Composition for preventing, ameliorating or treating respiratory disease comprising zinc salt and cyclo-hispro as active ingredient

Abstract

The present invention relates to a composition for the prevention, improvement, or treatment of respiratory diseases comprising zinc salt and cyclo-hispro as active ingredients, and more specifically, provides a pharmaceutical composition for the prevention or treatment of respiratory diseases comprising a combination of zinc salt and cyclo-hispro in a specific weight ratio as active ingredients, which exhibits excellent allergenic cytokine reduction and mucus secretion reduction effects, and a health functional food composition for the prevention or improvement of respiratory diseases comprising the same active ingredients.

Description

Technology Field

[0001] The present invention relates to a composition for the prevention, improvement, or treatment of respiratory diseases comprising zinc salt and cyclo-hispro (CHP) as active ingredients. More specifically, the invention provides a pharmaceutical composition for the prevention or treatment of respiratory diseases comprising a combination of zinc salt and cyclo-hispro in a specific weight ratio as active ingredients, which exhibits excellent effects of reducing allergic cytokines and reducing mucus secretion, and a health functional food composition for the prevention or improvement of respiratory diseases comprising the same active ingredients. Background Technology

[0002] Respiratory diseases are diseases related to the lungs and airways, and can occur primarily due to causes such as weakened immunity, inflammation, bacterial or viral infections, inhalation of harmful particles from fine dust or smoking, and aging. Representative respiratory diseases include pneumonia, rhinitis, asthma and bronchitis, tuberculosis, and chronic obstructive pulmonary disease (COPD).

[0003] Among these, asthma is a disease characterized by the hypersensitivity of the airways to various stimuli, with symptoms such as wheezing, shortness of breath, and coughing appearing due to extensive narrowing of the airways. Most cases of asthma are allergic, and symptoms appear upon exposure to external causative antigens. House dust mites (HDMs) are the most common causative antigens, but pollen, mold, cockroaches, and animal dander can also act as antigens. Generally, a positive reaction is observed in skin tests or bronchial provocation tests for causative antigens, and the age of onset is typically relatively young.

[0004] Asthma is also recognized as a chronic inflammatory disease because inflammatory cells proliferate, differentiate, and become activated by IL-4, IL-5, and IL-13 produced by TH2-type immune cells, accumulating in the airways and surrounding tissues. It is known that inflammatory cells, such as activated eosinophils, mast cells, and alveolar macrophages in the bronchi, secrete various inflammatory mediators and are involved in strong bronchoconstriction. Therefore, since the production of cytokines such as IL-4, IL-5, and IL-13, as well as Ig-E, acts as a major cause of inflammation, allergic reactions, and the resulting asthma, much research is being conducted on the development of drugs to suppress them.

[0005] Currently, steroids, bronchodilators, and antibiotics are primarily used to treat asthma. Steroids and antibiotics are used to treat asthma by suppressing immune and inflammatory responses, while bronchodilators are used to counteract clinical symptoms such as shortness of breath when they occur. Inhaled corticosteroids, currently the most widely used medications, demonstrate excellent therapeutic effects; however, long-term use is known to cause adrenal suppression, decreased bone density, growth disorders, complications affecting the eyes and skin, and increased collagen synthesis, in proportion to the dose and duration of use. Additionally, long-acting beta-2 agonists such as salmeterol and formeterol provide a preventive effect against asthma attacks, but warnings have been issued that they can be fatal in some cases. Furthermore, their use as asthma treatments is limited due to the discovery of side effects associated with long-term use. Therefore, there is a need for the development of treatments with novel mechanisms and fewer side effects.

[0006] Against this background, the inventors confirmed that a combination of zinc and cyclo-hispro in a specific weight ratio exhibits a synergistic effect on reducing allergic cytokines and mucus secretion, thereby demonstrating an excellent therapeutic effect for respiratory diseases, and completed the present invention. Prior art literature

[0007] Republic of Korea Published Patent No. 10-2022-0078140 Republic of Korea Registered Patent No. 10-2264825 The problem to be solved

[0008] Accordingly, the present invention aims to provide a composition for the prevention, improvement, or treatment of respiratory diseases comprising a combination of zinc and cyclo-hispro. means of solving the problem

[0009] To solve the above-mentioned problem, the present invention provides a pharmaceutical composition for the prevention or treatment of respiratory diseases comprising a zinc salt comprising zinc cations and anions; and cyclo-hispro (CHP) or a pharmaceutically acceptable salt thereof.

[0010] In addition, the present invention provides a health functional food composition for preventing or improving respiratory diseases comprising a zinc salt containing zinc cations and anions; and cyclo-hispro or a food-grade acceptable salt thereof.

[0011] In addition, the weight ratio of the zinc cation to cyclo-hispro or a pharmaceutically or food-grade acceptable salt thereof may be 1:11 to 13.

[0012] In addition, the above respiratory disease may be one or more diseases selected from the group consisting of respiratory inflammatory lung disease, chronic obstructive pulmonary disease (COPD), sinusitis, allergic rhinitis, lower respiratory tract infection, bronchitis, emphysema, pneumonia, asthma, bronchiectasis, emphysema, sequelae of pulmonary tuberculosis, acute respiratory distress syndrome (ARDS), cystic fibrosis, otitis media, and pulmonary fibrosis.

[0013] In addition, the bronchitis may be one or more selected from the group consisting of acute bronchitis, chronic bronchitis, allergic bronchitis, infectious bronchitis, traumatic bronchitis, catarrhal bronchitis, suppurative bronchitis, obstructive bronchitis, ulcerative bronchitis, and infiltrative bronchitis.

[0014] In addition, the above asthma may be one or more selected from the group consisting of bronchial asthma, atopic asthma, non-atopic asthma, exercise-induced asthma, aspirin asthma, psychogenic asthma, and alveolar asthma.

[0015] In addition, the above composition may exhibit i) a reduction in allergic cytokines and ii) a reduction in mucus secretion.

[0016] In addition, the zinc salt and cyclo-hispro or a pharmaceutically or food-grade acceptable salt thereof may be administered simultaneously, separately, or sequentially. Effects of the invention

[0017] A composition comprising zinc salt and cyclo-hispro in a specific weight ratio according to the present invention exhibits a synergistic effect on reducing allergic cytokines and mucus secretion, and thus can be used as a treatment for various respiratory diseases, including asthma and bronchitis. Furthermore, since the composition of the present invention is effective upon oral administration, it can also be utilized as a health functional food. Brief explanation of the drawing

[0018] Figure 1 shows the results of measuring the change in the expression level of the allergic cytokine IL-4 according to the weight ratio of Zn and CHP in lung tissue in which inflammation was induced by HDM. Figure 2 shows the results of measuring the change in the expression level of the allergic cytokine IL-13 according to the weight ratio of Zn and CHP in lung tissue in which inflammation was induced by HDM. Figure 3 shows the results of measuring the change in the expression level of the allergic cytokine IL-17a according to the weight ratio of Zn and CHP in lung tissue with inflammation induced by HDM. Figure 4 shows the results of measuring the change in the expression level of the mucus gene muc5ac according to the weight ratio of Zn and CHP in lung tissue with inflammation induced by HDM. Specific details for implementing the invention

[0019] As mentioned above, existing asthma treatments have been reported to have various side effects, and there is still a demand for the development of treatments with new mechanisms and fewer side effects. Accordingly, the inventors sought a solution to the aforementioned problem by experimentally verifying that a combination of zinc and cyclo-hispro in a specific weight ratio exhibits a synergistic effect on the reduction of allergic cytokines and mucus secretion.

[0020] Accordingly, the present invention relates to a pharmaceutical composition for the prevention or treatment of respiratory diseases, comprising a zinc salt comprising zinc cations and anions; and cyclo-hispro or a pharmaceutically acceptable salt thereof.

[0021] In the composition of the present invention, the zinc salt comprises zinc cations and anions, wherein chlorides, sulfates, or gluconates may be used as the anions, but are not limited thereto.

[0022] In the present invention, "cyclo-hisPro (CHP)" refers to a substance widely distributed throughout the brain, spinal cord, and gastrointestinal tract, which is a naturally occurring circular dipeptide composed of histidine-proline, a metabolite of thyrotropin-releasing hormone (TRH), or a physiologically active dipeptide that is synthesized in the body de novo through the TRH metabolic process.

[0023] In the composition of the present invention, the CHP may be synthesized or commercially available. Additionally, it may be purified and used from a substance containing CHP, such as prostate extract and soybean hydrolysate.

[0024] The use of the term "refined" implies that CHP is in a concentrated form compared to forms obtainable from natural sources, such as prostate extract. Refined ingredients can be obtained by concentrating them from their natural sources or through chemical synthesis methods.

[0025] In the present invention, the zinc salt and cyclo-hispro are also referred to as "Cyclo-Z," and the zinc salt and cyclo-hispro may be included in the composition of the present invention in the form of a single compound or as individual components.

[0026] Therefore, zinc salt and cyclo-hispro can be administered as a single complex or as individual components simultaneously, separately, or sequentially.

[0027] In the composition of the present invention, the weight ratio of zinc cation to cyclo-hispro may be 1:11 to 13.

[0028] In a specific embodiment of the present invention, an asthma animal model induced by intranasal administration of HDM was administered zinc cations and CHP at different weight ratios of 2:1 (experimental group 1) and 1:11.9 (experimental group 2), respectively, and then changes in the expression levels of allergic cytokine genes (IL-4, IL-13, and IL-17a) and mucus genes (muc5ac) according to the weight ratio of zinc cations and CHP were observed.

[0029] As a result, as confirmed in Figures 1 to 4, the expression levels of allergic cytokines (IL-4, IL-13, and IL-17a) and mucus genes (muc5ac), which were increased by HDM, were significantly reduced in both experimental groups 1 and 2 administered with the combination of zinc cations and CHP. In particular, although experimental group 2 maintained the CHP content and significantly lowered the zinc cation content to 1 / 23 to 1 / 24 of that of experimental group 1, it showed a significant reduction in allergic cytokine gene expression and mucus gene expression compared not only to experimental group 1 but also to the positive control (fluticasone propionate), indicating that the synergistic effect of the combination of zinc cations and CHP was the most superior.

[0030] Accordingly, in the composition of the present invention, the weight ratio of zinc cation to cyclo-hispro is preferably 1:11 to 13, and if zinc cation and cyclo-hispro are administered in a weight ratio outside this range, the intended synergistic effect may be reduced.

[0031] In the present invention, the respiratory disease may be one or more diseases selected from the group consisting of respiratory inflammatory lung disease, chronic obstructive pulmonary disease (COPD), sinusitis, allergic rhinitis, lower respiratory tract infection, bronchitis, emphysema, pneumonia, asthma, bronchiectasis, emphysema, sequelae of pulmonary tuberculosis, acute respiratory distress syndrome (ARDS), cystic fibrosis, otitis media, and pulmonary fibrosis, but is not limited thereto.

[0032] In the present invention, the bronchitis may be acute bronchitis, chronic bronchitis, allergic bronchitis, infectious bronchitis, traumatic bronchitis, catarrhal bronchitis, suppurative bronchitis, obstructive bronchitis, ulcerative bronchitis, or infiltrative bronchitis, but is not limited thereto.

[0033] In the present invention, the asthma may be bronchial asthma, atopic asthma, non-atopic asthma, exercise-induced asthma, aspirin asthma, psychogenic asthma, or alveolar asthma, but is not limited thereto.

[0034] The composition of the present invention is effective in treating respiratory diseases, including asthma and bronchial diseases, because it reduces the secretion of allergic cytokines (IL-4, IL-13, and IL-17a) and mucus in lung tissue that are increased by external causative antigens such as HDM.

[0035] The term "prevention" as used in this invention refers to any act of suppressing or delaying the onset of a disease or pathology. In this invention, it refers to delaying the onset of a respiratory disease or suppressing its onset.

[0036] The term "improvement" as used in this invention refers to any act of improving or beneficially altering a disease or pathological condition, and in this invention, it refers to improving the symptoms of a respiratory disease.

[0037] The term "treatment" as used in this invention refers to any act of delaying, stopping, or reversing the progression of a disease or pathology; in this invention, it refers to alleviating, relieving, or eliminating, or reversing the symptoms of a respiratory disease.

[0038] The term "pharmaceuticalally acceptable salt" as used in the present invention refers to any organic or inorganic addition salt of cyclo-hispro, which has an effective effect that is relatively non-toxic and harmless to the patient, and whose side effects caused by the salt do not reduce the beneficial efficacy of cyclo-hispro. As free acids, inorganic and organic acids may be used for these salts; as inorganic acids, hydrochloric acid, bromic acid, nitric acid, sulfuric acid, perchloric acid, phosphoric acid, etc. may be used, and as organic acids, citric acid, acetic acid, lactic acid, maleic acid, fumaric acid, gluconic acid, methanesulfonic acid, glyconic acid, succinic acid, tartaric acid, galacturonic acid, emvonic acid, glutamic acid, aspartic acid, oxalic acid, (D) or (L) malic acid, maleic acid, methanesulfonic acid, ethanesulfonic acid, 4-toluenesulfonic acid, salicylic acid, citric acid, benzoic acid, or malonic acid, etc. In addition, these salts include alkali metal salts (sodium salts, potassium salts, etc.) and alkaline earth metal salts (calcium salts, magnesium salts, etc.). For example, acid addition salts include acetate, aspartate, benzate, besylate, bicarbonate / carbonate, bisulfate / sulfate, borate, camsylate, citrate, edicilate, esylate, formate, fumarate, gluteptate, gluconate, glucuronate, hexafluorophosphate, hyperbenzate, hydrochloride / chloride, hydrobromide / bromide, hydroiodide / iodide, isethionate, lactate, malate, maliate, malonate, mesylate, methyl sulfate, naphthylate, 2-naphthylate, nicotinate, nitrate, orotate, oxalate, palmitate, pamoate, phosphate / hydrogen phosphate / dihydrogen phosphate, saccharate, stearate, succinate, tartrate, It may include tosylate, trifluoroacetate, aluminum, arginine, benzathine, calcium, choline, diethylamine, diolamine, glycine, lysine, magnesium, meglumine, olamine, potassium, sodium, tromethamine, zinc salt, etc.

[0039] The pharmaceutical composition of the present invention may further comprise a pharmaceutically acceptable carrier. The pharmaceutical composition comprising the pharmaceutically acceptable carrier may be in various formulations for oral or parenteral administration. When formulating, it may be prepared using diluents or excipients such as commonly used fillers, extenders, binders, wetting agents, disintegrants, and surfactants. Solid formulations for oral administration may include tablets, pills, powders, granules, capsules, troches, etc., and such solid formulations may be prepared by mixing at least one excipient, for example, starch, calcium carbonate, sucrose or lactose, or gelatin, with one or more compounds of the present invention. In addition, lubricants such as magnesium stirate talc may also be used in addition to simple excipients. Liquid formulations for oral administration may include suspensions, liquid formulations, emulsions, or syrups, and may contain various excipients in addition to commonly used simple diluents such as water and liquid paraffin, such as humectants, sweeteners, flavorings, and preservatives.

[0040] Preparations for parenteral administration may include sterile aqueous solutions, non-aqueous solvents, suspension solvents, emulsions, lyophilized preparations, suppositories, etc. As non-aqueous solvents and suspension solvents, propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate may be used. As bases for suppositories, witepsol, macrogol, Tween 61, cocoa paste, laurin paste, glycerol, gelatin, etc. may be used.

[0041] The pharmaceutical composition of the present invention may be administered via any general route capable of reaching a target tissue or cell within an individual or sample. Such administration may include systemic or local administration and may include, but is not limited to, intraperitoneal administration, intravenous administration, intramuscular administration, subcutaneous administration, intradermal administration, oral administration, intranasal administration, intrapulmonary administration, rectal administration, etc. The dosage of the pharmaceutical composition may vary depending on the patient's age, body weight, gender, form of administration, health status, and degree of disease.

[0042] The term "patient" refers to any single individual requiring treatment, including humans, cattle, dogs, guinea pigs, rabbits, chickens, insects, etc. Additionally, the subject includes any subject participating in a clinical study or epidemiological study that does not exhibit any clinical signs of disease, or a subject used as a control group.

[0043] In addition, the present invention relates to a health functional food composition for preventing or improving respiratory diseases, comprising a zinc salt containing zinc cations and anions; and cyclo-hispro or a food-grade acceptable salt thereof.

[0044] In the health functional food composition of the present invention, the description of the composition and effects of the zinc salt and cyclo-hispro included as active ingredients is the same as previously described, so the description is omitted.

[0045] In the present invention, the term "food-grade acceptable salt" includes a salt derived from a food-grade acceptable organic acid, inorganic acid, or base.

[0046] In the present invention, the term "health functional food" includes both the meanings of "functional food" and "health food."

[0047] In this invention, the term "functional food" is synonymous with "food for special health use (FosHu)," and refers to a food with high medical or health effects that is processed to efficiently exhibit bio-regulatory functions in addition to providing nutrition.

[0048] In the present invention, the term "health food" refers to a food that has an active effect of maintaining or promoting health compared to general food, and "health supplement food" refers to a food intended for the purpose of supplementing health. Depending on the case, the terms functional food, health food, and health supplement food are used interchangeably. The above-mentioned food may be manufactured in various forms such as tablets, capsules, powders, granules, liquids, and pills to obtain a useful effect for the prevention or improvement of respiratory diseases.

[0049] As a specific example of such a functional food, a processed food can be manufactured by using the zinc salt and cyclo-hispro or a food-acceptable salt thereof of the present invention to modify agricultural, livestock, or fishery products while preserving their characteristics and improving their shelf life.

[0050] The health functional food composition of the present invention may also be manufactured in the form of nutritional supplements, food additives, and animal feed, and is intended for consumption by humans or animals, including livestock.

[0051] The above-mentioned type of food composition can be prepared in various forms according to conventional methods known in the art. General foods may be prepared by adding the zinc salt and cyclo-hispro or a food-grade salt thereof of the present invention to beverages (including alcoholic beverages), fruits and their processed foods (e.g., canned fruit, bottled fruit, jam, marmalade, etc.), fish, meat and its processed foods (e.g., ham, sausage, corned beef, etc.), breads and noodles (e.g., udon, buckwheat noodles, ramen, spaghetti, macaroni, etc.), fruit juices, various drinks, cookies, malt syrup, dairy products (e.g., butter, cheese, etc.), edible vegetable oils, margarine, vegetable proteins, retort foods, frozen foods, various seasonings (e.g., soybean paste, soy sauce, sauces, etc.).

[0052] In addition, nutritional supplements may be prepared by adding the zinc salt and cyclo-hispro or a food-grade acceptable salt thereof of the present invention to capsules, tablets, pills, etc., although not limited thereto.

[0053] In addition, as a health functional food, the zinc salt and cyclo-hispro or a food-grade acceptable salt thereof of the present invention may be consumed by liquefying, granulating, encapsulating, and powdering, for example, so as to be prepared in the form of tea, juice, and drink (health beverage). In addition, to use the zinc salt and cyclo-hispro or a food-grade acceptable salt thereof of the present invention as a food additive, they may be prepared and used in the form of a powder or a concentrate. Furthermore, the zinc salt and cyclo-hispro or a food-grade acceptable salt thereof of the present invention may be prepared in the form of a composition by mixing them with a known active ingredient known to be effective in preventing or improving respiratory diseases.

[0054] When the food composition of the present invention is used as a health drink composition, the health drink composition may contain various flavoring agents or natural carbohydrates as additional ingredients, as in conventional beverages. The aforementioned natural carbohydrates may be monosaccharides such as glucose and fructose; disaccharides such as maltose and sucrose; polysaccharides such as dextrin and cyclodextrin; or sugar alcohols such as xylitol, sorbitol, and erythritol. Sweeteners may include natural sweeteners such as thaumatin and stevia extract; or synthetic sweeteners such as saccharin and aspartame. The proportion of the natural carbohydrates is generally about 0.01 to 0.04 g, preferably about 0.02 to 0.03 g per 100 mL of the composition of the present invention.

[0055] The zinc salt and cyclo-hispro or a food-grade acceptable salt thereof of the present invention may be contained as active ingredients in a health functional food composition for the prevention or improvement of respiratory diseases, and the amount thereof is an amount effective for obtaining the prevention or improvement effect, for example, preferably 0.01 to 100 weight% with respect to the total weight of the composition, but is not particularly limited thereto. The health functional food composition of the present invention may be prepared in the form of a composition by mixing the zinc salt and cyclo-hispro or a food-grade acceptable salt thereof together with a known active ingredient known to be effective in the prevention or improvement of respiratory diseases.

[0056] In addition to the above, the health functional food of the present invention may contain various nutritional supplements, vitamins, electrolytes, flavoring agents, coloring agents, pectic acid, salts of pectic acid, alginic acid, salts of alginic acid, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohol, or carbonating agents. Furthermore, the health food of the present invention may contain fruit pulp for the production of natural fruit juice, fruit juice beverages, or vegetable beverages. These ingredients may be used independently or in combination. Although the proportion of these additives is not critical, it is generally selected in the range of 0.01 to 0.1 parts by weight per 100 parts by weight of the composition of the present invention.

[0057] The present invention will be described in more detail below through examples. These examples are intended solely to illustrate the present invention, and it will be obvious to those skilled in the art that the scope of the present invention is not to be interpreted as being limited by these examples.

[0058] Establishment of an asthma animal model using house dust mites (HDM)

[0059] 1-1. Rearing of Experimental Animals and Induction of Asthma Animal Models

[0060] HDM (D. pteronyssius) extract for inducing an asthma animal model was purchased from GREER, and female Balb / c 6-week-old mice were purchased from Coatec Co., Ltd.

[0061] Upon arrival, Balb / c mice were housed in an environment of 23±3℃ with free access to food and water. After acclimatizing to the rearing environment for one week and measuring body weight, they were randomly distributed into five groups as shown in Table 1 to ensure uniform average body weight. For HDM sensitization, 25 μg of HDM per animal was administered intranasally to all groups except the normal control group on days 0 and 3. The HDM was dissolved in 50 μl of physiological saline. For the subsequent challenge, the same amount of HDM was administered intranasally on days 10, 11, and 12. Physiological saline was administered to the normal control group using the same method.

[0062] 1-2. Administration of Experimental Substance

[0063] As shown in Table 1, immediately after HDM stimulation on days 10, 11, and 12, 10 mg / kg of Zn (zinc cation) + 5 mg / kg of CHP and 0.42 mg / kg of Zn (zinc cation) + 5 mg / kg of CHP were dissolved in 200 μl of distilled water and administered orally to experimental group 1, while the same amount of distilled water was administered orally to the normal control group and the HDM control group. Fluticasone propionate used as the positive control was purchased from Angene Chemical. Fluticasone propionate was administered to the positive control group via the intranasal route at a dose of 20 μg per animal. At this time, fluticasone propionate was first dissolved in 100% ethanol (pure grade) at a concentration of 20 mg / ml, and then dissolved in physiological saline to a concentration of 20 μg / 50 μl for use.

[0064] group Normal control group (Vehicle) HDM control group (HDM) Experimental group 1 (Zn+CHP 15mg / kg) Experimental group 2 (Zn+CHP 5.42 mg / kg) Positive control (Fluticasone propionate) HDM(in) Physiological saline solution HDM 25μg / head administration DW DW Zn 10mg / kg CHP 5mg / kg Zn 0.42 mg / kg CHP 5 mg / kg 20μg / head Oral administration (oral) Intranasal administration (in) Number of Marisu 4 7 7 6 7

[0065] Confirmation of the allergic cyclo-histone reduction effects of zinc and cyclo-histone

[0066] After the administration of the experimental substances of Examples 1-2 was completed, lung tissue was excised from mice of each group in Table 1, and RNA was extracted using NucleoZOL (MACHEREY-NAGEL) according to the manufacturer's Total RNA isolation protocol. 1 μg of RNA was used to synthesize cDNA by inducing a Reverse Transcription Polymerase Chain Reaction with an iScript cDNA Synthesis Kit (Bio-Rad).

[0067] The synthesized cDNA is an allergic reactive cytokine IL-4, IL-13 and IL-17 Genes and mucus genes muc5ac Real-time PCR was performed using iQ SYBR Green Supermix (Bio-Rad) with the primer set for analysis. The primers for real-time PCR were synthesized by Bioneer, and their specific sequences are shown in Table 2. The expression values ​​of each gene are for the housekeeping gene hprt It was corrected by dividing by the expression value.

[0068] Gene name Forward primer sequence (5'→3') Sequence number Reverse primer sequence (5'→3') Sequence number IL-4 TCGGCATTTTGAACGAGGTC 1 CGTTGCTGTGAGGACGTTTG 2 IL-13 CCATCTACAGGACCCAGAGGA 3 TTTTGGTATCGGGGAGGCTG 4 IL-17a CCTCACACGAGGCACAAGT 5 TGAAGCTCTCCCTGGACTCA 6 Muc5ac TGTGCCTGCCTGTACAATGGG 7 CATGTGTTGGTGCAGTCAGTAGA 8 hprt AAATGTCAGTTGCTGCGTCC 9 TCTACCAGAGGGTAGGCTGG 10

[0069] As shown in Figures 1 to 3, experimental groups 1 and 2, administered with a combination of Zn and CHP, showed a significant reduction in the allergic cytokines IL-4, IL-13, and IL-17a, which were increased by HDM. In particular, although experimental group 2 had a significantly lower Zn content compared to experimental group 1 (1 / 23 to 1 / 24), it showed a significant reduction in allergic cytokines compared to experimental group 1 as well as the positive control group, indicating that the synergistic effect of the combination of Zn and CHP was the most superior.

[0070] In addition, as shown in Figure 4, the expression of the mucus gene muc5ac, which is increased by HDM, was significantly reduced in experimental groups 1 and 2 administered with the combination of Zn and CHP, and the effect was most excellent in experimental group 2.

[0071] Through this, it was confirmed that the combination of Zn and CHP showed excellent effects in reducing allergic cytokines and mucus secretion, and in particular, treating with zinc cations and CHP in a weight ratio of 1:11 to 13 showed the best synergistic effect, making it effective for the treatment of respiratory diseases.

Claims

Claim 1 A pharmaceutical composition for the prevention or treatment of respiratory diseases, comprising a zinc salt containing zinc cations and anions; and cyclo-hispro or a pharmaceutically acceptable salt thereof, wherein the respiratory disease is one or more selected from the group consisting of allergic rhinitis, allergic bronchitis, and allergic asthma. Claim 2 A pharmaceutical composition for the prevention or treatment of respiratory diseases according to claim 1, wherein the weight ratio of the zinc cation to cyclo-hispro or a pharmaceutically acceptable salt thereof is 1:11 to 13. Claim 3 A pharmaceutical composition for the prevention or treatment of respiratory diseases according to claim 1, wherein the composition exhibits i) the effect of reducing allergic cytokines and ii) the effect of reducing mucus secretion. Claim 4 A pharmaceutical composition for the prevention or treatment of respiratory diseases according to claim 1, wherein the zinc salt and cyclo-hispro or a pharmaceutically acceptable salt thereof are administered simultaneously, separately, or sequentially. Claim 5 A health functional food composition for preventing or improving respiratory diseases, comprising a zinc salt containing zinc cations and anions; and cyclo-hispro or a food-grade acceptable salt thereof, wherein the respiratory disease is one or more selected from the group consisting of allergic rhinitis, allergic bronchitis, and allergic asthma. Claim 6 A health functional food composition for the prevention or improvement of respiratory diseases, wherein, in claim 5, the weight ratio of the zinc cation to cyclo-hispro or a food-grade acceptable salt thereof is 1:11 to 13. Claim 7 A health functional food composition for the prevention or improvement of respiratory diseases, wherein, in claim 5, the composition exhibits the effects of i) reducing allergic cytokines and ii) reducing mucus secretion. Claim 8 A health functional food composition for the prevention or improvement of respiratory diseases, wherein, in paragraph 5, the zinc salt and cyclo-hispro or a food-grade salt thereof are administered simultaneously, separately, or sequentially.

Images