Biomarker composition for diagnosing muscle-aging related diseases comprising MRPS9 protein or gene encoding the same as an active ingredient

Abstract

The present invention relates to a biomarker composition for diagnosing muscle aging-related diseases comprising the MRPS9 (mitochondrial ribosomal protein S9) protein or a gene encoding it as an active ingredient. By confirming that the expression of MRPS9 increases as cellular aging progresses in muscle cells and that muscle cell aging is promoted in an MRPS9 overexpression model, the composition can be usefully utilized as a diagnostic composition for muscle aging-related diseases.

Description

Technology Field

[0001] The present invention relates to a biomarker composition for diagnosing muscle aging-related diseases comprising the MRPS9 (mitochondrial ribosomal protein S9) protein or a gene encoding it as an active ingredient. Background Technology

[0002] Aging is a chronic process involving the occurrence of various physical and biochemical alterations affecting the structure and function of high-density lipoprotein (HDL), accompanied by increased circulation of pro-inflammatory cytokines, acute phase reactants, and C-reactive protein (CRP), and causing changes in hair, skin, eyes, bones, and the brain, as well as a decline in motor skills and energy metabolism.

[0003] Meanwhile, muscle is an important component of the human body and is a tissue derived from mesenchymal stem cells. Muscles account for about 40% of our body weight; they are supported by bones and tendons and consist of bundles of muscle fibers that move with one another and change cell size to induce contraction. As muscle cells age, a decline in motor skills may occur, along with various muscle diseases such as muscular atrophy, muscular dystrophy, sarcopenia, myopathy, and myasthenia.

[0004] The elderly population is continuously increasing worldwide, and it is predicted that by 2050, the population aged 65 and older in Europe and North America will reach 25%, and the global total will reach 2 billion. Korea is the country with the fastest aging rate in the world, and according to 2019 resident registration statistics, the population aged 65 and older has exceeded 8 million. As such, in line with the recent trends of an aging society and increased life expectancy, the number of patients with age-related muscle aging diseases is expected to rise, and the demand for treatments for these diseases is also projected to increase. Accordingly, research for the development of diagnostic agents and treatments for muscle aging-related diseases is currently actively underway. Prior art literature

[0005] 1. Republic of Korea Registered Patent KR 10-2177130 (Registered Nov. 04, 2020) The problem to be solved

[0006] The object of the present invention is to provide a biomarker composition for diagnosing muscle aging-related diseases comprising the MRPS9 (mitochondrial ribosomal protein S9) protein or a gene encoding it as an active ingredient.

[0007] Another objective of the present invention is to provide a composition for diagnosing muscle aging-related diseases comprising, as an active ingredient, a preparation capable of confirming the expression level of said protein or the gene encoding it.

[0008] Another objective of the present invention is to provide a diagnostic kit for muscle aging-related diseases comprising the above-mentioned diagnostic composition as an active ingredient.

[0009] Another objective of the present invention is to provide a composition for preventing, treating, or improving muscle aging-related diseases comprising an inhibitor of the protein or the gene encoding it as an active ingredient.

[0010] Another objective of the present invention is to provide a screening method for a therapeutic agent for muscle aging-related diseases using the said protein or the gene encoding it. means of solving the problem

[0011] To achieve the above objective, the present invention provides a biomarker composition for diagnosing muscle aging-related diseases comprising the MRPS9 (mitochondrial ribosomal protein S9) protein or a gene encoding the same as an active ingredient.

[0012] In addition, the present invention provides a composition for diagnosing muscle aging-related diseases comprising, as an active ingredient, a preparation capable of confirming the expression level of the protein or the gene encoding it.

[0013] In addition, the present invention provides a diagnostic kit for muscle aging-related diseases comprising the above-mentioned diagnostic composition as an active ingredient.

[0014] In addition, the present invention provides a pharmaceutical composition for the prevention or treatment of muscle aging-related diseases comprising an inhibitor of the protein or the gene encoding it as an active ingredient.

[0015] In addition, the present invention provides a health functional food composition for preventing or improving muscle aging-related diseases, comprising an inhibitor of the protein or the gene encoding it as an active ingredient.

[0016] In addition, the present invention provides a screening method for a therapeutic agent for muscle aging-related diseases, comprising the steps of: treating a biological sample isolated from an individual with a candidate substance (step 1); confirming the expression level of the protein or the gene encoding it in the biological sample treated with the candidate substance (step 2); and comparing the expression level with the expression level of the protein or the gene encoding it in a biological sample not treated with the candidate substance (step 3). Effects of the invention

[0017] According to the present invention, as cellular aging progresses in muscle cells, the expression of MRPS9 (mitochondrial ribosomal protein S9) increases, and by confirming that muscle cell aging is promoted in an MRPS9 overexpression model, it can be usefully utilized as a diagnostic composition for muscle aging-related diseases. Brief explanation of the drawing

[0018] Figure 1 shows the results of analyzing the difference in MRPS9 expression according to cell age using a general cell model. Figure 2 shows the results of analyzing the difference in MRPS9 expression according to human age using human-derived tissues. Figure 3 shows the results of analyzing the correlation between MPRS9 and exercise performance using human specimens. Figure 4 shows the results of analyzing differences in MRPS9 expression according to animal age using a general animal model or tissues derived therefrom. Figure 4A shows the results of analyzing MRPS9 expression in mouse-derived muscle tissue, and Figure 4B shows the results of analyzing MRPS9 expression in Caenorhabditis elegans. **P<0.01. Figure 5 shows the results of analyzing the effect of MRPS9 overexpression on cellular aging using an MRPS9 overexpression cell model. ***P<0.001. Figure 6 shows the results of analyzing the effect of MRPS9 overexpression on the expression of aging-related factors using an MRPS9 overexpression cell model. Figure 6A shows the results of analyzing aging-related factor proteins, and Figure 6B shows the results of analyzing aging-related factor gene expression. ***P<0.001. Figure 7 shows the results of analyzing the effect of MRPS9 overexpression on inflammatory cytokine expression using an MRPS9 overexpression cell model. ***P<0.001. Figure 8 shows the results of analyzing the effect of MPRS9 overexpression on exercise performance using an MRPS9 overexpression animal model. *P<0.05, **P<0.01. Figure 9 shows the results of analyzing the effect of MPRS9 overexpression on muscle mass using an MRPS9 overexpression animal model. *P<0.05. Specific details for implementing the invention

[0019] The present invention will be described in more detail below.

[0021] The present invention provides a biomarker composition for diagnosing muscle aging-related diseases comprising the MRPS9 (mitochondrial ribosomal protein S9) protein or a gene encoding it as an active ingredient.

[0022] The above protein or the gene encoding it may show increased expression in the patient group with muscle aging-related diseases compared to the normal group.

[0023] In addition, the above protein or the gene encoding it can promote muscle aging.

[0024] In addition, the above protein or the gene encoding it is IL-1β (Interleukin-1 beta), IL-6 (Interleukin-6), IL-8 (Interleukin-8), TNF-α (tumor necrosis factor-α), p53, p16 INK4α and p21 Cip1 One or more expressions selected from a group consisting of can be promoted, but are not limited thereto.

[0025] The above-mentioned muscle aging-related diseases may be one or more selected from the group consisting of muscular atrophy, muscular dystrophy, sarcopenia, myopathy, myasthenia, and muscular injury, but are not limited thereto.

[0026] In this specification, “diagnosis” refers to identifying the existence or characteristics of a pathological condition, and for the purposes of the present invention, means identifying a muscle aging-related disease, and includes determining the subject’s susceptibility to a muscle aging-related disease or at least one symptom thereof, and therametrics (e.g., monitoring the subject’s condition to provide information on therapeutic efficacy). It also includes a primary diagnosis of a clinical condition or a diagnosis of a relapsed disease.

[0027] In this specification, “biomarker” refers to an indicator capable of detecting changes within the body, and is a substance capable of confirming the normal or pathological state of a living organism or whether there are changes thereof. It may include organic biomolecules such as polypeptides, nucleic acids, lipids, glycolipids, glycoproteins, sugars (monosaccharides, disaccharides, oligosaccharides, etc.), and can be used to diagnose muscle aging-related diseases as in the present invention.

[0029] In addition, the present invention provides a composition for diagnosing muscle aging-related diseases comprising, as an active ingredient, a preparation capable of confirming the expression level of the MRPS9 (mitochondrial ribosomal protein S9) protein or the gene encoding it.

[0030] The agent capable of confirming the above expression level may be an antibody, peptide, aptamer, or compound that specifically binds to the protein; or a primer or probe that specifically binds to the gene encoding the protein, but is not limited thereto.

[0031] In this specification, "primer" refers to a short nucleic acid sequence having a short free 3' hydroxyl group, capable of forming base pairs with a complementary template, and functioning as a starting point for template strand replication. The primer can initiate DNA synthesis in the presence of a reagent for a polymerization reaction (i.e., DNA polymerase or reverse transcriptase) and four different nucleotide triphosphates at an appropriate buffer solution and temperature. PCR conditions and the lengths of the sense and antisense primers can be appropriately selected according to techniques known in the art.

[0032] In this specification, "probe" refers to a fragment of several to hundreds of nucleotide sequences capable of specifically binding to a gene or miRNA, and is labeled so as to confirm the presence or absence and expression level of said gene. Appropriate probes and hybridization conditions may be appropriately selected according to techniques known in the art.

[0034] In addition, the present invention provides a kit for diagnosing muscle aging-related diseases comprising the above-mentioned composition for diagnosing muscle aging-related diseases as an active ingredient.

[0035] The above kit can be used to diagnose whether a muscle aging-related disease has developed by measuring the expression level of the protein or the gene encoding it in a sample isolated from an individual suspected of having a muscle aging-related disease.

[0036] In addition, the kit may include not only a preparation for measuring the expression level of the protein or the gene encoding it, but also one or more other component compositions, solutions, or devices suitable for the analysis method.

[0037] For example, the kit according to the present invention may be a kit comprising genomic DNA derived from a sample to be analyzed for performing PCR, a primer set specific to the marker gene of the present invention, an appropriate amount of DNA polymerase, a dNTP mixture, a PCR buffer solution, and water. The PCR buffer solution may include KCl, Tris-HCl, and MgCl2. In addition, components necessary for performing electrophoresis to verify whether the PCR product has been amplified may be additionally included in the kit of the present invention.

[0038] In addition, the kit according to the present invention may be a kit containing essential elements necessary for performing RT-PCR. In addition to each primer pair specific to a marker gene, the RT-PCR kit may include a test tube or other suitable container, reaction buffer, deoxynucleotides (dNTPs), enzymes such as Taq-polymerase and reverse transcriptase, DNase, RNase inhibitors, DEPC-water, sterile water, etc. Additionally, it may include a primer pair specific to a gene used as a quantitative control.

[0040] In addition, the present invention provides a method for providing information for diagnosing muscle aging-related diseases, comprising the steps of: isolating a biological sample from an individual (step 1); and measuring the expression level of the MRPS9 (mitochondrial ribosomal protein S9) protein or the gene encoding it in the biological sample (step 2).

[0041] The above biological samples may be one or more selected from the group consisting of tissue, cells, whole blood, blood, serum, saliva, sputum, cerebrospinal fluid, and urine, but are not limited thereto.

[0042] The method for measuring the protein expression level may be one or more selected from the group consisting of Western blot, ELISA (enzyme linked immunosorbent assay), radioimmunoassay (RIA), radioimmunodiffusion, Ouchterlony immunodiffusion, rocket immunoelectrophoresis, tissue immunostaining, immunoprecipitation assay, complement fixation assay, FACS, and protein chips, but is not limited thereto.

[0043] The method for measuring the gene expression level described above may be one or more selected from the group consisting of microarray, next-generation sequencing (NGS), polymerase chain reaction (PCR), reverse transcription PCR (RT-PCR), competitive RT-PCR, real-time RT-PCR, RNase protection assay (RPA), Northern blotting, and DNA chips, but is not limited thereto.

[0045] In addition, the present invention provides a pharmaceutical composition for the prevention or treatment of muscle aging-related diseases comprising an inhibitor of the MRPS9 (mitochondrial ribosomal protein S9) protein or the gene encoding it as an active ingredient.

[0046] The above inhibitor may be one or more selected from the group consisting of antibodies, miRNA, siRNA, shRNA, and antisense oligonucleotides that specifically bind to the protein or gene, but is not limited thereto.

[0047] The pharmaceutical composition of the present invention may be manufactured in a unit dose form or contained in a multi-dose container by formulation using a pharmaceutically acceptable carrier according to a method that can be easily carried out by a person skilled in the art to which the invention belongs.

[0048] The above-mentioned pharmaceutically acceptable carriers are those commonly used in formulations and include, but are not limited to, lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia gum, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methyl cellulose, methyl hydroxybenzoate, propyl hydroxybenzoate, talc, magnesium stearate, mineral oil, etc. In addition to the above components, the pharmaceutical composition of the present invention may further include lubricants, wetting agents, sweeteners, flavoring agents, emulsifiers, suspending agents, preservatives, etc.

[0049] In the present invention, the content of the additive included in the pharmaceutical composition is not particularly limited and can be appropriately adjusted within the content range used in conventional formulations.

[0050] The above pharmaceutical composition may be formulated in the form of one or more external skin preparations selected from the group consisting of injectable formulations such as aqueous solutions, suspensions, and emulsions, pills, capsules, granules, tablets, creams, gels, patches, sprays, ointments, warning agents, lotions, liniments, pastes, and cataplasms, but is not limited thereto.

[0051] The pharmaceutical composition of the present invention may further include pharmaceutically acceptable carriers and diluents for formulation. The pharmaceutically acceptable carriers and diluents include, but are not limited to, excipients such as starch, sugars, and mannitol; fillers and extenders such as calcium phosphate; cellulose derivatives such as carboxymethylcellulose and hydroxypropylcellulose; binders such as gelatin, alginates, and polyvinylpyrrolidone; lubricants such as talc, calcium stearate, hydrogenated castor oil, and polyethylene glycol; disintegrants such as povidone and crospovidone; and surfactants such as polysorbate, cetyl alcohol, and glycerol. The pharmaceutically acceptable carriers and diluents may be biologically and physiologically affinities for the target. Examples of diluents include, but are not limited to, saline solution, aqueous buffer solution, solvent, and / or dispersion media.

[0052] The pharmaceutical composition of the present invention may be administered orally or parenterally (e.g., intravenously, subcutaneously, intraperitoneally, or topically) depending on the intended method. In the case of oral administration, it may be formulated into tablets, troches, lozenges, water-soluble suspensions, oily suspensions, prepared powders, granules, emulsions, hard capsules, soft capsules, syrups, elixirs, etc. In the case of parenteral administration, it may be formulated into injectable solutions, suppositories, powders for respiratory inhalation, aerosols for sprays, ointments, powders for topical application, oils, creams, etc.

[0053] The dosage of the pharmaceutical composition of the present invention may vary depending on the patient's condition, weight, age, gender, health status, dietary constitutional specificity, properties of the formulation, degree of disease, time of administration of the composition, method of administration, duration or interval of administration, excretion rate, and form of the drug, and may be appropriately selected by a person skilled in the art. For example, it may be in the range of about 0.1 to 10,000 mg / kg, but is not limited thereto, and may be administered once or several times a day.

[0054] The above pharmaceutical composition may be administered orally or parenterally (e.g., intravenously, subcutaneously, intraperitoneally, or topically) depending on the intended method. The pharmaceutical effective amount and effective dosage of the pharmaceutical composition of the present invention may vary depending on the formulation method, method of administration, time of administration, route of administration, etc., and a person skilled in the art can easily determine and prescribe a dosage effective for the intended treatment. The pharmaceutical composition of the present invention may be administered once a day or divided into several doses.

[0056] In addition, the present invention provides a health functional food composition for preventing or improving muscle aging-related diseases, comprising an inhibitor of the MRPS9 (mitochondrial ribosomal protein S9) protein or the gene encoding it as an active ingredient.

[0057] The present invention can be generally used as a commonly used food.

[0058] The food composition of the present invention may be used as a health functional food. The term “health functional food” refers to a food manufactured and processed using raw materials or ingredients having functional properties useful to the human body in accordance with the Health Functional Foods Act, and the term “functional properties” refers to consuming the food for the purpose of obtaining beneficial effects for health purposes, such as regulating nutrients or physiological actions on the structure and function of the human body.

[0059] The above-mentioned health functional food composition may include ordinary food additives, and unless otherwise specified, suitability as a “food additive” shall be determined in accordance with the specifications and standards for the relevant item, based on the general provisions and general test methods of the Food Additives Codex approved by the Ministry of Food and Drug Safety.

[0060] Examples of items listed in the above “Food Additives Codex” include chemically synthesized products such as ketones, glycine, potassium citrate, nicotinic acid, and cinnamon acid; natural additives such as persimmon dye, licorice extract, crystalline cellulose, sorghum dye, and guar gum; and mixed preparations such as L-sodium glutamate preparations, alkaline noodle additives, preservative preparations, and tar dye preparations.

[0061] The food composition of the present invention can be manufactured and processed in the form of tablets, capsules, powders, granules, liquids, pills, etc. For example, among health functional foods in capsule form, hard capsules can be manufactured by mixing and filling a conventional hard capsule with the composition according to the present invention and additives such as excipients, and soft capsules can be manufactured by mixing the composition according to the present invention with additives such as excipients and filling it into a capsule base such as gelatin. The soft capsule may contain plasticizers such as glycerin or sorbitol, coloring agents, preservatives, etc., as needed.

[0062] The definitions of terms regarding the above excipients, binders, disintegrants, lubricants, flavoring agents, etc., are those described in literature known in the art and include those with identical or similar functions. There are no special restrictions on the types of food mentioned above, and they include all health functional foods in the conventional sense.

[0063] In the present invention, the term “prevention” refers to any act of suppressing or delaying muscle aging-related diseases through the administration of a composition according to the present invention.

[0064] In the present invention, the term “treatment” refers to any act of improving or beneficially altering the symptoms of muscle aging-related diseases through the administration of a composition according to the present invention.

[0065] In this invention, the term “improvement” refers to any act of improving a poor condition of muscle aging-related diseases through the administration of a composition according to this invention.

[0067] In addition, the present invention provides a reagent composition for inhibiting muscle aging comprising an inhibitor of the MRPS9 (mitochondrial ribosomal protein S9) protein or the gene encoding it as an active ingredient.

[0069] In addition, the present invention provides a reagent composition for promoting muscle aging comprising the MRPS9 (mitochondrial ribosomal protein S9) protein or the gene encoding it as an active ingredient.

[0071] In addition, the present invention provides a screening method for a therapeutic agent for muscle aging-related diseases, comprising the steps of: treating a biological sample isolated from an individual with a candidate substance (step 1); confirming the expression level of the MRPS9 (mitochondrial ribosomal protein S9) protein or the gene encoding it in the biological sample treated with the candidate substance (step 2); and comparing the expression level with the expression level of the MRPS9 protein or the gene encoding it in a biological sample not treated with the candidate substance (step 3).

[0072] The above screening method may determine that the candidate substance is a treatment for muscle aging-related diseases if the expression of the MRPS9 protein or the gene encoding it is reduced in a biological sample treated with the candidate substance compared to a biological sample not treated with the candidate substance.

[0074] Hereinafter, the present invention will be described in detail with reference to examples to aid in understanding. However, the following examples are merely illustrative of the content of the present invention and the scope of the present invention is not limited to the following examples. The examples of the present invention are provided to more completely explain the present invention to those with average knowledge in the art.

[0076] [ Experimental Example 1] Analysis using general cell models and human-derived tissues

[0077] 1-1. Preparation of Cell Model

[0078] Mouse-derived C2C12 cells (ATCC, USA, CRL-1772), a mouse myoblast, were treated with etoposide (Sigma-Aldrich, USA, 341205), known as an aging-inducing substance, at various concentrations for 48 hours, and harvested to obtain a cell pellet.

[0080] 1-2. Preparation of Human-Derived Tissues

[0081] Muscle tissue derived from a normal group (ages 25–40) and a sarcopenia patient group (ages 65–82) was obtained at Jeonbuk National University Hospital in accordance with IRB approval (CUH 2022-07-007-001).

[0083] 1-3. MRPS9 Expression analysis

[0084] Western blot analysis was performed using the above cell model (Experimental Example 1-1) and human-derived tissue (Experimental Example 1-2) to confirm differences in MRPS9 expression according to cell and human age. The cells and tissues were lysed using RIPA buffer, and proteins were quantified using a BCA protein assay kit. Subsequently, proteins were separated by molecular weight using an SDS-PAGE gel, and the separated proteins were blotted onto a PVDF membrane. Then, the membrane was blocked with 5% skim milk, and the primary antibody was added and incubated overnight at 4°C. Afterward, the membrane was washed three times, the secondary antibody was added and incubated for one hour, and MRPS9 protein expression was measured using an ECL solution. The bands of each protein were quantified using the Image J program.

[0085] As a result, as shown in Figure 1, MRPS9 expression significantly increased as the concentration of etoposide treatment increased (= as cell aging progressed) in C2C12 cells, and as shown in Figure 2, MRPS9 expression significantly increased in the sarcopenic patient group (Aged subject) compared to the normal group (Young subject).

[0087] 1-4. MPRS9 Analysis of the correlation between and exercise performance

[0088] To confirm the correlation between MPRS9 and exercise performance, grip strength was measured in a normal group (ages 25–40) and a sarcopenic patient group (ages 65–82) at Jeonbuk National University Hospital in accordance with IRB approval (CUH 2022-07-007-001), and MPRS9 expression in human tissues was analyzed according to Experimental Examples 1-3 above. Subsequently, the correlation between grip strength and MPRS9 expression was analyzed using the GraphPed Prism program.

[0089] As a result, as shown in Figure 3, it was confirmed that grip strength and MPRS9 expression have an inverse relationship.

[0091] [ Experimental Example 2] Analysis using general animal models or tissues derived therefrom

[0092] 2-1. Preparation of tissues derived from animal models

[0093] Animal experiments were conducted under the approval of the Korea Food and Drug Administration (Approval No.: KFRI-M-22042). Aging mice were prepared using 5-week-old C57BL / 6 mice (Orient Bio Inc, Korea). Mice were reared for 5, 15, or 21 months under a 12-hour day-night cycle at 21–23°C, after which the mice were sacrificed to obtain muscle tissue.

[0095] 2-2. Preparation of Animal Models

[0096] N2 wild-type Caenorhabditis elegans obtained from the Caenorhabditis Genetic Center (CGC) Caenorhabditis elegans ) was used as an experimental model, and E. coli was used as the food strain for the above model. Escherichia coli OP50) was used. For nematode culture, the E. coli culture solution was uniformly dispensed into the NGM medium, and after transferring the Caenorhabditis elegans, they were cultured at 18–24°C for 2–14 days.

[0098] 2-3. MPRS9 Expression analysis

[0099] RT-PCR analysis was performed using tissues derived from the above animal model (Experimental Example 2-1) or the animal model (Experimental Example 2-2) to confirm differences in MRPS9 expression according to animal age. RNA was extracted from mouse muscle tissue using the RNeasy Fibrous Tissue Mini Kit (74704, QIAGEN, Germany), and RNA was extracted from Caenorhabditis elegans using the RNeasy Mini Kit (74104, QIAGEN, Germany). Subsequently, RNA concentration was measured using a nanodrop, and cDNA was prepared at a concentration of 500 ng / mL using the Synthesize cDNA for real-time Kit (ReverTra Ace™ qPCR RT Kit, FSQ-201, TOYOBO, Japan). Afterward, cDNA was synthesized, and PCR analysis was performed using the RT-PCR Master Mix (QPK-101, TOYOBO, Japan). The specific primer sequences of the genes whose expression was measured in the above analysis are as shown in Table 1 below.

[0100] As a result, as shown in Fig. 4, MPRS9 expression increased significantly as the age of the mouse (4A) and Caenorhabditis elegans (4B) increased.

[0101] Mus musculus nucleotide sequence (5' → 3') MRPS9 Sense CTTTGGTTCACTCCCGCTGTT Anti-sense TGCGGAACCTCTGCACAAAT 18s Sense CTCAACACGGGAAACCTCAC Anti-sense CGCTCCACCAACTAAGAACG C. elegans nucleotide sequence (5' → 3') MRPS9 Sense AAACACAGAGCAGAGTTCGAG Anti-sense GGAAGAATTTCATCTGGTGGTC act-3 Sense AAGTCATCACCGTCGGAAAC Anti-sense TTCCTGGGTACATGGTGGTT

[0103] [ Experimental Example 3] MRPS9 Analysis using an overexpression cell model

[0104] 3-1. MRPS9 Production of an overexpression cell model

[0105] To construct an MRPS9 overexpression cell model, pBABE-MRPS9 was inoculated into Platimum-A Retrovial Packaging Cell Line (RV-101, Cell Biolabs, USA) using X-tremeGENE9 DNA Transfection Reagent (Roche, Basel, Switzerland) and cultured for 24 hours. Subsequently, the cell medium was filtered through a 0.2 μm filter in a 50 mL tube, treated with 10 μg / mL of polybrene, and then treated with the medium in HSMM (Lonza, Cat No.: CC-2580) at 3-hour intervals for 12 hours. Afterward, the medium was replaced, and the cells were cultured for an additional 48 hours. Subsequently, 1 μg / mL of puromycin was mixed into the medium and replaced to specifically and selectively obtain only pBABE-MRPS9 cells.

[0107] 3-2. Analysis of Cellular Aging

[0108] Using the above cell model (3-1), staining was performed for SA-β-gal (senescence associated-beta galatosidase), known as a cell aging marker, to confirm the effect of MRPS9 overexpression on cell aging.

[0109] As a result, as shown in Figure 5, the blue precipitate in MPRS9 overexpressing cells and the number of β-gal positive cells (number of cells stained blue) relative to the total number of cells were significantly increased in normal cells (control group; pBABE-WT). From the above results, it was confirmed that the promotion of MRPS9 expression promotes muscle cell aging.

[0111] 3-3. Analysis of Aging-Related Factor Expression

[0112] Using the cell model (3-1) above, Western blot analysis was performed in the same manner as in Experimental Example 1-3 to confirm the effect of MRPS9 overexpression on the protein expression of aging-related factors.

[0113] As a result, as shown in Figure 6A, p16, p21, and p53 expression were significantly increased in MRPS9 overexpressing cells compared to normal cells (control; pBABE-WT).

[0114] In addition, using the cell model (3-1) above, RT-PCR analysis was performed in the same manner as in Experimental Example 2-3 to confirm the effect of MRPS9 overexpression on the gene expression of aging-related factors. The specific primer sequences of the genes whose expression was measured in the analysis are as shown in Table 2 below.

[0115] As a result, as shown in Fig. 6B, p16 in MRPS9-overexpressing cells compared to normal cells (control; pBABE-WT) INK4α and p21 Cip1 Expression increased significantly.

[0116] Homo sapiens nucleotide sequence (5' → 3') p16 INK4α Sense GATGAGGACAATGAGGCAAAG Anti-sense TGGGAAGAAAAGCAAGACAAC p21 Cip1 Sense TGGAGACTCTCAGGGTCGAAA Anti-sense GGCGTTTGGAGTGGTAGAAATC B2M Sense CACTGAATTCACCCCCACTGA Anti-sense GCTTACATGTCTCGATCCCAC

[0118] 3-4. Analysis of Inflammatory Cytokine Expression

[0119] Using the cell model (3-1) above, RT-PCR analysis was performed in the same manner as in Experimental Example 2-3 to confirm the effect of MRPS9 overexpression on inflammatory cytokine expression. The specific primer sequences of the gene whose expression was measured in the above analysis are as shown in Table 3 below.

[0120] As a result, as shown in Figure 7, the expression of IL-1β (Interleukin-1 beta), IL-6 (Interleukin-6), IL-8 (Interleukin-8), and TNF-α (tumor necrosis factor-α) was significantly increased in MRPS9 overexpressing cells compared to normal cells (control group; pBABE-WT).

[0121] Homo sapiens nucleotide sequence (5' → 3') IL-1β Sense AGCTACGAATCTCCGACCAC Anti-sense CGTTATCCCATGTGTCGAAGAA IL-6 Sense TGGCTGCAGGACATGACAA Anti-sense TGAGGTGCCCATGCTACATTT IL-8 Sense TTGCCAAGGAGTGCTAAAGAA Anti-sense GCCCTCTTCAAAAACTTCTCC TNFα Sense CCTCTCTCTAATCAGCCCTCTG Anti-sense GAGGACCTGGGAGTAGATGAG B2M Sense CACTGAATTCACCCCCACTGA Anti-sense GCTTACATGTCTCGATCCCAC

[0123] [ Experimental Example 4] MRPS9 Analysis using an overexpression animal model

[0124] 4-1. MRPS9 Production of overexpression animal models

[0125] To construct an animal model of MRPS9 overexpression, 5-week-old C57BL / 6 mice (Experimental Example 2-1) were reared until 18 months of age, and then AAV_MRPS9 was introduced into the mice at a total dose of 1×10⁻¹⁰ at a total dose of 100 μL using the AAV1 (TaKaRa, Tokyo, Japan) vector. 14 A single intravenous injection of vg / kg was administered. An animal model in which an AAV (AAV_CTL) with a blank vector inserted instead of AAV_MRPS9 was intravenously injected was set as the control group. Experimental Examples 4-2 and 4-3 were performed 8 weeks after intravenous injection.

[0127] 4-2. Analysis of Exercise Performance

[0128] Using the above animal model (Experimental Example 4-1), grip strength was measured using a grip strength meter (Bioseb, Chaville) and Rotarod was measured to determine the effect of MPRS9 overexpression on exercise performance, and a hanging test was performed. Specifically, grip strength was measured by determining the grip strength when the mouse grasped the grip with its forelimbs (repeated 5 times), verifying the average value, and then adjusting it for the mouse's body weight. For Rotarod measurement, the mice were trained for 5 minutes at a speed of 4 rpm for 2 days, and in this experiment, the speed was increased from 4 rpm to 20 rpm every minute to measure how far the mice could run. For the hanging test, the mice were suspended from a wire 30 cm high, and the time they remained hanging upside down was measured. This was repeated 3 times with a maximum duration of 180 seconds. Changes in muscle strength were confirmed using the average values ​​of the measurements.

[0129] As a result, as shown in Figure 8, grip strength, hanging test time, and latency to fall values ​​were significantly reduced in the MRPS9 overexpression animal model compared to the normal animal model (AAV-CTL).

[0131] 4-3. Muscle Mass Analysis

[0132] In order to confirm the effect of MRPS9 overexpression on muscle mass using the above animal model (Experimental Example 4-1), mice were dissected and muscle was obtained 8 weeks after AAV_MPRS9 was intravenously injected into the mice in Experimental Example 4-1. Muscle weight was measured and the change in muscle mass was confirmed by adjusting for the weight of each mouse.

[0133] As a result, as shown in Figure 9, the muscle mass of the gastrocnemius muscle (Gas), quadriceps muscle (Quad), and tibialis anterior muscle (TA) was significantly reduced in the MRPS9 overexpression animal model compared to the normal animal model (AAV-CTL).

[0135] Foregoing, specific parts of the present invention have been described in detail. It is evident to those skilled in the art that such specific descriptions are merely preferred embodiments and do not limit the scope of the invention. That is, the actual scope of the invention is defined by the appended claims and their equivalents.

Claims

Claim 1 A biomarker composition for diagnosing muscle aging-related diseases comprising MRPS9 (mitochondrial ribosomal protein S9) protein or a gene encoding it as an active ingredient. Claim 2 A composition according to claim 1, characterized in that the expression of the protein or the gene encoding it increases in a patient group of muscle aging-related diseases compared to a normal group. Claim 3 A composition according to claim 1, characterized in that the protein or the gene encoding it promotes muscle aging. Claim 4 A composition according to claim 1, characterized in that the muscle aging-related disease is one or more selected from the group consisting of muscular atrophy, muscular dystrophy, sarcopenia, myopathy, myasthenia, and muscular injury. Claim 5 A composition for diagnosing muscle aging-related diseases comprising, as an active ingredient, a preparation capable of confirming the expression level of the MRPS9 (mitochondrial ribosomal protein S9) protein or the gene encoding it. Claim 6 A composition according to claim 5, wherein the preparation capable of confirming the expression level is an antibody, peptide, aptamer, or compound that specifically binds to the protein; or a primer or probe that specifically binds to the gene encoding the protein. Claim 7 A diagnostic kit for muscle aging-related diseases comprising the diagnostic composition of claim 5 as an active ingredient. Claim 8 A pharmaceutical composition for the prevention or treatment of muscle aging-related diseases comprising, as an active ingredient, an inhibitor of the MRPS9 (mitochondrial ribosomal protein S9) protein or the gene encoding it. Claim 9 A composition according to claim 8, wherein the inhibitor is one or more selected from the group consisting of antibodies, miRNA, siRNA, shRNA, and antisense oligonucleotides that specifically bind to the protein or gene. Claim 10 A health functional food composition for preventing or improving muscle aging-related diseases, comprising an inhibitor of the MRPS9 (mitochondrial ribosomal protein S9) protein or the gene encoding it as an active ingredient. Claim 11 A screening method for a therapeutic agent for muscle aging-related diseases, comprising: a step of treating a biological sample isolated from an individual with a candidate substance (Step 1); a step of confirming the expression level of the MRPS9 (mitochondrial ribosomal protein S9) protein or the gene encoding it in the biological sample treated with the candidate substance (Step 2); and a step of comparing the expression level with the expression level of the MRPS9 protein or the gene encoding it in a biological sample not treated with the candidate substance (Step 3). Claim 12 In claim 11, the screening method is characterized by determining the candidate substance as a treatment for muscle aging-related diseases if the expression of the MRPS9 protein or the gene encoding it is reduced in a biological sample treated with the candidate substance compared to a biological sample not treated with the candidate substance.

Images