Biomarker composition for diagnosing muscle-aging related diseases comprising DDX54 protein or gene encoding the same as an active ingredient

Abstract

The present invention has confirmed that DDX54 (DEAD-Box Helicase 54) expression increases as cellular aging progresses in muscle cells, that muscle cell aging is promoted in a DDX54 overexpression model, and that muscle cell aging is inhibited in a DDX54 knockout model, thereby confirming that DDX54 or its inhibitors can be utilized for the diagnosis, prevention, treatment, or improvement of muscle aging-related diseases or for screening as therapeutic agents for said diseases.

Description

Technology Field

[0001] The present invention relates to a biomarker composition for diagnosing muscle aging-related diseases comprising the DX54 (DEAD-Box Helicase 54) protein or a gene encoding it as an active ingredient. Background Technology

[0002] Aging is a chronic process involving the occurrence of various physical and biochemical alterations affecting the structure and function of high-density lipoprotein (HDL), accompanied by increased circulation of pro-inflammatory cytokines, acute phase reactants, and C-reactive protein (CRP), and causing changes in hair, skin, eyes, bones, and the brain, as well as a decline in motor skills and energy metabolism.

[0003] Meanwhile, muscle is an important component of the human body and is a tissue derived from mesenchymal stem cells. Muscles account for about 40% of our body weight; they are supported by bones and tendons and consist of bundles of muscle fibers that move with one another and change cell size to induce contraction. As muscle cells age, a decline in motor skills may occur, along with various muscle diseases such as muscular atrophy, muscular dystrophy, sarcopenia, myopathy, and myasthenia.

[0004] The elderly population is continuously increasing worldwide, and it is predicted that by 2050, the population aged 65 and older in Europe and North America will reach 25%, and the global total will reach 2 billion. Korea is the country with the fastest aging rate in the world, and according to 2019 resident registration statistics, the population aged 65 and older has exceeded 8 million. As such, in line with the recent trends of an aging society and increased life expectancy, the number of patients with age-related muscle aging diseases is expected to rise, and the demand for treatments for these diseases is also projected to increase. Accordingly, research for the development of diagnostic agents and treatments for muscle aging-related diseases is currently actively underway. Prior art literature

[0005] 1. Republic of Korea Published Patent KR 10-2023-0140392 (Published Oct. 06, 2023) The problem to be solved

[0006] The objective of the present invention is to provide a biomarker composition for diagnosing muscle aging-related diseases comprising the DDX54 (DEAD-Box Helicase 54) protein or the gene encoding it as an active ingredient.

[0007] Another objective of the present invention is to provide a composition for diagnosing muscle aging-related diseases comprising, as an active ingredient, a preparation capable of confirming the expression level of said protein or the gene encoding it.

[0008] Another objective of the present invention is to provide a diagnostic kit for muscle aging-related diseases comprising the above-mentioned diagnostic composition as an active ingredient.

[0009] Another objective of the present invention is to provide a composition for preventing, treating, or improving muscle aging-related diseases comprising an inhibitor of the protein or the gene encoding it as an active ingredient.

[0010] Another objective of the present invention is to provide a screening method for a therapeutic agent for muscle aging-related diseases using the said protein or the gene encoding it. means of solving the problem

[0011] To achieve the above objective, the present invention provides a biomarker composition for diagnosing muscle aging-related diseases comprising DDX54 (DEAD-Box Helicase 54) protein or a gene encoding it as an active ingredient.

[0012] In addition, the present invention provides a composition for diagnosing muscle aging-related diseases comprising, as an active ingredient, a preparation capable of confirming the expression level of the protein or the gene encoding it.

[0013] In addition, the present invention provides a diagnostic kit for muscle aging-related diseases comprising the above-mentioned diagnostic composition as an active ingredient.

[0014] In addition, the present invention provides a pharmaceutical composition for the prevention or treatment of muscle aging-related diseases comprising an inhibitor of the protein or the gene encoding it as an active ingredient.

[0015] In addition, the present invention provides a health functional food composition for preventing or improving muscle aging-related diseases, comprising an inhibitor of the protein or the gene encoding it as an active ingredient.

[0016] In addition, the present invention provides a screening method for a therapeutic agent for muscle aging-related diseases, comprising the steps of: treating a biological sample isolated from an individual with a candidate substance (step 1); confirming the expression level of the protein or the gene encoding it in the biological sample treated with the candidate substance (step 2); and comparing the expression level with the expression level of the protein or the gene encoding it in a biological sample not treated with the candidate substance (step 3). Effects of the invention

[0017] According to the present invention, it was confirmed that as cellular aging progresses in muscle cells, the expression of DDX54 (DEAD-Box Helicase 54) increases, muscle cell aging is promoted in a DDX54 overexpression model, and muscle cell aging is inhibited in a DDX54 knockout model, thereby confirming that the DDX54 or its inhibitor can be utilized for the diagnosis, prevention, treatment, or improvement of muscle aging-related diseases or for screening as a therapeutic agent for said disease. Brief explanation of the drawing

[0018] Figure 1 shows the results of analyzing differences in DDX54 expression according to the age of the cell or animal using a general cell model and an animal model. Figure 1A shows the results of analyzing DDX54 expression in an aging mouse muscle model, and Figure 1B shows the results of analyzing DDX54 expression in a human-derived spinal muscle model. Figure 2 shows the results of analyzing the differences in motor performance according to animal age and the correlation between grip strength and DDX54 expression using a general animal model. Figure 3 shows the results of analyzing the effect of DDX54 overexpression on cellular aging using a DDX54 overexpression cell model. **P<0.01. Figure 4 shows the results of analyzing the effects of DDX54 overexpression on inflammatory cytokine and aging-related gene expression using a DDX54 overexpression cell model. **P<0.01, ***P<0.001. Figure 5 shows the results of analyzing the effect of DDX54 expression inhibition on cellular aging using a DDX54 expression inhibition cell model. ***P<0.001. Figure 6 shows the results of analyzing the effect of DDX54 expression inhibition on gene expression of the SASP (Senescence-associated secretory phenotype) mechanism using a cell model with DDX54 expression inhibition. *P<0.05, **P<0.01. Figure 7 shows the results of analyzing the effect of DDX54 overexpression on exercise performance using a DDX54 overexpression animal model. **P<0.01, ***P<0.001. Figure 8 shows the results of analyzing the effect of DX54 overexpression on muscle mass using a DDX54 overexpression animal model. *P<0.05, ***P<0.001. Figure 9 shows the results of the analysis of the effect of DDX54 overexpression on muscle area. **P<0.01. Figure 10 shows the results of analyzing the effect of DDX54 expression inhibition (KO) on exercise performance using a DDX54 knockout (hereinafter referred to as KO) animal model. *P<0.05, **P<0.01. Figure 11 shows the results of analyzing the effect of DDX54 expression inhibition (KO) on lean body mass using a DDX54 knockout animal model. *P<0.05. Figure 12 shows the results of analyzing the effect of DDX54 expression inhibition (KO) on muscle mass using a DDX54 knockout animal model. **P<0.01, ***P<0.001. Figure 13 shows the results of analyzing the effect of DDX54 expression inhibition (KO) on muscle area using a DDX54 knockout animal model. Specific details for implementing the invention

[0019] The present invention will be described in more detail below.

[0021] The present invention provides a biomarker composition for diagnosing muscle aging-related diseases comprising DDX54 (DEAD-Box Helicase 54) protein or a gene encoding it as an active ingredient.

[0022] The above protein or the gene encoding it may show increased expression in the patient group with muscle aging-related diseases compared to the normal group.

[0023] In addition, the above protein or the gene encoding it can promote muscle aging.

[0024] In addition, the above protein or the gene encoding it is IL-1α (Interleukin-1 alpha), IL-1β (Interleukin-1 beta), IL-6 (Interleukin-6), p16 INK4α and p21 Cip1 One or more expressions selected from a group consisting of can be promoted, but are not limited thereto.

[0025] The above-mentioned muscle aging-related diseases may be one or more selected from the group consisting of muscular atrophy, muscular dystrophy, sarcopenia, myopathy, myasthenia, and muscular injury, but are not limited thereto.

[0026] In this specification, “diagnosis” refers to identifying the existence or characteristics of a pathological condition, and for the purposes of the present invention, means identifying a muscle aging-related disease, and includes determining the subject’s susceptibility to a muscle aging-related disease or at least one symptom thereof, and therametrics (e.g., monitoring the subject’s condition to provide information on therapeutic efficacy). It also includes a primary diagnosis of a clinical condition or a diagnosis of a relapsed disease.

[0027] In this specification, “biomarker” refers to an indicator capable of detecting changes within the body, and is a substance capable of confirming the normal or pathological state of a living organism or whether there are changes thereof. It may include organic biomolecules such as polypeptides, nucleic acids, lipids, glycolipids, glycoproteins, sugars (monosaccharides, disaccharides, oligosaccharides, etc.), and can be used to diagnose muscle aging-related diseases as in the present invention.

[0029] In addition, the present invention provides a composition for diagnosing muscle aging-related diseases comprising, as an active ingredient, a preparation capable of confirming the expression level of the DDX54 (DEAD-Box Helicase 54) protein or the gene encoding it.

[0030] The agent capable of confirming the above expression level may be an antibody, peptide, aptamer, or compound that specifically binds to the protein; or a primer or probe that specifically binds to the gene encoding the protein, but is not limited thereto.

[0031] In this specification, "primer" refers to a short nucleic acid sequence having a short free 3' hydroxyl group, capable of forming base pairs with a complementary template, and functioning as a starting point for template strand replication. The primer can initiate DNA synthesis in the presence of a reagent for a polymerization reaction (i.e., DNA polymerase or reverse transcriptase) and four different nucleotide triphosphates at an appropriate buffer solution and temperature. PCR conditions and the lengths of the sense and antisense primers can be appropriately selected according to techniques known in the art.

[0032] In this specification, "probe" refers to a fragment of several to hundreds of nucleotide sequences capable of specifically binding to a gene or miRNA, and is labeled so as to confirm the presence or absence and expression level of said gene. Appropriate probes and hybridization conditions may be appropriately selected according to techniques known in the art.

[0034] In addition, the present invention provides a kit for diagnosing muscle aging-related diseases comprising the above-mentioned composition for diagnosing muscle aging-related diseases as an active ingredient.

[0035] The above kit can be used to diagnose whether muscle aging-related diseases have developed by measuring the expression level of the DDX54 (DEAD-Box Helicase 54) protein or the gene encoding it in samples isolated from individuals suspected of having muscle aging-related diseases.

[0036] In addition, the kit may include not only a preparation for measuring the expression level of the protein or the gene encoding it, but also one or more other component compositions, solutions, or devices suitable for the analysis method.

[0037] For example, the kit according to the present invention may be a kit comprising genomic DNA derived from a sample to be analyzed for performing PCR, a primer set specific to the marker gene of the present invention, an appropriate amount of DNA polymerase, a dNTP mixture, a PCR buffer solution, and water. The PCR buffer solution may include KCl, Tris-HCl, and MgCl2. In addition, components necessary for performing electrophoresis to verify whether the PCR product has been amplified may be additionally included in the kit of the present invention.

[0038] In addition, the kit according to the present invention may be a kit containing essential elements necessary for performing RT-PCR. In addition to each primer pair specific to a marker gene, the RT-PCR kit may include a test tube or other suitable container, reaction buffer, deoxynucleotides (dNTPs), enzymes such as Taq-polymerase and reverse transcriptase, DNase, RNase inhibitors, DEPC-water, sterile water, etc. Additionally, it may include a primer pair specific to a gene used as a quantitative control.

[0040] In addition, the present invention provides a method for providing information for diagnosing muscle aging-related diseases, comprising the steps of: isolating a biological sample from an individual (step 1); and measuring the expression level of a DDX54 (DEAD-Box Helicase 54) protein or a gene encoding it in the biological sample (step 2).

[0041] The above biological samples may be one or more selected from the group consisting of tissue, cells, whole blood, blood, serum, saliva, sputum, cerebrospinal fluid, and urine, but are not limited thereto.

[0042] The method for measuring the protein expression level may be one or more selected from the group consisting of Western blot, ELISA (enzyme linked immunosorbent assay), radioimmunoassay (RIA), radioimmunodiffusion, Ouchterlony immunodiffusion, rocket immunoelectrophoresis, tissue immunostaining, immunoprecipitation assay, complement fixation assay, FACS, and protein chips, but is not limited thereto.

[0043] The method for measuring the gene expression level described above may be one or more selected from the group consisting of microarray, next-generation sequencing (NGS), polymerase chain reaction (PCR), reverse transcription PCR (RT-PCR), competitive RT-PCR, real-time RT-PCR, RNase protection assay (RPA), Northern blotting, and DNA chips, but is not limited thereto.

[0045] In addition, the present invention provides a pharmaceutical composition for the prevention or treatment of muscle aging-related diseases comprising an inhibitor of the DDX54 (DEAD-Box Helicase 54) protein or the gene encoding it as an active ingredient.

[0046] The inhibitors include FAS, Transforming Growth Factor Beta 2 (TGFB2), Growth Differentiation Factor 15 (GDF15), CXC motif chemokine receptor 2 (CXCR2), Interleukin-1 alpha (IL-1α), Interleukin-1 beta (IL-1β), CXC motif chemokine ligand 2 (CXCL2), Interleukin-6 (IL-6), and Timp1 (TIMP). Metallopeptidase Inhibitor 1), Cdkn1a (Cyclin Dependent Kinase Inhibitor 1A), Cdkn2a (Cyclin Dependent Kinase Inhibitor 2A), p16INK4α and p21 Cip1 One or more expressions selected from a group consisting of can be suppressed, but are not limited thereto.

[0047] The above inhibitor may be one or more selected from the group consisting of antibodies, miRNA, siRNA, shRNA, and antisense oligonucleotides that specifically bind to the protein or gene, but is not limited thereto.

[0048] The above siRNA was used in experiments with ON-TARGETplus Human DDX54(79039) siRNA-SMARTpool (L-017128-01-0010, Horizon Discovery)(https: / / horizondiscovery.com / en / gene-modulation / knockdown / sirna / products / on-targetplus-sirna-reagents?nodeid=entrezgene-79039&catalognumber=L-017128-01-0010).

[0049] The pharmaceutical composition of the present invention may be manufactured in a unit dose form or contained in a multi-dose container by formulation using a pharmaceutically acceptable carrier according to a method that can be easily carried out by a person skilled in the art to which the invention belongs.

[0050] The above-mentioned pharmaceutically acceptable carriers are those commonly used in formulations and include, but are not limited to, lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia gum, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methyl cellulose, methyl hydroxybenzoate, propyl hydroxybenzoate, talc, magnesium stearate, mineral oil, etc. In addition to the above components, the pharmaceutical composition of the present invention may further include lubricants, wetting agents, sweeteners, flavoring agents, emulsifiers, suspending agents, preservatives, etc.

[0051] In the present invention, the content of the additive included in the pharmaceutical composition is not particularly limited and can be appropriately adjusted within the content range used in conventional formulations.

[0052] The above pharmaceutical composition may be formulated in the form of one or more external skin preparations selected from the group consisting of injectable formulations such as aqueous solutions, suspensions, and emulsions, pills, capsules, granules, tablets, creams, gels, patches, sprays, ointments, warning agents, lotions, liniments, pastes, and cataplasms, but is not limited thereto.

[0053] The pharmaceutical composition of the present invention may further include pharmaceutically acceptable carriers and diluents for formulation. The pharmaceutically acceptable carriers and diluents include, but are not limited to, excipients such as starch, sugars, and mannitol; fillers and extenders such as calcium phosphate; cellulose derivatives such as carboxymethylcellulose and hydroxypropylcellulose; binders such as gelatin, alginates, and polyvinylpyrrolidone; lubricants such as talc, calcium stearate, hydrogenated castor oil, and polyethylene glycol; disintegrants such as povidone and crospovidone; and surfactants such as polysorbate, cetyl alcohol, and glycerol. The pharmaceutically acceptable carriers and diluents may be biologically and physiologically affinities for the target. Examples of diluents include, but are not limited to, saline solution, aqueous buffer solution, solvent, and / or dispersion media.

[0054] The pharmaceutical composition of the present invention may be administered orally or parenterally (e.g., intravenously, subcutaneously, intraperitoneally, or topically) depending on the intended method. In the case of oral administration, it may be formulated into tablets, troches, lozenges, water-soluble suspensions, oily suspensions, prepared powders, granules, emulsions, hard capsules, soft capsules, syrups, elixirs, etc. In the case of parenteral administration, it may be formulated into injectable solutions, suppositories, powders for respiratory inhalation, aerosols for sprays, ointments, powders for topical application, oils, creams, etc.

[0055] The dosage of the pharmaceutical composition of the present invention may vary depending on the patient's condition, weight, age, gender, health status, dietary constitutional specificity, properties of the formulation, degree of disease, time of administration of the composition, method of administration, duration or interval of administration, excretion rate, and form of the drug, and may be appropriately selected by a person skilled in the art. For example, it may be in the range of about 0.1 to 10,000 mg / kg, but is not limited thereto, and may be administered once or several times a day.

[0056] The above pharmaceutical composition may be administered orally or parenterally (e.g., intravenously, subcutaneously, intraperitoneally, or topically) depending on the intended method. The pharmaceutical effective amount and effective dosage of the pharmaceutical composition of the present invention may vary depending on the formulation method, method of administration, time of administration, route of administration, etc., and a person skilled in the art can easily determine and prescribe a dosage effective for the intended treatment. The pharmaceutical composition of the present invention may be administered once a day or divided into several doses.

[0058] In addition, the present invention provides a health functional food composition for preventing or improving muscle aging-related diseases, comprising an inhibitor of the DDX54 (DEAD-Box Helicase 54) protein or the gene encoding it as an active ingredient.

[0059] The present invention can be generally used as a commonly used food.

[0060] The food composition of the present invention may be used as a health functional food. The term “health functional food” refers to a food manufactured and processed using raw materials or ingredients having functional properties useful to the human body in accordance with the Health Functional Foods Act, and the term “functional properties” refers to consuming the food for the purpose of obtaining beneficial effects for health purposes, such as regulating nutrients or physiological actions on the structure and function of the human body.

[0061] The above-mentioned health functional food composition may include ordinary food additives, and unless otherwise specified, suitability as a “food additive” shall be determined in accordance with the specifications and standards for the relevant item, based on the general provisions and general test methods of the Food Additives Codex approved by the Ministry of Food and Drug Safety.

[0062] Examples of items listed in the above “Food Additives Codex” include chemically synthesized products such as ketones, glycine, potassium citrate, nicotinic acid, and cinnamon acid; natural additives such as persimmon dye, licorice extract, crystalline cellulose, sorghum dye, and guar gum; and mixed preparations such as L-sodium glutamate preparations, alkaline noodle additives, preservative preparations, and tar dye preparations.

[0063] The food composition of the present invention can be manufactured and processed in the form of tablets, capsules, powders, granules, liquids, pills, etc. For example, among health functional foods in capsule form, hard capsules can be manufactured by mixing and filling a conventional hard capsule with the composition according to the present invention and additives such as excipients, and soft capsules can be manufactured by mixing the composition according to the present invention with additives such as excipients and filling it into a capsule base such as gelatin. The soft capsule may contain plasticizers such as glycerin or sorbitol, coloring agents, preservatives, etc., as needed.

[0064] The definitions of terms regarding the above excipients, binders, disintegrants, lubricants, flavoring agents, etc., are those described in literature known in the art and include those with identical or similar functions. There are no special restrictions on the types of food mentioned above, and they include all health functional foods in the conventional sense.

[0065] In the present invention, the term “prevention” refers to any act of suppressing or delaying muscle aging-related diseases through the administration of a composition according to the present invention.

[0066] In the present invention, the term “treatment” refers to any act of improving or beneficially altering the symptoms of muscle aging-related diseases through the administration of a composition according to the present invention.

[0067] In this invention, the term “improvement” refers to any act of improving a poor condition of muscle aging-related diseases through the administration of a composition according to this invention.

[0069] In addition, the present invention provides a reagent composition for inhibiting muscle aging comprising an inhibitor of the DDX54 (DEAD-Box Helicase 54) protein or the gene encoding it as an active ingredient.

[0071] In addition, the present invention provides a reagent composition for promoting muscle aging comprising DDX54 (DEAD-Box Helicase 54) protein or a gene encoding it as an active ingredient.

[0073] In addition, the present invention provides a screening method for a therapeutic agent for muscle aging-related diseases, comprising the steps of: treating a biological sample isolated from an individual with a candidate substance (step 1); confirming the expression level of the DDX54 (DEAD-Box Helicase 54) protein or the gene encoding it in the biological sample treated with the candidate substance (step 2); and comparing the expression level with the expression level of the DDX54 protein or the gene encoding it in a biological sample not treated with the candidate substance (step 3).

[0074] The above screening method may determine that the candidate substance is a treatment for muscle aging-related diseases if the expression of the protein or the gene encoding it is reduced in a biological sample treated with the candidate substance compared to a biological sample not treated with the candidate substance.

[0076] Hereinafter, the present invention will be described in detail with reference to examples to aid in understanding. However, the following examples are merely illustrative of the content of the present invention and the scope of the present invention is not limited to the following examples. The examples of the present invention are provided to more completely explain the present invention to those with average knowledge in the art.

[0078] [ Experimental Example 1] Analysis using a general cell model

[0079] 1-1. Spinal Muscle Distribution

[0080] In accordance with IRB approval (CUH 2022-07-007-001), spinal muscle (muscle cells derived therefrom) and blood were collected from the normal group (25–40 years old) and sarcopenia group (65–80 years old), regardless of gender, at Jeonbuk National University Hospital and used for analysis. At this time, sample specimens from patients excluding those with blood-borne diseases and blood cancers were imported due to patient characteristics.

[0082] 1-2. DDX54 Expression analysis

[0083] Western blot analysis was performed using the above cells (Experimental Example 1-1) to confirm differences in DDX54 expression according to cell age. Cells were lysed using RIPA buffer, and proteins were quantified using a BCA protein assay kit. Subsequently, proteins were separated by molecular weight using an SDS-PAGE gel, and the separated proteins were blotted onto a PVDF membrane. Then, the membrane was blocked with 5% skim milk, and the primary antibody was added and reacted overnight at 4°C. Afterward, the membrane was washed three times, the secondary antibody was added and reacted for one hour, and then DDX54 protein expression was measured using an ECL solution.

[0084] As a result, as shown in Figure 1B, DDX54 expression was significantly increased in aged HSMM compared to young HSMM.

[0086] [ Experimental Example 2] Analysis using a general animal model

[0087] 2-1. Preparation of Animal Models

[0088] Animal experiments were conducted under the approval of the Korea Food Research Institute (Approval No.: KFRI-M-22042). Aged mice were prepared using 5-week-old C57BL / 6 mice (Orient Bio Inc, Korea). Mice were reared for 5 months (young mice) or 21 months (aged mice) under a 12-hour day-night cycle at 21–23°C.

[0090] 2-2. DDX54 Expression analysis

[0091] Western blot analysis was performed using the above animal model (Experimental Example 2-1) to confirm differences in DDX54 expression according to animal age. Muscle tissue isolated from the above animal model was lysed using RIPA buffer, and the protein was quantified using a BCA protein assay kit. Subsequently, proteins were separated by molecular weight using an SDS-PAGE gel, and the separated proteins were blotted onto a PVDF membrane. Then, the membrane was blocked with 5% skim milk, and the primary antibody was added and reacted overnight at 4°C. Afterward, the membrane was washed three times, the secondary antibody was added and reacted for one hour, and then DDX54 protein expression was measured using an ECL solution.

[0092] As a result, as shown in Figure 1A, DDX54 expression was significantly increased in aged mice compared to young mice.

[0094] 2-3. Analysis of Exercise Performance

[0095] Using the above animal model (Experimental Example 2-1), grip strength was measured using a grip strength meter (Bioseb, Chaville) to confirm differences in motor performance according to animal age. Specifically, grip strength was measured by determining the grip strength when the mouse grasped the grip with its forelimbs (performed 5 times), verifying the average value, and then adjusting it for the mouse's body weight. In addition, the correlation between grip strength and DDX54 expression was analyzed using the GraphPed Prism program.

[0096] As a result, as shown in Figure 2, grip strength was significantly reduced and DDX54 expression was significantly increased in aged mice compared to young mice. In addition, correlation analysis of grip strength and DDX54 expression confirmed that grip strength and DDX54 expression have an inverse relationship.

[0098] [ Experimental Example 3] DDX54 Analysis using an overexpression cell model

[0099] 3-1. DDX54 Production of an overexpression cell model

[0100] To construct a DDX54 overexpression cell model, pBABE-DDX54 was inoculated into Platimum-A Retrovial Packaging Cell Line (RV-101, Cell Biolabs, USA) using X-tremeGENE9 DNA Transfection Reagent (Roche, Basel, Switzerland) and cultured for 24 hours. Subsequently, the cell medium was filtered through a 0.2 μm filter in a 50 mL tube, treated with 10 μg / mL of polybrene, and then treated with the medium in HSMM (Lonza, Cat No.: CC-2580) at 3-hour intervals for 12 hours. Afterward, the medium was replaced, and the cells were cultured for an additional 48 hours. Subsequently, 1 μg / mL of puromycin was mixed into the medium and replaced to specifically and selectively obtain only pBABE-DDX54 cells.

[0102] 3-2. Analysis of Cellular Aging

[0103] Using the above cell model (3-1), staining was performed for SA-β-gal (senescence associated-beta galatosidase), known as a cell aging marker, to confirm the effect of DDX54 overexpression on cell aging.

[0104] As a result, as shown in Figure 3, the blue precipitate in DDX54 overexpressing cells and the number of β-gal positive cells (number of cells stained blue) relative to the total number of cells were significantly increased in DDX54 overexpressing cells compared to normal cells (control group; pBabe). From the above results, it was confirmed that promoting DDX54 expression promotes muscle cell aging.

[0106] 3-3. Analysis of Inflammatory Cytokines and Aging-Related Gene Expression

[0107] Using the cell model (3-1) above, qRT-PCR analysis was performed to determine the effect of DDX54 overexpression on inflammatory cytokines and aging-related gene expression. RNA was extracted from the cell model (3-1) using the RNeasy Mini Kit (74104, QIAGEN, Germany), and RNA concentration was measured using a nanodrop. Then, cDNA was prepared at a concentration of 500 ng / mL using the Synthesize cDNA for real-time Kit (ReverTra Ace™ qPCR RT Kit, FSQ-201, TOYOBO, Japan). Afterward, cDNA was synthesized, and PCR analysis was performed using the RT-PCR Master Mix (QPK-101, TOYOBO, Japan). The specific primer sequences of the genes whose expression was measured in the above analysis are as shown in Table 1 below. B2M (Beta-2 microglobulin) was used as a control.

[0108] As a result, as shown in Figure 4, the expression of inflammatory cytokines (IL-1α, IL-1β, and IL-6) increased in DDX54-overexpressing cells compared to normal cells (control; pBabe), and aging-related genes (p16 INK4 and p21 Cip1 ) expression significantly increased. From the above results, it was confirmed that promoting DDX54 expression promotes inflammation and muscle cell aging.

[0109] Homo sapiens nucleotide sequence (5' → 3') IL-1α Sense AGGGAGTCAACTCATTGGCG Anti-sense TGGCAGAACTGTAGTCTTCGT IL-1β Sense AGCTACGAATCTCCGACCAC Anti-sense CGTTATCCCATGTGTCGAAGAA IL-6 Sense TGGCTGCAGGACATGACAA Anti-sense TGAGGTGCCCATGCTACATTT p16 INK4α Sense GATGAGGACAATGAGGCAAAG Anti-sense TGGGAAGAAAAGCAAGACAAC p21 Cip1 Sense TGGAGACTCTCAGGGTCGAAA Anti-sense GGCGTTTGGAGTGGTAGAAATC B2M Sense CACTGAATTCACCCCCACTGA Anti-sense GCTTACATGTCTCGATCCCAC

[0111] [ Experimental Example 4] DDX54 Analysis using a cell model of expression inhibition

[0112] 4-1. DDX54 Production of a cell model for expression inhibition

[0113] To construct a cell model of DDX54 expression inhibition, aged HSMM (PromoCell, Germany, Cat No: C-12530) was dispensed into a 6-well plate, and 24 hours later, Human DDX54 siRNA (ON-TARGETplus Human DDX54(79039) siRNA-SMARTpool https: / / horizondiscovery.com / en / gene-modulation / knockdown / sirna / products / on-targetplus-sirna-reagents?nodeid=entrezgene-79039&catalognumber=L-017128-01-0010, L-017128-01-0010, Horizon Discovery) was inserted into the cells using Lipofectamine RNAiMAX (ThermoFisher Scientific, USA). 48 hours after insertion, qRT-PCR analysis confirmed that DDX54 expression in the cells was significantly reduced, thereby obtaining a cell model with suppressed DDX54 expression. A cell model with a blank vector inserted instead of DDX54 siRNA was set as a control.

[0115] 4-2. Analysis of Cellular Aging

[0116] Using the cell model (4-1) above, staining for SA-β-gal (senescence associated-beta galatosidase), known as a cell aging marker, was performed to confirm the effect of DDX54 expression inhibition on cell aging. The staining was performed in the same manner as in Experimental Example 3-2.

[0117] As a result, as shown in Figure 5, the blue precipitate in cells with inhibited DDX54 expression compared to normal cells (control group; si-con); and the number of β-gal positive cells (number of cells stained blue) relative to the total number of cells were significantly reduced. From the above results, it was confirmed that inhibition of DDX54 expression inhibits muscle cell aging.

[0119] 4-3. SASP Mechanism of gene expression analysis

[0120] Using the cell model (4-1) above, qRT-PCR analysis was performed to confirm the effect of DDX54 expression inhibition on gene expression of the SASP (Senescence-associated secretory phenotype) mechanism. The qRT-PCR analysis was performed in the same manner as in Experimental Example 3-3 above. The specific primer sequences of the genes whose expression was measured in the analysis are as shown in Table 2 below.

[0121] As a result, as shown in Figure 6, the expression of SASP mechanism genes was significantly reduced in cells inhibiting DDX54 expression compared to normal cells (control group; si-con).

[0122] Homo sapiens Nucleotide sequence (5' → 3') FAS Sense ACAGCGGGGAATGGGTACT Anti-sense GACTGGTACAACGAGCGGAT TGFB2 Sense CCCCGGAGGTGATTTCCATC Anti-sense GGGCGGATGTCTATTTTGTAAA GDF15 Sense ACCTGCACCTGCGTATCTC Anti-sense CGGACGAAGATTCTGCCAG CXCR2 Sense CCTGTTTACTTTTCCGAAGGAC Anti-sense TTGCTGTATTGTTGCCCATG IL-1α Sense AGGGAGTCAACTCATTGGCG Anti-sense TGGCAGAACTGTAGTCTTCGT IL-1β Sense AGCTACGAATCTCCGACCAC Anti-sense CGTTATCCCATGTGTCGAAGAA CXCL2 Sense CCCAGACAGAAGTCATAGCCAC Anti-sense TGGTTCTTCCGTTGAGGGAC IL-6 Sense TGGCTGCAGGACATGACAA Anti-sense TGAGGTGCCCATGCTACATTT Timp1 Sense CACACCCAGAGCAGATACCATG Anti-sense GGGGAACCCATGAATTTAGCC Cdkn1a Sense GCAGATCCACAGCGATATCCA Anti-sense AACAGGTCGGACATCACCAG Cdkn2a Sense CCCAACGCCCCGAACT Anti-sense GCGAAGAGCTGCTACGTGAA p16INK4α Sense GATGAGGACAATGAGGCAAAG Anti-sense TGGGAAGAAAAGCAAGACAAC p21Cip1 Sense TGGAGACTCTCAGGGTCGAAA Anti-sense GGCGTTTGGAGTGGTAGAAATC B2M Sense CACTGAATTCACCCCCACTGA Anti-sense GCTTACATGTCTCGATCCCAC

[0124] [ Experimental Example 5] DDX54 Analysis using an overexpression animal model

[0125] 5-1. DDX54 Production of overexpression animal models

[0126] To construct a DDX54 overexpression animal model, 5-week-old C57BL / 6 mice (Experimental Example 2-1) were reared until 18 months of age, and then AAV_DDX54 was administered to the mice at a total dose of 1×10⁻¹⁰ at a total dose of 100 μL using the AAV1 (TaKaRa, Tokyo, Japan) vector. 14 A single intravenous injection of vg / kg was administered. An animal model in which an AAV (AAV_Con) with a blank vector inserted was intravenously injected instead of AAV_DDX54 was set as the control group. Experimental Examples 5-2, 5-3, and 5-4 were performed 8 weeks after intravenous injection.

[0128] 5-2. Analysis of Exercise Performance

[0129] Using the above animal model (Experimental Example 5-1), grip strength was measured using a grip strength meter (Bioseb, Chaville) and Rotarod was measured to determine the effect of DDX54 overexpression on exercise performance. Specifically, grip strength was measured in the same manner as in Experimental Example 2-3, and for Rotarod measurement, mice were made to practice for 5 minutes at a speed of 4 rpm for 2 days, and in this experiment, the speed was increased from 4 rpm to 20 rpm every minute to measure how far the mice could run.

[0130] As a result, as shown in Figure 7, grip strength and latency to fall values ​​were significantly reduced in the DDX54 overexpression animal model compared to the normal animal model (AAV Con). From the above results, it was confirmed that DDX54 overexpression reduces exercise performance.

[0132] 5-3. Muscle Mass Analysis

[0133] In order to determine the effect of DDX54 overexpression on muscle mass using the above animal model (Experimental Example 5-1), mice were dissected and muscle was obtained 8 weeks after AAV_DDX54 was intravenously injected into the mice in Experimental Example 5-1. Muscle weight was measured and the change in muscle mass was confirmed by adjusting for the weight of each mouse.

[0134] As a result, as shown in Figure 8, the muscle mass of the gastrocnemius muscle (Gas) and quadriceps muscle (Quad) was significantly reduced in the DDX54 overexpression animal model compared to the normal animal model (AAV-Con).

[0136] 5-4. Muscle Area Analysis

[0137] Using the above animal model (Experimental Example 5-1), laminin staining analysis was performed to determine the cross-sectional area (hereinafter referred to as CSA) of muscle fibers in order to confirm the effect of DDX54 overexpression on muscle area. The mouse gastrocnemius muscle was fixed at -20°C with OCT compound (Optimal Cutting Temperature Compound), sectioned to a thickness of 7 μm, and attached to a slide. Subsequently, the sectioned muscle tissue was fixed with 20% acetone, blocked with 10% FBS, and stained with Alexa fluor 488-conjugated laminin at 4°C for 16 hours. The stained tissue was washed with PBS, covered with a cover slide, and observed using a confocal microscope (laminin appears green in immunohistochemical staining).

[0138] As a result, as shown in Figure 9, CSA was significantly reduced in the DDX54 overexpression animal model compared to the normal animal model (AAV-Con).

[0140] [ Experimental Example 6] DDX54 Analysis using an animal model of expression inhibition

[0141] 6-1. DDX54 KO animal model production

[0142] To construct a DDX54 muscle-specific knockout (KO) animal model, mice (F1) were bred by crossing myf5-cre mice, which possess a muscle-specific promoter, with DDX54 cKO mice (Cyagen Biosciences, CA, USA). The resulting mice were raised for 4 weeks, and genotyping confirmed that the mice (F1) possessed two genotypes: DDX54 cKO mice and heterozygous DDX54×Myf5-cre mice. To proceed with 10 breeding cages, breeding was continued until 25 mice (F1) were obtained. In the second step, heterozygous DDX54×Myf5-cre mice were crossed with DDX54 cKO mice to obtain homozygous DDX54 loxp-Myf5-cre mice. Specifically, a total of four genotype types of mice were obtained by crossing the above heterozygous DDX54×Myf5-cre mouse and DDX54 cKO mouse as follows.

[0143] 1) Homozygous DDX54 loxp-Myf5 cre (hereinafter referred to as DDX-mKO)

[0144] 2) Heterozygous DDX54 loxp-Myf5 cre

[0145] 3) DDX54 loxp-WT (referred to as WT)

[0146] 4) WT

[0147] Among the above mice, DDX54 loxp-WT and homozygous DDX54 loxp-Myf5 cre mice (Ddx-mKO) were each naturally aged.

[0149] 6-2. Analysis of Motor Performance

[0150] Using the above animal model (Experimental Example 6-1), grip strength and Rotarod were measured using a grip strength meter (Bioseb, Chaville) to determine the effect of DDX54 expression inhibition (KO) on exercise performance. Specifically, grip strength was measured in the same manner as in Experimental Example 2-3, and Rotarod was measured in the same manner as in Experimental Example 5-2.

[0151] As a result, as shown in Figure 10, grip strength and latency to fall values ​​were significantly increased in DDX-mKO mice compared to WT mice.

[0153] 6-3. lean body mass analyze

[0154] Using the above animal model (Experimental Example 6-1), lean body mass was measured using an inalyzer to determine the effect of DDX54 expression inhibition (KO) on lean body mass.

[0155] As a result, as shown in Figure 11, lean body mass was significantly increased in DDX-mKO mice compared to WT mice. From the above results, it was confirmed that inhibition of DDX54 expression increases muscle mass.

[0157] 6-4. Muscle Mass Analysis

[0158] In order to determine the effect of DDX54 expression inhibition (KO) on muscle mass using the above animal model (Experimental Example 6-1), the WT mice and DDX-mKO mice were naturally aged for 21 months, and then the mice were dissected to obtain muscle. The muscle weight was measured, and the muscle mass was measured by correcting for the weight of each mouse.

[0159] As a result, as shown in Figure 12, the muscle mass of the gastrocnemius muscle (Gas), quadriceps muscle (Quad), and triceps muscle (Tri) was significantly increased in DDX-mKO mice compared to WT mice.

[0161] 6-5. Muscle Area Analysis

[0162] Using the above animal model (Experimental Example 6-1), to confirm the effect of DDX54 expression inhibition (KO) on muscle area, laminin staining analysis was performed to determine the cross-sectional area (CSA). The analysis was performed in the same manner as in Experimental Example 5-4.

[0163] As a result, as shown in Figure 13, CSA was significantly increased in DDX-mKO mice compared to WT mice.

[0165] Foregoing, specific parts of the present invention have been described in detail. It is evident to those skilled in the art that such specific descriptions are merely preferred embodiments and do not limit the scope of the invention. That is, the actual scope of the invention is defined by the appended claims and their equivalents.

Claims

Claim 1 A biomarker composition for diagnosing muscle aging-related diseases comprising DDX54 (DEAD-Box Helicase 54) protein or a gene encoding it as an active ingredient. Claim 2 A composition according to claim 1, characterized in that the expression of the protein or the gene encoding it increases in a patient group of muscle aging-related diseases compared to a normal group. Claim 3 A composition according to claim 1, characterized in that the protein or the gene encoding it promotes muscle aging. Claim 4 A composition according to claim 1, characterized in that the muscle aging-related disease is one or more selected from the group consisting of muscular atrophy, muscular dystrophy, sarcopenia, myopathy, myasthenia, and muscular injury. Claim 5 A composition for diagnosing muscle aging-related diseases comprising, as an active ingredient, a preparation capable of confirming the expression level of DDX54 (DEAD-Box Helicase 54) protein or the gene encoding it. Claim 6 A composition according to claim 5, wherein the preparation capable of confirming the expression level is an antibody, peptide, aptamer, or compound that specifically binds to the protein; or a primer or probe that specifically binds to the gene encoding the protein. Claim 7 A diagnostic kit for muscle aging-related diseases comprising the diagnostic composition of claim 5 as an active ingredient. Claim 8 A pharmaceutical composition for the prevention or treatment of muscle aging-related diseases comprising, as an active ingredient, an inhibitor of the DDX54 (DEAD-Box Helicase 54) protein or the gene encoding it. Claim 9 A composition according to claim 8, wherein the inhibitor is one or more selected from the group consisting of antibodies, miRNA, siRNA, shRNA, and antisense oligonucleotides that specifically bind to the protein or gene. Claim 10 A health functional food composition for preventing or improving muscle aging-related diseases, comprising as an active ingredient an inhibitor of DDX54 (DEAD-Box Helicase 54) protein or the gene encoding it. Claim 11 A screening method for a therapeutic agent for muscle aging-related diseases, comprising: a step of treating a biological sample isolated from an individual with a candidate substance (Step 1); a step of confirming the expression level of the DDX54 (DEAD-Box Helicase 54) protein or the gene encoding it in the biological sample treated with the candidate substance (Step 2); and a step of comparing the expression level with the expression level of the DDX54 protein or the gene encoding it in a biological sample not treated with the candidate substance (Step 3). Claim 12 In claim 11, the screening method is characterized by determining that the candidate substance is a treatment for muscle aging-related diseases if the expression of the protein or the gene encoding it is reduced in a biological sample treated with the candidate substance compared to a biological sample not treated with the candidate substance.

Images