enrichment maps were generated using the Emapplot function of ClusterProfiler.In addition, a custom package was used to construct chord diagrams illustrating the interactions between genes and specific GO terms. To explore the data from a broader perspective, genes (FDR < 0.25) were identified, and overall trends were analyzed using gene-set enrichment analysis (GSEA) focused on the KEGG pathway. This analysis was performed using the gseKEGG function of ClusterProfiler. To further explore pathway activity inferred from RNA-sequencing data, the PROGENy algorithm implemented in the progeny R package was utilized.
[0066] 1-8. Cell viability
[0067] Cells were seeded at a density of 20,000 per well in Matrigel-coated 96-well plates. The following day, after removing the previous medium, 100 μL of RPMI1640 supplemented with B27 was added, and the medium was changed every two days. On day 38 after differentiation, cells were treated with a uremic toxin mixture, and the medium was changed every two days. Cell viability was quantitatively evaluated using PrestoBlue reagent (Life Technologies), and measurements were performed using a Cytation 5 microplate reader (BioTek).
[0069] 1-9. GSH / GSSG-Glo Analysis
[0070] Cells were seeded at a density of 20,000 per well in Matrigel-coated 96-well plates. Then, total glutathione (GSH) and oxidized glutathione (GSSG) were measured in the cell lysates using a GSH / GSSG-Glo assay (Promega) according to the manufacturer's instructions. Luminescence signals were measured using a Cytation 5 microplate reader (BioTek). The GSH / GSSG ratio was calculated as [(Net Total Glutathione RLU - Net Oxidized Glutathione RLU)] / (Net Oxidized Glutathione RLU) × 2, where RLU represents the relative light unit.
[0072] 1-10. Immunocytochemistry
[0073] Cells were dispensed onto Matrigel-coated cell chamber slides. The following day, cells were fixed in 4% paraformaldehyde (Thermo Fisher Scientific) for 15 minutes at room temperature and washed three times with PBS, followed by treatment with 0.1% Triton X-100 / PBS for 15 minutes at room temperature and washing three times with PBS. Cells were blocked with 1% BSA / PBS on a shaker at room temperature for 1 hour. Incubation with the diluted primary antibody was performed overnight at 4°C. After 16 hours, cells were washed three times with PBS for 10 minutes each at room temperature. The Alexa-conjugated secondary antibody was diluted 1:600 in blocking buffer and incubated with the cells on a shaker at room temperature for 1 hour and 30 minutes. After incubation, cells were washed three times with PBS for 10 minutes each. Nuclei were counterstained with Hoechst stain (Gibco). The primary and secondary antibodies used herein are as follows: Mouse monoclonal anti-cardiac troponin T (Abcam, ab8295), anti-sarcomeric alpha actinin antibody (Abcam, ab137346), Goat anti-mouse IgG (H+L) secondary antibody, Alexa Fluor™ 488 (Thermo Fisher Scientific, A-11001), and Goat anti-Rabbit IgG (H+L) secondary antibody, Alexa Fluor™ 647 (Thermo Fisher Scientific, A-21244).
[0075] 1-11. Statistical Analysis
[0076] Graphic presentation and statistical analysis were performed using GraphPad Prism software v10.4.2 (GraphPad Software, USA), and results were expressed as mean ± standard deviation (SD) per group unless otherwise specified. Comparisons between groups were performed by unpaired Student's t-tests (independent samples t-test), Welch's t-test, one-way ANOVA, or Brown-Forsythe and Welch ANOVA. For one-way ANOVA and Brown-Forsythe or Welch ANOVA, multiplicity-adjusted (Tukey or Dunnett T3) P-values with an alpha threshold of 0.05 were reported overall. P-values were indicated in each figure for statistically significant comparisons (*, P<0.05; **, P<0.01; ***, P<0.001; ****, P<0.0001).
[0078] 2. Experimental Results
[0079] Uremic cardiomyopathy is a condition in which the concentration of uremic toxins in the blood increases due to chronic kidney disease, leading to impaired function of myocardial cells in the heart tissue and manifesting various phenotypes such as left ventricular hypertrophy, diastolic dysfunction, pericardial effusion, pericarditis, and cardiac failure. Among these, pericardial effusion is a condition in which fluid accumulates between the two layers of the pericardium, the membrane surrounding the heart, and can be triggered by inflammation caused by advanced chronic kidney disease or infection.
[0080] Referring to Fig. 1, induced pluripotent stem cells (iPSCs) for a uremic cardiomyopathy model (UCM) were produced by reprogramming peripheral blood mononuclear cells (PBMCs) from three chronic kidney disease patients exhibiting severe pericardial effusion. Additionally, iPSCs were produced from three additional chronic kidney disease patients who did not exhibit a heart-related phenotype, serving as a disease control (DC) for comparison. All produced iPSCs were confirmed to express the pluripotency marker genes NANOG, OCT4, and SOX2 (Fig. 2a). Furthermore, cardiomyocytes derived from the iPSCs were confirmed to express the cardiomyocyte marker genes TNNT2 and MYH7 (Fig. 2b).
[0081] Transcriptome analysis was performed on mRNA samples from induced pluripotent stem cell-derived cardiomyocytes (day 38 of differentiation) from the disease control group (DC) and the patient group (UCM). As a result, genes showing significant differences in expression between the two groups were identified, and it was confirmed that the expression of genes related to the extracellular matrix and cell adhesion molecules was increased in the patient group (UCM) (Fig. 3). In addition, it was confirmed that the phosphorylation level of the PI3K-Akt signaling pathway was higher in the patient group (UCM) compared to the disease control group (DC). This model is a patient-specific uremic cardiomyopathy model distinct from existing animal models and can be usefully applied for personalized drug screening and toxicity testing.
[0082] The disease control group (DC) and the patient group (UCM) were treated with a uremic toxin mixture, and the phenotypes and gene expression patterns between the two groups were compared. In both groups, the cardiac cell heart rate decreased in the uremic toxin-treated group (UTH) compared to the untreated group (veh) (Fig. 4). Cell viability (Fig. 5a) and the degree of glutathione reduction (Fig. 5b) were compared as indicators of apoptosis, but there were no significant differences between the two groups. Two patients in the patient group (UCM2 and UCM3) actually exhibited left ventricular hypertrophy, and a comparison of the cardiac cell sizes of these patients showed that the cardiac cell sizes of the corresponding patients were large in both the uremic toxin-treated group (UTH) and the untreated group (veh) (Fig. 6).
[0083] To select biomarkers for predicting the phenotype of the patient group, genes showing significant differences in expression were identified in the uremic toxin-treated (UT) and untreated (veh) groups of the disease control group (DC) and the patient group (UCM). Genes exhibiting the same pattern in both the disease control group (DC) and the patient group (UCM) accounted for 4.9%, confirming that most genes were group-specific (Figure 7). In particular, it was confirmed that in the patient group (UCM), uremic toxin treatment increased the expression of genes related to cell adhesion substances and innate immune system activation; among these, the genes C5AR1, CCL21, ITGA11, and ACTA1 were selected as biomarkers. Conversely, ATF5, ASNS, and PSAT1 were additionally selected, which showed significant differences in expression in the disease control group (DC) but no differences in expression in the patient group (UCM) (Figure 8). Through this, it was confirmed that the two groups exhibited different gene expression patterns for uremic mixtures, and finally, the genes ATF5, ASNS, PSAT1, C5AR1, CCL21, ITGA11, and ACTA1 were proposed as biomarkers for diagnosing uremic cardiomyopathy.
[0085] The present invention has been described above with reference to its preferred embodiments. Those skilled in the art will understand that the present invention may be embodied in modified forms without departing from the essential characteristics of the invention. Therefore, the disclosed embodiments should be considered in an illustrative rather than a restrictive sense. The scope of the invention is defined by the claims, not by the foregoing description, and all variations within the scope of the claims should be interpreted as being included in the invention.
Claims
Claim 1 A composition for diagnosing uremic cardiomyopathy comprising a preparation for detecting the expression of one or more genes or proteins selected from the group consisting of ATF5, ASNS, PSAT1, C5AR1, CCL21, ITGA11, and ACTA1. Claim 2 A composition according to claim 1, wherein the preparation is one or more selected from the group consisting of primers, probes, antisense nucleotides, antibodies, oligopeptides, ligands, PNAs, and aptamers that bind to each gene or protein. Claim 3 A kit for diagnosing uremic cardiomyopathy comprising the composition of claim 1. Claim 4 a) detecting the expression of one or more genes or proteins selected from the group consisting of ATF5, ASNS, PSAT1, C5AR1, CCL21, ITGA11, and ACTA1 in a biological sample isolated from a subject; and b) comparing the expression level of the detected genes or proteins with a control group, comprising a method for providing information for the diagnosis of uremic cardiomyopathy. Claim 5 A method according to claim 4, wherein the biological sample of step a) is one or more selected from the group consisting of blood, plasma, serum, lymph fluid, saliva, urine, and tissue. Claim 6 A method according to claim 4, wherein the gene or protein expression of step a) is detected by one or more methods selected from the group consisting of fluorescent nucleic acid hybridization, chromatin immunoprecipitation, next-generation sequencing, polymerase chain reaction (PCR), reverse transcription polymerase chain reaction (RT-PCR), competitive RT-PCR, real-time PCR, real-time RT-PCR, nuclease protection assay, in situ hybridization, DNA or RNA microarray, Northern blot, enzyme immunoassay, Western blot, radioimmunoassay, immunodiffusion, immunoprecipitation, flow cytometry, immunohistochemistry, immunofluorescence, and protein microarray. Claim 7 A method according to claim 4, wherein step b) determines uremic cardiomyopathy when the expression level of one or more genes or proteins selected from the group consisting of ATF5, ASNS, and PSAT1 is low compared to a control group, or when the expression level of one or more genes or proteins selected from the group consisting of C5AR1, CCL21, ITGA11, and ACTA1 is high.