Pharmaceutical Composition for Preventing or Treating Aging-Induced Liver Damage Containing Filbertone

Abstract

The present invention relates to a pharmaceutical composition for preventing or treating liver damage caused by aging, comprising filvertone as an active ingredient. The filvertone effectively prevents and treats liver damage caused by aging by reducing the expression of p53 protein and inhibiting the p53-p21 signaling pathway, which is closely associated with the senescence signaling process. Therefore, it can be usefully utilized as an active ingredient in pharmaceutical compositions and health functional food compositions for preventing, improving, or treating liver damage.

Description

Technology Field

[0001] The present invention relates to a pharmaceutical composition for preventing or treating liver damage caused by aging, comprising filvertone as an active ingredient. Background Technology

[0002] Aging is a phenomenon in which the physical functions of an organism degenerate over time, applicable from the individual level to the cellular level and, more broadly, the molecular level. It can be defined as a process of change characterized by reduced responsiveness to external stimuli, a decline in the ability to maintain homeostasis leading to vulnerability to external stress, and increased susceptibility to disease, thereby increasing the likelihood of developing chronic conditions. Furthermore, due to the increase in the elderly population, Korea is projected to enter a super-aged society in 2025, with 20.6% of the population being elderly. An increase in the number of elderly people implies a rise in the prevalence of chronic degenerative diseases. Along with this increase in the elderly population, the incidence of age-related diseases has also been found to be rising significantly, with over 84% of the elderly population reported to suffer from at least one such disease. Recent research indicates that the amount of senescent cells in the body increases with age, and that these increased senescent cells are directly linked to age-related diseases. As humans age, the likelihood of normal cells transforming into cancer cells increases. Cells tend to voluntarily transform into senescent cells to prevent conversion into cancer cells. However, the accumulation of senescent cells triggers various forms of inflammation, which can be a cause of age-related diseases. As cells age, their functions decline. Cellular aging is defined as the stage where cell division permanently ceases; this mechanism is highlighted as a cause of age-related diseases such as cancer, arteriosclerosis, and degenerative arthritis. When cells age, differentiation and proliferation decrease at the cellular level, leading to structural changes in specific molecules and alterations in a series of reaction pathways. Consequently, inevitable anatomical and physiological changes occur beyond the cellular and molecular levels. Furthermore, the homeostasis of organs deteriorates, resulting in a rapid increase in susceptibility to external stress, disease, and mortality.

[0003] It is known that liver function is well maintained even as aging progresses if the liver remains healthy. In fact, in elderly patients, serum liver function tests—such as Alanine Aminotransferase (ALT), Aspartate Aminotransferase (AST), Alkaline Phosphate (ALP), and Bilirubin—are mostly within the normal range. However, it is reported that as aging progresses, the size of the liver shrinks, and blood flow to the liver decreases by more than 30–40%. Furthermore, an aged liver is easily damaged by dietary habits, alcohol, smoking, and poor nutritional status; it turns brown, atrophies, and reduces in size by up to 20–40%. This reduction in liver volume is attributed to decreased blood flow to the liver due to aging, with blood flow decreasing by approximately 35% or more in individuals over 65 compared to those under 40. Generally, with age, the accumulation of secondary lysosomes, residual bodies, and dense bodies caused by lipofuscin within hepatocytes increases, leading to an increase in the relative volume they occupy within the hepatocytes. As the accumulation of dense bodies increases in this manner, the metabolism of intracellular bodies or cellular components does not proceed properly, which can lead to problems in various metabolic processes within liver cells. Consequently, liver function declines as the body ages. Furthermore, the aging of liver cells impairs liver function, resulting in reduced regenerative capacity and an increased risk of hepatocellular carcinoma.

[0004] The background description of the invention is provided to facilitate a better understanding of the present invention. The matters described in the background description should not be construed as an acknowledgment that they exist as prior art. The problem to be solved

[0005] Meanwhile, as the body ages, the physiological functions of the liver gradually decline and vulnerability to various liver diseases increases. It is known that an increase in senescent cells within liver tissue secretes inflammatory cytokines and growth factors, and that vulnerability to various liver diseases increases as functional capacity declines; however, research on substances capable of inhibiting liver cell aging is currently lacking.

[0006] Furthermore, it was noted that while filbertone, the main flavor compound of hazelnuts, has been confirmed to be effective in reducing blood sugar levels, body weight, and visceral fat, preventing obesity-induced hypothalamic inflammation, and improving neurodegenerative diseases, and has been shown to contribute to maintaining energy balance and overall metabolic health by regulating muscle lipid metabolism, evidence linking filbertone directly to liver aging and related physiological mechanisms has not yet been confirmed despite these research findings.

[0007] As a result, the inventors of the present invention confirmed that filvertone inhibits the p53-p21 signaling pathway and reduces the number of aged liver cells, and completed the present invention.

[0008] Accordingly, the problem that the present invention aims to solve is to provide a pharmaceutical composition for preventing or treating liver damage comprising filbertone as an active ingredient.

[0009] In addition, another problem that the present invention aims to solve is to provide a health functional food composition for preventing or improving liver damage, comprising filbertone as an active ingredient.

[0010] In addition, another problem that the present invention aims to solve is to provide a method for preventing or treating liver damage, comprising the step of administering a pharmaceutical composition containing Filbertone as an active ingredient to an individual other than a human.

[0011] The problems of the present invention are not limited to those mentioned above, and other unmentioned problems will be clearly understood by those skilled in the art from the description below. means of solving the problem

[0012] In order to solve the problem described above, a pharmaceutical composition for preventing or treating liver damage comprising filbertone as an active ingredient according to one embodiment of the present invention is provided.

[0013] According to a feature of the present invention, the filvertone may be represented by Chemical Formula 1.

[0014] [Chemical Formula 1]

[0015]

[0016] According to another feature of the present invention, the filvertone may be included at a concentration of 15 to 110 μM.

[0017] According to another feature of the present invention, the liver damage may be liver damage caused by aging.

[0018] According to another feature of the present invention, the filvertone may reduce the expression of p53 protein.

[0019] According to another feature of the present invention, the filverton may inhibit the p53-p21 signaling pathway.

[0020] In order to solve the problem described above, a health functional food composition for preventing or improving liver damage is provided, comprising Filbertone as an active ingredient according to another embodiment of the present invention.

[0021] According to a feature of the present invention, the filvertone may be represented by Chemical Formula 1.

[0022] [Chemical Formula 1]

[0023]

[0024] According to another feature of the present invention, the filvertone may maintain or improve reduced liver function due to aging.

[0025] To solve the problem described above, a method for preventing or treating liver damage is provided, comprising the step of administering a pharmaceutical composition containing Filbertone as an active ingredient according to another embodiment of the present invention to an individual other than a human.

[0026] According to the features of the present invention, the liver damage may be liver damage caused by aging. Effects of the invention

[0027] The filvertone according to the present invention can effectively prevent and treat liver damage caused by aging by reducing the expression of p53 protein and inhibiting the p53-p21 signaling pathway, which is closely associated with the senescence signaling process. Therefore, it can be usefully utilized as an active ingredient in pharmaceutical compositions and health functional food compositions for the prevention, improvement, or treatment of liver damage.

[0028] The effects according to the present invention are not limited to those exemplified above, and various other effects are included in this specification. Brief explanation of the drawing

[0029] Figure 1 illustrates the results of an evaluation of cytotoxicity following Filverton treatment in AML12 cells according to one embodiment of the present invention. Figure 2 shows the results of measuring the p53 protein expression level according to the doxorubicin treatment concentration and time in AML12 cells according to one embodiment of the present invention. Figure 3 illustrates the results of measuring the p53 protein expression level according to the H2O2 treatment time of AML12 cells according to one embodiment of the present invention. Figure 4 illustrates the results of senescence-associated β staining and the measurement of the number of senescent cells following Filbertone treatment in senescent cells generated from AML12 cells according to one embodiment of the present invention. Figure 5 shows the results of measuring the protein expression level of p53 in AML12 cells induced with aging by Filbertone treatment according to one embodiment of the present invention. Figure 6 shows the results of measuring the protein expression level of p53 in senescent cells generated from AML12 cells following Filbertone treatment according to one embodiment of the present invention. Figure 7 shows the results of measuring the mRNA expression level of p53 in senescent cells generated from AML12 cells following Filbertone treatment according to one embodiment of the present invention. Figure 8 shows the results of measuring the mRNA expression level of p21 in senescent cells generated from AML12 cells following Filbertone treatment according to one embodiment of the present invention. Specific details for implementing the invention

[0030] The advantages and features of the present invention and the methods for achieving them will become clear by referring to the embodiments described below in detail together with the accompanying drawings. However, the present invention is not limited to the embodiments disclosed below but may be implemented in various different forms. These embodiments are provided merely to ensure that the disclosure of the present invention is complete and to fully inform those skilled in the art of the scope of the invention, and the present invention is defined only by the scope of the claims.

[0031] For clarity of explanation, the terms used within this specification have been explained below.

[0032] In this document, expressions such as "have," "can have," "include," or "can include" refer to the existence of the relevant feature (e.g., numerical values, functions, actions, or components, etc.) and do not exclude the existence of additional features.

[0033] In this document, "or" means "and / or" unless otherwise noted. Expressions such as "A or B," "at least one of A or / and B," or "one or more of A or / and B" may include all possible combinations of items listed together. For example, "A or B," "at least one of A and B," or "at least one of A or B" may refer to cases including (1) at least one A, (2) at least one B, or (3) both at least one A and at least one B.

[0034] The term "Filbertone" as used in this invention refers to a ketone-based compound known as a major flavor component of hazelnut, and its molecular formula is C8H 14 It is O, and the IUPAC name is ( E ,5 S It is )-5-methylhept-2-en-4-one, has synonyms such as 5-Methyl-2-hepten-4-one and Hazelnut ketone, and has a molecular weight of 126.20 g / mol.

[0035] The term “liver damage due to aging” used in the present invention refers to the phenomenon in which the structure and function of the liver gradually deteriorate with age, and preferably refers to the accumulation of senescent cells within liver tissue. As aging progresses, a decline in liver function, a decrease in liver size and blood flow, the induction of inflammatory responses and fibrosis, a decline in the metabolic function of liver cells, and a decrease in the regenerative capacity of liver cells may occur, and these changes may have a negative effect on the overall health and function of the liver and may increase the risk of liver disease.

[0036] The term "health functional food" as used in this invention is synonymous with "food for special health use (FosHU)," and refers to a food with high medical or therapeutic effects that is processed to efficiently exhibit bio-regulatory functions in addition to nutritional supply. Here, "function" refers to obtaining useful effects for health purposes, such as regulating nutrients or physiological actions regarding the structure and function of the human body. The health functional food of this invention can be manufactured by methods commonly used in the industry, and during such manufacturing, raw materials and ingredients commonly added in the industry may be added. Furthermore, the formulation of the health functional food can be manufactured without restriction as long as it is a formulation recognized as a food. The health functional food of this invention can be manufactured in various forms of formulations. Unlike general pharmaceuticals, it uses food as a raw material, offering the advantage of not causing side effects that may occur with long-term use of pharmaceuticals. Additionally, due to its excellent portability, the health functional food of this invention can be consumed as an adjuvant to enhance the effect of improving liver function.

[0037] The aforementioned health functional food refers to a food that possesses active effects of maintaining or promoting health compared to general food, and health supplement food refers to a food intended for the purpose of supporting health. In some cases, the terms health functional food, health food, and health supplement food are used interchangeably.

[0039] In one aspect, the present invention relates to a pharmaceutical composition for the prevention or treatment of liver damage comprising filbertone or a pharmaceutically acceptable salt thereof as an active ingredient.

[0040] In one embodiment of the present invention, the filvertone may be represented by Chemical Formula 1, but is not limited thereto.

[0041]

[0042] In one embodiment of the present invention, the filvertone or a pharmaceutically acceptable salt thereof may be included at a concentration of 15 to 110 μM, preferably at a concentration of 90 to 110 μM, but is not limited thereto.

[0043] In one embodiment of the present invention, the liver damage may be liver damage caused by aging, but is not limited thereto.

[0044] In one embodiment of the present invention, the aging may be aging caused by oxidative stress, but is not limited thereto.

[0045] In one embodiment of the present invention, the oxidative stress may be induced by doxorubicin or hydrogen peroxide, but is not limited thereto.

[0046] In one embodiment of the present invention, the filvertone may reduce the expression of p53 protein, but is not limited thereto.

[0047] In one embodiment of the present invention, the filverton may inhibit the p53-p21 signal transmission path, but is not limited thereto.

[0048] The filvertone of the present invention may be used in the form of a pharmaceutically acceptable salt, and an acid addition salt formed by a pharmaceutically acceptable free acid is useful as the salt. The term "pharmaceutically acceptable salt" refers to any organic or inorganic addition salt of a filvertone base compound at a concentration that has a relatively non-toxic and harmless active effect on the patient, such that side effects caused by this salt do not impair the beneficial efficacy of the filvertone base compound. These salts may use inorganic and organic acids as free acids; as inorganic acids, hydrochloric acid, bromic acid, nitric acid, sulfuric acid, perchloric acid, phosphoric acid, etc. may be used, and as organic acids, citric acid, acetic acid, lactic acid, maleic acid, fumaric acid, gluconic acid, methanesulfonic acid, glyconic acid, succinic acid, tartaric acid, galacturonic acid, emvonic acid, glutamic acid, aspartic acid, oxalic acid, (D) or (L) malic acid, maleic acid, methanesulfonic acid, ethanesulfonic acid, 4-toluenesulfonic acid, salicylic acid, citric acid, benzoic acid, or malonic acid, etc. In addition, these salts include alkali metal salts (sodium salts, potassium salts, etc.) and alkaline earth metal salts (calcium salts, magnesium salts, etc.).For example, acid addition salts include acetate, aspartate, benzate, besylate, bicarbonate / carbonate, bisulfate / sulfate, borate, camsylate, citrate, edicilate, esylate, formate, fumarate, gluteptate, gluconate, glucuronate, hexafluorophosphate, hyperbenzate, hydrochloride / chloride, hydrobromide / bromide, hydroiodide / iodide, isethionate, lactate, malate, maliate, malonate, mesylate, methyl sulfate, naphthylate, 2-naphthylate, nicotinate, nitrate, orotate, oxalate, palmitate, pamoate, phosphate / hydrogen phosphate / dihydrogen phosphate, saccharate, stearate, succinate, tartrate, The following may be included: tosylate, trifluoroacetate, aluminum, arginine, benzathine, calcium, choline, diethylamine, diolamine, glycine, lysine, magnesium, meglumine, olamine, potassium, sodium, tromethamine, zinc salt, etc., among which hydrochloride or trifluoroacetate is preferred.

[0049] The acid addition salt according to the present invention can be prepared by conventional methods, for example, by dissolving filvertone in an organic solvent, for example, methanol, ethanol, acetone, methylene chloride, acetonitrile, etc., adding an organic acid or an inorganic acid, and filtering and drying the resulting precipitate, or by drying the solvent and excess acid after vacuum distillation or crystallizing under an organic solvent.

[0050] In addition, pharmaceutically acceptable metal salts can be produced using a base. Alkali metal or alkaline earth metal salts are obtained, for example, by dissolving a compound in an excess amount of alkali metal hydroxide or alkaline earth metal hydroxide solution, filtering the undissolved compound salt, and evaporating and drying the filtrate. At this time, it is pharmaceutically suitable to produce sodium, potassium, or calcium salts as metal salts. In addition, the corresponding silver salt is obtained by reacting the alkali metal or alkaline earth metal salt with a suitable silver salt (e.g., silver nitrate).

[0051] Furthermore, the present invention includes not only filvertone and its pharmaceutically acceptable salts, but also all possible solvates, hydrates, isomers, optical isomers, etc. that can be prepared therefrom.

[0052] The term "prevention" above refers to any act that reduces the frequency or severity of pathological phenomena. Prevention may be complete or partial. In this case, it may refer to a phenomenon in which liver damage within the individual is reduced compared to the case where the composition is not used.

[0053] The above "treatment" refers to any act of clinical intervention intended to alter the natural processes of the target or cell to be treated, and may be performed during the progression of a clinical pathological condition or to prevent it. The intended therapeutic effects may include preventing the onset or recurrence of the disease, alleviating symptoms, reducing all direct or indirect pathological consequences associated with the disease, preventing metastasis, slowing the rate of disease progression, alleviating or temporarily resolving the disease state, or improving the prognosis.

[0054] The pharmaceutical composition of the present invention is administered in a pharmaceutically effective amount. As used in the present invention, the term "pharmaceuticalally effective amount" refers to an amount sufficient to treat a disease with a reasonable benefit / risk ratio applicable to medical treatment and that does not cause adverse effects. The effective dose level may be determined based on factors including the patient's health status, type and severity of the disease, drug activity, sensitivity to the drug, method of administration, time of administration, route of administration and elimination rate, duration of treatment, drugs used in combination or concurrently, and other factors well known in the medical field. The composition of the present invention may be administered as an individual therapeutic agent or in combination with other therapeutic agents, may be administered sequentially or simultaneously with conventional therapeutic agents, and may be administered as a single or multiple doses. Considering all of the above factors, it is important to administer an amount that obtains maximum effect with a minimum amount without adverse effects, and this can be easily determined by a person skilled in the art.

[0055] In the present invention, the term "individual" refers to an individual intended for the prevention or treatment of liver damage, and is not particularly limited to animals including humans, e.g., non-primates (e.g., cattle, pigs, horses, cats, dogs, rats, and mice) and mammals including primates (e.g., monkeys, e.g., cynomolgous monkeys and chimpanzees). In some cases, it may be an individual excluding humans.

[0056] A composition according to the present invention may comprise, alone, a pharmaceutically effective amount of filvertone or a pharmaceutically acceptable salt thereof, or one or more pharmaceutically acceptable carriers, excipients, or diluents. Where above, "pharmaceutically effective amount" means an amount sufficient to prevent, improve, and treat liver damage. Where above, "pharmaceutically acceptable" means a composition that is physiologically acceptable and, when administered to humans, does not typically cause allergic reactions or similar reactions such as gastrointestinal disturbances or dizziness.

[0057] Additionally, a composition comprising a pharmaceutically acceptable carrier may be one or more formulations selected from the group comprising oral formulations, topical preparations, suppositories, sterile injectable solutions, and sprays, such as various formulations including capsules, liquids, injections, soft capsules, granules, or tablets. When formulated, it may be prepared using diluents or excipients such as commonly used fillers, extenders, binders, wetting agents, disintegrants, and surfactants. The above carrier, excipient, and diluent may be one or more selected from the group consisting of lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinylpyrrolidone, physiological saline, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil, dextrin, calcium carbonate, propylene glycol and liquid paraffin, but are not limited thereto, and any conventional carrier, excipient, or diluent may be used. The above components may be added independently or in combination to the active ingredient filvertone or a pharmaceutically acceptable salt thereof.

[0058] In addition, the pharmaceutical composition of the present invention may have any one formulation selected from the group consisting of tablets, pills, powders, granules, capsules, suspensions, liquid formulations, emulsions, syrups, sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized formulations, and suppositories. Witepsol, macrogol, Tween 61, cacao oil, laurin oil, glycerol, gelatin, etc. may be used as the base for suppositories.

[0059] The filvertone of the present invention or a pharmaceutically acceptable salt thereof may be administered in various oral and parenteral formulations during clinical administration, and when formulated, it is prepared using diluents or excipients such as commonly used fillers, extenders, binders, wetting agents, disintegrants, and surfactants.

[0060] Solid dosage forms for oral administration include tablets, pills, powders, granules, capsules, troches, etc., and these solid dosage forms are prepared by mixing at least one excipient, such as starch, calcium carbonate, sucrose, lactose, or gelatin, with one or more of the filvertone of the present invention or a pharmaceutically acceptable salt thereof. In addition, lubricants such as magnesium stirate talc are also used in addition to simple excipients. Liquid dosage forms for oral administration include suspensions, liquid formulations, emulsions, or syrups, and may include various excipients, such as humectants, sweeteners, flavorings, and preservatives, in addition to commonly used simple diluents such as water and liquid paraffin.

[0061] Preparations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized preparations, suppositories, etc. As non-aqueous solvents and suspensions, propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate may be used. As bases for suppositories, witepsol, macrogol, tween 61, cocoa paste, laurin paste, glycerol, gelatin, etc. may be used.

[0062] The pharmaceutical composition of the present invention may be administered by any device capable of transferring filvertone or a pharmaceutically acceptable salt thereof to target cells. Preferred modes of administration and formulations include intravenous injections, subcutaneous injections, intradermal injections, intramuscular injections, drip injections, etc. The injection may be prepared using aqueous solvents such as physiological saline solution or Ringer's solution, vegetable oils, higher fatty acid esters (e.g., ethyl oleate), alcohols (e.g., ethanol, benzyl alcohol, propylene glycol, glycerin, etc.), non-aqueous solvents such as vegetable oils, higher fatty acid esters (e.g., ethyl oleate), and alcohols (e.g., ethanol, benzyl alcohol, propylene glycol, glycerin, etc.), and may include pharmaceutical carriers such as stabilizers to prevent deterioration (e.g., ascorbic acid, sodium bisulfite, sodium pyrosulfite, BHA, tocopherol, EDTA, etc.), emulsifiers, buffers for pH adjustment, and preservatives to inhibit microbial growth (e.g., phenylmercury nitrate, thimerosal, benzalkonium chloride, phenol, cresol, benzyl alcohol, etc.).

[0063] The pharmaceutical composition of the present invention may also be provided in the form of a topical formulation comprising filvertone or a pharmaceutically acceptable salt thereof as an active ingredient.

[0064] When the pharmaceutical composition of the present invention is used as a topical application for the skin, it may additionally contain adjuvants commonly used in the field of dermatology, such as fatty substances, organic solvents, solvents, thickeners and gelling agents, emollients, antioxidants, suspending agents, stabilizers, foaming agents, fragrances, surfactants, water, ionic emulsifiers, nonionic emulsifiers, fillers, metal ion chelating agents, chelating agents, preservatives, vitamins, blockers, humectants, essential oils, dyes, pigments, hydrophilic activators, lipophilic activators, or lipid vesicles, and any other ingredients commonly used in topical applications for the skin. Furthermore, said ingredients may be introduced in amounts commonly used in the field of dermatology. When the pharmaceutical composition of the present invention is provided as a topical application for the skin, it may be in the form of an ointment, patch, gel, cream, or spray, but is not limited thereto.

[0065] The pharmaceutical composition of the present invention may further include pharmaceutically acceptable additives, wherein the pharmaceutically acceptable additives may include starch, gelatinized starch, microcrystalline cellulose, lactose, povidone, colloidal silicon dioxide, calcium hydrogen phosphate, lactose, mannitol, malt syrup, gum arabic, pregelatinized starch, corn starch, powdered cellulose, hydroxypropyl cellulose, Opadry, sodium starch glycolate, carnauba wax, synthetic aluminum silicate, stearic acid, magnesium stearate, aluminum stearate, calcium stearate, sucrose, dextrose, sorbitol, and talc. The pharmaceutically acceptable additive according to the present invention is preferably included in an amount of 0.1 to 90 parts by weight with respect to the composition, but is not limited thereto.

[0066] The term "administration" as used in the present invention means providing a specific composition of the present invention to an individual by any appropriate method.

[0067] In addition, the effective dosage of the filvertone of the present invention or its pharmaceutically acceptable salt to the human body may vary depending on the patient's age, body weight, gender, form of administration, health condition, and degree of disease, and is generally about 0.001-100 mg / kg / day, preferably 0.01-35 mg / kg / day. Based on an adult patient weighing 70 kg, it is generally 0.07-7000 mg / day, preferably 0.7-2500 mg / day, and may be administered in divided doses once or several times a day at regular intervals according to the judgment of a doctor or pharmacist.

[0068] The pharmaceutical composition of the present invention may be used alone or in combination with methods using surgery, radiation therapy, hormone therapy, chemotherapy, or biological response modifiers.

[0070] In one aspect, the present invention relates to a health functional food composition for preventing or improving liver damage, comprising filbertone as an active ingredient.

[0071] In one embodiment of the present invention, the filvertone may be represented by Chemical Formula 1, but is not limited thereto.

[0072] [Chemical Formula 1]

[0073]

[0074] In one embodiment of the present invention, the filvertone may maintain or improve reduced liver function due to aging, but is not limited thereto.

[0075] The food composition of the present invention can be formulated into various forms, such as tablets, pills, granules, capsules, liquid preparations, and beverages, and added to food. There are no specific restrictions on the types of food. Examples of foods to which the filvertone of the present invention or its food-grade acceptable salt may be added include drinks, meat, sausages, bread, biscuits, rice cakes, chocolates, candies, snacks, confectionery, pizza, ramen, other noodles, chewing gum, dairy products including ice cream, various soups, beverages, alcoholic beverages, vitamin complexes, dairy products and dairy processed products, and include both health foods and health functional foods in the conventional sense.

[0076] A health food and health functional food composition containing filvertone or a food-grade acceptable salt thereof according to the present invention may be added directly to food or used together with other food or food ingredients, and may be used appropriately according to conventional methods. The amount of filvertone or a food-grade acceptable salt thereof may be appropriately determined according to the purpose of use (for prevention or improvement). Generally, the amount of the above composition in the health food and health functional food may be added in an amount of 0.1 to 90 parts by weight of the total weight of the food. However, in the case of long-term consumption for the purpose of maintaining health or regulating health, the above amount may be less than the above range, and the active ingredient may be used in an amount greater than the above range as there are no issues regarding safety.

[0077] The health food and health functional food compositions of the present invention have no special restrictions on other ingredients other than containing the filvertone of the present invention or a food-grade acceptable salt thereof as an essential ingredient in the indicated proportions, and may contain various flavoring agents or natural carbohydrates, etc., as additional ingredients, as in ordinary beverages. Examples of the natural carbohydrates described above are monosaccharides, e.g., glucose, fructose, etc.; disaccharides, e.g., maltose, sucrose, etc.; polysaccharides, e.g., dextrin, cyclodextrin, etc., and conventional sugars, and sugar alcohols such as xylitol, sorbitol, erythritol, etc. Natural flavoring agents other than those described above (taumatin, stevia extract (e.g., rebaudioside A, glycyrrhizin, etc.)) and synthetic flavoring agents (saccharin, aspartame, etc.) may be advantageously used. The ratio of the above natural carbohydrates is generally about 1 to 20 g, preferably about 5 to 12 g per 100g of the health functional food composition of the present invention.

[0078] In addition to the above, the health food and health functional food compositions of the present invention containing filvertone or a food-grade acceptable salt thereof may contain various nutritional supplements, vitamins, minerals (electrolytes), flavoring agents such as synthetic flavoring agents and natural flavoring agents, coloring agents and thickening agents (cheese, chocolate, etc.), pectic acid and its salts, alginic acid and its salts, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohol, carbonating agents used in carbonated beverages, etc. Furthermore, the health food and health functional food compositions of the present invention may contain fruit pulp for the production of natural fruit juices, fruit juice beverages, and vegetable beverages.

[0079] These ingredients may be used independently or in combination. Although the proportion of these additives is not that important, it is generally selected in the range of 0.1 to about 20 parts by weight per 100 parts by weight of a health food and health functional food composition containing the filbertone of the present invention or a food-acceptable salt thereof.

[0081] In one aspect, the present invention relates to a method for preventing or treating liver damage comprising the step of administering a pharmaceutical composition containing Filbertone as an active ingredient to an individual other than a human.

[0082] In one embodiment of the present invention, the liver damage may be liver damage caused by aging, but is not limited thereto.

[0083] In one embodiment of the present invention, the individual refers to a subject requiring a method for preventing, controlling, or treating liver damage, and may be used without limitation as a dog, monkey, cat, rodent, e.g., mouse, genetically modified mouse, etc. More specifically, it refers to mammals such as primates excluding humans, mice, rats, dogs, cats, horses, and cattle.

[0084] The pharmaceutical composition of the present invention may be administered in a therapeutically effective amount or a pharmaceutically effective amount.

[0085] In the present invention, the term "therapeutically effective amount" refers to a pharmaceutically acceptable amount of salt of a composition effective for preventing or treating a target disease, and the therapeutically effective amount of the composition of the present invention may vary depending on various factors, such as the method of administration, the target site, the patient's condition, etc. Therefore, when used in humans, the dosage should be determined as an appropriate amount by considering both safety and efficacy. It is also possible to estimate the amount used in humans from the effective amount determined through animal experiments. Such matters to be considered when determining the effective amount are described, for example, in Hardman and Limbird, eds., Goodman and Gilman's The Pharmacological Basis of Therapeutics, 10th ed. (2001), Pergamon Press; and EW Martin ed., Remington's Pharmaceutical Sciences, 18th ed. (1990), Mack Publishing Co.

[0086] In the present invention, the term “pharmacologically effective amount” refers to an amount sufficient to treat a disease with a reasonable benefit / risk ratio applicable to medical treatment and that does not cause side effects. The effective dose level may be determined based on factors including the patient’s health status, type and severity of the disease, drug activity, sensitivity to the drug, method of administration, time of administration, route of administration and elimination rate, duration of treatment, drugs used in combination or concurrently, and other factors well known in the medical field. The composition of the present invention may be administered as an individual therapeutic agent or in combination with other therapeutic agents, may be administered sequentially or simultaneously with conventional therapeutic agents, and may be administered as a single or multiple doses. Taking all of the above factors into consideration, it is important to administer an amount that obtains maximum effect with a minimum amount without side effects, and this can be easily determined by a person skilled in the art.

[0088] The following examples have been described in more detail. However, these examples are intended to illustrate one or more specific embodiments, and the scope of the present invention is not limited to these examples.

[0090] Example 1: Cytotoxicity of Filverton in AML12 Hepatocytes

[0091] Cytotoxicity was confirmed via an MTT assay after treatment with filvertone at concentrations of 25 μM, 50 μM, and 100 μM for 48 hours.

[0092] First, mouse hepatocytes AML12 were cultured in DMEM (WELGENE, LM001-05, Korea, Dulbecco's Modified Eagle Medium) containing 10% FBS (WELGENE, S101-07, Korea, Fetal Bovine serum) and 1% P / S (WELGENE, LS202-02, Korea, penicillin-streptomycin) in an incubator at 37°C under 5% CO2 conditions, and maintained by subculture every 3-5 days. When the cells had grown to 80-90%, the medium in the 100mm dish was suctioned out and washed twice with DPBS (WELGENE, LB001-02, Korea). After washing, 3 ml of Trypsin-EDTA (WELGENE, LS015-01, Korea, Trypsin-EDTA) was dispensed into the 100mm dish. After dispensing Trypsin-EDTA, cells attached to the bottom were separated by placing the sample in an incubator at 37°C with 5% CO2 for 5 minutes. Medium was added to the separated cells and placed in a 15ml tube, centrifuged at 1000 rpm for 3 minutes, and then the pellet was resuspended. Cells were counted using a spectrophotometer and then subcultured.

[0093] 0.4 × 10⁶ AML12 in a 48-well plate for cell culture 5Cells were seeded into wells and cultured for 24 hours. After 24 hours of culture, when the cells had grown to about 50%, Filverton (Sigma-Aldrich, W376108) at concentrations of 25 μM, 50 μM, and 100 μM was added and the mixture was incubated for 48 hours. After the 48-hour reaction was complete and the cells had grown to 100%, the MTT assay was performed. After the 48-hour reaction was complete, the medium was removed, and 250 μl of a 5 mg / ml MTT (Thermo SCIENTIFIC, L11939.03, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-tetrazolium bromide) solution was added to each well and incubated in a CO2 incubator for 1 hour. After removing the medium from the supernatant containing the MTT reagent, 200 μl of DMSO (SAMCHUN, 000D1137, Korea) was added to each well and placed in a twister for 15 minutes to dissolve the intracellular formazan generated during the reaction process. Subsequently, the absorbance was measured at 570 nm using a microplate reader (BioTeck).

[0094] As a result, as shown in Figure 1, no cytotoxicity was observed in AML12 cells following Filverton treatment, and cell viability in all treatment groups shown in the graph was similar to that of the experimental group. These results suggested that Filverton acts safely on AML12 cells, does not have a negative effect on cell viability, and acts selectively and safely on AML12 cells.

[0096] Example 2: Induction of aging in AML12 hepatocytes

[0097] 2-1. Doxorubicin

[0098] To determine the timing at which treatment with doxorubicin affects the expression of p53, an aging-related gene, in AML12 cells, the expression levels of p53 protein were investigated according to various concentrations and treatment times of doxorubicin.

[0099] 1.0 × 10⁶ AML12 cells in a 60 mm cell culture dish 6 Cells were seeded into wells and cultured for 24 hours. After 24 hours of culture, the cells were confirmed to have grown to approximately 50%-60%, and AML12 cells were treated with doxorubicin at concentrations of 1 μM and 2 μM for 6 and 24 hours to confirm the expression of p53 protein.

[0100] The expression and quantification of p53 protein were confirmed by the following method. After treatment, the AML12 cell plates were placed on ice and washed twice with 1X PBS (ELPIS BIOTECH, EBA-1105). 500 μl of RIPA buffer (0.5M Tris-HCl, pH 7.4, 1.5M NaCl, 2.5% deoxycholic acid, 10% NP-40, 10mM EDTA, protease inhibitor, phosphatase inhibitor, Thermo SCIENTIFIC, 89900) was dispensed, and the samples were collected and transferred to a new tube. Subsequently, proteins were extracted by pulverizing three times for 2 seconds each using a sonicator (SONICS, vibra cell). Albumin standard (2 mg / ml) was serially diluted to 2 mg / ml, 1 mg / ml, 0.5 mg / ml, 0.25 mg / ml, and 0.125 mg / ml. BCA protein reagent A (Thermo SCIENTIFIC, #23228) and BCA protein reagent B (Thermo SCIENTIFIC, #1859078) were mixed in a 50:1 ratio, and 200 μl of the mixture was added to each well of a 96-well plate. Albumin standard and protein samples were added to the dispensed BCA reagent for measurement. In this case, nothing other than the BCA reagent was added to the blank wells, and dH2O was added to the concentration of 0. After dispensing both the albumin standard and protein samples into each well, the plate was left for approximately 30 minutes until a color change from green to purple appeared. Subsequently, absorbance was measured at 562 nm using a microplate reader (BioTeck). The concentration of the samples was calculated using the amount of BCA standard protein (x-axis) and the measured absorbance (y-axis). Then, 4X sample buffer (0.5M Tris-HCl pH 6.8, 8% SDS (BIO-RAD, 161-0302), 0.A 1 μg / μl protein sample was prepared using 4% BPB, 40% glycerol, dH2O and dH2O. The heat block was set to 95°C, and the sample was heated for 10 minutes. 20 μg of protein was electrophoresed on a 10% SDS-PAGE gel at 50V for 20 minutes and at 100V for 100 minutes. Subsequently, it was transferred to a nitrocellulose membrane at 100V for 90 minutes. After the transfer was complete, a blocking process was performed for 1 hour using 5% skim milk containing 0.1% Tween20-TBS (Difco, 232100). The primary antibody was diluted in 0.1% Tween20-TBS and reacted at 4°C for at least 18 hours, and the secondary antibody with HRP binding was diluted at a ratio of 10,000:1 in 5% skim milk containing 0.1% Tween20-TBS (Difco, 232100) and reacted at room temperature for 1 hour. After the reaction, the samples were washed three times for 15 minutes each with 0.1% Tween-TBS. p53 expression was confirmed using a p53 antibody (Cell signaling, 2524S, 1:4000), and the protein amount was corrected using β (Proteintech, 1:10000). After reacting the ECL (WESTAR ANTARES, CYANAGEN) solution with a nitrocellulose membrane for about 1 minute, the amount of protein was analyzed using Western Blot & Chemi Imaging (Vilber, FUSION Solo S).

[0101] As a result, as shown in Figure 2a, p53 expression significantly increased when treated with 2 μM doxorubicin in the group treated with doxorubicin for 6 hours. In addition, p53 expression significantly increased when treated with 2 μM doxorubicin in the group treated with 24 hours. In particular, a higher expression level was observed when treated with 2 μM doxorubicin for 6 hours compared to when treated for 24 hours.

[0103] Next, the expression level of p53 was investigated when AML12 hepatocytes were treated with doxorubicin for 1, 2, 4, and 6 hours using the same method as above.

[0104] As a result, as shown in Figure 2b, the expression of p53 significantly increased in all experimental groups, but it was found that the expression of p53 increased significantly when treated with 2 μM doxorubicin for 6 hours.

[0105] Based on these results, AML12 hepatocytes treated with 2 μM doxorubicin for 6 hours were used as senescent cells.

[0107] 2-2. Hydrogen peroxide

[0108] To determine the point at which treatment with H2O2 affects the expression of p53, an aging-related gene, in AML12 cells, the expression level of p53 protein was investigated according to the time of treatment with H2O2.

[0109] 1.0 × 10⁶ AML12 cells in a 60 mm cell culture dish 6 Cells were seeded into wells and cultured for 24 hours. After 24 hours of culture, it was confirmed that the cells had grown to about 50%-60%, and oxidative stress was induced in AML12 cells by treating them with 750 mM H2O2 (Junsei, 23150-0350, Japan) for 15, 30, 45, and 60 minutes, after which the expression of p53 protein was confirmed. The expression and quantification of p53 protein were performed using the same method as described in Example 2-1 above.

[0110] As a result, as shown in Figures 3a and 3b, it was confirmed that the expression of p53 significantly increased in the group treated with 750 μM H2O2 for 1 hour.

[0112] Next, the expression level of p53 was investigated when AML12 hepatocytes were treated with 750 μM H2O2 for 1, 2, 4, and 6 hours using the same method as above.

[0113] As a result, as shown in Figures 3c and 3d, the expression level of p53 was found to be significantly increased in the group treated with 2, 4, and 6 hours of H2O2 750 μM for 1 hour compared to the groups treated with 2, 4, and 6 hours.

[0114] Based on these results, AML12 hepatocytes treated with 750 μM H2O2 for 1 hour were used as senescent cells.

[0116] Example 3: Effect of Filverton on the Aging of AML12 Cells

[0117] To confirm whether senescence occurred in senescent cells generated from AML12, senescence-associated β(β-gal) staining was performed.

[0118] Senescent cells were generated using Protocol to Generate Senescent Cells from the Mouse Hepatic Cell Line AML12 to Study Hepatic Aging (STAR ​​protocols, Cell Press).

[0119] Specifically, 1.0 × 10⁶ AML12 cells in a 100 mm cell culture dish 6 Cells were seeded into wells and cultured for 24 hours. After 24 hours of culture, once the cells had grown to approximately 50%–60%, oxidative stress was induced by treating with 1 mM H2O2 for 1 hour. The point at which 1 mM H2O2 was applied marks Day 1, the date when oxidative stress is introduced. Following the H2O2 treatment, a recovery period of 23 hours was observed. Subsequently, from Day 2 to Day 6, 750 μM H2O2 was applied for 1 hour at the same time each day, followed by a 23-hour recovery period. Day 7 marks the stop point for senescent cells. At this point, the cells were cultured to proceed with the intended experiment.

[0120] Senescence-associated β-Galactosidase staining was performed using the Senescence β-Galactosidase Staining Kit (Cell Signaling, #9860). In a 12-well plate, 4×10⁶ normal AML12 cells and senescent cells generated from AML12 were placed at the stop point. 5 Cells were seeded into wells and cultured for 48 hours. After 48 hours of culture, when the cells had grown to 100%, senescent cells were treated with 100 μM of Filverton (Sigma-Aldrich, W376108) and incubated for 24 hours. After the incubation was complete, the medium was aspirated from the plates and washed once with 1X PBS (ELPIS BIOTECH, EBA-1105). The 10X fixation solution (Cell Signaling, #11674) included in the kit was diluted to 1X and 500 μl was dispensed into aliquot. The cells were then fixed at room temperature for 10–15 minutes. After fixation, the cells were washed twice with 1X PBS (ELPIS BIOTECH, EBA-1105). 500 μl of β-staining solution (930 μl 1X staining solution #11675, 10 μl 100X solution A #11676, 10 μl 100X solution B #11677, 50 μl 20 mg / ml X-gal #11678 stock solution) was dispensed into aliquot. After dispensing the β-staining solution, the plates were sealed with Parafilm to prevent evaporation and incubated overnight in an incubator at 37°C under CO2 conditions. After overnight incubation, the degree of cell staining was checked under a microscope.

[0121] As a result, as shown in Fig. 4, the staining intensity that had deepened in senescent cells generated from AML12 was found to decrease similarly to that of normal AML12 cells when treated with Filverton (Fig. 4a). In addition, when comparing normal cells and senescent cells, it was confirmed that the number of senescent cells significantly increased, and when senescent cells were treated with Filverton, it was confirmed that the increased number of senescent cells significantly decreased (Fig. 4b).

[0122] Through this, it was confirmed that cell senescence is inhibited when filvertone is treated on senescent cells generated from AML12 cells.

[0124] Example 4: Effects of Filverton on p53 Protein Expression in Age-Induced AML12 Cells

[0125] To determine the effect of Filverton treatment on the expression of p53, an aging-related gene, in aging-induced AML12 cells, the expression level of p53 protein was investigated. After treating AML12 cells with Filverton at concentrations of 25 μM, 50 μM, and 100 μM for 24 hours, the expression level of p53 protein was determined by treating with doxorubicin 2 μM for 6 hours or hydrogen peroxide 750 μM for 1 hour using the same method as described in Example 2-1.

[0126] As a result, as shown in Fig. 5, it was confirmed that the expression of p53 was significantly reduced when filvertone was treated together with doxorubicin compared to the group treated only with doxorubicin (Fig. 5a). In addition, it was confirmed that the expression of p53 showed a tendency to significantly decrease when filvertone was treated together with hydrogen peroxide compared to the group treated only with hydrogen peroxide (Fig. 5b).

[0127] These results indicate that cell aging induced by doxorubicin and hydrogen peroxide was inhibited by treatment with filvertone.

[0129] Example 5: Effect of Filverton on p53 Protein Expression in Senescent Cells Generated from AML12 Cells

[0130] After preparing senescent cells from AML12 normal cells using the method described in Example 3, normal cells and senescent cells were treated with 100 μM of filvertone for 24 hours, and then the expression level of p53 protein was checked using the same method described in Example 2-1.

[0131] As a result, as shown in Figure 6, it was confirmed that aging of AML12 cells was induced, as p53 expression increased in the senescent cell control group compared to the normal cell control group. When treated with Filbertone, p53 expression decreased in both normal and senescent cells compared to the group not treated with Filbertone.

[0133] Example 6: Effect of Filverton on p53 gene expression in senescent cells generated from AML12 cells

[0134] To determine the effect of Filverton treatment on the expression of p53, an aging-related gene, in aging-induced AML12 cells, the expression level of the p53 gene was investigated. After treating AML12 cells with Filverton at concentrations of 25 μM, 50 μM, and 100 μM for 24 hours, the expression level of p53 mRNA was checked by treating with doxorubicin 2 μM for 6 hours or hydrogen peroxide 750 μM for 1 hour. Additionally, after preparing senescent cells from normal AML12 cells using the method described in Example 3, the normal cells and senescent cells were treated with Filverton at a concentration of 100 μM for 24 hours, and the expression level of p53 mRNA was checked.

[0135] RNA isolation and quantification were confirmed by the following method. Each well of the treated AML12 cell plate was washed twice with 1X PBS (ELPIS BIOTECH, EBA-1105) solution. 1,000 μl of TRIzol reagent (Takara Bio Inc, #9109) was added to each well to completely lyse the cell membrane. After transferring the completely lysed TRIzol reagent to a new tube, 200 μl of chloroform (Sigma-Aldrich, C2432) was added. The ratio of chloroform to TRIzol reagent was adjusted to 1:5. Subsequently, the sample was mixed using a vortexer 2–3 times at 30-second intervals. The mixed sample was placed on ice for 5 minutes (2–3 minutes) and then centrifuged at 12,000 rpm for 15 minutes in a 4°C centrifuge. After this process, layer separation was observed. After centrifugation, the separated RNA layer was transferred to a new tube. An equal amount of isopropanol (SAMCHUN, 000P2083) to the RNA was added and mixed, then left at -20°C for at least 18 hours. Subsequently, the sample was centrifuged in a 4°C centrifuge at 12,000 rpm for 20 minutes. Afterward, the supernatant was removed while carefully separating the settled precipitate. After removing the supernatant, 1 ml of 70% EtOH was added to wash the precipitate. Next, the sample was centrifuged in a 4°C centrifuge at 12,000 rpm for 5 minutes. Care was taken to completely remove the 70% EtOH, avoiding contact with the precipitate, and the sample was dried for 5–10 minutes to remove any remaining EtOH. After drying, 20–30 μl of RNA-free water (SolBio, WAT001) was added to the precipitate. The sample was completely dissolved in a heat block set to 58°C. RNA concentrations of the samples were measured sequentially using a Biochrom BioDrop μLITE Micro-volume Spectrophotometer.

[0136] After performing RNA isolation, cDNA was synthesized for Real-time PCR. For each sample, 2.5 μl of 10X MMLV buffer (Promega, Madison, #B201), 1.5 μl of 10 mM dNTP (Promega, Madison, U151B), 1 μl of Rnase inhibitor (Promega, Madison, #2313A), 2 μl of random primer (150 ng / μl, Promega, Madison, C118A), and 1 μl of MML V RT Enzyme (Promega, Madison, RT001S) were added. The RNA concentration was set to 2 μg, the total volume to 25 μl, and the remaining volume was adjusted with Rnase-free water (SolBio, WAT001). Subsequently, vortexing and spin-down steps were performed. cDNA was synthesized using a TaKaRa PCR Thermal Cycler Dice® through a process of 1 hour at 37℃, 10 min at 72℃, and then maintaining at 4℃.

[0137] Using the synthesized cDNA as a template strand, 11 μl of 2X Ex Taq (TaKaRa Bio Inc, #RR820A), 8 μl of Rnase-free water (SolBio, WAT001), and 2 μl of Rplp0, Trp53, and CDKN1A primers (Bionics, Korea) were added, followed by vortexing and spin-down to duplicate the DNA. Amplification was performed using a Real-time PCR instrument (Takara Bio Inc, Japan) through a process consisting of 1 cycle of 30 seconds at 95°C (Hold), 40 cycles of 5 seconds at 95°C / 10 seconds at 58°C / 20 seconds at 72°C (3-Step PCR), and 15 seconds at 95°C / 30 seconds at 60°C / 15 seconds at 95°C (Dissociation). Subsequently, the results were analyzed using Real-Time System TP800 software (Takara). The gene expression level of each sample was corrected to the expression level of Rplp0(36b4). The primers used for RT-PCR are shown in Table 1.

[0138] As a result, as shown in Fig. 7, the group treated with doxorubicin and filvertone did not affect the mRNA expression of p53 (Fig. 7a), and the group treated with hydrogen peroxide and filvertone also did not have a significant effect on the mRNA expression of p53 (Fig. 7b). In addition, when normal cells were senescent cells were produced and then treated with the same concentration of filvertone for 24 hours to check the mRNA expression of p53, it was found that cellular senescence did not have a significant effect on the mRNA expression of p53 (Fig. 7c). In other words, senescence of AML12 cells does not affect the mRNA expression of p53, and accordingly, it was confirmed that treatment with filvertone also did not have a significant effect on the mRNA expression of p53 in senescent-induced AML12 cells.

[0139] Through this, it was confirmed that while filvertone can reduce the amount of p53 protein in aged liver cells, it does not affect mRNA expression levels. These results suggest that filvertone is closely associated with the post-translational regulation of p53 protein and reduces its amount by promoting its degradation or decreasing its stability.

[0141] Gene species Forward Primer Sequence (5' to 3') Reverse Primer Sequence (5' to 3') Rplp0(36b4) Mouse GATGAGAGCCATGACGACCAGA TGTGTACCACACCACCCAGGA Trp53 Mouse CTCCGAAGACTGGATGACTG ACAGATCGTCCATGCAGTGAG

[0143] Example 7: Effect of Filverton on p21 gene expression in senescent cells generated from AML12 cells

[0144] The expression of p21 (Cdkn1a), an aging-related gene known to be regulated by p53, was investigated in AML12 cells induced by aging with Filverton treatment. After treating AML12 cells with Filverton at concentrations of 25 μM, 50 μM, and 100 μM for 24 hours, the expression levels of p21 mRNA were determined using the same method described in Example 6 by treating with doxorubicin 2 μM for 6 hours or hydrogen peroxide 750 μM for 1 hour. Additionally, senescent cells were prepared from normal AML12 cells using the method described in Example 3, and the expression levels of p21 (Cdkn1a) mRNA were determined after treating both normal and senescent cells with Filverton at a concentration of 100 μM for 24 hours. The primers used for RT-PCR are shown in Table 2.

[0145] As a result, as shown in Fig. 8, it was confirmed that p21 mRNA expression decreased when filvertone was treated together with the group treated only with doxorubicin (Fig. 8a). In addition, the group treated only with hydrogen peroxide also showed a tendency for p21 mRNA expression to decrease when filvertone was treated together with the group (Fig. 8b). Furthermore, when p21 expression was checked after treating senescent cells and normal cells prepared according to the Protocol to Generate Senescent Cells from the Mouse Hepatic Cell Line AML12 to Study Hepatic Aging (STAR ​​protocols) described in Example 3 with 100 μM of filvertone for 24 hours, it was confirmed that p21 mRNA expression was reduced by filvertone (Fig. 8c).

[0146] These results indicate that filvertone tends to inhibit aging by reducing the aging levels increased by doxorubicin and hydrogen peroxide, and inhibits the p53-p21 signaling pathway, which is closely associated with senescence signaling processes under aging-inducing conditions.

[0148] Gene species Forward Primer Sequence (5' to 3') Reverse Primer Sequence (5' to 3') Rplp0(36b4) Mouse GATGAGAGCCATGACGACCAGA TGTGTACCACACCACCCAGGA Cdkn1a Mouse TGTCTTGCACTCTGGTGTCTG CAATCTGCGCTTGGAGTGAT

[0150] Although embodiments of the present invention have been described in more detail with reference to the attached drawings, the present invention is not necessarily limited to these embodiments and may be modified in various ways within the scope of the technical spirit of the present invention. Accordingly, the embodiments disclosed in the present invention are intended to explain, not limit, the technical spirit of the present invention, and the scope of the technical spirit of the present invention is not limited by these embodiments. Therefore, the embodiments described above should be understood as illustrative in all respects and not restrictive. The scope of protection of the present invention shall be interpreted by the claims below, and all technical spirits within an equivalent scope shall be interpreted as being included within the scope of rights of the present invention.

Claims

Claim 1 A pharmaceutical composition for preventing or treating liver damage, comprising filbertone as an active ingredient. Claim 2 A pharmaceutical composition for the prevention or treatment of liver damage according to claim 1, wherein the filvertone is represented by Chemical Formula 1: [Chemical Formula 1] . Claim 3 A pharmaceutical composition for preventing or treating liver damage, wherein, in claim 1, the filvertone is included at a concentration of 15 to 110 μM. Claim 4 A pharmaceutical composition for preventing or treating liver damage, characterized in that, in claim 1, the liver damage is liver damage caused by aging. Claim 5 A pharmaceutical composition for preventing or treating liver damage, wherein, in claim 1, the filvertone reduces the expression of p53 protein. Claim 6 A pharmaceutical composition for preventing or treating liver damage, wherein, in claim 1, the filvertone inhibits the p53-p21 signaling pathway. Claim 7 A health functional food composition for preventing or improving liver damage, comprising Filbertone as an active ingredient. Claim 8 In claim 7, the above-mentioned filvertone is represented by Chemical Formula 1, a health functional food composition for the prevention or treatment of liver damage: [Chemical Formula 1] . Claim 9 In claim 7, the above-mentioned filvertone is a health functional food composition for preventing or improving liver damage, which maintains or improves reduced liver function due to aging. Claim 10 A method for preventing or treating liver damage, comprising the step of administering the pharmaceutical composition of claim 1 to an individual other than a human. Claim 11 A method for preventing or treating liver damage, characterized in that, in claim 10, the liver damage is liver damage caused by aging.

Images