Genetic engineering, delivery, and application of tumor antigen peptide fusion proteins and their compositions
Patent Information
- Application Number
- KR1020267022358
- Authority / Receiving Office
- KR · KR
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-02-06
- Filing Date
- 2024-12-13
- Publication Date
- 2026-08-12
Smart Images

Figure PCT00023_ABST
Abstract
Description
Technology Field
[0001] The present invention belongs to the fields of biopharmaceuticals and tumor immunology and relates to the genetically engineered delivery and application of tumor antigen peptide fusion proteins and their compositions. Background Technology
[0002] Cancer vaccines possess both preventive and therapeutic properties. Vaccines administered to individuals who have not yet developed cancer can prevent tumor development by activating the immune system to kill cancer cells, while vaccines can treat existing cancer patients by activating the immune system to kill cancer cells. Although vaccination is one of the effective methods for cancer prevention and treatment, there are several obstacles to maximizing the efficacy of therapeutic cancer vaccines, including a lack of specific tumor antigens, reduced immunogenicity of the antigens, and decreased delivery efficiency.
[0003] Therapeutic cancer vaccines activate an immune response against cancer cells within the body based on tumor antigens. Tumor-specific antigens are antigens unique to tumor cells, including major histocompatibility complex (MHC)-associated tumor antigens, and can activate an immune response. Generally, tumor-specific antigens arise from acquired genetic mutations and are considered most common in cancers with high mutation rates, such as melanoma and lung cancer; through the immune response, they can accurately kill cancer cells within the tumor microenvironment without causing adverse effects such as the miskilling of normal cells. Cancer-testis antigens (CTAs), also known as cancer germline antigens, belong to the category of tumor-specific antigens. They include proteins expressed in over 200 lineage tissues (e.g., testes, ovaries, placentas), and their expression characteristics are as follows: ① they are expressed at different frequencies in various tumor tissues; ② most CTAs are located on the X chromosome; and ③ they generally exist in the form of multiple family members. ④ CTA expression exhibits heterogeneity across various tumor tissues of different origins. Tumor cells create an inhibitory immune microenvironment that allows them to evade the immune system. Therefore, these tumor antigens enable the development of more accurate and effective immunotherapies and serve as ideal targets in tumor immunotherapy. Sipuleucel-T (trade name: Provenge), a prostate cancer vaccine, is an antigen-presenting cell-based autologous cell immunotherapy and the first prostate cancer cell immunotherapy approved by the U.S. Food and Drug Administration (FDA). While patients in the Sipuleucel-T treatment group experienced a 4.1-month extension in median survival, significant effort is still required for a complete cure.
[0004] NAD +15-hydroxyprostaglandin dehydrogenase (HPGD) is a key enzyme for prostaglandin inactivation and is an important target for drug intervention as it participates extensively in regulating various cellular pathways, including inflammation, differentiation, and signal transduction. Furthermore, HPGD is universally expressed in mammalian tissues and is positioned in the cytoplasm. It degrades prostaglandins (tumor-promoting molecules) within cancer cells, thereby inhibiting cancer cell proliferation and inducing differentiation. Additionally, when HPGD is knocked out or underexpressed, the susceptibility of colon tumors increases, and pancreatic tumor cells expand. This suggests that HPGD is a tumor suppressor gene and a potential therapeutic target molecule for cancer control.
[0005] Poxviruses are large, structurally complex DNA viruses with various types; however, the major viruses that exhibit pathogenicity to humans are orthopox viruses, examples of which include smallpox virus, vaccinia virus, smallpox virus, and monkeypox virus. Poxvirus vectors are capable of expressing foreign proteins, are closer to their natural structure compared to bacterial or yeast expression, and offer good stability. Here, vaccinia virus is used as a smallpox vaccine and possesses the following characteristics: ① It has a wide host range, allowing it to infect both mammalian and avian cells; ② Its large genome allows for the insertion of foreign protein gene fragments; ③ The virus replicates within the host cytoplasm without integrating with the host cell genes; and ④ Some vaccinia viruses can be used in the development of oncolytic viruses. Therefore, vaccinia virus is an ideal vector for the expression of eukaryotic genes or foreign viral genes. Commonly known vaccinia virus strains currently include the Western Reserve (WR) strain, Copenhagen strain, Lister strain, Ankara strain, Modified Vaccinia Ankara strain, New York Vaccinia strain, Tian Tan strain, Dryvax strain, Bern strain, Paris strain, Tash Kent strain, IHD-J strain, IHD-W strain, Brighton strain, CVA382 strain, Dairen strain, LC16m8 strain, LC16M0 strain, LIVP strain, ACAM2000 strain, WR65-16 strain, Connaught strain, EM-63 strain, etc.
[0006] Based on the above background, the present invention aims to provide a method for genetically engineered delivery of a tumor antigen peptide fusion protein and its composition, and applications.
[0007] One aspect of the present invention provides a tumor antigen peptide fusion protein comprising a signal peptide, a human-derived 15-hydroxyprostaglandin dehydrogenase (HPGD), and at least one selective tumor antigen peptide.
[0008] A second aspect of the present invention provides a composition comprising a tumor antigen peptide fusion protein and a therapeutic factor of the present invention. The therapeutic factor comprises a therapeutic factor fusion protein, which comprises a therapeutic factor and at least one selected from a signal peptide, a membrane permeable peptide, and a signal anchor peptide, wherein the signal peptide, the membrane permeable peptide, and / or the signal anchor peptide are located at the N-terminus or C-terminus of the therapeutic factor fusion protein.
[0009] In some embodiments, the composition comprises the tumor antigen peptide fusion protein and the IL12 p70 fusion protein of the present invention, wherein the IL12 p70 fusion protein comprises a signal peptide or signal anchor peptide from the N-terminus to the C-terminus, the IL12 p70 protein, and a selective membrane permeable peptide.
[0010] A third aspect of the present invention provides a tumor antigen peptide fusion protein of the present invention or a nucleic acid composition encoding a composition of the present invention.
[0011] A fourth aspect of the present invention provides a genetically engineered recombinant virus comprising the nucleic acid composition.
[0012] A fifth aspect of the present invention provides an expression system comprising a host cell and a genetically engineered recombinant virus of the present invention.
[0013] A sixth aspect of the present invention provides a pharmaceutical composition comprising the tumor antigen peptide fusion protein, composition, nucleic acid construct, or genetically engineered recombinant virus of the present invention; and a pharmaceutically acceptable carrier.
[0014] A seventh aspect of the present invention provides a method for treating or preventing a tumor, comprising the step of administering the tumor antigen peptide fusion protein, composition, nucleic acid construct, genetically engineered recombinant virus, or pharmaceutical composition of the present invention.
[0015] The eighth aspect of the present invention provides the use of a tumor antigen peptide fusion protein, a composition, a nucleic acid composition, a genetically engineered recombinant virus, or a pharmaceutical composition in the manufacture of a drug for treating or preventing tumors.
[0016] A ninth aspect of the present invention provides a method for activating or enhancing immune cell function, comprising the step of administering a tumor antigen peptide fusion protein, a composition, a nucleic acid construct, a genetically engineered recombinant virus, or a pharmaceutical composition according to the present invention.
[0017] The tumor antigen peptide fusion protein, composition, nucleic acid construct, genetically engineered recombinant virus, or pharmaceutical composition of the present invention has the following characteristics.
[0018] (1) Therapeutic effect: Vaccinia virus directly degrades tumor cells and simultaneously activates an inflammatory response to indirectly enhance anti-tumor immunity, thereby exhibiting an immune-enhancing effect in cancer patients and activating and / or strengthening the immune system to enter an immune response state. The expression and release of tumor antigen peptide fusion proteins induce proliferation of tumor-specific immune cells and simultaneously degrade prostaglandin E2 to reduce tumor immunosuppressive factors, thereby enhancing immune cells to effectively eliminate tumor cells.
[0019] (2) Vaccine-like: The host can induce a tumor immune response, but first, the vaccinia virus itself causes a strong viral immune response in the host, and then the host shows a strong immune response to the vaccinia virus, and at the same time, the tumor antigen peptide fusion protein is released to induce a strong tumor immune response, thereby proliferating a large number of tumor-specific immune cells and achieving the therapeutic and preventive effects against cancer.
[0020] (3) High specificity and low side effects: It selectively infects only target cells to induce a tumor-specific immune response, and since the proliferated specific immune cells cannot recognize or attack normal cells, it has strong immunogenicity and tumor antigen specificity while having few side effects and high safety. Brief explanation of the drawing
[0021] The present invention can be more fully understood by referring to the drawings below. Figure 1 shows a schematic diagram of a tumor antigen peptide fusion protein (A) and an IL12 p70 fusion protein (B). SP is a signal peptide, and TA peptide is a tumor antigen peptide (TA1peptide, TA2peptide, …… TA n peptide may be the same or different), Linker refers to a linker peptide, TP refers to a membrane-permeable peptide, and SAP refers to a signal anchor peptide. Figure 2 shows a schematic diagram of a shuttle plasmid. Figure 2A is a schematic diagram of a shuttle plasmid of a fusion protein of a secreted fusion tumor antigen peptide, where Figure 2Ai shows a secreted human HPGD (sHPGD) and a green fluorescent protein (GFP) driven by a promoter; Figure 2Aii shows a secreted fusion tumor antigen peptide and a human HPGD (hHPGD) fusion protein (secreted TA peptide+hHPGD, sTAH) and GFP driven by a promoter; and Figure 2Aiii shows a multiple secreted fusion tumor antigen peptide and a human HPGD fusion protein (secreted multiple TA peptides+hHPGD, smTAH) and GFP driven by a promoter. Figure 2B shows a shuttle plasmid of IL12 p70 fusion protein, where Figure 2Bi shows secreted IL12 p70 (sIL12) and GFP driven by a promoter, Figure 2Bi shows type I membrane protein IL12 p70 (mIL12 I) and GFP driven by a promoter, and Figure 2Biii shows type II membrane protein IL12 p70 (mIL12 II) and GFP driven by a promoter. Figure 3 illustrates the genetic modification of vaccinia virus. Figure 3A is a schematic diagram of the construction of a vaccinia virus WC strain in which the A34R gene sequence of the WR strain (WR A34R) is replaced with the A34R gene sequence of the Copenhagen strain (CoA34R), using the Western Reserve (WR) strain as a scaffold. Figure 3B compares the plaque morphology of extracellular enveloped virus (EEV) and intracellular mature virus (IMV) of the WR strain and WC strain in CV-1 cells. Figure 3C shows a comparison of the titer multiples of EEV viruses of the WR strain and WC strain, and the data indicated in the figure is the mean of the results from three experiments. Fig. 3D shows a genetic modification using a vaccinia virus WC strain as a vector, which includes modification of six gene sequences: sequence 1 (J2R), sequence 2 (A34R), sequences 3-5 (A44L-A45R-A46R) and sequence 6 (A52R), and further includes melting heterologous nucleic acids encoding tumor antigen peptide fusion proteins and / or therapeutic factors. FIG. 4 shows a shuttle plasmid for constructing a genetically engineered recombinant virus using a novel vaccinia virus WC strain as a vector, wherein FIG. 4A is for the knockout of the A34R (CoA34R) heteronucleus of the Copenhagen strain; FIG. 4B is for the knockout of J2R (Fig. 4Bi), A44L-A45R-A46R (Fig. 4Bii), and A52R (Fig. 4Biii); FIG. 4C is for the knockout of the heteronucleus mouse-derived HPGD (mHPGD) (Fig. 4Ci), secreted human-derived HPGD (sHPGD; Fig. 4Cii), sIL12 (Fig. 4Ciii), mIL12I (Fig. 4Civ), and mIL12II (Fig. 4Cv) simultaneously with the J2R gene knockout; Fig. 4D shows A44L-A45R-A46R gene knockout simultaneously with heterologous nucleic acid sHPGD (Di in Fig. 4), a fusion protein of a secreted fusion MHC class I polypeptide-related sequence B (MICB) peptide and human HPGD (human HPGD, hHPGD) (secreted MICB peptide+hHPGD, sMICBH; Dii in Fig. 4), a fusion protein of a secreted fusion MHC class I polypeptide-related sequence A (MICA) peptide and hHPGD (secreted MICA peptide+hHPGD, sMICAH; Diii in Fig. 4), a secreted fusion MICB peptide, and a fusion protein of hHPGD and multiple cancer-testis antigen (CTA) peptides (secreted MICB peptide+multiple CTA peptides+hHPGD, smCTAH;Div-v in Fig. 4), secreted fusion MICB peptide, multiple prostate carcinoma tumor antigen (Prostate carcinoma TA, PCTA) peptides, and fusion protein of hHPGD (secreted MICB peptide + multiple PCTA peptides + hHPGD, smPCTAH; Dvi-vii in Fig. 4) are for knockout; E in Fig. 4 is for knockout of heterologous nucleic acids sHPGD (Ei in Fig. 4), sMICBH (Eii in Fig. 4), smCTAH (Eiii-iv in Fig. 4), and smPCTAH (Ev-vi in Fig. 4) simultaneously with A52R gene knockout. Figure 5 shows a genetically engineered recombinant virus of a fusion tumor antigen peptide. Here, Fig. 5A represents genetically engineered recombinant viruses IVIR001–IVIR013 using a novel vaccinia virus WC strain as a vector, respectively, wherein IVIR001, IVIR002, and IVIR010 express the type I membrane protein IL12 p70 (mIL12 I) and secreted human-derived HPGD (sHPGD); IVIR003, IVIR004, and IVIR011 express mIL12 I and a fusion protein of hHPGD with a secreted fusion tumor antigen MICB peptide (sMICBH); and IVIR005, IVIR006, and IVIR012 express mIL12 I and a fusion protein of hHPGD with a secreted fusion tumor antigen MICB peptide and multiple cancer-testis antigen peptides (smCTAH). IVIR007, IVIR008, and IVIR013 express a fusion protein (smPCTAH) of mIL12 I and secreted fusion tumor antigen MICB peptide, multiple prostate cancer tumor antigen peptides, and hHPGD; IVIR009 expresses a fusion protein (sMICAH) of mIL12 I and secreted fusion tumor antigen MICA peptide and hHPGD. Fig. 5B represents fusion proteins delivered by recombinant viruses IVIR001–IVIR013, respectively, wherein Fig. 5B represents mIL12I (Type I membrane protein IL12 p70) comprising a signal peptide, IL12 p40, (G4S)2 linker peptide, IL12 p35, and a transmembrane peptide (TP); Fig. 5Bi represents sHPGD comprising a signal peptide and human-derived HPGD (hHPGD); and Fig. 5Biii represents sMICBH comprising a signal peptide, G2S linker peptide, MICB peptide, AEAAAKEAAAKA linker peptide, and hHPGD; Biv in Fig. 5 represents smCTAHa comprising a signal peptide, G2S linker peptide, MICB peptide, AEAAAKEAAAKA linker peptide, CTA1 peptide (cancer-testis antigen peptide 1), CTA2 peptide…CTA33 peptide, AEAAAKEAAAKA linker peptide, and hHPGD, where the linker peptide between each CTA peptide is GG; Bv in Fig. 5 represents smCTAHb comprising a signal peptide, G2S linker peptide, MICB peptide, AEAAAKEAAAKA linker peptide, CTA1 peptide (cancer-testis antigen peptide 1), CTA2 peptide…CTA33 peptide, AEAAAKEAAAKA linker peptide, and hHPGD, where the linker peptide between each CTA peptide is PP; Bvi in Fig. 5 is a signal peptide, G2S linker peptide, MICB peptide, AEAAAKEAAAKA linker peptide, PCTA1 peptide (prostate cancer tumor antigen peptide 1), PCTA2 peptide… PCTA 10Figure 5 shows smPCTAHa comprising a peptide, an AEAAAKEAAAKA linker peptide, and hHPGD, where the linker peptide between each PCTA peptide is GG; Bvii of Figure 5 shows smPCTAHb comprising a signal peptide, a G2S linker peptide, an MICB peptide, an AEAAAKEAAAKA linker peptide, PCTA1 peptide (prostate cancer tumor antigen peptide 1), PCTA2 peptide…PCTA10 peptide, an AEAAAKEAAAKA linker peptide, and hHPGD, where the linker peptide between each PCTA peptide is PP; Bviii of Figure 5 shows a signal peptide, It represents sMICAH containing G2S linker peptide, MICA peptide, AEAAAKEAAAKA linker peptide, and hHPGD. Figure 6 shows the PCR verification results of vaccinia virus gene knockout. Here, Δ represents gene knockout. Figure 7 shows the verification results of IL12 p70 expressed after 16h infection of CV-1 cells with a recombinant virus. Figure 7A is a schematic diagram of the fusion IL12 p70 fusion proteins expressed by the recombinant viruses WRΔJ2R-sIL12, WRΔJ2R-mIL12 I, and WRΔJ2R-mIL12 II, where sIL12 is the secreted IL12 p70, mIL12 I is the type I membrane protein IL12 p70, and mIL12 II is the type II membrane protein IL12 p70, SP is the secreted signal peptide of sIL12, TP is the membrane permeable peptide of mIL12 I, and SAP is the signal anchor peptide of mIL12 II. Figure 7B shows the Western blot (WB) results for non-extracellular (intracellular and on the cell membrane) IL12 p70 and internal reference protein β-actin in the recombinant virus WRΔJ2R-sIL12, WRΔJ2R-mIL12 I, WRΔJ2R-mIL12 II infected groups and the control virus WRΔJ2R (J2R knockout type WR strain) infected groups. Figure 7C shows the flow cytometry results for IL12 p70 on the cell membrane in the recombinant virus WRΔJ2R-sIL12, WRΔJ2R-mIL12 I, WRΔJ2R-mIL12 II, WRΔJ2R infected groups and the virus non-infected group (Cell only group). Figure 8 shows the results of in vitro functional verification of the recombinant virus expressing intracellular mouse-derived HPGD and secreted human-derived HPGD. The concentration of prostaglandin E2 (PGE2) in the culture medium was detected using an ELISA kit after infecting LLC cells for 24 hours with recombinant viruses IVIR006a, IVIR008a, and control viruses WRΔJ2R (J2R knockout type WR strain) and WRΔJ2R-HPGD (recombinant viruses of J2R knockout and mHPGD knockout type WR strains), respectively. Here, IVIR006a expressed a secreted fusion MICB peptide, multiple cancer-testis antigen peptides, a human-derived HPGD fusion protein (secreted MICB peptide + multiple CTA peptides + hHPGD, smCTAH), and type I membrane protein IL12 p70 (mIL12 I), while IVIR008a expressed a fusion protein of a secreted fusion MICB peptide, multiple prostate cancer tumor antigen peptides, and human-derived HPGD (secreted MICB It expresses peptide + multiple PCTA peptides + hHPGD, smPCTAH) and mIL12 I. The data shown in the figure are mean ± standard deviation (SD), and error bars are ±SD; in the comparison between **** WRΔJ2R and WRΔJ2R-HPGD, p-value < 0.0001; in the comparison between **** WRΔJ2R and IVIR006a, p-value < 0.0001; and in the comparison between **** WRΔJ2R and IVIR008a, p-value < 0.0001. Figure 9 shows the verification of the fusion protein expressed after infecting CV-1 cells for 16 h with WC strain recombinant virus IVIR004, which delivers the tumor antigen MICB peptide fusion protein. Figure 9A shows a schematic diagram of the fusion protein expressed by the WC strain recombinant virus IVIR004, which expresses the secreted fusion tumor antigen MICB peptide and human-derived HPGD fusion protein (secreted MICB peptide+hHPGD, sMICBH) and the type I membrane protein IL12 p70 (mIL12 I), and the control virus is the J2R knockout type WR strain (WRΔJ2R). Figure 9B shows the Western blot (WB) results of non-extracellular (intracellular and on the cell membrane) HPGD in the IVIR004 infected group and the control virus WRΔJ2R infected group. Figure 9C shows the flow cytometry results for IL12 p70 expression on the cell membrane of the IVIR004, WRΔJ2R infected group and the virus-free group (Cell only group). Figure 9D shows the Western blot results for non-extracellular (intracellular and on the cell membrane) IL12 p70 of the IVIR004, WRΔJ2R infected group. Figure 10 shows the results of IFNγ ELISpot in spleen cells 14 days after intraperitoneal injection of the WC strain recombinant virus into 6-8 week old female Balb / c mice. Figure 10A shows the IFNγ spot in mouse spleen cells of the IVIR002 (MICB peptide non-expression, w / o MICB peptide) infected group, IVIR004 (MICB peptide expression, w / MICB peptide) infected group, WRΔJ2R (J2R knockout type WR strain) infected group, and virus-free group (Cell only group). Figure 10B shows the number of IFNγ spots associated with MICB peptide (each spot represents an immune cell capable of secreting IFNγ). In the bar graph, the data indicated for MICB peptide is the value obtained by subtracting the number of IVIR002 infected group spots from the number of IVIR004 infected group spots in Figure 10A, and the data indicated for Control is the value obtained by subtracting the number of Cell only group spots from the number of WRΔJ2R infected group spots. The data indicated in Figure 10B is mean ± SD, and the error bar is ± SD; ** In the comparison between MICB peptide and Control, P<0.01. Figure 11 shows the verification of fusion proteins expressed after 16 hours of infection of CV-1 cells by a WC strain recombinant virus delivering multiple cancer-testis antigen peptide fusion proteins. Figure 11A shows a schematic diagram of the fusion protein expressed by the WC strain recombinant virus IVIR006, which includes two subtypes, a and b. When comparing the two, the commonality is that both express a fusion protein of secreted fusion MICB peptide, multiple cancer-testis antigen peptides, and human-derived HPGD (secreted MICB peptide + multiple CTA peptides + hHPGD, smCTAH) and type I membrane protein IL12 p70 (mIL12 I). The difference lies in the linker peptides between the CTA peptides; specifically, IVIR006a uses a GG linker peptide, while IVIR006b uses a PP linker peptide. Figure 11B shows the Western blot results for non-extracellular (intracellular and on the cell membrane) HPGD and internal reference protein β-actin in the IVIR006a infected group and the control virus J2R knockout type WR strain (WRΔJ2R) infected group. Figure 11C shows the flow cytometry results for IL12 p70 expression on the cell membrane in the IVIR006a, WRΔJ2R infected groups and the virus-free group (Cell only group), and Figure 11D shows the Western blot results for IL12 p70 expression on the non-extracellular (intracellular and on the cell membrane) of each group. Figure 12 shows the IFNγ ELISpot results in splenocytes 14 days after intraperitoneal injection of WC strain recombinant viruses into 6-8 week old C57BL / 6N female mice, including WC strain recombinant viruses IVIR006a (MICB peptide and CTA peptide expression, w / MICB peptide+CTA peptides), IVIR002 (MICB and CTA peptide non-expression, w / o MICB peptide+CTA peptides), and control virus WRΔJ2R (J2R knockout type WR strain). Figure 12A is a diagram of the IFNγ spots in the splenocytes of mice from each group. Figure 12B shows the number of IFNγ spots associated with MICB peptide and CTA peptide (each spot represents an immune cell capable of secreting IFNγ), and in the bar graph, the data indicated for MICB peptide+CTA peptides is the number of spots in the IVIR002 injection group minus the number of spots in the IVIR006a injection group in Figure 12A, and the data indicated for Control is the value obtained by subtracting the number of spots in the Cell only group from the number of spots in the WRΔJ2R injection group. The data shown in the figure is mean ± SD, and the error bars are ± SD; **** In the comparison between MICB peptide+CTA peptides and Control, the p-value is < 0.0001. Figure 13 shows the tumor growth curves of lung and colon cancer in mice after treatment with a WC strain recombinant virus delivering multiple cancer-testis antigen peptide fusion proteins. Figure 13A shows the tumor growth curves of mouse lung cancer cells LLC in the control group, IVIR001 treatment group, and IVIR006a treatment group; Figure 13B shows the tumor growth curves of mouse colon cancer cells MC38 in the control group, the control virus WRΔJ2R (J2R knockout type WR strain) treatment group, and IVIR006a treatment group. Here, IVIR001 is a WC strain recombinant virus expressing secreted human-derived HPGD (sHPGD) and type I membrane protein IL12 p70 (mIL12 I), and IVIR006a is a WC strain recombinant virus expressing secreted fusion MICB peptide, multiple onco-testis antigen peptides, and human-derived HPGD fusion protein (secreted MICB peptide + multiple CTA peptides + hHPGD, smCTAH) and mIL12 I. Each experimental group consists of 9-10 mice, and the data shown in the figure are the average values of tumor volumes for each group. Figure 14 shows the verification of the fusion protein expressed after 16 hours of infection of CV-1 cells by a WC strain recombinant virus delivering multiple prostate cancer tumor antigen peptide fusion proteins. Figure 14A shows a schematic diagram of the fusion protein expressed by the WC strain recombinant virus IVIR008, which includes two subtypes, a and b. When comparing the two, the commonality is that both express a fusion protein of secreted fusion MICB peptide, multiple prostate cancer tumor antigen peptides, and human-derived HPGD (secreted MICB peptide + multiple PCTA peptides + hHPGD, smPCTAH) and the type I membrane protein IL12 p70 (mIL12 I). The difference lies in the linker peptide between the PCTA peptide and another PCTA; specifically, IVIR008a uses a GG linker peptide, while IVIR008b uses a PP linker peptide. Figure 14B shows the Western blot (WB) results for non-extracellular (intracellular and on the cell membrane) HPGD and internal reference protein β-actin in the IVIR008a infected group and the control virus WRΔJ2R (J2R knockout type WR strain) infected group. Figure 14C shows the flow cytometry results for IL12 p70 expression on the cell membrane in the IVIR008a, WRΔJ2R infected groups and the virus-free group (Cell only group). Figure 14D shows the Western blot results for IL12 p70 expression on the non-extracellular (intracellular and on the cell membrane) in the IVIR008a and WRΔJ2R infected groups. Figure 15 shows the IFNγ ELISpot results in splenocytes 14 days after intraperitoneal injection of WC strain recombinant virus into 6-8 week old female Balb / c mice, including IVIR008a (MICB and PCTA peptide expression, w / MICB peptide+PCTA peptides), IVIR002 (MICB and PCTA peptide non-expression, w / o MICB peptide+PCTA peptides), and the control virus WRΔJ2R (J2R knockout type WR strain). Figure 15A is a diagram of the IFNγ spots in the splenocytes of mice from each group. Figure 15B shows the number of IFNγ spots associated with MICB and PCTA peptides (each spot represents an immune cell capable of secreting IFNγ). In the bar graph, the data indicated for MICB peptide+PCTA peptides is the value obtained by subtracting the number of spots in the IVIR002 injection group from the number of spots in the IVIR008a injection group in Figure 15A, and the data indicated for Control is the value obtained by subtracting the number of spots in the Cell only group from the number of spots in the WRΔJ2R injection group. The data shown in the figure are mean ± SD, and the error bars are ± SD; ** In the comparison between MICB peptide+PCTA peptides and Control, the p-value is < 0.01. Figure 16 shows the Western blot verification of the fusion protein expressed after 16h infection of CV-1 cells by the WC strain recombinant virus IVIR009, which delivers a tumor antigen MICA peptide fusion protein. Figure 16A shows a schematic diagram of the fusion protein expressed by the WC strain recombinant virus IVIR009, which expresses the fusion protein of secreted fusion tumor antigen MICA peptide and human-derived HPGD (secreted MICA peptide+hHPGD, sMICAH) and the type I membrane protein IL12 p70 (mIL12 I), and the control virus is the J2R knockout type WR strain (WRΔJ2R). Figures 16B to 16C are the Western blot results for non-extracellular (intracellular and membrane-bound) HPGD and IL12 p70 in the IVIR009 and WRΔJ2R infected groups. Figure 17 shows the IFNγ ELISpot results in splenocytes 14 days after intraperitoneal injection of WC strain recombinant virus into 6-8 week old female Balb / c mice, including IVIR009 (MICA peptide expression, w / MICA peptide), IVIR002 (MICA peptide non-expression, w / o MICA peptide), and control virus WRΔJ2R (J2R knockout type WR strain). Figure 17A is a diagram of the IFNγ spots in the splenocytes of mice from each group. Figure 17B shows the number of MICA peptide-associated IFNγ spots (each spot represents an immune cell capable of secreting IFNγ), and in the bar graph, the data marked for MICA peptide is the value obtained by subtracting the number of IVIR002 injection group spots from the number of IVIR009 injection group spots in Figure 17A, and the data marked for Control is the value obtained by subtracting the number of Cell only group spots from the number of WRΔJ2R injection group spots. The data shown in the figure is mean ± SD, and the error bars are ± SD; ** In the comparison between MICA peptide and Control, the p-value is < 0.01. Figure 18 shows the verification of the fusion protein expressed after 16h infection of CV-1 cells by WC strain recombinant virus IVIR006b, which delivers multiple cancer-testis antigen peptide fusion proteins. Figure 18A shows a schematic diagram of the fusion protein expressed by WC strain recombinant virus IVIR006b, which expresses secreted fusion tumor antigen MICB peptide, multiple cancer-testis antigen peptides, human-derived HPGD fusion protein (secreted MICB peptide + multiple CTA peptides + hHPGD, smCTAH) and type I membrane protein IL12 p70 (mIL12 I), and is different from IVIR006a in that the linker peptide between the CTA peptide and another CTA is a PP linker peptide. Figure 18B shows the Western blot results for non-extracellular (intracellular and cell membrane) HPGD in the IVIR006b infected group and the control virus WRΔJ2R (J2R knockout type WR strain) infected group. Figure 18C shows the flow cytometry results for IL12 p70 expression on the cell membrane in the IVIR006b, WRΔJ2R infected groups and the virus-free group (Cell only group). Figure 18D shows the Western blot results for non-extracellular (intracellular and cell membrane) IL12 p70 in the IVIR006b, WRΔJ2R infected groups. Figure 19 shows the verification of the fusion protein expressed after 16h infection of CV-1 cells with a WC strain recombinant virus delivering multiple prostate cancer tumor antigen peptide fusion proteins. Figure 19A shows a schematic diagram of the fusion protein expressed by the WC strain recombinant virus IVIR008b, which expresses a secreted fusion MICB peptide, multiple prostate cancer tumor antigen peptides, a fusion protein of human-derived HPGD (secreted MICB peptide + multiple PCTA peptides + hHPGD, smPCTAH), and type I membrane protein IL12 p70 (mIL12 I). The difference from IVIR008a is that the linker peptide between the PCTA peptide and another PCTA is a PP linker peptide. Figure 19B shows the Western blot results for non-extracellular (intracellular and on the cell membrane) HPGD and internal reference protein β-actin in the IVIR008b infected group and the control virus WRΔJ2R (J2R knockout type WR strain) infected group. Figure 19C shows the flow cytometry results for IL12 p70 expression on the cell membrane in the IVIR008b, WRΔJ2R infected groups and the virus-free group (Cell only group). Figure 19D shows the Western blot results for IL12 p70 on non-extracellular (intracellular and on the cell membrane) in the IVIR008b, WRΔJ2R infected groups. Figure 20 shows the verification of fusion proteins expressed after 16 hours of infection of CV-1 cells by WC strain recombinant viruses delivering tumor antigen peptide fusion proteins. Figure 20A is a schematic diagram of the fusion proteins expressed by WC strain recombinant viruses IVIR010, IVIR011, IVIR012a / b, and IVIR013a / b. Figure 20B is a Western blot (WB) result for non-extracellular (intracellular and membrane-bound) HPGD and internal reference protein β-actin in each recombinant virus infected group and the control virus WRΔJ2R (J2R knockout type WR strain) infected group. Figure 20C is a Western blot result for non-extracellular (intracellular and membrane-bound) IL12 p70 and internal reference protein β-actin expression in each recombinant virus infected group and the WRΔJ2R infected group. Figure 20D is a flow cytometry analysis result of IL12 p70 expression on the cell membrane of the WRΔJ2R, IVIR011, IVIR012b, and IVIR013b infected groups and the virus-free group (Cell only group). Figure 21 shows the IFNγ ELISpot results in spleen cells 7 days after intraperitoneal injection of the WC strain recombinant virus into 6-8 week old female Balb / c mice, which include IVIR011 (MICB peptide expression, w / MICB peptide), IVIR012b (MICB peptide + CTA peptide expression, w / MICB peptide + CTA peptides), IVIR013b (MICB peptide + PCTA peptide expression, w / MICB peptide + PCTA peptides), IVIR010 (MICB peptide, MICB peptide + CTA peptide and non-expression of MICB peptide + PCTA peptide, w / o MICB peptide, MICB peptide + CTA peptides or MICB peptide + PCTA peptides) and control virus WR It includes J2R (J2R knockout type WR strain). Fig. 21A is a diagram of IFNγ spots in mouse splenocytes of each group. Fig. 21B shows the number of IFNγ spots associated with MICB peptide, MICB peptide+CTA peptide, and MICB peptide+PCTA peptide (each spot represents an immune cell capable of secreting IFNγ); in the bar graph, the data indicated for MICB peptide, MICB peptide+CTA peptides, and MICB peptide+PCTA peptides are the values obtained by subtracting the number of spots in the IVIR010 injection group from the number of spots in the IVIR011 injection group, IVIR012b injection group, and IVIR013b injection group in Fig. 21A, respectively, and the data indicated for Control is the value obtained by subtracting the number of spots in the Cell only group from the number of spots in the WRΔJ2R injection group. The data shown in the figure are mean ± SD, and the error bars are ± SD; * In the comparison between MICB peptide and Control, p-value < 0.05; ** In the comparison between MICB peptide + CTA peptides and Control, p-value < 0.01; **** In the comparison between MICB peptide + PCTA peptides and Control, p-value < 0.0001. Specific details for implementing the invention
[0022] The following description of the invention is intended only to illustrate various embodiments of the invention. Accordingly, specific modifications discussed herein should not be construed as limiting the scope of the invention. Those skilled in the art should understand that various equivalents, modifications, and alterations can be made without departing from the scope of the invention, and that such equivalent embodiments are incorporated herein. All references, including publications, patents, and patent applications cited herein, are incorporated herein in their entirety.
[0023] The first aspect of the present invention provides a tumor antigen peptide fusion protein comprising a signal peptide, a human-derived 15-hydroxyprostaglandin dehydrogenase (HPGD), and at least one selective tumor antigen peptide.
[0024] In some embodiments, the signal peptide, HPGD and / or tumor antigen peptide is a human-derived peptide or a non-human mammalian-derived peptide.
[0025] In some embodiments, the tumor antigen peptide may be selected from, for example, an MHC class I polypeptide-related sequence peptide, a cancer-testis antigen (abbreviated as CTA) peptide, and a prostate carcinoma tumor antigen (PCTA) peptide. Herein, the MHC class I polypeptide-related sequence is preferably MHC class I polypeptide-related sequence A (MICA) and MHC class I polypeptide-related sequence B (MICB); and the CTA is preferably CAMEL (melanoma surface antigen recognized by CTLs); cancer-testis antigen 2 (CT6.2); BAGE (melanoma antigen; CT2.1); DAM-6 / 10 (MAGE-B1 / B2); Alzheimer's disease-associated microglia; and melanoma antigen family member B2. CT3.2), GAGE-2 (G antigen 2; CT4.2), GAGE-5 (G antigen 5; CT4.5), GAGE-6 (G antigen 6; CT4.6), GAGE-7 (G antigen 7; CT4.7), GAGE-8 (G antigen 8; CT4.8), GAGE-7B (G antigen 7B; CT4.7), MAGE-A1 (melanoma-associated antigen A1; CT1.1), MAGE-A2 (melanoma-associated antigen A2; CT1.2), MAGE-A3 (melanoma-associated antigen A3; CT1.3), MAGE-A4 (melanoma-associated antigen A4; CT1.4), MAGE-A6 (melanoma-associated antigen A6; CT1.6), MAGE-A10 (melanoma-associated antigen A10; CT1.10), MAGE-A12 (melanoma-associated antigen A12; CT1.12), NY-ESO-1 (human esophageal squamous cell carcinoma antigen 1; cancer-testis antigen 1B; CT6.1), CTAG1A (cancer-testis antigen 1A; CT6.1) and TRAG-3 (paclitaxel resistance-associated gene 3; chondrosarcoma-associated gene family member 2; CT24).2) and; PCTA is preferably prostatic acid phosphatase (PAP). In some embodiments, the sequence of the tumor antigen peptide is as shown in Table 5.
[0026] In some embodiments, the tumor antigen peptide may be one or more of MICB peptide, MICA peptide, CTA peptide, and PAP peptide.
[0027] In some embodiments, as illustrated in FIG. 1A, the fusion protein may comprise any one group of polypeptide combinations linked in the following order: (i) a signal peptide, HPGD, and one or more tumor antigen peptides; (ii) a signal peptide, one or more tumor antigen peptides, and HPGD; and (iii) a signal peptide, one or more tumor antigen peptides, HPGD, and one or more tumor antigen peptides. Here, one or more tumor antigen peptides may be the same or different.
[0028] In some embodiments, HPGD and two tumor antigen peptides, and a plurality of tumor antigen peptides, may be connected by a linker peptide as needed. The linker peptide may be any linker peptide, for example, GG, G2S, G3S, (G4S) n (n is an integer ≥1, preferably 1, 2, 3, or 4), [A(EAAAK) nA ] m (n=2,3 or 4, m=1 or 2), (XP) n (n is an integer ≥ 1, X can be any amino acid), (CW n )(n is an integer ≥ 1), one or more selected from GFLG, PLGLWA, and RVLAEA.
[0029] In some embodiments, the HPGD may be a human-derived HPGD (Gene ID: 3248), the nucleic acid sequence derived from NM_000860.6, NM_001145816.3, NM_001256301.1, NM_001256305.2, NM_001256306.2, NM_001256307.2, NM_001363574.2, and the amino acid sequence derived from NP_000851.2, NP_001139288.1, NP_001243230.1, NP_001243234.1, NP_001243235.1, NP_001243236.1, NP_001350503.1; The above HPGD may be a mouse-derived HPGD (Gene ID: 15446), its nucleic acid sequence is derived from NM_008278.2, and its amino acid sequence is derived from NP_032304.2. Preferably, the amino acid sequence of the human-derived HPGD is SEQ ID NO: 2; and the amino acid sequence of the mouse-derived HPGD is SEQ ID NO: 1.
[0030] In some embodiments, the MICB may be a human-derived MICB (Gene ID: 4277), and its nucleic acid sequence is derived from NM_001289160.2, NM_001289161.2, NM_005931.5, XM_054328503.1, XM_054330825.1, XM_054355464.1, and its amino acid sequence is derived from NP_001276089.1, NP_001276090.1, NP_005922.2, XP_054184478.1, XP_054186800.1, XP_054211439.1. Preferably, the amino acid sequence of the MICB peptide is SEQ ID NO: 28, and refer to Table 5.
[0031] In some embodiments, the MICA may be a human-derived MICA (Gene ID: 100507436), its nucleic acid sequence derived from NM_000247.3, NM_001177519.3, NM_001289152.2, NM_001289153.2, NM_001289154.2, and its amino acid sequence derived from NP_000238.1, NP_001170990.1, NP_001276081.1, NP_001276082.1, NP_001276083.1. Preferably, the amino acid sequence of the MICA peptide is SEQ ID NO: 27, and refer to Table 5.
[0032] In some embodiments, the CTA is CAMEL(Gene ID: 30848), BAGE(Gene ID: 574), DAM-6(Gene ID: 4113), DAM-10(Gene ID: 4112), GAGE-2(Gene ID: 729447), GAGE-5(Gene ID: 2577), GAGE-6(Gene ID: 2578), GAGE-7(Gene ID: 2579), GAGE-8(Gene ID: 100101629), GAGE-7B(Gene ID: 26748), MAGE-A1(Gene ID: 4100), MAGE-A2(Gene ID: 4101), MAGE-A3(Gene ID: 4102), MAGE-A4(Gene ID: 4103), MAGE-A6(Gene ID: 4105), It may be MAGE-A10 (Gene ID: 4109), MAGE-A12 (Gene ID: 4111), NY-ESO-1 (Gene ID: 1485), CTAG1A (Gene ID: 246100), and TRAG-3 (Gene ID: 102723547). Preferably, the amino acid sequences of the CTA peptides are SEQ ID NOs: 29-61, and refer to Table 5. Preferably, the amino acid sequences of the plurality of CTA peptides are SEQ ID NOs: 8 or 9, and refer to Table 1.
[0033] In some embodiments, the PCTA may be PAP; the PAP may be human-derived PAP (Gene ID: 55), the nucleic acid sequence of which is derived from NM_001134194.2, and the amino acid sequence of which is derived from NP_001127666.1. Preferably, the PCTA peptide is a PAP peptide, the amino acid sequence of which is SEQ ID NO: 62, and refer to Table 5. Preferably, the amino acid sequence of a plurality of PCTA peptides is SEQ ID NO: 10 or 11, and refer to Table 1.
[0034] In some embodiments, the amino acid sequences of the signal peptide, HPGD, MICB peptide, MICA peptide, CTA peptide, and PCTA peptide are the amino acid sequences shown in Table 1 or Table 5 or variants thereof.
[0035] In some embodiments, as illustrated in FIG. 5B, the fusion protein comprises the following:
[0036] (1) sHPGD: signal peptide + HPGD;
[0037] (2) sMICBH: signal peptide + MICB peptide + HPGD;
[0038] (3) sMICAH: signal peptide + MICA peptide + HPGD;
[0039] (4) smCTAH: signal peptide + MICB peptide + CTA1 peptide + CTA2 peptide + … + CTA n Peptide + HPGD, where n is an integer from 1 to 50, preferably 33; where CTA1 peptide, CTA2 peptide, … CTA n The peptides may be the same or different; or
[0040] (5) smPCTAH: signal peptide + MICB peptide + PCTA1 peptide + PCTA2 peptide + … + PCTA nPeptide + HPGD, where n is an integer from 1 to 20, e.g., 10. Here, PCTA1 peptide, PCTA2 peptide, … PCTA n Peptides may be the same or different.
[0041] In the above (4), smCTAH comprises n CTA peptides; preferably, 33 different CTA peptides are denoted as CTA1 to CTA33 (i.e., SEQ ID No: 29-61).
[0042] In the above (5), smPCTAH comprises n PCTA peptides; preferably, it comprises 10 identical prostatic acid phosphatase peptide (PAP peptide) sequences (SEQ ID No: 62).
[0043] In some embodiments, the linker peptide between the MICB peptide or MICA peptide and the signal peptide is GGGGSGGGGS, GGGS, GGS, GG, etc. In some embodiments, the linker peptide between the CTA peptide or PCTA peptide and the MICB peptide is AEAAAKEAAAKA, etc. In some embodiments, the linker peptide between the CTA peptides or between the PCTA peptides is GG, PP, etc.
[0044] In some preferred embodiments, the signal peptide comprises SEQ ID NO: 7 or a variant thereof. In some preferred embodiments, the HPGD comprises the amino acid sequence of SEQ ID NO: 1 or 2 or a variant thereof. In some preferred embodiments, the MICB peptide comprises SEQ ID NO: 28 or a variant thereof.
[0045] In some preferred embodiments, the tumor antigen peptide fusion protein comprises an amino acid sequence selected from SEQ ID NOs: 12-18 or a variant thereof, see Table 2.
[0046] Variants of proteins according to the present invention, for example, signal peptides, HPGDs, and / or tumor antigen peptides, have at least 75% (e.g., 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 99.8% or more) sequence identity with a corresponding amino acid sequence, or have one or more amino acids (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) deleted, inserted, and / or substituted, or have a functional domain, and furthermore, the altered sequence essentially retains at least one biological activity of the derived amino acid sequence. Preferably, the above substitution is a conservative substitution.
[0047] A second aspect of the present invention provides a composition (also known as a fusion protein composition) comprising a tumor antigen peptide fusion protein and a therapeutic factor of the first aspect. The therapeutic factor comprises a therapeutic factor fusion protein, which comprises a therapeutic factor and at least one selected from a signal peptide, a membrane permeable peptide, and a signal anchor peptide, wherein the signal peptide, the membrane permeable peptide, and / or the signal anchor peptide are located at the N-terminus or C-terminus of the therapeutic factor fusion protein. Accordingly, the therapeutic factor fusion protein may be secretory (containing only the signal peptide) or membrane permeable (containing the signal peptide and the membrane permeable peptide, or containing the signal anchor peptide).
[0048] In some embodiments, the therapeutic factor fusion protein is an IL12 p70 fusion protein. The IL12 p70 fusion protein comprises IL12 p35 and IL12 p40, preferably comprising IL12 p40 and IL12 p35 linked by a linker peptide.
[0049] In some embodiments, the IL12 p70 may be a human-derived IL12 p70, which is composed of two genes, IL12 p35 (Gene ID: 3592) and IL12 p40 (Gene ID: 3593), wherein the nucleic acid sequence of IL12 p35 is derived from NM_000882.4, NM_001354582.2, NM_001354583.2, NM_001397992.1, and the amino acid sequence is derived from NP_000873.2, NP_001341511.1, NP_001341512.1, NP_001384921.1; the nucleic acid sequence of IL12 p40 is derived from NM_002187.3, and the amino acid sequence is derived from NP_002178.2. Preferably, the amino acid sequence of human-derived IL12 p35 is SEQ ID NO: 6, refer to Table 1, wherein the underlined amino acid sequence is for constructing an IL12 p70 fusion protein; preferably, the amino acid sequence of human-derived IL12 p40 is SEQ ID NO: 5, refer to Table 1, wherein the underlined amino acid sequence is for constructing an IL12 p70 fusion protein.
[0050] In some embodiments, the IL12 p70 may be mouse-derived IL12 p70, which consists of two genes IL12 p35 (Gene ID: 16159) and IL12 p40 (Gene ID: 16160), wherein the nucleic acid sequence of IL12 p35 is derived from NM_001159424.3, NM_001410417.1, NM_001410418.1, NM_001410419.1, NM_001410420.1, NM_008351.4, and the amino acid sequence is derived from NP_001152896.2, NP_001397346.1, NP_001397347.1, NP_001397348.1, It is derived from NP_001397349.1 and NP_032377.1; the nucleic acid sequence of IL12 p40 is derived from NM_001303244.1 and the amino acid sequence is derived from NP_001290173.1. Preferably, the amino acid sequence of mouse-derived IL12 p35 is SEQ ID NO: 4, and refer to Table 1, wherein the underlined amino acid sequence is for constructing an IL12 p70 fusion protein; preferably, the amino acid sequence of mouse-derived IL12 p40 is SEQ ID NO: 3, and refer to Table 1, wherein the underlined amino acid sequence is for constructing an IL12 p70 fusion protein.
[0051] In some embodiments, as illustrated in FIG. 1B, the IL12 p70 fusion protein may comprise the following:
[0052] (i) Secreted IL12 p70 (secreted IL12 p70, sIL12): sequentially linked signal peptide, IL12 p35, linker peptide and IL12 p40, or sequentially linked signal peptide, IL12 p40, linker peptide and IL12 p35;
[0053] (ii) Type I membrane protein IL12 p70 (type I membrane protein IL12 p70, mIL12 I): sequentially linked signal peptide, IL12 p35, linker peptide, IL12 p40, and membrane permeation peptide, or sequentially linked signal peptide, IL12 p40, linker peptide, IL12 p35, and membrane permeation peptide; and / or
[0054] (iii) Type II membrane protein IL12 p70 (mIL12 II): comprises sequentially linked signal anchor peptide, IL12 p35, linker peptide and IL12 p40, or sequentially linked signal anchor peptide, IL12 p40, linker peptide and IL12 p35.
[0055] In some embodiments, IL12 p35 comprises an underlined amino acid sequence selected from SEQ ID NOs: 4 and 6 or a variant thereof. In some embodiments, IL12 p40 comprises an underlined amino acid sequence selected from SEQ ID NOs: 3 and 5 or a variant thereof. In some embodiments, the signal peptide comprises SEQ ID NO: 7 or a variant thereof. In some embodiments, the signal anchor peptide comprises SEQ ID NO: 63 or a variant thereof. In some embodiments, the membrane permeation peptide comprises SEQ ID NO: 64 or a variant thereof.
[0056] In addition, if necessary, the IL12 p70 fusion protein can use the same linker peptide as the tumor antigen peptide fusion protein.
[0057] In some embodiments, the IL12 p70 fusion protein comprises an amino acid sequence selected from SEQ ID NOs: 21-26 or a variant thereof, see Table 4.
[0058] A third aspect of the present invention provides a nucleic acid composition encoding the tumor antigen peptide fusion protein of the first aspect or the composition of the second aspect.
[0059] In the present invention, there are no specific limitations on the nucleic acid construct, as long as it can code for the relevant fusion protein, it may be, for example, a DNA fragment, mRNA, or plasmid. The expression of the fusion protein may be implemented by the shuttle plasmid shown in FIG. 2. The shuttle plasmid may be the shuttle plasmid shown in FIG. 4.
[0060] A fourth aspect of the present invention provides a genetically engineered recombinant virus comprising the nucleic acid composition of the third aspect.
[0061] In some embodiments, the recombinant virus may be a DNA virus, an RNA virus, and a mutant thereof. The DNA virus may be a single-stranded (ss) DNA virus, a double-stranded (ds) DNA virus, or a DNA virus comprising ss and ds DNA regions, and includes the Adenoviridae, Herpesviridae, and Poxviridae families, such as adenovirus, adeno-associated virus, replication-deficient reverse transcriptase virus, herpes simplex virus 1 (HSV1), and vaccinia virus (VV).
[0062] In some embodiments, the vaccinia virus may be a Western Reserve (WR) strain, a Copenhagen strain, a Lister strain, an Ankara strain, a Modified Vaccinia Ankara strain, a New York Vaccinia strain, a Tian Tan strain, a Dryvax strain, a Bern strain, a Paris strain, a Tash Kent strain, an IHD-J strain, an IHD-W strain, a Brighton strain, a CVA382 strain, a Dairen strain, an LC16m8 strain, an LC16M0 strain, a LIVP strain, an ACAM2000 strain, a WR65-16 strain, a Connaught strain, an EM-63 strain and its derivatives, and a genetically modified strain. The genetically modified strain may include knockout of a vaccinia virus gene and knock-in of a heterologous nucleic acid (e.g., a fusion protein-coding gene, a tumor target gene, a tumor suppressor gene, etc.) and a selective knock-in of another vaccinia virus strain gene. The knockout-capable viral gene comprises any one or more regions of A34R, J2R, A44L, A45R, A46R, and / or A52R. In some embodiments, the genetically modified vaccinia virus comprises the knockout of one or more genes (J2R, A34R, A44L-A45R-A46R, and A52R) and the knockout of a nucleic acid sequence encoding a fusion protein with an exogenous gene. The A44L-A45R-A46R gene comprises any one of the A44L, A45R, and A46R genes, or any combination of two or three of them, and preferably comprises a combination of the three genes A44L, A45R, and A46R.
[0063] In some embodiments, the genetically modified vaccinia virus is preferably an extracellular enveloped virus (EEV) enhanced vaccinia virus, which comprises modification of the EEV envelope glycoprotein-coding gene A34R of the vaccinia virus (including replacement and / or mutation of the A34R gene). Preferably, the EEV enhanced vaccinia virus is a vaccinia virus WR strain comprising the A34R gene modification.
[0064] In some embodiments, the modification comprises the replacement of the WR A34R gene and / or the mutation of the WR A34R gene. In some embodiments, the replacement comprises replacing the vaccinia virus WR strain A34R gene with the A34R gene of the Copenhagen strain, IHD-J strain, or IHD-W strain. In some embodiments, the EEV-enhanced vaccinia virus containing the mutation may be a strain obtained by performing point mutations on the A34R gene of, for example, the WI strain, the WC strain, or the WR strain. The WI strain is a strain in which the A34R gene sequence of the WR strain is replaced with the A34R gene sequence of the IHD-J strain, using the vaccinia virus WR strain genome as a backbone. The WC strain is a strain in which the A34R gene sequence of the WR strain is replaced with the A34R gene sequence of the Copenhagen strain (coA34R), using the WR strain genome as a backbone.
[0065] In some embodiments, the EEV-enhanced vaccinia virus comprises a coA34R gene encoding an amino acid sequence or variant comprising SEQ ID NO: 19.
[0066] A fifth aspect of the present invention provides an expression system comprising a host cell and a genetically engineered recombinant virus of the fourth aspect.
[0067] In the present invention, the host cell may be a prokaryotic cell or a eukaryotic cell, preferably a eukaryotic cell, and more preferably a mammalian cell, such as a HeLa cell, human embryonic kidney cell 293 (HEK 293), Chinese hamster ovary cell (CHO), mouse myeloma cell, African green monkey kidney cell (CV-1 or Vero), etc.
[0068] Genetically engineered recombinant viruses expressed by host cells selectively infect target cells to realize high-efficiency delivery and release of tumor antigens within the body, enhance / activate the tumor immune function of the immune system, and achieve tumor therapeutic effects by promoting the proliferation of specific effector cells and tumor cell death.
[0069] In the tumor antigen peptide fusion protein, fusion protein composition, and genetically engineered recombinant virus of the present invention, the effector cells thereof may be any mammalian cell type capable of promoting the death of target cells. In some embodiments, the effector cells are immune cells, for example, T cells, B cells, innate lymphocytes, natural killer cells (NK cells), natural killer T cells (NKT), granulocytes (e.g., neutrophils, basophils, mast cells, or eosinophils), macrophages, monocytes, or dendritic cells (DC). The viral vector and the therapeutic polypeptide may all activate or restore effector cells (e.g., T cells) to have one or more of the following characteristics: (i) increased proliferation of effector cells; (ii) a change in the expression or activity of one or more cell surface proteins of effector cells; (iii) a change in the expression or activity of one or more intracellular proteins expressed by effector cells; (iv) a change in the amount or nature of factors (e.g., cytokines, chemokines, or reactive oxygen species) produced and / or secreted by effector cells; (v) changes in the morphology of the effector cells; (vi) changes in the chemotaxis potential of the effector cells, e.g., increased or decreased expression of one or more chemokine receptors; (vii) changes in the functional activity of the effector cells, e.g., increased lytic activity and / or increased phagocytic activity. The activation of the effector cells or effector cell colonies can be confirmed by conventional methods in the art, for example, changes in cell proliferation and protein expression, production or secretion can be confirmed through flow cytometry, Western blotting (WB), enzyme-linked immunosorbent assay (ELISA), enzyme-linked immunospot assay (ELISpot), immunohistochemistry, immunoprecipitation, or immunofluorescence techniques.
[0070] A sixth aspect of the present invention provides a pharmaceutical composition comprising a tumor antigen peptide fusion protein, a composition, a nucleic acid construct, or a genetically engineered recombinant virus according to the present invention; and a pharmaceutically acceptable carrier.
[0071] A seventh aspect of the present invention provides a method for treating or preventing a tumor, comprising the step of administering a tumor antigen peptide fusion protein, a composition, a nucleic acid construct, a genetically engineered recombinant virus, or a pharmaceutical composition according to the present invention.
[0072] The eighth aspect of the present invention provides the use of a tumor antigen peptide fusion protein, a composition, a nucleic acid construct, a genetically engineered recombinant virus, or a pharmaceutical composition according to the present invention in the manufacture of drugs for treating or preventing tumors.
[0073] A ninth aspect of the present invention provides a method for activating or enhancing immune cell function, comprising the step of administering a tumor antigen peptide fusion protein, a composition, a nucleic acid construct, a genetically engineered recombinant virus, or a pharmaceutical composition according to the present invention.
[0074] In some embodiments, the tumor antigen peptide fusion protein, composition, nucleic acid construct, genetically modified recombinant virus, or formulation of the pharmaceutical composition according to the present invention, the method of administration, etc., may be specifically selected as needed. The formulation may be an ointment or a lipid composition. The method of administration may be local or systemic and may be prepared by a method of administration such as local intratumoral injection, local intra-arterial injection (a blood vessel supplying blood to the tumor), subcutaneous injection, intracavitary injection, intraperitoneal injection, intrathoracic injection, systemic intravenous injection, intramuscular injection, intradermal injection, intrathecal injection, direct intraventricular injection, intracardiac injection, or intranasal injection. This pharmaceutical composition may be used alone as a monotherapy; or may be used in combination with an anticancer agent.
[0075] In some specific embodiments, as illustrated in FIG. 5, the present invention provides the following recombinant virus:
[0076] (1) IVIR001, IVIR002 and IVIR010 are recombinant viruses that express secretory human HPGD (sHPGD) and type I membrane protein IL12 p70 (mIL12 I).
[0077] (2) IVIR003, IVIR004 and IVIR011 are recombinant viruses that express a fusion protein (sMICBH) of mIL12 I, secreted fusion tumor antigen MICB peptide, and human HPGD.
[0078] (3) IVIR005, IVIR006 and IVIR012 are recombinant viruses that express a fusion protein (smCTAH) of mIL12 I and secretory fusion MICB peptide, a number of cancer-testis antigen peptides and human HPGD, each containing two subtypes a and b, the difference between the two being the linker peptide between the CTA peptides, where subtype a uses GG linker peptide and subtype b uses PP linker peptide.
[0079] (4) IVIR007, IVIR008 and IVIR013 are recombinant viruses that express a fusion protein (smPCTAH) of mIL12 I and secretory fusion MICB peptide, multiple prostate cancer tumor antigen peptides and human HPGD, each containing two subtypes a and b, the difference between the two being the linker peptide between the PCTA peptides, where subtype a uses GG linker peptide and subtype b uses PP linker peptide.
[0080] (5) IVIR009 is a recombinant virus that expresses a fusion protein (sMICAH) of mIL12 I, a secretory fusion MICA peptide, and human HPGD.
[0081] Refer to Table 2 and Table 4 for the amino acid sequences of the preferred fusion proteins of (1) to (5) above.
[0082] terminology
[0083] "Tumor antigen (TA)" refers to a major histocompatibility complex (MHC) related molecule expressed on the surface of tumor cells and is a key component in manufacturing therapeutic cancer vaccines. It aims to treat cancer by rationally selecting vaccine targets and establishing personalized treatment plans based on the individual tumor characteristics of patients. In the first clinical trial of personalized cancer vaccines, applicability, safety, and immunotherapeutic activity regarding tumor mutation characteristics were confirmed.
[0084] "Tumor antigen peptides (TA peptides)" are antigens that stimulate a tumor immune response as tumor markers and act as targets for immune cells to attack tumor cells. The core of tumor immunotherapy is the reaction between tumor antigens presented by MHC and T cells, and small molecule polypeptides generated by the degradation of tumor antigens within the cell bind to MHC I on the surface of antigen-presenting cells, are expressed on the surface of cancer cells, and are presented to T cells.
[0085] "Cancer-testicular antigens," or "CTAs," also known as cancer germline antigens, are genes expressed during fetal development; their mode of expression is limited in normal tissues and they are generally expressed only in germline tissues (e.g., testes, ovaries, and placentas). The human genome contains over 200 CTA genes, classified into 44 gene families, some of which contain multiple members. Furthermore, CTA gene homologs and analogs are found in a diverse range of organisms, including primates, rodents, zebrafish, fruit flies, nematodes, and yeast. Relevant data is available at the Ludwig Institute for Cancer Research (http: / / www.cta.lncc.br / index.php). The characteristics of their expression are as follows: ① expression frequencies vary across different tumor tissues; ② most CTAs are located on the X chromosome; ③ they generally exist in the form of members from multiple families; and ④ CTA expression exhibits heterogeneity across various tumor tissues of different origins.
[0086] "Protein," "protein," or "polypeptide" means at least two linked amino acids, which include, for example, modifications after protein expression such as glycosylation, acetylation, phosphorylation, etc., and further include variants obtained after genetic modifications, for example, deletion, replacement, knockout, etc., are performed on the amino acid sequence of a natural protein or polypeptide.
[0087] "Modification" refers to a modification of the amino acid sequence of a protein or polypeptide, which includes acetyl groups, carboxyl groups, glycosyl groups, immunoglobulin (Ig) Fc, polyethylene glycol (PEG), streptavidin, and various other molecules (e.g., biotin, radioisotopes, fluorescent agents, enzymes, cytotoxic substances, antitumor agents, etc.), and further includes linkage with functional groups (e.g., phosphate residues, amino acid residues). After modification, the biochemical properties of the protein are altered, e.g., increased resistance to protein hydrolysis, increased solubility, etc., or new biochemical properties, e.g., targetability, or new antigen recognition epitopes, may be conferred. In the present invention, a signal peptide may be coupled to the N-terminus of a tumor antigen peptide to obtain secretory protein properties; or a tumor antigen peptide and a tumor suppressor factor HPGD may be serially linked so that the encoded protein has an anticancer effect; Alternatively, a personalized therapeutic cancer vaccine is developed by linking different human-derived tumor antigen peptides.
[0088] A "signal peptide (SP)" is a specific sequence located at the N-terminus of a secreted protein (sometimes not necessarily at the N-terminus) that guides polypeptides and ribosomes to the endoplasmic reticulum membrane and guides the transmembrane transport of nephrites, and after reaching the endoplasmic reticulum, the SP is typically cleaved by a signal peptide enzyme. If the synthesized product is a secreted protein, it enters the endoplasmic reticulum lumen entirely, except for SP cleavage, and if it is a membrane protein, the protein is anchored to the endoplasmic reticulum membrane by one or more intrinsic stop transition signals.
[0089] "Transmembrane peptides (TPs)" refer to short peptides that anchor proteins or polypeptides to the cell membrane and perform various biological functions in cells, and are essential substances for molecular transport, signal transduction, and membrane fusion.
[0090] "Signal-anchor peptide (SAP)" is a polypeptide that acts similarly to a signal peptide (SP), allowing the peptide chain to pass through the membrane without being cleaved, and thus can anchor to the membrane as a signal peptide of a type II membrane protein.
[0091] A “linker peptide” is a chain of amino acids that connects two fusion proteins and possesses a certain degree of flexibility to allow both proteins to perform their respective functions independently; it is typically classified into three types: flexible linkers, rigid linkers, and cleavable linkers. As an essential component of fusion protein recombination, the linker peptide plays a crucial role in constructing stable and biologically active fusion proteins.
[0092] "Fusion protein" refers to a protein product produced by connecting and expressing two or more genes encoding a functional protein molecule according to a specific purpose using technologies such as genetic engineering. The fusion protein is a novel protein that possesses two or more biological activities and functions. Fusion protein technology is used to improve the characteristics of a protein or to confer new functions upon it. Since the characteristics of the protein include stability, activity, expression, secretion, and solubility, fusion protein technology is widely utilized in clinical practice and is used to manufacture vaccines, specialized biologically active drugs, thrombolytic agents, antimicrobial peptides, dual-function enzymes, etc.
[0093] "MICA" and "MICB" are two very similar MHC I polypeptide-associated sequences that are widely expressed in mammals and upregulated in cells infected with viruses or metastatic tumors, encoding glycoproteins on the cell surface. As antigen molecules responding to cellular stress, MICA / MICB binds to the receptor D (NKG2D), a member of the G2D natural killer cell population 2, thereby activating cytotoxic NK cells and T cells, and plays a crucial role in in vivo immune surveillance. The release of soluble MICA / MICB is considered a mechanism for tumor immune evasion; it can reduce the density of NKG2D ligands on tumor cell surfaces, contributing to the suppression of immune effector cells, and has been demonstrated to be elevated in the serum of patients with various malignancies. According to reports, stable expression of MICA / MICB may be one of the pathways activating the tumor immune response.
[0094] "15-hydroxyprostaglandin dehydrogenase (HPGD)" is NAD + As a prostaglandin-dependent enzyme, HPGD is widely expressed in mammalian tissues and exists as a homodimeric form within the cytoplasm; it extensively regulates various cellular pathways, including inflammation, differentiation, and signal transduction, making it an important target for drug intervention. According to previous studies, the gene coding for HPGD possesses multiple transcriptional variants and encodes different isomers; HPGD can inhibit cancer cell proliferation and induce differentiation by degrading prostaglandins (tumor-promoting molecules) within cancer cells, and furthermore, knockout or underexpression of HPGD may increase colon tumor susceptibility and pancreatic tumor cell expansion. However, there are relatively few studies on the role HPGD plays in tumorigenesis and immune responses, and its functions have not yet been clearly elucidated, necessitating further research.
[0095] The term "identity" refers to the degree of matching between two polypeptides or between two nucleic acids. When a position in one of two comparison sequences is occupied by the same base or amino acid monomer subunit (e.g., one position in each of two DNA molecules is occupied by adenine, or one position in each of two polypeptides is occupied by lysine), said molecules are the same at said position. "Percent identity" between two sequences is a function of multiplying the value obtained by dividing the number of matching positions shared by the two sequences by the number of positions being compared by 100. For example, if 6 out of 10 positions in two sequences match, the two sequences have 60% identity. For example, DNA sequences CTGACT and CAGGTT share 50% identity (3 out of a total of 6 positions match). Typically, comparison is performed when the two sequences achieve maximum identity. Such comparisons can be easily performed using computer programs, for example, such as the Align program (DNAstar, Inc.), and are based on the method described in J. Mol. Biol. 48:443-453 by Needleman et al. (1970). Percentage identity between two amino acid sequences can also be measured using the algorithm by E. Meyers and W. Miller (Comput. Appl Biosci., 4:11-17 (1988)) in the already integrated ALIGN program (version 2.0), applying the PAM120 weight residue table, gap length penalty of 12, and gap penalty of 4. Additionally, the algorithm by Needleman and Wunsch (J. MoI Biol.) in the GAP program integrated into the GCG software package (available at www.gcg.com)Using the algorithm 48:444-453(1970)), the Blossum 62 matrix or PAM250 matrix and gap weights of 16, 14, 12, 10, 8, 6 or 4 and length weights (1, 2, 3, 4, 5 or 6) can be applied to calculate the identity ratio between two amino acid sequences.
[0096] The term "conservative substitution" refers to an amino acid substitution that does not adversely affect or alter the expected properties of a protein / polypeptide containing an amino acid sequence. For example, conservative substitutions may be introduced through standard techniques known in the art, such as site-specific mutagenesis and PCR-mediated mutation. Conservative amino acid substitutions include substitutions that replace an amino acid residue with an amino acid residue having a similar side chain, for example, using a residue that is physically or functionally similar to said amino acid residue (e.g., having size, shape, charge, chemical properties, including the ability to form covalent or hydrogen bonds). Families of amino acid residues having similar side chains are defined in the art. These families include amino acids with basic side chains (e.g., lysine, arginine, and histidine), acidic side chains (e.g., aspartic acid, glutamic acid), non-charged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine, tryptophan), non-polar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine), β-branched side chains (e.g., threonine, valine, isoleucine), and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine). Therefore, it is desirable to substitute a corresponding amino acid residue with another amino acid residue derived from the same side chain family. Methods for identifying conserved amino acid substitutions are well known in the art.
[0097] Prostaglandin E2 (PGE2) is a member of the eicosanic acid family and is the most abundant prostaglandin produced in almost all cells of the human body. It possesses diverse and important physiological functions and is widely produced under pathophysiological conditions. Cancer cells secreting PGE2 have been shown to induce the formation of human regulatory T cells (Tregs). Furthermore, PGE2 selectively inhibits the effector functions of macrophages and neutrophils, as well as Type I immunity mediated by Th1-, CTL-, and NK cells, while promoting Th2, Th17, and Treg cell responses and the local accumulation of myeloid-derived suppressor cells. Targeting the production, degradation, and reactivity of PGE2 provides a tool for regulating immune modes in various diseases ranging from autoimmunity to cancer.
[0098] "Therapeutic factors" refer to factors that enhance immune response reactions and include cytokines, immune co-stimulatory molecules, immune checkpoint inhibitors, anti-angiogenic factors, nucleic acid polymers, etc. The aforementioned cytokines are involved in cellular activities such as cell signaling, apoptosis, development, and differentiation, and include chemokines, interferon (INF), interleukin (IL), tumor necrosis factor (TNF), and their respective receptors.
[0099] "Interleukin (IL)" refers to a molecule with a generally clear structure and biological function that plays an important regulatory role. It originated from its production in leukocytes and its interaction with other leukocytes; it belongs to the cytokine class and plays a crucial role in signal transmission, the activation and regulation of immune cells, inflammatory responses, and the activation, proliferation, and differentiation of immune T cells and B cells. IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8 (CXCL8), IL-9, IL-10, IL-11, IL-12, IL-13, IL-14, IL-15, IL-16, IL-17, IL-18, IL-19, IL-20, IL-21, IL-22, IL-23, IL-24, Includes IL-25, IL-26, IL-27, IL-28, IL-29, IL-30, IL-31, IL-32, IL-33, IL-35 and IL-36.
[0100] "J2R" is a gene closely associated with DNA replication within the vaccinia virus (VV) genome and codes for thymidine kinase (TK).
[0101] "A52R" is an immunomodulatory gene on the VV genome that codes for the Toll / Interleukin-1 receptor (TIR) protein molecule and enables the virus to evade immunity by suppressing the natural immune response through the inhibition of intracellular TIR-dependent Toll-like receptor (TLR) / nuclear factor kappa-B (NF-κB) signaling, and deletion of the viral gene related to TLR signaling has been proven to be an effective method to improve VV into an ideal vaccine candidate.
[0102] "A46R" is an immunomodulatory gene on the VV genome that targets multiple TIR adapter proteins within host cells, such as Myd88, TRIF, and TRAM, and knockout of this gene significantly improves immunomodulatory function.
[0103] "A44L" is one of the immunoregulatory genes on the VV genome, and the coded hydroxyl steroid dehydrogenase plays a key role in the synthesis of steroid hormones within cells.
[0104] "A45R" is a late-expressed gene in VV infection that codes for a viral core protein, and its amino acid sequence is partially identical to that of copper-zinc superoxide dismutase (Cu-Zn SOD). In various strains of VV, this protein is highly conserved and interacts with late proteins J1R and A44L to play an important role in the morphology of the virus.
[0105] "A34R" refers to the gene encoding the type C lectin-like glycoprotein gp22-24 in VV.
[0106] "Target cell" refers to mammalian cells that are killed, attacked, destroyed, and / or controlled. In particular, a target cell refers to a cell that has been altered in any way compared to normal cells of the same cell type, and includes cancer cells and virus-infected cells.
[0107] "Gene knockout (abbreviated as KO)" is a widely used genetic engineering technique that targets and removes or inactivates specific genes within an organism's genome. This can be carried out using various methods, including homologous recombination, CRISPR-Cas9, and TALEN. Gene knockout encompasses two types: complete gene knockout and conditional gene knockout (also known as incomplete gene knockout). Complete gene knockout refers to the complete elimination of the activity of a target gene through homologous recombination, while conditional gene knockout refers to the knockout of a gene within a specific space by positioning a recombination system.
[0108] "Gene knock-in (abbreviated KI)" is a genetic manipulation method in molecular cloning and biology that replaces or inserts a DNA sequence, which is a gene sequence, with exogenous gene sequence information. Unlike traditional transformation techniques, gene knock-in technology concerns "directed" insertion, which involves inserting a gene at a specific location. This is the opposite of gene knockout.
[0109] "Genetically modified recombinant virus" or "recombinant virus" refers to a virus modified by genetic engineering, which can infect one or more cells or tissues and express proteins encoded by heterologous nucleic acids. Typically, since viruses have a natural host cell population to which they infect most effectively, modifying a virus to bind to a protein derived from another virus can facilitate viral penetration into specific cell or tissue types, and genetically modify the virus for the purpose of treating diseases. In some embodiments, compared to non-genetically modified viruses, genetically modified viruses can selectively infect target cells or tissue types, for example, tumor cells of cancer patients.
[0110] "Viral genome" means a nucleic acid component of a virus, said nucleic acid component codes for a genome containing all proteins necessary for genome replication and / or integration. In some embodiments, the viral genome acts as a viral vector and may contain heterologous genes. The viral genome according to the text may be based on any viral vector.
[0111] "Vector" refers to a delivery tool used in genetic engineering to introduce a target gene into a recipient cell. One type of vector is a non-viral vector, which can be mRNA, DNA, plasmids, bacteria, etc. Another type of vector is a viral vector, in which an exogenous gene fragment is linked to the viral genome to enable exogenous gene expression. The viral vectors applied may include, for example, poxviruses such as Vaccinia virus Western Reserve (WR) strain, Copenhagen strain, Lister strain, Ankara strain, Modified Vaccinia Ankara strain, New York Vaccinia strain, Tian Tan strain, Dryvax strain, Bern strain, Paris strain, Tash Kent strain, IHD-J strain, IHD-W strain, Brighton strain, CVA382 strain, Dairen strain, LC16m8 strain, LC16M0 strain, LIVP strain, ACAM2000 strain, WR65-16 strain, Connaught strain, and EM-63 strain, as well as adenoviruses and herpes simplex viruses. In some embodiments, the vector is a vaccinia virus vector, and the melted nucleic acid sequence is a recombinant nucleic acid sequence encoding a tumor antigen peptide fusion protein and / or a therapeutic factor fusion protein.
[0112] "Expression system" refers to a host cell that replicates and amplifies an expression vector, and the expression vector of the present invention includes a host cell of a genetically modified virus, which includes HeLa cells (Hela), Chinese hamster ovary cells (CHO), human embryonic kidney cells 293 (HEK 293), African green monkey kidney cells (CV-1 or Vero), etc.
[0113] The term "pharmacologically acceptable" means approved by federal regulatory agencies or state governments, or listed in the U.S. Pharmacopeia or other authorized pharmacopoeias, and does not cause adverse effects, allergies, or other adverse reactions in animals and humans.
[0114] The term "carrier" refers to a diluent, adjuvant, protective agent (e.g., biogel, fat, artificial lipid membrane, liposome), excipient, or medium administered together with the therapeutic agent. Such pharmaceutical carriers may be sterile liquids such as water and oils, including oils of animal, plant, or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil, etc. When the pharmaceutical composition is administered intravenously, water is a preferred carrier. Physiological saline solution, aqueous dextrose solution, and glycerol solution may also be used as liquid carriers, but this is particularly intended for injectable liquid carriers. Suitable pharmaceutical excipients include starch, glucose, lactose, sucrose, gelatin, malt, rice, wheat flour, chalk, silica gel, sodium stearate, glyceryl monostearate, talc, sodium chloride, anhydrous skim milk powder, glycerol, propylene glycol, glycol, water, and ethanol. If necessary, the composition may further include a small amount of a wetting agent, an emulsifier, or a pH buffer. Such compositions may take the form of solutions, suspensions, emulsions, tablets, pills, capsules, powders, sustained-release formulations, etc.
[0115] The term "treatment" refers to administering a therapeutically effective amount of a fusion protein, composition, nucleic acid construct, or recombinant virus, etc., as described in the text to a subject so that the subject may achieve a reduction in at least one symptom of the disease or an improvement in the disease, e.g., a beneficial or desired clinical outcome. For the purposes of this disclosure, a beneficial or desired clinical outcome includes, but is not limited to, the alleviation of one or more symptoms, a reduction in the severity of the disease, the stabilization of the disease state (i.e., not worsening), a delay or slowing of disease progression, an improvement or remission of the disease state, and a resolution (partial or complete resolution), and includes all such outcomes whether detectable or not. Treatment may mean an extension of survival time compared to the expected survival time without treatment. Accordingly, those skilled in the art recognize that treatment may improve the disease situation but may not necessarily be a complete cure of the disease. As used in the text, the term "treatment" includes prevention. Additionally, treatment is considered "effective" when there is a reduction or halt in disease progression. "Treatment" may mean an extension of survival time compared to the expected survival time without treatment. Patients requiring treatment include those who have already been diagnosed with a related disease, and those who are at risk of developing these conditions due to genetic predisposition or other factors.
[0116] The terms “patient” and “subject” are interchangeable and refer to any living organism that can be treated by the fusion protein disclosed herein. In this disclosure, the subject or individual of therapeutic or prophylactic treatment is preferably a mammal, and may be, for example, a human, a non-human primate, a livestock animal (e.g., sheep, cattle, horses, donkeys, pigs), a pet animal (e.g., dogs, cats), a laboratory test animal (e.g., mice, rabbits, rats, guinea pigs, hamsters), or a captured wild animal (e.g., foxes, deer), but is not limited thereto. The subject is preferably a primate. In some embodiments, the subject is a mammal, and preferably the subject is a human. In some embodiments, the subject may be an adult, a child, or an infant.
[0117] In order to enable those skilled in the art to better understand the methods of the present invention for carrying out the invention, the technical methods within the embodiments of the present invention are described clearly and completely below; provided, however, it is obvious that the described embodiments are merely examples of a part of the present invention and not the entire embodiment.
[0118] The meanings of the abbreviations are as follows: "h" is hour, "min" is minute, "s" is second, "μL" is microliter, "mL" is milliliter, "L" is liter, and "mM" is millimole.
[0119] Experimental method
[0120] (1) Cell culture: African green monkey kidney cells Vero and CV-1 cells (both provided by the Chinese Academy of Sciences Cell Bank) were cultured in DMEM medium or RPMI medium (Gibco) supplemented with 10% fetal bovine serum (FBS, Gibco) and 1% penicillin-streptomycin, where Vero cells were used to measure viral titers and CV-1 cells were used to mass-produce viruses and detect cell function. Cell growth and viral replication were both carried out in a CO2 incubator at 37°C.
[0121] (2) PCR Technique: Extract viral genome DNA using a Viral Genome Extraction Kit (purchased from Biomiga) and extract tissue DNA using a DNeasy® Blood & Tissue kit (purchased from Qiagen); refer to the manufacturer's instruction manual for specific procedures. Using DNA as a template, perform PCR amplification with the following primers using DNA polymerase (TAKARA): J2R primers: TGTTAGATACATAGATCCTCGTCG and CACTTTCTGGTTCGTAATCTAACTC; A44L-A45R-A46R primers: GTACTCTTACTGTGTAGTGG and CTCTATACATCTATGAGACTCC; A52R primers: TACGTTTACGGTATAGCCTC and TGCCGTAGCCAATGTAGTAATG. PCR reaction procedure: Perform pre-denaturation at 94°C for 5 min; Denaturation at 98°C for 10 seconds, annealing at 58°C for 30 seconds, extension at 72°C for 1 minute, reaction cycled 35 times; additional extension at 72°C for 10 minutes sufficiently, reaction terminated at 25°C. The PCR reaction was performed using a PCR instrument (manufactured by Bio-Rad), and the PCR amplification product was analyzed by agarose gel electrophoresis.
[0122] (3) Virus plaque test (Vero cells): Remove positive control virus and test virus from a -80°C freezer, thaw each within 5–7 min, shake for 3–5 s in between, sonicate for 1 min in a cuvette sonicator (4–20°C, 20 sec ON / 20 sec OFF); then proceed with a series of stepwise dilutions in which the virus is diluted 10-fold in sequence. In a biosafety cabinet, aspirate and dilute 800 μL / well of the virus sample using a 1 mL pipette and add it to a 6-well plate containing Vero cells, place it in an incubator containing 5% CO2, and incubate at 37°C for 1 h. After discarding the inoculum, add 1.5 mL of medium (DMEM + 10% FBS) and 1.5 mL of 3% carboxymethylcellulose (CMC) solution to each well, and incubate at 37°C for 40 h in an incubator containing 5% CO2. Stain cells with 0.1% crystal violet staining and scan a 6-well plate using a scanner to record the number of plaques per well (a count of 30-300 plaques per well is considered acceptable). Viral titer = (number of plaques / 0.8) × dilution factor, expressed in PFU / mL.
[0123] Example 1: Construction and Engineering Modification of Vaccinia Virus WC Strain
[0124] A novel vaccinia virus WC strain was obtained by using the genome of the vaccinia virus WR strain (ATCC VR-1354) as a backbone, knocking out the A34R gene sequence of the WR strain (WR A34R), and knocking in the A34R gene sequence of the vaccinia virus Copenhagen strain (CoA34R; GenBank: AAA48161.1) (Fig. 3A). The amino acid sequences coded by WR A34R and CoA34R are shown in Table 3. An exemplary operation is as follows. CV-1 cells were transfected using the shuttle plasmid pShuttleΔA34R-CoA34R under the action of the transfection reagent Lipofectamine3000. After 4 hours, the already transfected CV-1 cells were infected with a vaccinia virus WR strain at a concentration of 0.01 PFU / cell, and after 48 hours, vaccinia virus (WR-CoA34R GFP) expressing green fluorescent protein with CoA34R was collected and selected. The above recombinant virus (containing the GFP tag) was infected into CV-1 cells transformed with a Cre expression plasmid, and a recombinant vaccinia virus WC strain with the fluorescent tag deleted was obtained by removing the GFP gene using the Cre / loxP system. According to the results of the comet plaque formation experiment, the extracellular enveloped virus (EEV) and intracellular mature virus (IMV) of the WR strain infect CV-1 cells to form circular plaques, while the EEV and IMV of the WC strain infect CV-1 cells to form comet-shaped plaques (Fig. 3B); according to the titer detection results, when the MOI = 1, the viral titer (1.50 × 10⁻⁶) of the WC strain EEV after infecting CV-1 cells for 12 hours 5 PFU / mL) is the WR strain virus titer (1.01×10⁻⁶ 3It is 148 times the PFU / mL value; and at MOI=2, the viral titer (1.91×10⁻⁶) after infecting CV-1 cells for 12 hours with WC strain EEV 5 PFU / mL) is the WR strain virus titer (1.79 × 10⁻⁶ ³ It is 106 times the PFU / mL value (Fig. 3C).
[0125] FIG. 3D shows a schematic diagram of genetic modification using a vaccinia virus WC strain as a vector, which includes modification of six gene sequences: sequence 1 (J2R), sequence 2 (A34R), sequences 3-5 (A44L-A45R-A46R) and sequence 6 (A52R); and further includes knocking of heterologous nucleic acid sequences encoding a fusion protein.
[0126] Example 2: Vector Construction
[0127] As illustrated in FIG. 4, the shuttle plasmids include a shuttle plasmid for melting the CoA34R gene (Fig. 4A); a shuttle plasmid for knocking out the J2R (Fig. 4Bi), A44L-A45R-A46R (Fig. 4Bii), and A52R (Fig. 4Biii) genes; and a shuttle plasmid for melting heterologous nucleic acid mouse-derived HPGD (mouse HPGD, mHPGD) (Fig. 4Ci), sHPGD (secreted human HPGD; Fig. 4Cii), sIL12 (Fig. 4Ciii), mIL12I (Fig. 4Civ), and mIL12II (Fig. 4Cv) genes simultaneously with the J2R gene knockout. It includes shuttle plasmids for knockout of A44L-A45R-A46R genes and simultaneous knockout of heterologous nucleic acids sHPGD (Di in Fig. 4), sMICBH (secreted MICB peptide+hHPGD; Dii in Fig. 4), sMICAH (secreted MICA peptide+hHPGD; Diii in Fig. 4), smCTAH (secreted MICB peptide+multiple CTA peptides+hHPGD; Div-v in Fig. 4), and smPCTAH (secreted MICB peptide+multiple PCTA peptides+hHPGD; Dvi-vii in Fig. 4) and simultaneous knockout of A52R genes, along with shuttle plasmids for knockout of heterologous nucleic acids sHPGD (Ei in Fig. 4), sMICBH (Eii in Fig. 4), smCTAH (Eiii-iv in Fig. 4), and smPCTAH (Ev-vi in Fig. 4). The amino acid sequences of the fusion proteins encoded by the above heterogeneous nucleic acids are shown in Tables 2 and 4; and the corresponding nucleotide sequences are shown in Table 6.
[0128] (1) Shuttle plasmid expressing a tumor antigen peptide fusion protein
[0129] Target genes for tumor antigen peptide fusion protein expression were designed as follows: A44L left arm-pE / L-SP-hHPGD-loxP-H5-GFP-loxP-A46R right arm (Di in Fig. 4), A44L left arm-pE / L-SP-GGS-MICB peptide-AEAAAKEAAAKA-hHPGD-loxP-H5-GFP-loxP-A46R right arm (Dii in Fig. 4), A44L left arm-pE / L-SP-GGS-MICA peptide-AEAAAKEAAAKA-hHPGD-loxP-H5-GFP-loxP-A46R right arm (Diii in Fig. 4), A44L left arm-pE / L-SP-GGS-MICB peptide-AEAAAKEAAAKA-CTA1peptide-GG-CTA2peptide-GG…CTA 33 peptide-AEAAAKEAAAKA-hHPGD-loxP-H5-GFP-loxP-A46R right arm (Div in Figure 4), A44L left arm-pE / L-SP-GGS-MICB peptide-AEAAAKEAAAKA-CTA1peptide-PP-CTA2peptide-PP… CTAs 33 peptide-AEAAAKEAAAKA-hHPGD-loxP-H5-GFP-loxP-A46R right arm (Dv in Figure 4), A44L left arm-pE / L-SP-GGS-MICB peptide-AEAAAKEAAAKA-PCTA1peptide-GG-PCTA2peptide-GG… PCTA 10 peptide-AEAAAKEAAAKA-hHPGD-loxP-H5-GFP-loxP-A46R right arm (Dvi in Figure 4), A44L left arm-pE / L-SP-GGS-MICB peptide-AEAAAKEAAAKA-PCTA1peptide-PP-PCTA2peptide-PP… PCTA 10peptide-AEAAAKEAAAKA-hHPGD-loxP-H5-GFP-loxP-A46R right arm(도 4의 Dvii), A52R left arm-pE / L-SP-hHPGD-loxP-H5-GFP-loxP-A52R right arm(도 4의 Ei), A52R left arm-pE / L-SP-GGS-MICB peptide-AEAAAKEAAAKA-hHPGD-loxP-H5-GFP-loxP-A52R right arm(도 4의 Eii), A52R left arm-pE / L-SP-GGS-MICB peptide-AEAAAKEAAAKA-CTA1peptide-GG-CTA2peptide-GG…CTA 33 peptide-AEAAAKEAAAKA-hHPGD-loxP-H5-GFP-loxP-A52R right arm(도 4의 Eiii), A52R left arm-pE / L-SP-GGS-MICB peptide-AEAAAKEAAAKA-CTA1peptide-PP-CTA2peptide-PP…CTA 33 peptide-AEAAAKEAAAKA-hHPGD-loxP-H5-GFP-loxP-A52R right arm(도 4의 Eiv), A52R left arm-pE / L-SP-GGS-MICB peptide-AEAAAKEAAAKA-PCTA1peptide-GG-PCTA2peptide-GG…PCTA 10 peptide-AEAAAKEAAAKA-hHPGD-loxP-H5-GFP-loxP-A52R right arm(도 4의 Ev), A52R left arm-pE / L-SP-GGS-MICB peptide-AEAAAKEAAAKA-PCTA1peptide-PP-PCTA2peptide-PP…PCTA 10peptide-AEAAAKEAAAKA-hHPGD-loxP-H5-GFP-loxP-A52R right arm (Evi in Fig. 4). After obtaining the target gene through synthesis, each was cloned into pShuttle DNA (Shanghai Sangon) to obtain a shuttle plasmid expressing a tumor antigen peptide fusion protein.
[0130] (2) Shuttle plasmid expressing IL12 p70 fusion protein
[0131] Target genes for IL12 p70 fusion protein expression were designed as follows: J2R left arm-pE / L-SP-IL12 p40-GGGGSGGGGS-IL12 p35-loxP-H5-GFP-loxP-J2R right arm (Ciii in Fig. 4), J2R left arm-pE / L-SP-IL12 p40-GGGGSGGGGS-IL12 p35-transmembrane peptide(TP)-loxP-H5-GFP-loxP-J2R right arm (Civ in Fig. 4), J2R left arm-pE / L-signal-anchor peptide(SAP)-IL12 p40-GGGGSGGGGS-IL12 p35-loxP-H5-GFP-loxP-J2R right arm (Cv in Fig. 4). After obtaining the target gene through synthesis, a shuttle plasmid expressing the IL12 p70 fusion protein was obtained by cloning it into two suitable multiple cloning sites of pShuttle DNA (Shanghai Sangon), respectively.
[0132] Example 3: Gene knockout of vaccinia virus and knockout of heterologous nucleic acid sequences using a shuttle plasmid
[0133] (1) J2R gene knockout and heterologous nucleic acid knockout: CV-1 cells were transformed with Lipofectamine 3000 using the shuttle plasmid obtained in Example 2, e.g., pShuttleΔJ2R (Bi in Fig. 4), pShuttleΔJ2R-HPGD (Ci in Fig. 4), pShuttleΔJ2R-sHPGD (Cii in Fig. 4), pShuttleΔJ2R-sIL12 (Ciii in Fig. 4), pShuttleΔJ2R-mIL12 I (Civ in Fig. 4), or pShuttleΔJ2R-mIL12 II (Cv in Fig. 4). After 4 hours, the cells were cultured with the addition of a vaccinia virus WR strain or the novel vaccinia virus WC strain constructed in Example 1 at a concentration of 0.01 PFU / cell. After 48 hours, the cells were collected, and virus-infected cells expressing green fluorescent protein were selected using a fluorescence microscope to select and small-scale amplify the recombinant virus. By proceeding, a series of WR strain or WC strain recombinant viruses (including GFP tags) that undergo J2R gene knockout and heterologous nucleic acid knockout can be obtained, for example, WRΔJ2R-GFP, WRΔJ2R-HPGD-GFP, WRΔJ2R-sHPGD-GFP, WRΔJ2R-sIL12-GFP, WRΔJ2R-mIL12 I-GFP, WRΔJ2R-mIL12 II-GFP, and WCΔJ2R-mIL12 I-GFP. Viral genome DNA was extracted, and after identifying J2R gene deletions using the PCR method, the recombinant virus (including a GFP tag) was infected into CV-1 cells transformed with a Cre expression plasmid, and the GFP gene was removed using the Cre / loxP system, thereby obtaining J2R gene knockout type recombinant viruses with deleted fluorescent tags, namely WRΔJ2R, WRΔJ2R-HPGD, WRΔJ2R-sHPGD, WRΔJ2R-sIL12, WRΔJ2R-mIL12 I, WRΔJ2R-mIL12 II, and WCΔJ2R-mIL12 I.
[0134] (2) A44L-A45R-A46R gene knockout and heterologous nucleic acid knockout: The shuttle plasmids obtained in Example 2, e.g., pShuttleΔ(A44L-A45R-A46R)-sHPGD (Di in Fig. 4), pShuttleΔ(A44L-A45R-A46R)-sMICBH (Dii in Fig. 4), pShuttleΔ(A44L-A45R-A46R)-sMICAH (Diii in Fig. 4), pShuttleΔ(A44L-A45R-A46R)-smCTAH (Div-v in Fig. 4) or pShuttleΔ(A44L-A45R-A46R)-smPCTAH (Dvi-vii in Fig. 4)), were transfected into CV-1 cells with Lipofectamine 3000, and after 4h, 0.01 In the above step (1) of PFU / cell concentration, the J2R gene deletion type recombinant virus WCΔJ2R-mIL12 I obtained from the fluorescent tag is added to each cell and cultured, and after 48 hours, cells are collected and virus-infected cells expressing green fluorescent protein are selected using a fluorescence microscope, and the selection and small-scale amplification of the recombinant virus are carried out to obtain a recombinant virus (including a GFP tag) that performs J2R, A44L-A45R-A46R gene knockout and heterologous nucleic acid knockout.After extracting viral genomic DNA and verifying A44L-A45R-A46R gene deletions by the PCR method, CV-1 cells transformed with a Cre expression plasmid are infected with the said recombinant virus (including a GFP tag), and the GFP gene is removed using the Cre / loxP system, thereby performing J2R and A44L-A45R-A46R gene knockout with deleted fluorescent tags and heterologous nucleic acid knockout, a series of recombinant viruses WCΔJ2RΔ(A44L-A45R-A46R)-mIL12 I / sHPGD(IVIR001), WCΔJ2RΔ(A44L-A45R-A46R)-mIL12 I / sMICBH(IVIR003), WCΔJ2RΔ(A44L-A45R-A46R)-mIL12 I / smCTAH(IVIR005), WCΔJ2RΔ(A44L-A45R-A46R)-mIL12 I / smPCTAH(IVIR007) and WCΔJ2RΔ(A44L-A45R-A46R)-mIL12 I / sMICAH were obtained, as shown in Fig. 5A.
[0135] (3) A52R gene knockout and heterologous nucleic acid knockout: CV-1 cells were transfected with Lipofectamine 3000 using the shuttle plasmids obtained in Example 2, pShuttleΔA52R (Biii in Fig. 4), pShuttleΔA52R-sHPGD (Ei in Fig. 4), pShuttleΔA452R-sMICBH (Eii in Fig. 4), pShuttleΔA52R-smCTAH (Eiii-iv in Fig. 4) or pShuttleΔA52R-smPCTAH (Ev-vi in Fig. 4). After 4 hours, the recombinant virus with the fluorescent tag removed was used at a concentration of 0.01 PFU / cell, e.g., WCΔJ2RΔ(A44L-A45R-A46R)-mIL12 I / sHPGD(IVIR001), By adding WCΔJ2RΔ(A44L-A45R-A46R)-mIL12 I / sMICBH(IVIR003), WCΔJ2RΔ(A44L-A45R-A46R)-mIL12 I / smCTAH(IVIR005), WCΔJ2RΔ(A44L-A45R-A46R)-mIL12 I / smPCTAH(IVIR007), and WCΔJ2RΔ(A44L-A45R-A46R)-mIL12 I / sMICAH and culturing, cells are collected after 48 hours, and virus-infected cells expressing green fluorescent protein are selected using a fluorescence microscope. By proceeding with the selection and small-scale amplification of recombinant viruses, a recombinant virus (including a GFP tag) that performs J2R, A44L-A45R-A46R, and A52R gene knockout and heterologous nucleic acid knockout can be obtained.After extracting viral genomic DNA and verifying A52R gene deletion by the PCR method, CV-1 cells transformed with a Cre expression plasmid are infected with a recombinant virus (including a GFP tag) that performs J2R, A44L-A45R-A46R, and A52R gene knockout and heterologous nucleic acid knockout, and the GFP gene is removed using the Cre / loxP system, thereby forming a series of recombinant viruses with deleted fluorescent tags, namely WCΔJ2RΔ(A44L-A45R-A46R)ΔA52R-mIL12 I / sHPGD(IVIR002) and WCΔJ2RΔ(A44L-A45R-A46R)ΔA52R-mIL12 I / sMICBH(IVIR004), WCΔJ2RΔ(A44L-A45R-A46R)ΔA52R-mIL12 I / smCTAH(IVIR006), WCΔJ2RΔ(A44L-A45R-A46R)ΔA52R-mIL12 I / smPCTAH(IVIR008), WCΔJ2RΔ(A44L-A45R-A46R)ΔA52R-mIL12 I / sMICAH(IVIR009), WCΔJ2RΔA52R-mIL12 I / sHPGD(IVIR010), WCΔJ2RΔA52R-mIL12 I / sMICBH(IVIR011), WCΔJ2RΔA52R-mIL12 I / smCTAH(IVIR012), WCΔJ2RΔA52R-mIL12 I / smPCTAH(IVIR013) was obtained, as shown in Fig. 5A.
[0136] Example 4: Screening, Verification, and Amplification of Recombinant Viruses
[0137] (1) Selection of recombinant virus: Select virus-infected cells expressing green fluorescent protein and transfer them to a freezing tube containing 200 μL of cell culture medium. After thawing, take 20 μL of the cells and dilute them with cell medium. Then, add them to a 6-well plate inoculated with CV-1 cells for 24 hours and culture for another 48 hours. Observe the cells under a microscope to select virus-infected cells expressing green fluorescent protein. Continue the selection process until all cells emit fluorescence under a microscope. After obtaining the recombinant virus expressing green fluorescent protein (in the case of a recombinant virus with the GFP gene removed, select colorless viruses using the same method, i.e., select the necessary recombinant virus), scrape off the cells and freeze them at -80°C for use in virus amplification.
[0138] (2) Verification of recombinant virus: Take 20 μL of virus and let it sit for 24 hours in advance for 5 10 minutes 5 The cells were added to a 6-well plate inoculated with canine CV-1 cells and cultured for another 16 hours. The whole cell lysate of CV-1 cells was used as a protein sample to detect the expression of IL12 p70 and HPGD proteins in non-extracellular (intracellular and on the cell membrane) using sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and Western blotting (WB) methods and commercial anti-IL12 p35 antibody (αIL12 p35, ab131039, Abcam) and anti-HPGD antibody (αHPGD, ab187161, Abcam); and the expression of IL12 p70 protein on the cell membrane was detected using flow cytometry and an anti-IL12 antibody (anti-mouse IL12, 560564, BD).
[0139] (3) Amplification of recombinant virus: 100 μL of cells infected with a recombinant virus with the fluorescent tag removed (any one of IVIR001 to IVIR013 obtained in steps (2) and (3) of Example 3) is taken, and after thawing, added to a 6-well plate containing CV-1 cells and grown to 80-90% fusion in about 1.5 mL of cell culture medium, and after 48 hours, the cells and culture medium are scraped and stored to obtain a “seed virus”. The “seed virus” is rapidly thawed three times and diluted by an appropriate number of times, and 100 μL / bottle of the virus suspension is taken and added to a T225 culture bottle containing CV-1 cells. After 48 hours, cells are aspirated and centrifuged several times at 1500 rpm (4℃), the precipitate is washed with PBS, resuspended in 10 mL of 10 mM Tris-HCl buffer (pH 9), and stored at -80℃ for use in virus concentration.
[0140] (4) Concentration of recombinant virus: After thawing the recombinant virus amplified in step (3) above, swirl it for a few seconds and centrifuge at 1500 rpm (4°C) for 5 min to collect the supernatant (containing released virus particles) and dilute it with 10 mM Tris-HCl buffer to a total volume of 30 mL. After placing the average of 30 mL into four Beckman ultra-high centrifuge tubes, carefully add 17 mL of 36% sucrose solution to the virus solution and centrifuge at 13500 rpm (4°C) for 80 min. Resuspend the final precipitate in 1-4 mL of virus suspension buffer (PBS; 10% glycerol; 138 mM NaCl; pH 7.4) and store at -80°C.
[0141] (5) Western blot (WB) experiment: Cells infected with viruses (any one of IVIR001 to IVIR013 obtained in steps (2) and (3) of Example 3 and WRΔJ2R, WRΔJ2R-sIL12, WRΔJ2R-mIL12 I, WRΔJ2R-mIL12 II obtained in step (1) of Example 3) were collected using a cell scraper, and total cell protein was extracted by low-temperature high-speed centrifugation (4°C, centrifugation at 14,000×g for 15 min) using RIPA hydrolysate (Shanghai Biyun Tian Life Science Co., Ltd.) with PMSF and a protease-specific inhibitor (purchased from Applygen). The concentration of the protein sample is measured using the BCA method, 20 μg of protein / well is taken and SDS-PAGE is performed, and the separated target protein is transferred from the electrophoresis gel to a PVDF membrane. Then, the primary antibody, αIL12 p35 (ab131039, Abcam), αHPGD (ab187161, Abcam), or anti-β-actin antibody (C1313, Applygen), is cultured (overnight at 4°C, 35 rpm), and the secondary antibody, HRP-labeled anti-mouse antibody (BA1050, BOSTER), or HRP-labeled anti-rabbit antibody (ab6721, Abcam), is cultured (room temperature, 35 rpm, 2h). Afterward, an ECL luminescent solution (purchased from Cowin Biotech) is dropped onto the protein membrane, and exposure and images are collected using an electronic film imaging device (purchased from e-blot).
[0142] (6) Flow cytometry: CV-1 cells were infected with a recombinant virus with a multiplicity of infection (MOI) of 0.5, and after 16 hours, virus-infected cells were collected by trypLE digestion and incubated for 30 minutes with 5 μL of anti-IL12 antibody (anti-mouse IL12, 560564, BD) at 4°C in the dark. IL12 p70-positive cells were detected and analyzed using an instrument.
[0143] It is confirmed that 13 types of vaccinia virus WC strain recombinant viruses were obtained through viral recombination, screening, and verification, as illustrated in Fig. 5A: IVIR001, IVIR002, and IVIR010 (expressing both mIL12 I and sHPGD); IVIR003, IVIR004, and IVIR011 (expressing both mIL12 I and sMICBH); IVIR005, IVIR006, and IVIR012 (expressing both mIL12 I and smCTAH); IVIR007, IVIR008, and IVIR013 (expressing both mIL12 I and smPCTAH); and IVIR009 (expressing mIL12 I and sMICAH).
[0144] Fig. 5B represents a fusion protein expressed by recombinant viruses IVIR001–IVIR013, wherein Fig. 5B represents mIL12I (Type I membrane protein IL12 p70) comprising a signal peptide, IL12 p40, (G4S)2 linker peptide, IL12 p35, and a transmembrane peptide (TP); Fig. 5Bi represents sHPGD comprising a signal peptide and human HPGD (hHPGD); Fig. 5Biii represents sMICBH comprising a signal peptide, G2S linker peptide, MICB peptide, AEAAAKEAAAKA linker peptide, and hHPGD; Biv in Fig. 5 represents the signal peptide, G2S linker peptide, MICB peptide, AEAAAKEAAAKA linker peptide, CTA1peptide (cancer-testis antigen peptide 1), CTA2peptide… CTA 33It represents smCTAHa containing the peptide, AEAAAKEAAAKA linker peptide, and hHPGD, and the linker peptide between each CTA peptide is GG; Bv in Fig. 5 represents the signal peptide, G2S linker peptide, MICB peptide, AEAAAKEAAAKA linker peptide, CTA1peptide (cancer-testis antigen peptide 1), CTA2peptide… CTA 33 It represents smCTAHb containing a peptide, an AEAAAKEAAAKA linker peptide, and hHPGD, where the linker peptide between each CTA peptide is PP; Bvi in Fig. 5 represents a signal peptide, a G2S linker peptide, an MICB peptide, an AEAAAKEAAAKA linker peptide, PCTA1peptide (prostate cancer tumor antigen peptide 1), PCTA2peptide… PCTA 10 It represents smPCTAHa containing a peptide, an AEAAAKEAAAKA linker peptide, and hHPGD, and the linker peptide between each PCTA peptide is GG; Bvii in Fig. 5 represents a signal peptide, a G2S linker peptide, an MICB peptide, an AEAAAKEAAAKA linker peptide, PCTA1peptide (prostate cancer tumor antigen peptide 1), PCTA2peptide… PCTA 10 smPCTAHb is represented, comprising a peptide, an AEAAAKEAAAKA linker peptide, and hHPGD, where the linker peptide between each PCTA peptide is PP; Bviii of FIG. 5 is represented, comprising a signal peptide, a G2S linker peptide, a MICA peptide, an AEAAAKEAAAKA linker peptide, and hHPGD.
[0145] Example 5: Verification of Vaccinia Virus Gene Knockout
[0146] Vaccinia virus gene knockout is verified using PCR technology based on the molecular level. As shown in Figure 6, compared to the wild-type WR strain genome, when using the J2R knockout type WR strain (GFP tag included (WRΔJ2R-GFP) genome) as a template, the electrophoretic position of the PCR product of J2R appears higher (this is because the GFP gene fragment is larger than the J2R gene); compared to using the J2R knockout type WR strain (WRΔJ2R) genome as a template, when using the J2R and A52R knockout type WR strain (GFP tag included) (WRΔJ2RΔA52R-GFP) genomes as a template, the electrophoretic position of the PCR product of A52R appears lower (this is because the GFP gene fragment is smaller than the A52R gene); compared to using the WRΔJ2R genome as a template, J2R, A52R, and A44L-A45R-A46R knockout type WR strains (GFP tag When the WRΔJ2RΔ(A44L-A45R-A46R)-GFP genome is used as a template, the electrophoretic position of the PCR product of A44L-A45R-A46R appears low (this is because the GFP gene fragment is smaller than the A44L-A45R-A46R gene).
[0147] Example 6: Verification of IL12 p70 fusion protein expression in recombinant viruses
[0148] Based on the molecular level, the expression of the IL12 p70 fusion proteins—secretory IL12 p70 (sIL12), type I membrane protein IL12 p70 (mIL12 I), and type II membrane protein IL12 p70 (mIL12 II)—is verified as shown in Fig. 7A. According to the Western blot results, it was confirmed that the recombinant viruses WRΔJ2R-sIL12, WRΔJ2R-mIL12 I, and WRΔJ2R-mIL12 II each expressed the IL12 p70 protein after infecting CV-1 cells for 16 hours, whereas the control virus WRΔJ2R-infected cells did not express the IL12 p70 protein (Fig. 7B). Flow cytometry results show that after infecting CV-1 cells for 16 hours with recombinant viruses WRΔJ2R-sIL12, WRΔJ2R-mIL12 I, and WRΔJ2R-mIL12 II, the proportion of IL12 p70-positive cells was 4.15%, 96.7%, and 38.9%, respectively (Fig. 7C).
[0149] Example 7: Functional verification of recombinant virus-expressing secretory human-derived HPGD
[0150] Through enzyme-linked immunosorbent assay (ELISA) experiments, prostaglandin E2 of mouse lung cancer cells LLC infected with recombinant viruses IVIR006a, IVIR008a, the WR strain recombinant virus expressing intracellular mouse-derived HPGD prepared in step (1) of Example 3 (WRΔJ2R-HPGD), and the control virus WRΔJ2R, respectively The level of PGE2 secretion was detected.
[0151] (1) Cell medium sample collection: LLC cells are infected with a recombinant virus with an infection factor (MOI) of 1, and the cell medium is collected after 24 hours of infection. 20 mM arachidonic acid (purchased from Sigma-Aldrich) is added 4 hours before collecting the cell medium and treated for 4 hours. After removing all cell fragments from the cell medium by centrifugation (1500 rpm, 5 min), the medium is stored.
[0152] (2) ELISA experiment: Use a 96-well PGE2 ELISA kit (purchased from Caymen) to detect the concentration of PGE2 in the cell medium. Refer to the manufacturer's instruction manual for specific operation steps. Prepare four samples and four standards each. Read the absorbance value of each well at 412 nm and determine the PGE2 concentration according to the standard curve.
[0153] As shown in Figure 8, the results showed that after 24h, the PGE2 concentration in the cell medium was 257 pg / mL in the WRΔJ2R-HPGD infected group, 142 pg / mL in the IVIR006a infected group, and 123 pg / mL in the IVIR008a infected group. The PGE2 concentrations of all three groups were lower than the PGE2 concentration of the WRΔJ2R infected group (1561 pg / mL), and the difference was statistically significant (one-way ANOVA, p-value<0.0001); at the same time, the difference in PGE2 concentration between the WRΔJ2R infected group (1561 pg / mL) and the virus-free group (Cell only group; 1611 pg / mL) was not statistically significant (P=0.9886). The above results suggest that secreted HPGDs expressing IVIR006a and IVIR008a exhibit a superior effect on PGE2 degradation compared to intracellular HPGDs expressing WRΔJ2R-HPGD.
[0154] Example 8: Verification of recombinant virus expression fusion protein
[0155] Fusion proteins expressed after 16 hours of infection of CV-1 cells by the recombinant virus IVIR004 (expressing sMICBH and mIL12 I, Fig. 9A) were detected through WB and flow cytometry experiments. WB results (Fig. 9B) show that cells infected with IVIR004 expressed the HPGD protein, whereas cells infected with the control virus WRΔJ2R did not express the HPGD protein. Flow cytometry results (Fig. 9C) showed that the proportion of IL12 p70-positive cells in the IVIR004 infected group was 94.8%. WB results (Fig. 9D) show that cells infected with IVIR004 expressed the IL12 p70 protein, whereas cells infected with the control virus WRΔJ2R did not express the IL12 p70 protein.
[0156] Example 9: Effect of recombinant virus as a therapeutic cancer vaccine on mouse splenocyte immune function
[0157] Based on animal models, IFNγ secreted from splenocytes derived from mice injected with a recombinant virus was detected through ELISpot experiments.
[0158] (1) Acquisition of splenocytes: Select 6-8 week old, immune-normal Balb / c or C57BL / 6N female mice (purchased from Beijing Vital Liver Experimental Animal Technology Co., Ltd.) and inject intraperitoneally. Using a needle, inject 100 μL of the recombinant virus (IVIR002, IVIR004, and control virus WRΔJ2R) at a location approximately 0.3–0.5 cm away from the intersection of the two thigh lines and the abdominal midline, 5×10 6 Administer via intraperitoneal injection at a dose of PFU / animal, using 6 mice per group. On days 7 and 14 after injection, 3 mice are selected from each group to collect spleens. Imaging and splenocyte preparation after splenectomy: The spleens are successively cut, crushed, polished, and digested with an RBC digester; they are then resuspended in a complete medium containing RPMI + 5% FBS, and 10 μL is taken to count the cells.
[0159] (2) Preparation of immunostimulator: After infecting CV-1 cells with a recombinant virus at MOI=1 for 24 hours, scrape off the cells, thaw them three times, centrifuge at 4000 rpm for 6 minutes, take the supernatant, and inactivate the virus by treating it with UV light for 2.5 minutes / ultrasound once / 30s-UV light for 2.5 minutes to obtain an inactivated virus to use as a stimulator.
[0160] (3) ELISpot experiment: Mouse splenocytes (number of splenocytes 5×10 5 or 3×10 5 (1 / well) is inoculated into a 96-well plate pre-coated with IFNγ, and three multi-wells are set up for each group. 10 μL / well of stimulant is taken and added to a 96-well plate containing mouse-derived splenocytes from another injection group, and after incubation in a 37°C incubator for 60 hours, the cells are removed. Then, antibody culture, color development, and the number of IFNγ spots are counted according to the operation steps in the instructions of the Mouse IFNγ ELISpot Kit (Beijing Dakoway Biotech Co., Ltd.). IFNγ is a cytokine secreted by immune-activated cells that exerts important immunomodulatory effects in antiviral immunity and includes activated T cells, NK cells, and phagocytic cells. One spot represents a single cell secreting IFNγ, and the number of spots reflects the level of immune response of immune cells within the sample; a higher number of spots indicates a higher level of cellular immune response.
[0161] In the IFNγ ELISpot experiment, IFNγ-positive cells were detected in splenocytes 14 days after intraperitoneal injection of recombinant viruses IVIR004 (MICB peptide expression, w / MICB peptide), IVIR002 (MICB peptide non-expression, w / o MICB peptide), or control virus WRΔJ2R into b / c female mice.
[0162] According to the results of the IFNγ ELISpot experiment (Fig. 10A), IFNγ spots were observed in the mouse splenocytes of the IVIR004 and IVIR002 injection groups. According to quantitative analysis (Fig. 10B), 5×10 5 The number of IFNγ spots formed per MICB peptide-associated mouse splenocyte showed a statistically significant difference compared to the control group (non-matched T-test, p<0.01). This result indicates that IVIR004 expressing the MICB peptide can induce significant proliferation of MICB peptide-associated antigen-specific immune cells that secrete IFNγ, and that these immune cells can specifically kill tumor cells expressing the associated tumor antigen without affecting normal tissue cells.
[0163] Example 10: Verification of the fusion protein of a recombinant virus
[0164] Fusion proteins expressed after infecting CV-1 cells with the recombinant virus IVIR006a (expressing smCTAH and mIL12 I, Fig. 11A) for 16 hours were detected through WB and flow cytometry experiments. WB results (Fig. 11B) show that cells infected with IVIR006a expressed HPGD protein, whereas cells infected with the control virus WRΔJ2R did not express HPGD protein. Flow cytometry results (Fig. 11C) showed that the proportion of IL12 p70-positive cells in the IVIR006a-infected group was 90.8%. WB results (Fig. 11D) further show that cells infected with IVIR006a expressed IL12 p70 protein, whereas cells infected with the control virus WRΔJ2R did not express IL12 p70 protein.
[0165] Example 11: Effect of recombinant virus as a therapeutic cancer vaccine on mouse splenocyte immune function
[0166] Based on animal models, IFNγ secreted from splenocytes derived from mice injected with a recombinant virus was detected using the ELISpot experiment. Refer to Example 9 for the experimental method.
[0167] IFNγ-positive cells were detected in splenocytes 14 days after intraperitoneal injection of recombinant viruses IVIR006a (MICB peptide and CTA peptide expression, w / MICB peptide+CTA peptides), IVIR002 (MICB peptide and CTA peptide non-expression, w / o MICB peptide+CTA peptides), or control virus WRΔJ2R into female C57BL / 6N mice through an IFNγ ELISpot experiment.
[0168] According to the results of the IFNγ ELISpot experiment (Fig. 12A), IFNγ spots were observed in the mouse splenocytes of the IVIR006a and IVIR002 injection groups. According to quantitative analysis (Fig. 12B), 5×10 5 The number of IFNγ spots formed per mouse spleen cell associated with MICB peptide and CTA peptide showed a statistically significant difference compared to the control group (non-matched T-test, p-value < 0.0001). The above results suggest that IVIR006a expressing MICB peptide and CTA peptide can induce significant proliferation of antigen-specific immune cells associated with MICB peptide + CTA peptide that secrete IFNγ, and that these immune cells can specifically kill tumor cells expressing the associated tumor antigen without affecting normal tissue cells.
[0169] Example 12: Effect of recombinant virus as a therapeutic cancer vaccine on mouse lung and colon cancer tumor growth
[0170] Through xenograft tumor experiments, we monitor the transplanted tumor growth of mouse tumor cells and the effect of recombinant viruses on tumor growth as therapeutic cancer vaccines.
[0171] 6-8 week old C57BL / 6N female mice (purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd.) were selected, and after one week of rearing, the hair was removed from the groin area of the left hind leg; 2 days later, 100μL of lung cancer cell LLC suspension (LLC cells 5×10⁶) was applied to the hair removal site. 5 (including) or 50μL colon cancer cell MC38 suspension (5X10 5 Spherical protrusions are formed by subcutaneously injecting cells containing MC38 cells. LLC cells were purchased from Wuhan Procell, and MC38 cells were purchased from Shanghai Yaji Bio. The cell suspension consists of tumor cells suspended in PBS; cell counting and Mycoplasma detection were performed prior to subcutaneous transplantation. Cells suitable for transplantation are those in the logarithmic growth phase (70-80% density) and free from Mycoplasma and bacterial contamination. Tumor size is measured 10 or 13 days after transplantation, and mice with appropriate tumor sizes are randomly divided into groups, with 9-10 mice used per group.
[0172] Lung cancer tumor treatment (Fig. 13A) was performed on days 13 and 16 after LLC cell transplantation using recombinant viruses IVIR001 (sHPGD and mIL12 I expression) or IVIR006a (smCTAH and mIL12 I expression), respectively, and 100 μL of virus suspension (1×10⁻¹⁰) was injected intratumorally (IT Injection). 7 (containing PFU virus) or an equal volume of PBS was administered. Starting from day 13 after LLC cell transplantation, tumor volume was monitored by measuring it twice a week using slide calipers. Tumor volume calculated as an elliptical sphere = π / 6 × L (major axis) × W (minor axis) 2 . Tumor volume exceeding 1400 mm³ In this case, euthanasia was performed on the animals. During treatment with the LLC transplanted tumor model, the therapeutic cancer vaccine demonstrated superiority in tumor treatment by statistically significantly reducing the tumor growth rate. Survival data were compared using GraphPad software, and the significance of survival differences was determined using the log-rank (Mantel-Cox) test. Significance (*p-value < 0.05) was determined using the non-paired Student's t-test. As a result of constructing tumor growth curves according to tumor volume (Fig. 13A), the tumor growth curves of the IVIR006a and IVIR001 treatment groups were lower than those of the control group (PBS of the same volume); and on day 24 of cell transplantation, the tumor volumes of the IVIR006a and IVIR001 treatment groups were significantly smaller than those of the control group (p-value < 0.05).
[0173] Colon cancer tumor treatment (Fig. 13B) was performed on days 10 and 13 after MC38 cell transplantation using recombinant virus IVIR006a or control virus WRΔJ2R, respectively, and 50 μL of virus suspension (5 × 10⁻⁶) was injected intratumorally (IT Injection). 6 (containing PFU virus) or an equal volume of PBS was administered. Starting from day 10 after MC38 cell transplantation, tumor volume was monitored by measuring it twice a week using slide calipers. For the treatment of the MC38 transplanted tumor model, the calculation of tumor volume, construction of tumor growth curves, and confirmation of significance (*p-value < 0.05) all refer to the above LLC transplanted tumor model treatment. These results (Figure 13B) show that the tumor growth curve of the IVIR006a treatment group was lower than that of the control virus WRΔJ2R treatment group and the control group (equal volume of PBS); and on days 23 and 27 after cell transplantation, the tumor volume of the IVIR006a treatment group was significantly smaller than that of the control virus WRΔJ2R treatment group (p-value < 0.05).
[0174] Example 13: Verification of recombinant virus fusion protein
[0175] Fusion proteins expressed after infecting CV-1 cells with the recombinant virus IVIR008a (expressing smCTAH and mIL12 I, Fig. 14A) for 16 hours were detected through WB and flow cytometry experiments. WB results (Fig. 14B) show that cells infected with IVIR008a expressed HPGD protein, while cells infected with the control virus WRΔJ2R did not express HPGD protein. Flow cytometry results (Fig. 14C) showed that the proportion of IL12 p70-positive cells in the IVIR008a-infected group was 91.4%. WB results (Fig. 14D) further show that cells infected with IVIR008a expressed IL12 p70 protein, while cells infected with the control virus WRΔJ2R did not express IL12 p70 protein.
[0176] Example 14: Effect of recombinant virus as a therapeutic cancer vaccine on mouse splenocyte immune function
[0177] Based on animal models, IFNγ secreted from splenocytes derived from mice injected with a recombinant virus was detected using the ELISpot experiment. Refer to Example 9 for the experimental method.
[0178] In the IFNγ ELISpot experiment, IFNγ-positive cells were detected in splenocytes 14 days after intraperitoneal injection of recombinant viruses IVIR008a (MICB peptide and PCTA peptide expression, w / MICB peptide+PCTA peptides), IVIR002 (MICB peptide and PCTA peptide non-expression, w / o MICB peptide+PCTA peptides), or control virus WRΔJ2R into female Balb / c mice.
[0179] According to the results of the IFNγ ELISpot experiment (Fig. 15A), IFNγ spots were observed in the mouse splenocytes of the IVIR008a and IVIR002 injection groups. According to quantitative analysis (Fig. 15B), 3×10 5The number of IFNγ spots formed per mouse spleen cell associated with MICB peptide and PCTA peptide showed a statistically significant difference compared to the control group (non-matched T-test, p-value < 0.01). These results suggest that IVIR008a expressing MICB peptide and PCTA peptide can induce significant proliferation of antigen-specific immune cells associated with MICB peptide and PCTA peptide that secrete IFNγ, and that these immune cells can specifically kill tumor cells expressing the associated tumor antigen without affecting normal tissue cells.
[0180] Example 15: Verification of recombinant virus fusion protein
[0181] Fusion proteins expressed after 16 hours of infection with CV-1 cells by the recombinant virus IVIR009 (expressing sMICAH and mIL12 I, Fig. 16A) were detected through WB experiments. WB results (Fig. 16B) show that cells infected with IVIR009 expressed the HPGD protein, whereas cells infected with the control virus WRΔJ2R and the virus-uninfected group (Cell only group) did not express the HPGD protein. Additionally, WB results (Fig. 16C) further show that cells infected with IVIR009 expressed the IL12 p70 protein, whereas cells infected with the control virus WRΔJ2R and the virus-uninfected group (Cell only group) did not express the IL12 p70 protein.
[0182] Example 16: Effect of recombinant virus as a therapeutic cancer vaccine on mouse splenocyte immune function
[0183] Based on animal models, IFNγ secreted from splenocytes derived from mice injected with a recombinant virus was detected using the ELISpot experiment. Refer to Example 9 for the experimental method.
[0184] IFNγ-positive cells were detected in spleen cells 14 days after intraperitoneal injection of recombinant viruses IVIR009 (MICA peptide expression, w / MICA peptide), IVIR002 (MICA peptide non-expression, w / o MICA peptide), or control virus WRΔJ2R into female Balb / c mice through the IFNγ ELISpot experiment.
[0185] According to the results of the IFNγ ELISpot experiment (Fig. 17A), IFNγ spots were observed in mouse splenocytes of the IVIR009 and IVIR002 injection groups. According to the results of the quantitative analysis (Fig. 17B), 5×10 5 The number of IFNγ spots formed per MICA peptide-associated mouse spleen cell showed a statistically significant difference compared to the control group (non-matched T-test, p-value < 0.01). The above results suggest that IVIR009 expressing the MICA peptide can induce significant proliferation of MICA peptide-associated antigen-specific immune cells that secrete IFNγ, and that these immune cells can specifically kill tumor cells expressing the associated tumor antigen without affecting normal tissue cells.
[0186] Example 17: Verification of the fusion protein of a recombinant virus
[0187] IVIR006 includes two subtypes, a and b. When comparing the two, they both have in common that they express a secreted fusion MICB peptide, a fusion protein of multiple cancer-testis antigen peptides and human-derived HPGD (secreted MICB peptide + multiple CTA peptides + hHPGD, smCTAH) and the type I membrane protein IL12 p70 (mIL12 I). The difference is that the linker peptides between the CTA peptides are different, where IVIR006a uses a GG linker peptide (Fig. 11A) and IVIR006b uses a PP linker peptide (Fig. 18A). Fusion proteins expressed after 16 hours of infection with the recombinant virus IVIR006b in CV-1 cells were detected through WB and flow cytometry experiments. In the WB results (Figs. 18 B and 18 D), cells infected with IVIR006b expressed HPGD protein and IL12 p70 protein, whereas the control virus WR J2R infected cells showed that they did not express HPGD protein and IL12 p70 protein; flow cytometry results (Fig. 18 C) showed that the proportion of IL12 p70-positive cells in IVIR006b infected cells was 90.6%.
[0188] IVIR008 includes two subtypes, a and b. When comparing the two, they both have in common that they express a secreted fusion MICB peptide, a fusion protein of multiple cancer-testis antigen peptides and human-derived HPGD (secreted MICB peptide + multiple PCTA peptides + hHPGD, smPCTAH) and the type I membrane protein IL12 p70 (mIL12 I). The difference is that the linker peptides between the PCTA peptides are different, where IVIR008a uses a GG linker peptide (Fig. 14A) and IVIR008b uses a PP linker peptide (Fig. 19A). Fusion proteins expressed after 16 hours of infection with the recombinant virus IVIR008b in CV-1 cells were detected through WB and flow cytometry experiments. Here, WB results (Fig. 19 B and Fig. 19 D) showed that IVIR008b-infected cells expressed HPGD protein and IL12 p70 protein, while control virus WRΔJ2R-infected cells did not express HPGD protein and IL12 p70 protein; and flow cytometry results (Fig. 19 C) showed that the proportion of IL12 p70-positive cells in IVIR008b-infected cells was 86.9%.
[0189] Example 18: Verification of recombinant virus fusion protein
[0190] Fusion proteins expressed after 16 hours of infection of CV-1 cells by recombinant viruses IVIR010, IVIR011, IVIR012, and IVIR013 (all expressing mIL12 I and sHPGD, sMICBH, smCTAH, and smPCTAH, respectively; Fig. 20A) were detected through WB and flow cytometry experiments. Here, IVIR012 includes two subtypes, a and b; comparing the two, the commonality is that both express smCTAH and mIL12 I, while the difference lies in the linker peptides between the CTA peptides, specifically IVIR012a using the GG linker peptide and IVIR012b using the PP linker peptide; IVIR013 includes two subtypes, a and b; comparing the two, the commonality is that both express smPCTAH and mIL12 I, while the difference lies in the linker peptides between the PCTA peptides, here IVIR013a uses a GG linker peptide, and IVIR013b uses a PP linker peptide. WB results (Figs. 20B and 20C) show that cells infected with IVIR010, IVIR011, IVIR012a, IVIR012b, IVIR013a, and IVIR013b expressed HPGD protein and IL12 p70 protein, whereas cells infected with the control virus WRΔJ2R did not express HPGD protein and IL12 p70 protein. Flow cytometry results (Fig. 20D) showed that the proportion of IL12 p70-positive cells in IVIR011, IVIR012b, and IVIR013b infected cells was 82.4%, 78.0%, and 84.9%, respectively.
[0191] Example 19: Effect of recombinant virus as a therapeutic cancer vaccine on mouse splenocyte immune function
[0192] Based on animal models, IFNγ secreted from splenocytes derived from mice injected with a recombinant virus was detected using the ELISpot experiment. Refer to Example 9 for the experimental method.
[0193] In IFNγ ELISpot experiments, Balb / c female mice were treated with IVIR011 (MICB peptide expression, w / MICB peptide), IVIR012b (MICB peptide and CTA peptide expression, w / MICB peptide+CTA peptides), IVIR013b (MICB peptide+PCTA peptide expression, w / MICB peptide+PCTA peptides), IVIR010 (MICB peptide, MICB peptide+CTA peptide, and non-expression of MICB peptide+PCTA peptide, w / o MICB peptide, MICB peptide+CTA peptides, or MICB peptide+PCTA peptides) or a control virus WR IFNγ-positive cells were detected in spleen cells 7 days after J2R was injected into the peritoneum.
[0194] According to the IFNγ ELISpot results (Fig. 21A), IFNγ spots were observed in the mouse splenocytes of the IVIR010, IVIR011, IVIR012b, and IVIR013b injection groups. According to the quantitative analysis (Fig. 21B), 5×10 5 The number of IFNγ spots formed per spleen cell associated with MICB peptide, MICB peptide+CTA peptide, and MICB peptide+PCTA peptide showed statistically significant differences compared to the control group (non-matched T-test, p-value <0.05, p-value <0.01, p-value <0.0001). The above results suggest that IVIR011, IVIR012b, and IVIR013b can induce significant proliferation of antigen-specific immune cells that secrete IFNγ, and that these immune cells can specifically kill tumor cells expressing related tumor antigens without affecting normal tissue cells.
[0195] The above results suggest that multiple tumor antigen peptide linker peptides (GG or PP) can all be utilized in the design of tumor antigen peptide fusion proteins.
[0196] Merging via citation
[0197] All contents of each patent and scientific literature mentioned in the text are incorporated into the text by citation for all purposes.
[0198] Equivalence
[0199] The present invention may be embodied in other specific ways without departing from its spirit or essential characteristics. Accordingly, the above embodiments are for illustrative purposes only in all cases and should not be a limitation to the invention described herein. Accordingly, the scope of the invention is not defined by the description above but by the appended claims, and is intended to include all variations within the equivalent meaning and scope of the claims.
[0200] Sequence list
[0201]
[0202]
[0203]
[0204]
[0205]
[0206]
[0207]
[0208]
[0209]
[0210]
[0211]
[0212]
[0213]
[0214]
[0215]
[0216]
[0217]
[0218]
[0219]
Claims
Claim 1 A tumor antigen peptide fusion protein comprising a signal peptide, human-derived 15-hydroxyprostaglandin dehydrogenase (HPGD), and at least one selective tumor antigen peptide. Claim 2 The tumor antigen peptide fusion protein according to claim 1, characterized in that the tumor antigen peptide fusion protein comprises a polypeptide combination selected from any one of (i)-(iii) connected in the following order from the N-terminus to the C-terminus: (i) a signal peptide, HPGD, and one or more tumor antigen peptides; (ii) a signal peptide, one or more tumor antigen peptides, and HPGD; and (iii) a signal peptide, one or more tumor antigen peptides, HPGD, and one or more tumor antigen peptides. Claim 3 In claim 1 or 2, the HPGD and the two tumor antigen peptides, and the plurality of tumor antigen peptides are connected by a linker peptide; preferably, the linker peptide is GG, G2S, G3S, (G4S) n (n≥1, preferably 1, 2, 3 or 4), [A(EAAAK) n A] m (n=2, 3 or 4, m=1 or 2), (XP) n (n≥1, X is an arbitrary amino acid), (CW) n (n≥1), a tumor antigen peptide fusion protein, one or more selected from GFLG, PLGLWA, and RVLAEA. Claim 4 In any one of claims 1 to 3, the tumor antigen peptide is a tumor antigen peptide fusion protein selected from MHC type I polypeptide-associated sequence B (MICB) peptide and MHC class I polypeptide-associated sequence A (MICA) peptide. Claim 5 In claim 4, the tumor antigen peptide fusion protein further comprises a tumor antigen peptide selected from a prostate cancer tumor antigen (PCTA) peptide and a cancer-testis antigen (CTA) peptide. Claim 6 In any one of claims 1 to 5, the signal peptide comprises SEQ ID NO: 7, or an amino acid sequence having sequence identity of 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 99.8% or more with SEQ ID NO: 7; and / or the HPGD comprises an amino acid sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 99.8% sequence identity with SEQ ID NO:1 or 2; and / or the MICB peptide comprises an amino acid sequence having sequence identity of SEQ ID NO:28, or SEQ ID NO:28 of 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 99.8% or more, and is a tumor antigen peptide fusion protein. Claim 7 In any one of claims 2 to 6, the fusion protein comprises a polypeptide combination from any one of the following groups (1) to (5): (1) sHPGD: signal peptide + HPGD; (2) sMICBH: signal peptide + MICB peptide + HPGD; (3) sMICAH: signal peptide + MICA peptide + HPGD; (4) smCTAH: signal peptide + MICB peptide + CTA1 peptide + CTA2 peptide + … + CTA 33 Peptide + HPGD, where CTA1 peptide, CTA2 peptide, … CTA 33 The peptides are different; (5) smPCTAH: signal peptide + MICB peptide + PCTA1 peptide + PCTA2 peptide + … + PCTA 10 Peptide + HPGD, where PCTA1 peptide, PCTA2 peptide, … PCTA 10 The peptide is an identical tumor antigen peptide fusion protein. Claim 8 A tumor antigen peptide fusion protein according to any one of claims 1 to 7, wherein the tumor antigen peptide fusion protein further comprises an IL12 p70 protein following an N-terminal signal peptide. Claim 9 A tumor antigen peptide fusion protein according to any one of claims 1 to 8, wherein the tumor antigen peptide fusion protein comprises an amino acid sequence selected from SEQ ID NO: 12-18, or comprises an amino acid sequence having sequence identity of 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 99.8% or more with respect to the amino acid sequence of SEQ ID NO: 12-18. Claim 10 A composition comprising a tumor antigen peptide fusion protein and an IL12 p70 fusion protein according to any one of claims 1 to 9, wherein the IL12 p70 fusion protein comprises a signal peptide or signal anchor peptide from the N-terminus to the C-terminus, an IL12 p70 protein, and a selective membrane-permeable peptide. Claim 11 In claim 10, the above-mentioned IL12 p70 protein is a composition in which IL12 p40 and IL12 p35 are linked by a linker peptide. Claim 12 In claim 10 or 11, the IL12 p70 fusion protein comprises a polypeptide combination selected from any one group of (i) sequentially linked signal peptide, IL12, linker peptide, and IL12; (ii) sequentially linked signal peptide, IL12, linker peptide, IL12, and membrane permeability peptide; and (iii) sequentially linked signal anchor peptide, IL12, linker peptide, and IL12, wherein the two IL12s of (i)-(iii) are each IL12 p35 or IL12 p40; preferably, the linker peptide is GG, G2S, G3S, (G4S) n (n≥1, preferably 1, 2, 3 or 4), [A(EAAAK) n A] m (n=2, 3 or 4, m=1 or 2), (XP) n (n≥1, X is an arbitrary amino acid), (CW) n A composition comprising one or more selected from (n≥1), GFLG, PLGLWA, and RVLAEA. Claim 13 A composition according to claim 12, wherein the IL12 p40 is a mouse-derived or human-derived IL12 p40 fragment and the IL12 p35 is a mouse-derived or human-derived IL12 p35 fragment. Claim 14 A composition according to any one of claims 10 to 12, wherein the IL12 p70 fusion protein comprises an amino acid sequence selected from SEQ ID NOs: 21-26, or an amino acid sequence having 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 99.8% or more sequence identity with an amino acid sequence selected from SEQ ID NOs: 21-26. Claim 15 A nucleic acid construct encoding a tumor antigen peptide fusion protein according to any one of claims 1 to 9 or a composition according to any one of claims 10 to 14; preferably, said nucleic acid construct is a DNA fragment, mRNA, or plasmid. Claim 16 A genetically engineered recombinant virus comprising a nucleic acid construct according to paragraph 15, wherein the said construct is a DNA fragment. Claim 17 In claim 16, the vector of the recombinant virus is selected from poxvirus, adenovirus, and herpes simplex virus; the poxvirus is a recombinant virus selected from vaccinia virus Western Reserve (WR) strain, Copenhagen strain, Lister strain, Ankara strain, Modified Vaccinia Ankara strain, New York Vaccinia strain, Tian Tan strain, Dryvax strain, Bern strain, Paris strain, Tash Kent strain, IHD-J strain, IHD-W strain, Brighton strain, CVA382 strain, Dairen strain, LC16m8 strain, LC16M0 strain, LIVP strain, ACAM2000 strain, WR65-16 strain, Connaught strain, EM-63 strain and their derivative strains and genetically modified strains. Claim 18 In paragraph 17, the above-mentioned genetically modified strain is a recombinant virus in which one or more of the genes J2R, A34R, A44L, A45R, A46R, and A52R have been knocked out. Claim 19 In claim 18, the genetically modified strain is one that knocks out one or more of the J2R, A34R, A44L-A45R-A46R, and A52R gene sequences and knocks in; preferably, the A44L-A45R-A46R gene comprises any one of the A44L, A45R, and A46R genes, or any combination of two or three of them, and preferably comprises a combination of three genes of A44L, A45R, and A46R, a recombinant virus. Claim 20 In paragraph 19, the exogenous gene knockout is a recombinant virus that is a tumor target gene knockout, a therapeutic factor coding gene knockout, and / or a tumor suppressor gene knockout. Claim 21 In paragraph 20, the above therapeutic factor comprises one or more of a cytokine, an immune co-stimulatory molecule, an immune checkpoint inhibitor, an anti-angiogenic factor, and a nucleic acid polymer; and the cytokine is preferably one or more of a chemokine, an interferon (INF), an interleukin (IL), and a tumor necrosis factor (TNF), a recombinant virus. Claim 22 In paragraph 20, the tumor suppressor gene is a recombinant virus that is a gene coding for HPGD and its homologs or fusion proteins. Claim 23 In claim 17, the vector of the recombinant virus is an extracellular envelope-enhanced vaccinia virus, which is a vaccinia virus WR strain containing an A34R gene modification; preferably, said modification comprises replacing the A34R gene and / or mutating the A34R gene, and preferably, said modification comprises replacing the A34R gene of the vaccinia virus WR strain with the A34R gene of the vaccinia virus Copenhagen strain, IHD-J strain or IHD-W strain; preferably, said extracellular envelope-enhanced vaccinia virus contains the A34R gene of the Copenhagen strain, which is a recombinant virus encoding the amino acid sequence of SEQ ID NO: 19 or a variant thereof. Claim 24 An expression system comprising a host cell and a genetically engineered recombinant virus according to any one of claims 16 to 23. Claim 25 A tumor antigen peptide fusion protein according to any one of claims 1 to 9, a composition according to any one of claims 10 to 14, a nucleic acid construct according to claim 15, or a genetically engineered recombinant virus according to any one of claims 16 to 23; and a pharmaceutical composition comprising a pharmaceutically acceptable carrier. Claim 26 In paragraph 25, the above pharmaceutical composition further comprises using an anticancer agent in combination. Claim 27 A method for treating or preventing a tumor, comprising the step of administering a tumor antigen peptide fusion protein according to any one of claims 1 to 9, a composition according to any one of claims 10 to 14, a nucleic acid construct according to claim 15, a genetically engineered recombinant virus according to any one of claims 16 to 23, or a pharmaceutical composition according to claim 25 or 26. Claim 28 Use of a tumor antigen peptide fusion protein according to any one of claims 1 to 9, a composition according to any one of claims 10 to 14, a nucleic acid construct according to claim 15, a genetically engineered recombinant virus according to any one of claims 16 to 23, or a pharmaceutical composition according to claim 25 or 26 in the manufacture of a drug for treating or preventing tumors. Claim 29 In claim 27 or 28, the tumor is a solid tumor or a non-solid tumor; preferably, the solid tumor is selected from breast cancer, lung cancer, colon cancer, ovarian cancer, melanoma, kidney cancer, liver cancer, stomach cancer, glioma, pancreatic cancer, osteosarcoma, prostate cancer, bladder cancer, rectal cancer, mesothelioma, cervical cancer, endometrial cancer, lymphoma and nasopharyngeal cancer, method or use. Claim 30 A method for activating or enhancing immune cell function, comprising the step of administering a tumor antigen peptide fusion protein according to any one of claims 1 to 9, a composition according to any one of claims 10 to 14, a nucleic acid construct according to claim 15, a genetically engineered recombinant virus according to any one of claims 16 to 23, or a pharmaceutical composition according to claim 25 or 26.