Treatment method for primary hyperoxaluria through gene editing of hydroxy acid oxidase 1

Abstract

A composition for gene editing of the hydroxy acid oxidase 1 (HAO1) ​​gene, comprising: (a) messenger RNA (mRNA) encoding a Cas12i2 polypeptide; (b) guide RNA (gRNA) targeting the HAO1 gene; and (c) a lipid excipient that selectively forms lipid nanoparticles. Additionally, the present invention provides a method for genetically modifying the HAO1 gene in a host cell using the composition provided herein.

Description

Background Technology

[0001] Cross-reference regarding related applications

[0002] This application claims the benefit of the filing date of U.S. provisional application No. 63 / 617,867 filed on January 5, 2024, the entire contents of which are incorporated herein by reference.

[0003] Sequence list

[0004] The present application comprises a sequence list filed electronically in XML format, the entirety of which is incorporated herein by reference. The XML copy created on January 2, 2025, is named 063586-536001WO_Seq-Listing_ST26.xml and has a size of 56,491 bytes.

[0005] background

[0006] Primary hyperoxaluria (PH) is a medical condition characterized by recurrent kidney and bladder stones resulting from the overproduction of oxalate, which combines with calcium to form calcium oxalate, the main component of kidney and bladder stones. It is estimated that PH affects 1 in 58,000 people worldwide. There are three types of PH: PH1, PH2, and PH3, with PH1 accounting for approximately 80% of cases.

[0007] Primary hyperoxaluria is AGXT , GRHPR and HOGA1 It is associated with gene mutations in genes such as the hydroxy acid oxidase 1 (HAO1) ​​gene, leading to the abnormal degradation of glyoxylate. Glycolate oxidase (GO), encoded by the hydroxy acid oxidase 1 (HAO1) ​​gene, converts glyoxylate into oxalate. Knockout the HAO1 gene reduces the level of the GO enzyme and, consequently, can reduce the level of oxalate, which is beneficial for pH treatment.

[0008] The present disclosure is based on the development of a composition and a method for gene editing the hydroxy acid oxidase 1 (HAO1) ​​gene in a subject to be beneficial, at least partially, for the treatment of primary hyperoxaluria (PH). Accordingly, the present invention provides, in particular, a composition for gene editing the HAO1 gene, and a method of using the HAO1 gene editing composition disclosed herein for gene modification of the HAO1 gene in a cell (e.g., a subject) and / or for treating a disease associated with the HAO1 gene, e.g., primary hyperoxaluria (PH).

[0009] Accordingly, the present disclosure provides, in one aspect, a composition for gene editing of a hydroxy acid oxidase 1 (HAO1) ​​gene comprising:

[0010] (a) Messenger RNA (mRNA) encoding the Cas12i2 polypeptide presented as SEQ ID NO. 7, comprising a nucleotide sequence that is at least 80% identical to SEQ ID NO. 8;

[0011] (b) a guide RNA (gRNA) comprising the nucleotide sequence of SEQ ID NO. 13; and

[0012] (c) A lipid excipient comprising 45-50 mol% cationic lipids, 9-11 mol% zwitterionic phospholipids, 38-42 mol% cholesterol, and 2.2-2.8 mol% pegylated lipids.

[0013] In some embodiments, cationic lipids are It has the structure of, or is a pharmaceutically acceptable salt or stereoisomer thereof.

[0014] In some embodiments, pegylated lipids are It has the structure, where the mean n is 45-49 (including both ends).

[0015] In some embodiments, the zwitterionic phospholipid is 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC).

[0016] In some embodiments, the mRNA comprises a nucleotide sequence that is at least 85% identical to SEQ ID NO. 8. In some embodiments, the mRNA comprises a nucleotide sequence that is at least 90% identical to SEQ ID NO. 8. In some cases, the mRNA comprises a poly A tail at its 3' end, for example, a poly A tail containing 60 to 135 adenosine (A) residues (e.g., 85 or more A residues). In a specific example, the mRNA comprises the nucleotide sequence of SEQ ID NO. 23. Alternatively or additionally, the mRNA comprises a 5' cap moiety and / or one or more modified nucleotides, for example, pseudouridines (e.g., by replacing uridine residues). In some examples, the mRNA comprises pseudouridine residues at 75% or more of the uridine positions within the mRNA. In one specific example, the mRNA comprises pseudouridine residues at all uridine positions within the mRNA. In one specific example, mRNA contains pseudouridine residues at all uridine positions within the mRNA and contains a 5' cap moiety.

[0017] In some embodiments, the lipid excipient comprises 47.5 mol% cationic lipid, 10 mol% zwitterionic phospholipid, 40 mol% cholesterol, and 2.5 mol% pegylated lipid.

[0018] In any HAO1 gene editing composition disclosed herein, the ratio between messenger RNA and gRNA may be 1 ± 20% (e.g., 1 ± 10% or 1 ± 5%). In some examples, the ratio may be 1:1 (1). Nucleic acid components (mRNA and gRNA) may be associated with lipid excipients. In some cases, the lipid excipient may form lipid nanoparticles (LNPs), and the nucleic acid components may be attached to the LNPs or encapsulated within the LNPs.

[0019] In some embodiments, the gRNA in any composition disclosed herein comprises one or more modifications. Examples include phosphorothioate bonds, 2'-O-methylation, or combinations thereof. In some cases, the modification is located at the 5' and / or 3' nucleotide. In one specific example, the gRNA is a modified nucleic acid comprising the nucleotide sequence of SEQ ID NO. 14.

[0020] In some embodiments, the nitrogen:phosphate (N / P) ratio in the composition provided herein may be in the range of 3 to 9. In some examples, the N / P ratio in the composition is 6.0 ± 1.0. In one example, the N / P ratio of the composition is 6.0 ± 0.5 (e.g., about 6.0).

[0021] In another aspect, the present disclosure features a method for gene editing the HAO1 gene in a subject, comprising the step of administering an effective amount of any HAO1 gene editing composition disclosed herein to a subject requiring gene editing of the hydroxy acid oxidase 1 (HAO1) ​​gene. In some embodiments, the subject is a human subject having primary hyperoxaluria (PH). In some examples, the human subject has PH1.

[0022] In some cases, the method may further include a step of evaluating the level of HAO1 gene editing in the subject. Alternatively, the method may further include a step of analyzing the level of the HAO1 gene product (HAO1 protein, also known as GO protein or GO enzyme), the level of a molecule involved in the GO enzyme-mediated catalytic pathway (e.g., glycolate), or a combination thereof.

[0023] Additionally, HAO1 gene editing compositions as disclosed herein for use in gene editing the HAO1 gene in subjects, which may be host cells and / or human patients having PH, as well as for treating PH in subjects requiring treatment, are also within the scope of this disclosure. Furthermore, this application provides for the use of any HAO1 gene editing composition to manufacture a medicine for use in treating PH (e.g., PH1) in subjects, e.g., human patients having PH.

[0024] Details of one or more embodiments of the present invention are set forth in the description below. Other features or advantages of the present invention will become apparent from the following drawings, the detailed description of various embodiments, and the appended claims. Brief explanation of the drawing

[0025] The following drawings form part of this specification and are included to further demonstrate specific aspects of the disclosure that can be better understood by referring to the drawings in combination with the detailed description of specific embodiments presented herein. Fig. 1 This is a diagram showing the effects of various treatments and doses on HAO1 gene editing in the liver of non-human primates (NHP). The target indel edit was set to 55%. N / P: Nitrogen:phosphate (N / P) target ratio. Guide / RNA: gRNA to mRNA target ratio. FIGS. 2a to 2c It includes a diagram showing the therapeutic efficacy of an exemplary HAO1 gene editing composition as indicated. Fig. 2a : HAO1 gene editing efficiency. Fig. 2b : GO enzyme activity. Fig. 2c : Glycolate levels. Fig. 3 This is a diagram showing the correlation between HAO1 knockdown, glycolate, and GO protein in mice using mouse counterparts of the HAO1 gene editing composition provided herein. FIGS. 4a to 4dIt includes a diagram showing HAO1 gene editing in a mouse model for PH1 using a mouse counterpart of the HAO1 gene editing composition provided herein. Fig. 4a : Increase in HAO1 indel with increased capacity. Fig. 4b : Hao1 Effect of editing on GO enzyme activity. Fig. 4c : Hao1 Effect of editing on glycolate levels. Fig. 4d : Hao1 Reduction of urinary oxalate due to gene editing. Figs. 5a and 5b Is Agxt - / - Includes a diagram showing the long-term persistence of HAO1 gene editing and urinary oxalate levels in mice. Fig. 5a : Diagram showing the total liver tissue indel at the endpoint 3 and 6 months after administration of the composition at 1.5 mg / kg. Fig. 5b : 3 and 6 months after administration of the composition at 1.5 mg / kg Agxt - / - Diagram showing urine oxalate expressed as a percentage relative to baseline in mice. Figures 6a and 6b is childhood treated with an HAO1 gene editing composition Agxt - / - Includes a diagram showing Hao1 gene editing and urine oxalate levels in mice. Fig. 6a : At different ages after drug administration in childhood at a dose of 2 mg / kg Agxt - / - Liver from mouse Hao1 A diagram showing the editing of. Fig. 6b : 3 months after drug administration in childhood at a dose of 2 mg / kg Agxt - / - Diagram showing urinary oxalate in mice at 3 months. Fig. 7 This is a diagram showing normalized GO protein expression in the liver after 30 to 70% hepatectomy. Specific details for implementing the invention

[0026] The present disclosure is based on the development of a composition and method for gene editing the hydroxy acid oxidase 1 (HAO1) ​​gene in subjects to be at least partially beneficial for the treatment of primary hyperoxaluria (PH). As reported herein, the HAO1 gene editing composition disclosed herein has demonstrated successful gene editing of the HAO1 gene in non-human primates (NHP), as evidenced by the percentage of indels at the HAO1 locus. Knockout of the HAO1 gene in animals led to a decrease in GO enzyme activity and an increase in glycolate levels in the treated animals, which indicates a decrease in the level of conversion from glycolate to glyoxylate and a consequent decrease in oxalate. Therefore, the HAO1 gene editing composition provided herein is expected to aid in the treatment of diseases such as PH by gene editing the HAO1 gene to reduce molecules that contribute to the formation of kidney and bladder stones, which is one of the major symptoms associated with hyperoxaluria (PH).

[0027] Additionally, after treatment with the HAO1 gene editing composition provided herein, the liver in the PH1 mouse model Hao1 Durability of editing and a decrease in urinary oxalates were observed. Finally, using rhampseq from two primary hepatocyte donors treated with the editing composition, in silico ( in silico 1,549 candidate off-target sites selected by CALITAS and Digenome-Seq were evaluated. Although numerous off-target site candidates were identified in the in silico study, only 3 quantiles Cancer Somatic Mutation CatalogIn (COSMIC 2024), it was verified that unannotated intron regions possessed editing activity slightly exceeding the detection limit (0.012%) for either one or both donors. No true off-targets were identified in exon regions. No structural variations were detected using long-range sequencing and optical genome mapping, which is HAO1 It indicates that the chromosome structure is maintained after treatment with an editing composition.

[0028] Accordingly, the present disclosure provides, in particular, a composition for gene editing of the HAO1 gene, and a method of using such composition for gene modification of the HAO1 gene in cells (e.g., in a subject) and / or for treating a disease associated with the HAO1 gene, e.g., primary hyperoxaluria (PH).

[0029] I. Composition for gene editing of the HAO1 gene

[0030] Hydroxylic acid oxidase 1 ("HAO1"), also known as "glycolate oxidase 1," is a peroxisome protein primarily expressed in the liver and pancreas, and its activity involves the oxidation of glycolate and 2-hydroxy fatty acids. The HAO1 gene product is the glycolate oxidase (GO) enzyme, which is also referred to as the GO protein or HAO1 protein. Structural information for the human HAO1 gene can be found in the NCBI reference sequence NG_046733.1.

[0031] The present disclosure provides a gene editing composition that targets the HAO1 gene, e.g., the human HAO1 gene. The HAO1 gene editing composition provided herein may comprise (a) a Cas12i2 polypeptide or a nucleic acid encoding the Cas12i2 polypeptide, (b) a guide RNA that targets a genomic region within the HAO1 gene, and (c) a lipid excipient comprising one or more lipids capable of forming a lipid nanoparticle (LNP) structure. The Cas12i2 polypeptide or the nucleic acid encoding it and / or gRNA may be associated with the lipid excipient. When the lipid excipient forms an LNP, the Cas12i2 polypeptide or the nucleic acid encoding it and / or gRNA may be attached to the LNP and / or encapsulated therefrom.

[0032] In some embodiments, the HAO1 gene editing composition may comprise a messenger RNA (mRNA) molecule encoding a Cas12i2 polypeptide, which has at least 95% identical amino acid sequences to the parent Cas12i2 CRISPR nuclease presented as SEQ ID NO. 1 and may comprise at least amino acid substitutions (e.g., D581R, I926R, and V1030G) at positions D581, I926, and V1030 relative to SEQ ID NO. 1. Alternatively or additionally, the gRNA in the HAO1 gene editing composition may comprise a spacer sequence specific to the target sequence of 5'-CAAAGTCTATATATGACTAT-3' (SEQ ID NO. 10) within the HAO1 gene. The mRNA and gRNA in the composition may have a ratio of 1±20%, e.g., 1±10%, 1±5%, or 1±2%. In some examples, the ratio is approximately 1:1 (e.g., 1). Additionally, both mRNA and gRNA can be associated with lipid excipients capable of forming LNPs (e.g., attached to or encapsulated by them).

[0033] A. Cas12i2 polypeptide and coding nucleic acid

[0034] The HAO1 gene editing composition provided herein comprises a Cas12i2 polypeptide or a nucleic acid encoding the Cas12i2 polypeptide. In a specific example, the HAO1 gene editing composition comprises a messenger RNA (mRNA) molecule encoding the Cas12i2 polypeptide.

[0035] (a) Cas12i2 polypeptide

[0036] The Cas12i2 polypeptide disclosed herein comprises a Cas12i2 nuclease domain and optionally one or more additional functional motifs, e.g., nuclear localization signal(s), peptide linkers, or combinations thereof. The Cas12i2 nuclease is a Class 2 Type V CRISPR-Cas endonuclease capable of cleaving target double-stranded DNA under the guidance of a guide RNA. The Cas12i2 nuclease can be found, for example, in WO2021 / 202800 and WO2022 / 256642, the respective relevant disclosures of which are incorporated by reference for the subject matter and purposes mentioned herein.

[0037] In some embodiments, the Cas12i2 polypeptide included in the HAO1 gene editing composition disclosed herein may comprise a Cas12i2 nuclease which is a variant of the parent Cas12i2 enzyme presented in SEQ ID NO. 1. The following Ranking table Refer to [reference]. These variant Cas12i2 nucleases may contain an amino acid sequence that is at least 90% (e.g., at least 95%, at least 97%, at least 98%, at least 99%, or more) identical to SEQ ID NO. 1. Homology or identity may be determined by amino acid sequence alignment using a program such as BLAST, ALIGN, or CLUSTAL, for example, as described herein.

[0038] The "percentage of identity" of two nucleic acids or two amino acid sequences is determined using an algorithm from a modified version of the literature (Karlin and Altschul Proc. Natl. Acad. Sci. USA 87:2264-68, 1990), as in the literature (Karlin and Altschul Proc. Natl. Acad. Sci. USA 90:5873-77, 1993). This algorithm is included in the NBLAST and XBLAST programs (version 2.0) from the literature (Altschul, et al. J. Mol. Biol. 215:403-10, 1990). A BLAST nucleotide search can be performed with the NBLAST program, score=100, word length-12 to obtain nucleotide sequences homologous to the nucleic acid molecule of the present invention. BLAST protein search can be performed with the XBLAST program, score=50, and word length=3 to obtain amino acid sequences homologous to the protein molecule of the present invention. If a gap exists between two sequences, Gapped BLAST can be used as described in the literature (Altschul et al., Nucleic Acids Res. 25(17):3389-3402, 1997). When using BLAST and Gapped BLAST programs, the default parameters of each program (e.g., XBLAST and NBLAST) can be used.

[0039] The variant Cas12i2 nuclease may comprise one or more amino acid substitutions for SEQ ID NO. 1, for example at positions D581, I926, V1030 of SEQ ID NO. 1, and optionally additionally at positions G624, F626, P868, E1035, and S1046. In some cases, the original amino acid residue of SEQ ID NO. 1 at the just mentioned positions (e.g., positions D581, G624, F626, I926, and / or E1035) may be replaced with R or a conservative substitution thereof (e.g., K). Alternatively or additionally, the original amino acid residue of SEQ ID NO. 1 at the mentioned positions (e.g., V1030 and / or S1046) may be replaced with G or a conservative substitution thereof, for example, A. Additionally, the original amino acid residue at position P868 may be replaced with T or a conservative substitution thereof, for example, S.

[0040] As used herein, “conservative amino acid substitution” refers to an amino acid substitution that does not alter the relative charge or size characteristics of the protein to which the amino acid substitution has been made. Variants may be prepared according to methods of modifying polypeptide sequences known to those skilled in the art, and such methods may be found in reference literature compiling such methods, such as *Molecular Cloning: A Laboratory Manual*, J. Sambrook, et al., eds., Second Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, 1989, or *Current Protocols in Molecular Biology*, FM Ausubel, et al., eds., John Wiley & Sons, Inc., New York). Conservative amino acid substitutions include substitutions between amino acids within the following groups: (a) M, I, L, V; (b) F, Y, W; (c) K, R, H; (d) A, G; (e) S, T; (f) Q, N; and (g) E, D.

[0041] In one example, a variant Cas12i2 nuclease comprises D581R, I926R, and V1030G for SEQ ID NO. 1. Such a Cas12i2 nuclease may comprise the amino acid sequence of SEQ ID NO. 2. The following Ranking table Refer to .

[0042] In another example, the variant Cas12i2 nuclease comprises D581R, G624R, F626R, P868T, I926R, V1030G, E1035R, and S1046G for SEQ ID NO. 1. This Cas12i2 nuclease may comprise the amino acid sequence of SEQ ID NO. 3.

[0043] Any Cas12i2 polypeptide may additionally include one or more functional motifs in addition to the nuclease domain. For example, the Cas12i polypeptide includes at least one (e.g., two, three, four, five, six, or more, identical or different) nuclear localization signal (NLS). In some embodiments, the Cas12i polypeptide includes at least one (e.g., two, three, four, five, six, or more, identical or different) nuclear extratransport signal (NES). In some embodiments, the Cas12i polypeptide includes at least one (e.g., two, three, four, five, six, or more) NLS and at least one (e.g., two, three, four, five, six, or more) NES. In some examples, the Cas12i2 polypeptide may include a single NLS at the C-terminus. In other examples, the Cas12i2 polypeptide may include a single NLS at the N-terminus and a single NLS at the C-terminus. In some cases, the N-terminal and C-terminal NLS motifs may be the same. Suitable NLS motifs known in the art may be used for the Cas12i2 polypeptide disclosed herein. One example is as follows: Ranking table It is provided in.

[0044] In some embodiments, the Cas12i2 polypeptide may comprise one or more flexible peptide linkers between the nuclease domain and one or more additional functional motifs, such as an NLS motif. Any suitable flexible peptide linker (e.g., a G / S-rich peptide linker as known in the art) may be used. An example is as follows: Ranking table It is provided in.

[0045] In one specific example, the Cas12i2 polypeptide may comprise a Cas12i2 nuclease domain and an NLS from the N-terminus to the C-terminus. In another specific example, the Cas12i2 polypeptide may comprise a first NLS, a first flexible peptide linker, a Cas12i2 nuclease domain, a second flexible peptide linker, and a second NLS from the N-terminus to the C-terminus. Such a Cas12i2 polypeptide may comprise the amino acid sequence of SEQ ID NO. 7. In another example, the Cas12i2 polypeptide may comprise the amino acid sequence of SEQ ID NO. 17. The following Ranking table Refer to [link]. NLS motifs are displayed in italics and bold, and peptide linkers are underlined.

[0046] (b) Cas12i2 coding mRNA

[0047] In some embodiments, the HOA1 gene editing composition disclosed herein may comprise a nucleic acid such as an mRNA molecule encoding the Cas12i2 polypeptide disclosed herein.

[0048] In some examples, the nucleotide sequences encoding the Cas12i polypeptide described herein may be codon-optimized for use in specific host cells or organisms, e.g., human liver cells. Codon usage tables are readily available in the "Codon Usage Database" available, for example, at www.kazusa.or.jp / codon / , and these tables may be modified in various ways. For the subject matter and purposes mentioned herein, the literature incorporated herein by reference (Nakamura et al.Refer to Nucl. Acids Res. 28:292 (2000). Computer algorithms for codon-optimizing specific sequences for expression in specific host cells, such as Gene Forge (Aptagen; Jacobus, PA), are also available. In some examples, nucleic acids encoding Cas12i polypeptides, such as the Cas12i2 polypeptide disclosed herein, may be molecules capable of codon-optimization. Exemplary coding sequences, namely SEQ ID NO. 4 (coding for the Cas12i2 polypeptide of SEQ ID NO. 7) and SEQ ID NO. 18 (coding for the Cas12i2 polypeptide of SEQ ID NO. 17), are as follows Ranking table It is provided in.

[0049] In addition to the coding sequence for the Cas12i2 polypeptide, nucleic acids such as mRNA molecules may additionally contain untranslated regions (UTRs) at the 5' and / or 3' ends. For example, mRNA molecules may contain 5' cap modifications. mRNA typically contains a 5'-cap for efficient translation, stabilization, and transport within eukaryotic cells. In some examples, the mRNA molecules disclosed herein may contain a natural 5' m7G cap. Alternatively, mRNA molecules may contain a non-naturally occurring synthetic 5' cap, such as those known in the art for use in mRNA, for example, a synthetic cap provided by the company (TriLink BioTechnologies). For the purposes and subjects mentioned herein, also refer to the referenced literature (Ishikawa et al., Nucleic Acid Symposium Series No. 53, pages 129-130). Examples include, but are not limited to, CAP(G(5')ppp(5')G), mCAP(m7G(5')ppp(5')G), ARCA(3´-O-Me-m7G(5')ppp(5')G), m7(3'OMeG)(5')ppp('5)m6(2'OMeA)pG, m7G(5')ppp(5')(2'OMeA)pU, and m7G(5')ppp(5')(2'OMeA)pG.

[0050] Alternatively or additionally, the mRNA molecule disclosed herein may comprise one or more modifications, e.g., modified nucleotides and / or modified backbone bonds. In one example, the mRNA molecule may comprise pseudouridine residues. In some cases, the content of pseudouridine residues in the mRNA may be at least 50% (e.g., at least 60%, at least 70%, at least 80%, at least 90%, or greater than) at uridine positions in the mRNA. In some examples, the mRNA may comprise pseudouridine residues at all uridine positions in the mRNA.

[0051] In one specific example, the mRNA in the HAO1 gene editing composition disclosed herein may comprise a nucleotide sequence that is at least 70% identical to SEQ ID NO. 8 and may code for a Cas12i2 polypeptide (e.g., comprising the amino acid sequence of SEQ ID NO. 7). For example, the mRNA may comprise a nucleotide sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or more identical to SEQ ID NO. 8 and codes for the Cas12i2 polypeptide of SEQ ID NO. 7. In one specific example, the mRNA comprises the nucleotide sequence of SEQ ID NO. 8 (e.g., consists therein).

[0052] In another specific example, the mRNA in the HAO1 gene editing composition disclosed herein may comprise a nucleotide sequence that is at least 70% identical to SEQ ID NO. 18 and may code for a Cas12i2 polypeptide (e.g., comprising the amino acid sequence of SEQ ID NO. 17). For example, the mRNA may comprise a nucleotide sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or more identical to SEQ ID NO. 18 and codes for the Cas12i2 polypeptide of SEQ ID NO. 17. In one specific example, the mRNA comprises the nucleotide sequence of SEQ ID NO. 18 (e.g., consists therein).

[0053] Any such mRNA molecule may contain a 5' cap, e.g., an m7G(5')ppp(5')(2'OMeA)pG cap, and at least 75% (e.g., at least 80%, at least 85%, at least 90%, or at least 95%) of the uridine positions within the mRNA may be pseudouridine residues. In one example, the mRNA contains pseudouridine residues at all uridine positions.

[0054] Additional modifications to RNA molecules as known in the art (e.g., provided herein) may be introduced into the Cas12i2 coding mRNA molecule disclosed herein.

[0055] Alternatively or additionally, the Cas12i2 polypeptide-coding mRNA may contain a 3' poly A tail. In some cases, the poly A tail within the mRNA may contain about 50 to 150 adenosine (A) residues. In some examples, the poly A tail may have a length of about 60 to 140 A residues. In other examples, the poly A tail may have a length of about 70 to 140 A residues or about 80 to 140 A residues. In some examples, the poly A tail may have a length of about 85 to 135 A residues. In some examples, the poly A tail may have a length of more than 85 A residues. In one specific example, the Cas12i2 polypeptide-coding mRNA may contain the nucleotide sequence of SEQ ID NO. 23.

[0056] B. RNA Guide

[0057] The HAO1 gene editing composition disclosed herein also comprises a guide RNA (gRNA) that targets the HAO1 gene or a nucleic acid encoding the same. As used herein, the terms “RNA guide” or “RNA guide sequence” refer to any RNA molecule (e.g., a modified RNA molecule) that facilitates the targeting of a CRISPR nuclease, such as any Cas12i2 polypeptide described herein, to a target sequence (e.g., a sequence of the HAO1 gene). For example, the RNA guide may be a molecule that targets a nucleic acid sequence (target sequence) within a target gene (e.g., the HAO1 gene in this disclosure). More specifically, the RNA guide comprises a domain (spacer sequence) that is specific to the target sequence within the target gene (i.e., an RNA counterpart of the target sequence). In addition to the spacer sequence, the RNA guide may further comprise a direct repeat (DR) sequence that can be recognized by a CRISPR nuclease. In some cases, the RNA guide may be a modified RNA molecule that binds to a sequence complementary to the target sequence, for example, containing one or more deoxyribonucleotides within a spacer sequence. In some examples, the spacer sequence may include a DNA sequence or a DNA / RNA hybrid sequence.

[0058] As used herein, the first polyribonucleotide (e.g., a spacer sequence of an RNA guide) and the second polyribonucleotide (e.g., a sequence complementary to a target sequence) form a double-stranded complex through base pairing, so that the effector polypeptide complexed with the first polyribonucleotide can act on (e.g., cleave) the second polyribonucleotide, and the first polyribonucleotide has a certain level of complementarity with the second polyribonucleotide. In some embodiments, the first polynucleotide may be substantially complementary to the second polynucleotide, that is, may have at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% complementarity with respect to the second polynucleotide. In some embodiments, the first polynucleotide is completely complementary to the second polynucleotide, that is, has 100% complementarity with respect to the second polynucleotide.

[0059] In some embodiments, the RNA guide may include a direct repeat sequence followed by a spacer sequence based on the sequence in the 5' to 3' direction. In some embodiments, the RNA guide may include a spacer sequence and a second direct repeat sequence followed by a first direct repeat sequence based on the sequence in the 5' to 3' direction. In some embodiments, the first and second direct repeats of the RNA guide may be identical. In some embodiments, the first and second direct repeats of the RNA guide may be different.

[0060] In some embodiments, the spacer sequence and direct repeat sequence(s) of the RNA guide exist within the same RNA molecule. In some embodiments, the spacer and direct repeat sequences are directly connected to each other. In some embodiments, a short linker, for example, an RNA linker of length 1, 2, or 3 nucleotides, exists between the spacer and the direct repeat sequence. In some embodiments, the spacer sequence and direct repeat sequence(s) of the RNA guide exist within separate molecules and are connected to each other by base pairing interactions.

[0061] (a) Spacer sequence

[0062] In some embodiments, the RNA guide in the HAO1 gene editing composition provided herein comprises a spacer sequence specific to a target sequence within exon 1 of the human HAO1 gene, and its nucleotide sequence is as follows Ranking table Provided in. The target sequence is adjacent to the 5'-NTTN-3' or 5'-TTN-3' "protospacer adjacent motif" or "PAM" sequence, where N represents any nucleotide sequence. In some cases, the target sequence is located downstream of the PAM sequence, for example, at the 3' end of the PAM sequence.

[0063] The PAM sequence is a DNA sequence adjacent to the target sequence, and a complex comprising the RNA guide provided herein (e.g., HAO1 targeting RNA guide) and the Cas12i2 polypeptide binds to it. In a double-stranded DNA molecule, the strand containing the PAM motif is referred to as the "PAM strand," and the complementary strand is referred to as the "non-PAM strand." A spacer sequence within the RNA guide may bind to a site within the non-PAM strand that is complementary to the target sequence disclosed herein.

[0064] In some embodiments, the PAM strand is a coding (e.g., sense) strand. In other embodiments, the PAM strand is a non-coding (e.g., antisense) strand. Since the RNA guide binds to the non-PAM strand through base pairing, the non-PAM strand is also known as the target strand, and the PAM strand is also known as the non-target strand.

[0065] The spacer sequence of the RNA guide may have a length of 15 to 30 nucleotides (e.g., 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides) and is complementary to the non-PAM strand sequence. In some embodiments, the spacer sequence is designed to be complementary to a specific DNA strand of a genomic locus that may be present, for example, within exon 1 of the human HAO1 gene. In a specific example, the target sequence is presented as 5'-CAAAGTCTATATATGACTAT-3' (Sequence No. 10) in the HAO1 gene.

[0066] In some embodiments, the spacer sequence within the RNA guide is substantially identical to the complementary strand of the target sequence (e.g., SEQ ID NO. 10). In some embodiments, the spacer sequence may have at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or at least about 99.5% sequence identity with respect to the complementary strand of the target sequence such as SEQ ID NO. 10. The percentage of identity between these two nucleic acids may be determined manually by examining two optimally aligned nucleic acid sequences, or by using a software program or algorithm (e.g., BLAST, ALIGN, CLUSTAL) that uses standard parameters.

[0067] In some examples, the spacer sequence in the RNA guide disclosed herein may comprise the nucleotide sequence of 5'-CAAAGUCUAUAUAUGACUAU-3' (SEQ ID NO. 11). Alternatively, the spacer sequence may comprise a nucleotide sequence identical to SEQ ID NO. 11 by at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or more.

[0068] In some embodiments, the spacer sequence described herein includes uracil (U). In some embodiments, the spacer sequence described herein includes thymine (T). Any nucleotide sequence provided herein refers to a nucleic acid having a defined nucleotide sequence, regardless of any modifications (if any) included therein, unless explicitly noted.

[0069] (b) Direct repetition section

[0070] Any RNA guide disclosed herein may further include a direct repeat sequence. In some embodiments, the direct repeat sequence of the RNA guide has a length of 15 to 30 nucleotides. In some examples, the direct repeat sequence may have a length of 20 to 30 nucleotides, for example, 23 to 26 nucleotides.

[0071] In some embodiments, the direct repeat sequence may comprise the nucleotide sequence of 5'-AGAAAUCCGUCUUUCAUUGACGG-3' (SEQ ID NO. 12). Alternatively, the spacer sequence may comprise a nucleotide sequence identical to SEQ ID NO. 12 by at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 95% or more.

[0072] (c) strain

[0073] The RNA guide (and mRNA, where applicable) provided herein may include one or more covalent modifications to the reference sequence, particularly the parent polyribonucleotide, which are included within the scope of this disclosure.

[0074] Exemplary modifications may include any modifications to sugars, nucleobases, nucleoside bonds (e.g., linking phosphate / phosphodiester bonds / phosphodiester backbones), and any combination thereof. Some of the exemplary modifications provided herein are described in detail below.

[0075] The RNA guide may include any useful modifications to the sugar, nucleobase, or nucleoside-to-nucleoside bonds (e.g., linking phosphate / phosphodiester bonds / phosphodiester backbones). One or more atoms of the pyrimidine nucleobase may be replaced or substituted with an optionally substituted amino, an optionally substituted thiol, an optionally substituted alkyl (e.g., methyl or ethyl), or a halo (e.g., chloro or fluoro). In certain embodiments, modifications (e.g., one or more modifications) are present in each of the sugar and nucleoside bonds. The modifications may be modifications of ribonucleic acid (RNA) to deoxyribonucleic acid (DNA), threose nucleic acid (TNA), glycol nucleic acid (GNA), peptide nucleic acid (PNA), lock nucleic acid (LNA), or hybrids thereof. Additional modifications are described herein.

[0076] In some embodiments, modifications may include chemical or cell-induced modifications. For example, several non-limiting examples of intracellular RNA modifications are described in the literature (Lewis and Pan, "RNA modifications and structures cooperate to RNA guide-protein interactions", Nat Reviews Mol Cell Biol, 2017, 18:202-210).

[0077] Different sugar modifications, nucleotide modifications, and / or nucleoside-to-nucleoside bonds (e.g., backbone structure) may be present at various positions within the sequence. Those skilled in the art will understand that nucleotide analogs or other modification(s) may be located at any position(s) of the sequence, provided that the function of the sequence is substantially reduced. The sequence comprises about 1% to about 100% of modified nucleotides (in relation to the total nucleotide content, or in relation to any one or more types of nucleotides, i.e., A, G, U, or C) or any percentage in between (e.g., 1% to 20%, 1% to 25%, 1% to 50%, 1% to 60%, 1% to 70%, 1% to 80%, 1% to 90%, 1% to 95%, 10% to 20%, 10% to 25%, 10% to 50%, 10% to 60%, 10% to 70%, 10% to 80%, 10% to 90%, 10% to 95%, 10% to 100%, 20% to 25%, 20% to 50%, It may include 20% to 60%, 20% to 70%, 20% to 80%, 20% to 90%, 20% to 95%, 20% to 100%, 50% to 60%, 50% to 70%, 50% to 80%, 50% to 90%, 50% to 95%, 50% to 100%, 70% to 80%, 70% to 90%, 70% to 95%, 70% to 100%, 80% to 90%, 80% to 95%, 80% to 100%, 90% to 95%, 90% to 100%, and 95% to 100%.

[0078] In some embodiments, sugar modifications (e.g., modifications at the 2' or 4' position) or sugar substitutions in one or more ribonucleotides of the sequence may include modifications or substitutions of phosphodiester bonds as well as backbone modifications. Specific examples of sequences include, but are not limited to, sequences that include modified backbones, such as internucleoside modifications including modifications or substitutions of phosphodiester bonds, or sequences that do not include natural internucleoside bonds. Sequences having modified backbones include, in particular, sequences that do not have a phosphorus atom in the backbone. For the purposes of this application, and as is often referred to in the art, modified RNA that does not have a phosphorus atom in the internucleoside backbone may also be considered as an oligonucleotide. In certain embodiments, the sequence will include a ribonucleotide having a phosphorus atom in its internucleoside backbone.

[0079] The modified sequence backbone may include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates such as 3'-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates such as 3'-aminophosphoramidate and aminoalkylphosphoramidate, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and boranophosphates having normal 3'-5' bonds, their 2'-5' linked analogs, and those having reversed polarity in which adjacent pairs of nucleoside units are linked from 3'-5' to 5'-3' or from 2'-5' to 5'-2'. Various salts, mixed salts, and free acid forms are also included. In some embodiments, the sequence may be negatively or positively charged.

[0080] Modified nucleotides that can be incorporated into a sequence may be modified on nucleoside bonds (e.g., phosphate backbones). In the context of polynucleotide backbones, the terms "phosphate" and "phosphodiester" are used interchangeably. Backbone phosphate groups may be modified by replacing one or more oxygen atoms with different substituents. Additionally, modified nucleosides and nucleotides may involve the complete replacement of an unmodified phosphate moiety with another nucleoside bond as described herein. Examples of modified phosphate groups include, but are not limited to, phosphorothioates, phosphoselenates, boranophosphates, boranophosphate esters, hydrogen phosphonates, phosphoramidates, phosphorodiamidates, alkyl or aryl phosphonates, and phosphodiesters. In phosphorodithioates, both unlinked oxygens are replaced with sulfur. Phosphate linkers can also be modified by replacing the connecting oxygen with nitrogen (bridging phosphoramidate), sulfur (bridging phosphorothioate), and carbon (bridging methylene-phosphonate).

[0081] α-thio-substituted phosphate moiety is provided to confer stability to RNA and DNA polymers through non-natural phosphorothioate backbone binding. Phosphorothioate DNA and RNA have increased nuclease resistance and subsequently have a longer half-life in the cellular environment.

[0082] In certain embodiments, the modified nucleoside is an alpha-thio-nucleoside (e.g., 5'- O -(1-thiophosphate)-adenosine, 5'- O -(1-thiophosphate)-cytidine(a-thio-cytidine), 5'- O -(1-thiophosphate)-guanosine, 5'- O -(1-thiophosphate)-uridine, or 5'- O It includes -(1-thiophosphate)-pseudouridine).

[0083] Other internucleoside bonds that may be used according to the present disclosure, including internucleoside bonds that do not contain phosphorus atoms, are described herein.

[0084] In some embodiments, the sequence may include one or more cytotoxic nucleosides. For example, a cytotoxic nucleoside may be incorporated into the sequence, such as a dual-functional modification. Cytotoxic nucleosides include, but are not limited to, adenosine arabinoside, 5-azacitidine, 4'-thio-aracitidine, cyclopentenylcytosine, cladribin, cloparabine, cytarabine, cytosine arabinoside, 1-(2-C-cyano-2-deoxy-beta-D-arabino-pentofuranosyl)-cytosine, decitabine, 5-fluorouracil, fludarabine, fluoxuridine, gemcitabine, combination of tegafur and uracil, tegafur((RS)-5-fluoro-1-(tetrahydrophoran-2-yl)pyrimidine-2,4(1H,3H)-dione), troxacitabine, tezacitabine, 2'-deoxy-2'-methylidencitidine (DMDC), and 6-mercaptopurine. Additional examples include fludarabine phosphate, N4-behenoyl-1-beta-D-arabinofuranosylcytosine, N4-octadecyl-1-beta-D-arabinofuranosylcytosine, N4-palmitoyl-1-(2-C-cyano-2-deoxy-beta-D-arabino-pentofuranosyl)cytosine, and P-4055 (cytarabine 5'-ellaidic acid ester).

[0085] In some embodiments, the sequence comprises one or more post-transcriptional modifications (e.g., capping, cleavage, polyadenylation, splicing, poly A sequence, methylation, acylation, phosphorylation, methylation of lysine and arginine residues, acetylation, and nitrosylation of thiol groups and tyrosine residues). One or more post-transcriptional modifications may be any post-transcriptional modification, for example, any of more than 100 different nucleoside modifications identified in RNA (Rozenski, J, Crain, P, and McCloskey, J. (1999). The RNA Modification Database: 1999 update. Nucl Acids Res 27: 196-197). In some embodiments, the first isolated nucleic acid comprises messenger RNA (mRNA). In some embodiments, mRNA is pyridin-4-one ribonucleoside, 5-aza-uridine, 2-thio-5-aza-uridine, 2-thiouridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxyuridine, 3-methyluridine, 5-carboxymethyl-uridine, 1-carboxymethyl-pseudouridine, 5-propynyl-uridine, 1-propynyl-pseudouridine, 5-taurinomethyluridine, 1-taurinomethyl-pseudouridine, 5-taurinomethyl-2-thio-uridine, 1-taurinomethyl-4-thio-uridine, 5-methyl-uridine, 1-methyl-pseudouridine, 4-thio-1-methyl-pseudouridine, 2-thio-1-methyl-pseudouridine, It comprises at least one nucleoside selected from the group consisting of 1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-1-deaza-pseudouridine, dihydrouridine, dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-dihydropseudouridine, 2-methoxyuridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, and 4-methoxy-2-thio-pseudouridine.In some embodiments, mRNA is 5-aza-cytidine, pseudoisocytidine, 3-methyl-cytidine, N4-acetylcytidine, 5-formylcytidine, N4-methylcytidine, 5-hydroxymethylcytidine, 1-methyl-pseudoisocytidine, pyrrolo-cytidine, pyrrolo-pseudoisocytidine, 2-thio-cytidine, 2-thio-5-methyl-cytidine, 4-thio-pseudoisocytidine, 4-thio-1-methyl-pseudoisocytidine, 4-thio-1-methyl-1-deaza-pseudoisocytidine, 1-methyl-1-deaza-pseudoisocytidine, zebularin, 5-aza-zebularin, 5-methyl-zebularin, 5-aza-2-thio-zebularin, 2-thio-zebularin, It comprises at least one nucleoside selected from the group consisting of 2-methoxy-cytidine, 2-methoxy-5-methyl-cytidine, 4-methoxy-pseudoisocytidine, and 4-methoxy-1-methyl-pseudoisocytidine. In some embodiments, mRNA is 2-aminopurine, 2,6-diaminopurine, 7-deaza-adenine, 7-deaza-8-aza-adenine, 7-deaza-2-aminopurine, 7-deaza-8-aza-2-aminopurine, 7-deaza-2,6-diaminopurine, 7-deaza-8-aza-2,6-diaminopurine, 1-methyladenosine, N6-methyladenosine, N6-isopentenyladenosine, N6-(cis-hydroxyisopentenyl)adenosine, 2-methylthio-N6-(cis-hydroxyisopentenyl)adenosine, N6-glycinylcarbamoyladenosine, N6-threonylcarbamoyladenosine, 2-methylthio-N6-threonyl It comprises at least one nucleoside selected from the group consisting of carbamoyl adenosine, N6,N6-dimethyladenosine, 7-methyladenine, 2-methylthio-adenine, and 2-methoxy-adenine.In some embodiments, mRNA is inosine, 1-methyl-inosine, yosine, ybutosine, 7-deaza-guanosine, 7-deaza-8-aza-guanosine, 6-thio-guanosine, 6-thio-7-deaza-guanosine, 6-thio-7-deaza-8-aza-guanosine, 7-methyl-guanosine, 6-thio-7-methyl-guanosine, 7-methylinosine, 6-methoxy-guanosine, 1-methylguanosine, N2-methylguanosine, N2,N2-dimethylguanosine, 8-oxo-guanosine, 7-methyl-8-oxo-guanosine, 1-methyl-6-thio-guanosine, N2-methyl-6-thio-guanosine, and It comprises at least one nucleoside selected from the group consisting of N2,N2-dimethyl-6-thio-guanosine.

[0086] The sequence may or may not be uniformly modified over the entire length of the molecule. For example, one or more or all types of nucleotides (e.g., naturally occurring nucleotides, purines or pyrimidines, or any one or more of A, G, U, C, I, pU or all) may or may not be uniformly modified within the sequence or within a given predetermined sequence region. In some embodiments, the sequence contains pseudouridines. In some embodiments, the sequence contains inosine, which can help the immune system characterize the sequence as endogenous rather than viral RNA. The incorporation of inosine can also mediate improved RNA stability / reduced degradation. For example, refer to the literature incorporated in its entirety (Yu, Z. et al. (2015) RNA editing by ADAR1 marks dsRNA as “self”. Cell Res. 25, 1283-1284).

[0087] In some embodiments, one or more nucleotides of the RNA guide are 2'- O - It includes a methylphosphorothioate modification. In some embodiments, each of the first three nucleotides of the RNA guide is 2'- OIt includes a methylphosphorothioate modification. In some embodiments, each of the last four nucleotides of the RNA guide is 2'- O It includes a methylphosphorothioate modification. In some embodiments, the first, second, and third nucleotides from the end of the RNA guide are each 2'- O - It includes a methylphosphorothioate modification, and the last nucleotide of the RNA guide is not modified. In some embodiments, each of the first three nucleotides of the RNA guide is 2'- O - Containing a methylphosphorothioate modification, the first, second, and third nucleotides from the end of the RNA guide, respectively, are 2'- O - Includes methyl phosphorothioate modifications.

[0088] Where the gene editing system disclosed herein comprises a nucleic acid encoding the Cas12i polypeptide disclosed herein, e.g., an mRNA molecule, such nucleic acid molecule may comprise any of the modifications disclosed herein where applicable.

[0089] (d) Exemplary RNA Guide

[0090] In some examples, the RNA guide provided herein may include a direct repeat of SEQ ID NO. 12 and a spacer sequence having a length of 20 nucleotides specific to a target sequence (e.g., SEQ ID NO. 10) within exon 1 of the HAO1 gene. In some specific examples, the spacer sequence may consist of the nucleotide sequence of SEQ ID NO. 11. In some examples, the RNA guide may include a direct repeat sequence and a spacer sequence in the 5' to 3' direction.

[0091] In some specific examples, the RNA guide is as follows Ranking tableThe RNA guide may include (e.g., be composed thereof) the nucleotide sequence of SEQ ID NO. 13 provided in ). Alternatively, the RNA guide may be a variant of SEQ ID NO. 13 that includes (e.g., be composed thereof) a nucleotide sequence identical to SEQ ID NO. 13 by at least 80%, e.g., at least 85%, at least 90%, at least 95%, at least 97%, or more than SEQ ID NO. 13. In some examples, the variant of SEQ ID NO. 13 may include up to 5 nucleotide variations for SEQ ID NO. 13, e.g., up to 4, 3, 2, or 1 nucleotide variation for SEQ ID NO. 13.

[0092] The RNA guide provided herein may include one or more modifications such as those disclosed herein. In some embodiments, the modifications include 2'-O-methylation and / or phosphorothioate bonding. In some examples, these modifications may be located at the 5' end and / or 3' end of the RNA guide. One specific example is as follows: Ranking table It is sequence number 14 provided in.

[0093] C. Lipid Excipients and Lipid Nanoparticles (LNP)

[0094] In some embodiments, the HAO1 gene editing composition provided herein may comprise a lipid excipient, which may comprise one or more types of lipids, e.g., cationic lipids, phospholipids such as zwitterionic phospholipids, pegylated lipids, cholesterol, or a combination thereof. Nucleic acid components (mRNA and RNA guides) may be associated with the lipid excipient.

[0095] Lipid excipients can form lipid nanoparticles ("LNPs"), which are particles containing one or more lipids. In some embodiments, lipid nanoparticles may comprise a single-layer lipid membrane. Examples of such LNPs include micelles and reverse micelles. In other embodiments, LNPs may comprise a bilayer lipid membrane (e.g., liposomes). In yet another embodiment, LNPs are multilayer vesicles comprising a multilayer lipid bilayer. In yet another embodiment, LNPs may be solid lipid nanoparticles comprising a solid lipid core matrix capable of solubilizing lipophilic molecules. In some examples, solid lipid nanoparticles may also be used to solubilize molecules such as nucleic acids that can be encapsulated based on charge. In solid lipid nanoparticles, the lipid core may be stabilized by a surfactant (emulsifier), and cargo may be distributed into the lipid core.

[0096] The LNP disclosed herein refers to a particle that may have at least one dimension of the nanometer scale (e.g., 1–1,000 nm). The LNP may comprise a number of lipids, e.g., cationic lipids, ionizable lipids, anionic lipids, neutral lipids, amphiphilic lipids, conjugated lipids (e.g., pegylated lipids), amphiphilic lipids such as phospholipids, and / or cholesterol. In some embodiments, the LNP provided herein is included in a gene editing composition and is used to deliver an activator or therapeutic agent, such as a nucleic acid (e.g., mRNA), to a target site of interest (e.g., a cell, tissue, organ, tumor, etc.). In some embodiments, the activator or therapeutic agent, such as a nucleic acid (e.g., mRNA), may be encapsulated in an aqueous space surrounded by the lipid portion of the lipid nanoparticle or by part or all of the lipid portion of the lipid nanoparticle, thereby being protected from enzymatic degradation or other undesirable effects, e.g., harmful immune responses, induced by mechanisms of the host organism or cell.

[0097] In some embodiments, the LNP provided herein may include cationic lipids, neutral lipids (zwitterionic lipids), cholesterol, and pegylated lipids.

[0098] (a) cationic lipids

[0099] In some embodiments, the lipid excipient comprises one or more cationic lipids that are positively charged lipids.

[0100] "Cationic lipids" refer to lipids that can be positively charged. Exemplary cationic lipids contain one or more amine group(s) that carry a positive charge. Exemplary cationic lipids can be ionized to exist in a positively charged or neutral form depending on pH. The ionization of cationic lipids affects the surface charge of lipid nanoparticles under different pH conditions. These charge states can affect plasma protein adsorption, blood removal, and tissue distribution (Semple, SC, et al., Adv. Drug Deliv Rev 32:3-17 (1998)), as well as the ability to form an endosome-soluble non-bilayer structure critical for the intracellular delivery of nucleic acids (Hafez, IM, et al., Gene Ther 8:1188-1196 (2001)).

[0101] In one specific example, the cationic lipid is bis(2-butyloctyl) 10-(N-(3-(pyrrolidin-1-yl)propyl)nonanamido)nonadecandioate, and its structure is

[0102] , is a pharmaceutically acceptable salt or stereoisomer of it.

[0103] In some examples, the cationic lipid is an amino lipid. In some examples, the cationic lipid is the only amino lipid within the lipid excipients included in the HAO1 gene editing composition.

[0104] (b) Amphiphilic geology

[0105] In some embodiments, the lipid excipients disclosed herein comprise one or more amphiphilic lipids, namely lipids having a polar portion and a non-polar portion. Exemplary amphiphilic lipids suitable for use in the nanoparticles of this disclosure include, but are not limited to, sphingolipids, phospholipids, fatty acids, and amino lipids. In some examples, the lipid excipient comprises one or more phospholipids, for example, one or more saturated or (poly)unsaturated phospholipids or a combination thereof. Generally, the phospholipid comprises a phospholipid moiety and one or more fatty acid moietys.

[0106] In some examples, the phospholipids in the lipid excipients may be zwitterionic phospholipids. Examples include, but are not limited to, diacylphosphatidylcholine (or 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC)).

[0107] In some examples, the lipid excipient in the HAO1 gene editing composition provided herein comprises a zwitterionic phospholipid, which may be a DSPC.

[0108] (c) Pegylated lipids

[0109] In some embodiments, the lipid excipients disclosed herein comprise one or more pegylated lipids. The pegylated lipid (also known as PEG lipid or PEG modified lipid) is a lipid modified with polyethylene glycol.

[0110] In some examples, the lipid excipient in the HAO1 gene editing composition provided herein comprises a PEG lipid, which is 2-[2-(ω-methoxy(polyethylene glycol 2000)ethoxy]-N,N-ditetradecylacetamide, the structure of which is provided below:

[0111] (Average n=45-49, including both ends)

[0112] (d) Exemplary LNP

[0113] In some examples, the LNP may include (e.g., bis(2-butyloctyl) 10-(N-(3-(pyrrolidin-1-yl)propyl)nonanamido)nonadecandioate), zwitterionic phospholipids (e.g., DSPC), pegylated lipids (e.g., 2-[2-(ω-methoxy(polyethylene glycol 2000)ethoxy]-N,N-ditetradecylacetamide), and cholesterol (e.g., composed thereof). In certain examples, the molar ratio of cationic lipids to phospholipids is in the range of about 2:1 to about 8:1 and / or, the molar ratio of cationic lipids to cholesterol is in the range of about 2:1 to 1:1 and / or, or the molar ratio of cationic lipids to pegylated lipids is in the range of about 100:1 to about 25:1.

[0114] In some embodiments, the lipid excipient in the HAO1 gene editing composition may contain about 45-50 mol% of cationic lipids based on the total molar amount of lipid excipients in the LNP, e.g., about 45-48 mol%, about 46-49 mol%, about 47-48 mol%, or about 48-50% of cationic lipids. In some examples, the lipid excipient in the gene editing composition may contain about 47.5 ± 10% mol% of cationic lipids. In other examples, the lipid excipient in the gene editing composition may contain about 47.5 ± 5% mol% of cationic lipids. In one specific example, the lipid excipient in the gene editing composition may contain about 47.5 mol% of cationic lipids.

[0115] Alternatively or additionally, the lipid excipient in the HAO1 gene editing composition may comprise about 9-11 mol% of zwitterionic phospholipids based on the total molar amount of lipid excipients in the LNP, for example, about 9-10 mol%, about 9.5-10.5 mol%, or about 10-11 mol% of zwitterionic phospholipids. In another example, the lipid excipient in the gene editing composition may comprise about 10 ± 10 mol% of zwitterionic phospholipids. In yet another specific example, the lipid excipient in the gene editing composition may comprise about 10 ± 5 mol% of zwitterionic phospholipids. In some specific examples, the lipid excipient in the gene editing composition may comprise about 10 mol% of zwitterionic phospholipids.

[0116] Alternatively or additionally, the lipid excipient in the HAO1 gene editing composition may contain about 38-42 mol% of cholesterol, for example, about 38-40 mol%, about 39-41 mol%, about 39.5-41.5 mol%, or about 40-42 mol%, based on the total molar amount of the lipid excipient in the LNP. In some examples, the lipid excipient in the gene editing system may contain about 40 ± 10 mol% of cholesterol. In other examples, the lipid excipient in the gene editing system may contain about 40 ± 5 mol% of cholesterol. In one specific example, the lipid excipient in the gene editing system may contain about 40 mol% of cholesterol.

[0117] Alternatively or additionally, the lipid excipient in the HAO1 gene editing composition may comprise about 2.2–2.8 mol% of pegylated lipids based on the total molar amount of lipid excipients in the LNP, for example, about 2.2–2.5 mol%, about 2.4–2.6 mol%, or about 2.6–2.8 mol% of pegylated lipids. In some examples, the lipid excipient in the gene editing composition may comprise 2.5 ± 10 mol% of pegylated lipids. For example, the lipid excipient in the gene editing composition may comprise about 2.5 ± 5 mol% of pegylated lipids. In some specific examples, the lipid excipient in the gene editing composition may comprise about 2.5 mol% of pegylated lipids.

[0118] In one specific example, the lipid excipient comprises about 47.5 mol% of cationic lipid (e.g., bis(2-butyloctyl) 10-(N-(3-(pyrrolidin-1-yl)propyl)nonanamido)nonadecandioate), about 10 mol% of zwitterionic phospholipid (e.g., DSPC), about 40 mol% of cholesterol, and about 2.5 mol% of PEG lipid (e.g., 2-[2-(ω-methoxy(polyethylene glycol 2000)ethoxy]-N,N-ditetradecylacetamide).

[0119] The N / P ratio of LNP (where N represents the number of moles of cationic lipids and P represents the number of moles of phosphate present as part of the nucleic acid backbone) is in the range of 2:1 to 30:1, e.g., 3:1 to 22:1. In other embodiments, N / P is in the range of 6:1 to 20:1, 3:1 to 9:1, or 2:1 to 12:1. Exemplary N / P ranges include about 3:1, about 6:1, about 9:1, about 12:1, and about 22:1.

[0120] D. Exemplary HAO1 gene editing composition

[0121] In some embodiments, the HAO1 gene editing composition provided herein comprises an mRNA molecule encoding a Cas12i2 polypeptide as disclosed herein (e.g., SEQ ID NO. 7 or SEQ ID NO. 17), an RNA guide comprising a spacer sequence specific to SEQ ID NO. 10 in exon 1 of the human HAO1 gene and a direct repeat sequence of SEQ ID NO. 12, and a lipid excipient comprising a cationic lipid (which may be an amino lipid), a zwitterionic phospholipid, cholesterol, and a pegylated lipid. The lipid excipient forms an LNP, and the nucleic acid components (mRNA and RNA guide) are attached to or encapsulated by the LNP.

[0122] In some examples, the mRNA contains a nucleotide sequence that is at least 80% (e.g., at least 85%, at least 90%, at least 95%, at least 98% or more) identical to SEQ ID NO. 8. In one specific example, the mRNA may contain the nucleotide sequence of SEQ ID NO. 8.

[0123] In lipid excipients, cationic lipids are

[0124] It has the structure of, or is a pharmaceutically acceptable salt or stereoisomer thereof. Pegylated lipids are those with mean n of 45–49 (including both ends) (e.g., 45, 46, 47, 48, or 49). It can have a structure. The zwitterionic phospholipid is 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC).

[0125] In an exemplary HAO1 gene editing composition, the LNP may comprise, based on the total molar amount, 45-50 mol% (e.g., about 47.5 mol%) of cationic lipids, 9-11 mol% (e.g., about 10 mol%) of zwitterionic phospholipids, 38-42 mol% (e.g., about 40 mol%) of cholesterol, and 2.2-2.8 mol% (e.g., about 2.5 mol%) of pegylated lipids. In one specific example, the LNP may comprise, based on the total molar amount of the lipid excipients within the LNP, about 47.5 mol% of cationic lipids, about 10 mol% of zwitterionic phospholipids, about 40 mol% of cholesterol, and about 2.5 mol% of pegylated lipids.

[0126] In some examples, the mRNA includes UTRs that flank the coding sequence for the Cas12i2 polypeptide, e.g., a 5' UTR and a 3' UTR, and a poly A tail. In one specific example, the mRNA may include (e.g., consist of) the nucleotide sequence of SEQ ID NO. 23. Additionally, the mRNA may have a 5' cap, e.g., m7G(5')ppp(5')(2'OMeA)pG, and may include a pseudouridine residue in place of a uridine residue (e.g., 100%).

[0127] In some examples, the guide RNA may include the spacer sequence of SEQ ID NO. 11. Such guide RNA may include (e.g., consist of) the nucleotide sequence of SEQ ID NO. 13. The guide RNA may include one or more modifications, e.g., phosphorothioate linkage and 2'-O-methylation, which may be located at the 5' and / or 3' nucleotide. In one specific example, the guide RNA is presented at SEQ ID NO. 14.

[0128] In some examples, mRNA and RNA guides have a ratio of 1 ± 20% (e.g., 0.8 to 1.2) in the HAO1 gene editing composition. In some specific examples, the ratio is 1:1 (1.0).

[0129] In some examples, the HAO1 gene editing composition has a nitrogen:phosphate (N / P) ratio of 6.0 ± 20% (e.g., 6.0 ± 15%, 6.0 ± 10%, 6.0 ± 5%, 6.0 ± 2%, or 6.0 ± 1%), which represents the relative amounts of LNP and nucleic acid in the composition. In other examples, the HAO1 gene editing composition has a nitrogen:phosphate (N / P) ratio of 6.0 ± 1 (e.g., 6.0 ± 0.5). In some examples, the N / P ratio of the HAO1 gene editing composition provided herein is in the range of 5.18 to 7 (e.g., 5.6 or 6.0).

[0130] Generally, the N / P ratio can be calculated from the results of two tests: HPLC (for measuring amino lipid moles) and Ribogreen (for measuring total RNA moles). For details, see below. Example 1 It is provided in.

[0131] II. Manufacturing of Gene Editing Components

[0132] The present disclosure provides a method for preparing components of the gene editing system disclosed herein, for example, an RNA guide, a method for preparing a Cas12i polypeptide-coding mRNA, and a method for complexing the RNA guide and Cas12i mRNA with a lipid excipient.

[0133] A. RNA guide and Cas12i2 coding mRNA

[0134] In some embodiments, the RNA guide is prepared by in vitro transcription of a DNA template. Thus, for example, in some embodiments, the RNA guide is generated by in vitro transcription of a DNA template encoding the RNA guide and / or mRNA using an upstream promoter sequence (e.g., a T7 polymerase promoter sequence). In some embodiments, the DNA template codes for multiple guide RNAs, or the in vitro transcription reaction comprises multiple different DNA templates, each encoding a different guide RNA. In some embodiments, the DNA template codes for both the RNA guide and the mRNA molecule, and both can be generated as separate RNA molecules in vitro.

[0135] In some embodiments, mRNA is produced by in vitro transcription of a DNA template. In some examples, mRNA produced by in vitro transcription may undergo modifications, such as the addition of a 5'-cap (e.g., disclosed herein), according to methods known in the art. In some embodiments, a synthetic capping residue, a synthetic 5'-cap (e.g., disclosed herein), may be used in in vitro transcription so that the mRNA product may contain the synthetic 5'-cap. Alternatively or additionally, a modified nucleotide residue (e.g., a pseudouridine residue) may be used in in vitro transcription so that the modified nucleotide residue is incorporated into the mRNA product thus produced.

[0136] In some embodiments, the RNA guide is prepared using a chemical synthesis method. In some examples, the guide RNA may be synthesized using one or more modified nucleotides, for example as described above.

[0137] B. Nucleic acid-loaded LNP

[0138] In some embodiments, the HAO1 gene editing composition disclosed herein comprises a lipid excipient (e.g., one disclosed herein) that forms an LNP, and nucleic acid components (mRNA and gRNA) in the composition are attached to or encapsulated by the LNP to produce a nucleic acid-loaded LNP.

[0139] Various methods can be used to manufacture LNP. For example, the literature (Szoka et al., Ann. Rev. Biophys. Bioeng. 9:467 (1980), U.S. Patent No. 4,186,183, 4,217,344, 4,235,871, 4,261,975, 4,485,054, 4,501,728, 4,774,085, 4,837,028, 4,235,871, 4,261,975, 4,485,054, 4,501,728, 4,774,085, 4,837,028, 4,946,787, PCT Publication No. WO 91 / 17424, Deamer & Bangham, Biochim. Biophys. Acta See 443:629-634 (1976); Fraley, et al., PNAS 76:3348-3352 (1979); Hope et al., Biochim. Biophys. Acta 812:55-65 (1985); Mayer et al., Biochim. Biophys. Acta 858:161-168 (1986); Williams et al., PNAS 85:242-246 (1988); Hope et al., Chem. Phys. Lip. 40:89 (1986); Gregoriadis, Liposome Technology (1984). These conventional methods may be used to prepare LNPs having the lipid excipients disclosed herein. Any of these methods can be performed in the presence of nucleic acid components (mRNA and gRNA) of the gene editing composition, and the resulting lipid nanoparticles retain the nucleic acid to produce nucleic acid-loaded LNPs.

[0140] Lipid nanoparticles prepared according to any of the methods known in the art or disclosed herein may be analyzed (e.g., by NTA) to measure concentration and / or particle size distribution. Alternatively or additionally, lipid nanoparticles may be fractionated, and particles having a size suitable for use in the fusion method disclosed herein may be collected.

[0141] Additionally, nucleic acid-loaded LNPs may be analyzed to measure the N / P ratio in accordance with methods known in the art and / or the disclosures provided herein. The N / P ratio is the ratio of the number of moles (N) of cationic lipids to the number of moles (P) of phosphate present as part of the nucleic acid backbone.

[0142] LNP can be prepared by methods known in the art, for example, as disclosed in WO 2017 / 004143, which is incorporated herein by reference in its entirety. Briefly, cationic lipids, zwitterionic phospholipids, cholesterol, and pegylated lipids are solubilized in ethanol in molar ratios of 40-50:5-15:35-45:1-5, respectively. LNP is generally prepared with a total lipid to mRNA weight ratio of approximately 10:1 to 30:1. mRNA is diluted to 0.2 mg / mL in 10 to 50 mM citrate buffer (pH 4). Using a syringe pump, the ethanolic lipid solution is mixed with the mRNA aqueous solution in a ratio of approximately 1:5 to 1:3 (volume / volume), with a total flow rate greater than 15 ml / min. Subsequently, the ethanol is removed, and the external buffer is replaced with PBS by dialysis. Finally, the lipid nanoparticles are filtered through a 0.2 μm pore sterile filter.

[0143] III. Gene Editing of the HAO1 Gene and Treatment Methods for Primary Hyperoxaluria

[0144] Any of the HAO1 gene editing compositions disclosed herein may be used to genetically edit the HAO1 gene in a host cell. In some embodiments, the method comprises the step of introducing the HAO1 gene editing composition into a host cell. Such HAO1 gene editing compositions may comprise LNPs loaded with nucleic acids (mRNA / gRNA) as disclosed herein. In some examples, the HAO1 gene editing composition may be introduced into a host cell cultured in vitro. In other examples, the HAO1 gene editing composition described herein is delivered to a subject to genetically modify the HAO1 gene in the subject.

[0145] As used herein, the term “edit” refers to one or more modifications introduced into a target nucleic acid, for example, into the HAO1 gene. An edit may be one or more substitutions, one or more insertions, one or more deletions, or a combination thereof. As used herein, the term “substitution” refers to the replacement of a nucleotide or nucleotides with different nucleotides or nucleotides with respect to a reference sequence. As used herein, the term “insertion” refers to the acquisition of a nucleotide or nucleotides in a nucleic acid sequence with respect to a reference sequence. As used herein, the term “deletion” refers to the loss of a nucleotide or nucleotides in a nucleic acid sequence with respect to a reference sequence.

[0146] Any of the HAO1 gene editing compositions disclosed herein (e.g., comprising nucleic acid-loaded LNPs) or modified cells generated using such gene editing systems may be used to treat a disease that can benefit from gene editing of the HAO1 gene, e.g., primary hyperoxaluria (PH). In some embodiments, PH is PH1, PH2, or PH3. In a specific example, the target disease is PH1.

[0147] PH is a rare genetic disorder affecting subjects of all ages, from infants to the elderly. PH includes three subtypes involving genetic defects that alter the expression of three distinct proteins. PH1 is associated with alanine-glyoxylate aminotransferase, or AGT / AGT1. PH2 is associated with glyoxylate / hydroxypyruvate reductase, or GR / HPR, and PH3 is associated with 4-hydroxy-2-oxoglutarate aldolase, or HOGA.

[0148] In PH1, excess oxalate can also combine with calcium to form calcium oxalate in the kidneys and other organs. The deposition of calcium oxalate can lead to extensive deposition of calcium oxalate (nephrocalcinosis) or the formation of kidney and bladder stones (urolithiasis), which can result in kidney damage. Common renal complications in PH1 include blood in the urine (hematuria), urinary tract infections, kidney damage, and end-stage renal disease (ESRD). Over time, the kidneys of patients with PH1 may begin to decline in function, and blood oxalate levels may rise. The deposition of oxalate in tissues throughout the body, such as systemic oxalicosis, can occur due to high blood oxalate levels and cause complications in the bones, skin, and eyes. Patients with PH1 typically develop renal failure at an early age, and renal dialysis or a kidney / liver dual organ transplant is the only treatment option.

[0149] In some embodiments, a method for treating PH, e.g., PH1, in a subject requiring treatment (e.g., a human patient) is provided herein. The method may include the step of administering any HAO1 gene editing composition disclosed herein to a subject requiring treatment (e.g., a human patient). The HAO1 gene editing composition may be delivered to a specific tissue or a specific type of cell requiring gene editing. In some examples, the HAO1 gene editing composition comprises an LNP loaded with Cas12i2 coding mRNA and HAO1 targeting gRNA as also disclosed herein. In specific examples, the exemplary HAO1 gene editing composition disclosed above (e.g., see Section I, subsection D) may be used in the treatment method disclosed herein.

[0150] The HAO1 gene editing compositions disclosed herein may be manufactured, packaged, or sold in formulations for an appropriate route of administration, e.g., intravenously or another route of administration. The compositions of the present disclosure may be manufactured, packaged, or sold in bulk, as a single unit dose, or in multiple single unit doses. As used herein, a “unit dose” is an individual amount of a pharmaceutical composition (e.g., a gene editing system or a component thereof) to be administered to a subject, or a convenient amount of such a dose, e.g., half or one-third of such a dose.

[0151] In some embodiments, the HAO1 gene editing composition as disclosed herein may be administered to a subject in need thereof, for example, a subject suffering from liver disease associated with the HAO1 gene. In some examples, the gene editing composition may be delivered to a specific cell or tissue (e.g., liver cells), wherein the gene editing component may function to genetically modify the HAO1 gene within these cells.

[0152] Formulations of HAO1 gene-editing compositions suitable for parenteral administration may comprise pharmaceutically acceptable excipients (e.g., lipid excipients such as LNPs formed thereby) and a carrier, e.g., sterile water or sterile isotonic saline, combined with an activator (e.g., mRNA and gRNA encoding a nuclease). Such formulations may be manufactured, packaged, or sold in forms suitable for bolus or serial administration. Some injectable formulations may be manufactured, packaged, or sold in unit-dose forms, such as ampoules or multi-dose containers containing preservatives. Some formulations for parenteral administration include, but are not limited to, suspensions, solutions, emulsions, pastes, and implantable sustained-release or biodegradable formulations in oily or aqueous vehicles. Some formulations may further include one or more additional components, including but not limited to suspending agents, stabilizers, or dispersants.

[0153] HAO1 gene editing compositions may be in the form of sterile injectable aqueous or oily suspensions or solutions. These suspensions or solutions may be formulated according to known techniques and may contain additional components, such as dispersants, wetting agents, or suspending agents described herein, in addition to cells. These sterile injectable formulations may be prepared using non-toxic, parenterally acceptable diluents or solvents, such as water or saline solution. Other acceptable diluents and solvents include, but are not limited to, Ringer's solution, isotonic sodium chloride solution, and fixatives such as synthetic monoglycerides or diglycerides. Other useful parenterally administerable formulations include packaged forms, liposomal formulations, or those containing cells as components of biodegradable polymer systems. Some compositions for sustained release or implantation may contain pharmaceutically acceptable polymeric or hydrophobic materials, such as emulsions, ion exchange resins, poorly soluble polymers, or poorly soluble salts.

[0154] In some embodiments, an effective amount of the HAO1 gene editing composition disclosed herein (e.g., the exemplary HAO1 gene editing composition disclosed in Section I, sub-section D) may be administered to a human patient having PH (e.g., PH1) via an appropriate route, e.g., intravenous infusion, to treat a disease.

[0155] As used herein, the term “treating” refers to applying or administering a composition comprising one or more activators (here, nuclease-coding mRNA and HAO1-targeting gRNA) to a subject having a target disease or disorder (PH, such as PH1 in this disclosure), symptoms of the disease / disorder, or a predisposition to the disease / disorder, for the purpose of curing, healing, alleviating, reducing, changing, rescuing, ameliorating, improving, or affecting the disorder, symptoms of the disease, or predisposition to the disease or disorder.

[0156] Alleviating a target disease / disorder involves delaying the onset or progression of the disease, reducing disease severity, or extending survival. Alleviating the disease or extending survival does not necessarily require a curative outcome. As used herein, “delaying” the onset of a target disease or disorder means suspending, stopping, slowing, delaying, stabilizing, and / or postponing the progression of the disease. Such delay may be of varying lengths depending on the history of the disease and / or the individual being treated. A method of “delaying” or alleviating the onset of a disease, or a method of delaying the onset of the disease, is a method that reduces the probability of one or more symptoms of the disease developing within a given time frame and / or reduces the severity of symptoms within a given time frame compared to not using the method. Such comparisons are typically based on clinical studies using a sufficient number of subjects to provide statistically significant results.

[0157] "Onset" or "progression" of a disease refers to the initial signs and / or subsequent progression of the disease. Onset of the disease may be detected and evaluated using standard clinical techniques as is widely known in the art. However, onset may also refer to progression that may not be detected. For the purposes of this disclosure, onset or progression refers to the biological course of symptoms. "Onset" includes occurrence, recurrence, and initiation. As used herein, "initiation" or "occurrence" of a target disease or disorder includes an initial onset and / or recurrence.

[0158] As used herein, "effective dose" refers to the amount of each activator (e.g., nuclease-coding mRNA and HAO1-targeting gRNA) required to impart a therapeutic effect to the subject, either alone or in combination with one or more other activators. It will be obvious to those skilled in the art whether the amount of the HAO1 gene-editing composition produces a therapeutic effect. As recognized by those skilled in the art, the effective dose depends on the specific condition being treated, the severity of the condition, individual patient parameters including age, physical condition, size, sex, and weight, the duration of treatment, the characteristics of the combination therapy (if present), the specific route of administration, and similar factors within the knowledge and expertise of the medical professional. These factors are widely known to those skilled in the art and can be addressed through ordinary experimentation alone. In general, it is desirable to use the maximum dose of the individual components or a combination thereof—that is, the safest maximum dose based on sound medical judgment.

[0159] Empirical considerations, such as half-life, will generally contribute to dose determination. The frequency of administration may be determined and adjusted during the course of treatment, and is generally, but not necessarily, based on the treatment and / or suppression and / or improvement and / or delay of the target disease / disorder.

[0160] In one example, the dosage of the HAO1 gene editing composition as described herein, specifically the mRNA and gRNA components thereof, may be determined empirically in an individual who has received the composition one or more times. An increased dose of the agonist is administered to the individual. To evaluate the efficacy of the agonist, indicators of disease / disorder may be tracked.

[0161] In some embodiments, human PH patients may be administered the HAO1 gene editing composition disclosed herein at a dose of about 2.0-5.0 mg of nucleic acid (total of mRNA and gRNA) in the composition per kg of patient body weight.

[0162] Therapeutic efficacy may be evaluated through conventional medical practice. In some embodiments, host cells and / or subjects treated with an HAO1 gene editing composition may be examined for gene editing within the HAO1 gene, e.g., the percentage of indels within the HAO1 gene (e.g., at target sequence sites). Alternatively or additionally, to evaluate the results of HAO1 gene editing, HAO1 gene products (GO enzymes) and molecules involved in pathways catalyzed by GO enzymes, e.g., glycolates, glyoxylates, and / or oxalates, may be measured in subjects before and after treatment.

[0163] V. Kit and its uses

[0164] The present disclosure also provides a kit that can be used to perform the method described herein, for example, for genetic modification of the HAO1 gene. In some embodiments, the kit comprises components of the HAO1 gene editing composition disclosed herein, for example, mRNA encoding the Cas12i2 polypeptide, gRNA targeting the HAO1 gene, and lipid excipients. In some embodiments, the kit comprises an LNP loaded with mRNA and gRNA. Additionally, the kit may optionally include a buffer and / or instructions for use of the HAO1 gene editing composition.

[0165] In some embodiments, the kit may include instructions for use according to any method described herein. The included instructions may also include instructions for administering the HAO1 gene editing composition disclosed herein to treat, delay the onset of, or alleviate a target disease (such as PH1) as described herein. The kit may further include instructions for selecting a subject suitable for treatment based on determining whether the subject has the target disease.

[0166] Instructions for the use of the HAO1 gene editing composition generally include information regarding the dosage, administration schedule, and route of administration for the intended treatment. The container may be a unit dose, a large-volume package (e.g., a multi-dose package), or a sub-unit dose. Instructions provided in the kit of the present invention are typically written instructions on a label or package insert (e.g., a paper sheet included in the kit), but machine-readable instructions (e.g., instructions contained on a magnetic or optical storage disc) are also acceptable.

[0167] Labels or package inserts indicate that the composition is used to treat a target disease and / or delay its onset and / or alleviate it. Instructions for practicing any of the methods described herein may be provided.

[0168] The kit of the present invention is contained in suitable packaging. Suitable packaging includes, but is not limited to, vials, bottles, jars, flexible packaging (e.g., sealed Mylar or plastic bags), etc. Additionally, packaging for use in combination with specific devices, such as inhalers, nasal administration devices (e.g., nebulizers), or infusion devices such as minipumps, is also considered. The kit may have a sterile access port (e.g., the container may be an intravenous solution bag or a vial having a stopper that can be punctured by a subcutaneous injection needle). The container may also have a sterile access port (e.g., the container may be an intravenous solution bag or a vial having a stopper that can be punctured by a subcutaneous injection needle).

[0169] The kit may optionally provide additional components, such as buffers and interpretation information. Typically, the kit comprises a container and label or package insert(s) on or associated with the container. In some embodiments, the present disclosure provides a product comprising the contents of the above-described kit.

[0170]

[0171]

[0172]

[0173]

[0174]

[0175]

[0176]

[0177]

[0178]

[0179] · 2'-O-methyl phosphorothioate variant notation: *, phosphorothioate; m, 2' O-methyl

[0180] · Nucleotide sequences shown underlined and italicized refer to the 5' and 3' untranslated regions (UTR).

[0181] · "n" refers to or is absent from an adenosine(a) residue.

[0182] General skills

[0183] Practice of the present disclosure will utilize ordinary techniques of molecular biology (including recombinant techniques), microbiology, cell biology, biochemistry, and immunology within the scope of the art, unless otherwise indicated. Such techniques are sufficiently described in the following literature: Molecular Cloning: A Laboratory Manual, second edition (Sambrook, et al., 1989) Cold Spring Harbor Press; Oligonucleotide Synthesis (MJ Gait, ed. 1984); Methods in Molecular Biology , Humana Press; Cell Biology: A Laboratory Notebook(J. E. Cellis, ed., 1989) Academic Press; Animal Cell Culture (R. I. Freshney, ed. 1987); Introuction to Cell and Tissue Culture (J. P. Mather and P. E. Roberts, 1998) Plenum Press; Cell and Tissue Culture: Laboratory Procedures (A. Doyle, J. B. Griffiths, and D. G. Newell, eds. 1993-8) J. Wiley and Sons; Methods in Enzymology (Academic Press, Inc.); Handbook of Experimental Immunology (D. M. Weir and C. C. Blackwell, eds.): Gene Transfer Vectors for Mammalian Cells (J. M. Miller and M. P. Calos, eds., 1987); Current Protocols in Molecular Biology (F. M. Ausubel, et al. eds. 1987); PCR: The Polymerase Chain Reaction, (Mullis, et al., eds. 1994); Current Protocols in Immunology (J. E. Coligan et al., eds., 1991); Short Protocols in Molecular Biology (Wiley and Sons, 1999); Immunobiology (C. A. Janeway and P. Travers, 1997); Antibodies (P. Finch, 1997); Antibodies: a practice approach (D. Catty., ed., IRL Press, 1988-1989); Monoclonal antibodies: a practical approach (P. Shepherd and C.Dean, eds., Oxford University Press, 2000); Using antibodies: a laboratory manual (E. Harlow and D. Lane (Cold Spring Harbor Laboratory Press, 1999); The Antibodies (M. Zanetti and JD Capra, eds. Harwood Academic Publishers, 1995); DNA Cloning: A practical Approach, Volumes I and II (DN Glover ed. 1985); Nucleic Acid Hybridization (BD Hames & SJ Higgins eds. (1985≫; Transcription and Translation (BD Hames & SJ Higgins, eds. (1984≫; Animal Cell Culture (RI Freshney, ed. (1986) Immobilized Cells and Enzymes (lRL Press, (1986≫; and B. Perbal, A practical Guide To Molecular Cloning (1984); FM Ausubel et al. (eds.).

[0184] It is believed that those skilled in the art will be able to make the full use of the invention based on the foregoing description, without further detailed explanation. Accordingly, the specific embodiments described below should be interpreted merely as illustrative and are not intended to limit the remainder of the disclosure in any way. All disclosures cited herein are incorporated by reference for the purposes or subject matter referred to herein.

[0185] Examples

[0186] The following examples are provided to further illustrate some embodiments of the invention but are not intended to limit the scope of the invention; it will be understood from the exemplary nature thereof that other procedures, methodologies, or techniques known to those skilled in the art may be used alternatively.

[0187] Example 1: Efficacy and Tolerability of the HAO1 Gene Editing System in Vivo

[0188] This example evaluates the efficacy and tolerability of a gene editing system comprising Cas12i2 mRNA and HAO1 guide RNA. mRNA expressing the Cas12i2 protein and gRNA targeting HAO1 were loaded onto lipid nanoparticles.

[0189] Formation and treatment group

[0190] The composition of a specific treatment group is Table 1 It is listed in.

[0191]

[0192] LNP A comprises 47.5% cationic lipid bis(2-butyloctyl) 10-(N-(3-(pyrrolidin-1-yl)propyl)nonanamido)nonadecandioate, 10.0% phospholipid DSPC, 40.0% cholesterol, and 2.5% PEG lipid 2-[2-(ω-methoxy(polyethylene glycol 2000)ethoxy]-N,N-ditetradecylacetamide. LNP A was prepared according to the general procedures of WO 2017 / 004143, which is incorporated herein by reference for the subject and purposes mentioned herein.

[0193] LNP B was a comparative LNP containing lipid excipients different from LNP A.

[0194] The nitrogen:phosphate (N / P) ratio is calculated from the results of HPLC (for measuring the moles of amino lipids) and ribogrin (for measuring the moles of total RNA) as shown in the following mathematical formula:

[0195]

[0196] Animal handling protocol

[0197] A test composition containing nucleic acid-loaded LNP was administered to synomolgus (NHP) via intravenous infusion over 1 hour. Prior to the start of the study, the animals were acclimatized to laboratory conditions for a period of at least 14 days. Pre-treatment drugs containing dexamethasone 1 mg / kg, famotidine 0.5 mg / kg, and diphenhydramine 5 mg / kg were administered by intramuscular injection into the quadriceps muscle 1 day prior to administration and 60-90 minutes prior to administration.

[0198] The composition was diluted to an appropriate test dose concentration (total RNA mg / mL) using 0.9% sodium chloride as the vehicle to achieve an appropriate dose level (mg / kg / dose) at an infusion rate of 5 mL / kg / hr. The administration formulation was administered by IV infusion over a period of 1 hour (±5 min). The administration formulation was administered using a temporary catheter inserted into a peripheral vein connected to the infusion line. An appropriate volume was delivered by an infusion pump.

[0199] In some animals, additional doses of dexamethasone at 1 mg / kg were administered by intramuscular injection into the quadriceps femoris at 6 hours and approximately 24 hours after administration.

[0200] After administration, animals were monitored at least twice daily for morbidity, appetite level / food consumption, and other cage-related observations such as overall appearance and activity levels. Body weight was also monitored at 24, 72, and 168 hours after administration, and thereafter once a week throughout the study. Blood samples were also collected for serum chemistry and coagulation assays at different time points after injection. Exemplary biomarkers for testing are listed below. Table 2 It is listed in.

[0201]

[0202] The in-life portion of the NHP study was terminated at 3–4 weeks after administration. Animals were fasted overnight prior to termination. After the final blood collection, the animals were sedated, weighed, and then euthanized with an overdose of euthanasia solution. The animals were subjected to systemic perfusion with phosphate-buffered saline, and a complete gross examination and tissue collection were performed.

[0203] HAO1 Gene Editing: Indel% Determination

[0204] Liver tissues were collected at the end of the study to evaluate indel levels. Approximately 250 mg were collected from the tail, left, medial, and right hepatic lobes, flash-frozen in liquid nitrogen, and stored at -80°C. To extract DNA for indel analysis, 4 x 20 mg liver samples obtained from each of the four hepatic lobes were placed in 700 µL of Quick Extract solution, placed on ice, and homogenized under low-temperature conditions using a Qiagen TissueLyser II.

[0205] Next-generation sequencing (NGS) samples were prepared by two rounds of PCR. Round 1 (PCR1) was used to amplify specific genomic regions depending on the target. Round 2 PCR (PCR2) was performed to add Illumina adapters and indices. Subsequently, the reaction products were pooled and purified by column purification. Sequencing runs were performed using a 150-cycle NextSeq 500 / 550 Mid or High Output v2.5 kit or a 200-cycle NovaSeq 6000 SP or S1 reagent kit v1.5.

[0206] For NGS analysis, the indel mapping function utilized the sample's fastq file, amplicon reference sequence, and forward primer sequence. For each read, the kmer-scanning algorithm was used to calculate the editing operations (match, mismatch, insertion, deletion) between the read and the reference sequence. To eliminate small amounts of primer dimers present in some samples, the first 30 nts of each read had to match the reference sequence, and reads where more than half of the mapped nucleotides were mismatched were filtered out. Up to 50,000 reads that passed this filter were used for analysis, and those containing insertions or deletions were counted as indel reads. The QC criterion for the minimum number of reads passing the filter was 10,000.

[0207] For each target, the indel ratio, which refers to the percentage of NGS reads containing indels, was calculated for each sample and its corresponding no-template control.

[0208] Measurement of GO enzyme activity and glycolate

[0209] GO activity was measured by an HPLC-based assay that measures glyoxylate levels after adding a sodium glycolate substrate to liver tissue homogenates. In this assay, 25–50 mg of tissue was sonicated in a lysis buffer containing HEPES and 10% Triton-X. The liver lysate solution was incubated with a sodium glycolate master mix (100 mM Tris HCl, 5 mM Na₂Glycol) at 37°C for 15 minutes. After incubation, 5 M PCA was added, the sample was centrifuged for 5 minutes, and the supernatant was applied to HPLC to detect glyoxylate levels. Since GO (an enzyme encoded by the HAO1 gene) is responsible for the conversion of glycolate to glyoxylate, HAO1-edited samples are expected to have lower glyoxylate levels.

[0210] Serum glycolate levels were measured using ion chromatography-mass spectrometry (ICMS). Plasma was diluted approximately 10-fold with 13C2-glycolate. Plasma macromolecules were removed by centrifugation using a 0.4 ml Amicon Ultra 10 kD nominal molecular weight limit filter (Millipore Sigma). Ion chromatography was performed using an Integrion Reagent Free HPIC equipped with an AS-AP refrigerated automatic sample injector (Thermo Fisher), and mass spectrometry was performed using an ISQ-EC (Thermo Fisher).

[0211] summation

[0212] These results obtained from the aforementioned study demonstrate the effects of optimizing the guide, LNP, guide:mRNA ratio, N / P ratio, and nuclease variant on in vivo editing levels in NHP livers. The treatment exhibiting the highest indel level (average 60%) was LNP-A, which was loaded with mRNA of SEQ ID NO. 23 and HAO1 E1T2 guide RNA in a 1:1 ratio and had a total N / P ratio of approximately 6.0 (e.g., 5.64). Fig. 1 Refer to .

[0213] In addition, animals in the treatment group that achieved an average edit of over 55% were edited ( Fig. 2c ), GO activity( Fig. 2a ), and glycolate biomarker levels ( Fig. 2b It is indicated for individual animals. Two out of three animals exceeded indel levels of more than 55% (dots represent individual mesenchymal lobes). All animals showed a reduction in GO activity of more than 75% compared to the treatment group showing low indel (less than 5%). All animals showed increased glycolate levels.

[0214] These results demonstrate that treatment with LNP-A, loaded with Cas12i2 B coding mRNA (SEQ No. 23) and HAO1 gRNA 1 in a 1:1 ratio and having a total N / P ratio of about 6.0, can achieve a target indel ratio of over 55% and the accompanying decrease in GO activity and increase in glycolate required for physiologically meaningful results.

[0215] Example 2: In wild-type mice HAO1 Effects of gene editing

[0216] This example illustrates the effect of the mouse counterpart of the HAO1 gene editing composition provided herein in wild-type mice.

[0217] Animal handling protocol

[0218] A short-term PK study was performed on 6-8 week old male C57BL / 6 mice. The body weight of the mice was measured 3 days prior to administration. After a 30-minute incubation period at room temperature, whole blood was centrifuged at 2,000 xg for 10 minutes. Plasma was pipetted into an Eppendorf collection tube and stored at -80℃.

[0219] On the day of administration, LNP (LNP A) loaded with Cas12i2 mRNA A (SEQ No. 18) (coding for Cas12i2 polypeptide A of SEQ No. 17) and a mouse HAO1 guide (mA*mG*mA*AAUCCGUCUUUCAUUGACGGUGAAGCACUGAUCGGAC*mA*mU*mG, SEQ No. 19) was delivered via tail vein injection; retroorbital injection may also be used. The mRNA / gRNA-loaded LNP was administered at 2.5 mg RNA per kg of body weight. Necropsy and tissue collection were performed as follows Table 3 As shown in [figure], it was performed at various points in time after processing.

[0220] To enable maximum blood collection, whole blood was collected via cardiac puncture using an insulin syringe equipped with a needle. The tissue was perfused with PBS through the superior vena cava using a 10 ml syringe fitted with a 23-gauge needle. Upon completion of perfusion, the spleen and two individual hepatic lobes were collected and rapidly frozen on dry ice. For histology, a third hepatic lobe was collected, placed in 10% NBF for 24–48 hours, and then transferred to 70% ethanol. Whole blood was processed as described above.

[0221]

[0222] This study Hao1 It was demonstrated that editing the gene to an indel level exceeding 55% induces a reduction of more than 90% in GO protein. The decrease in GO protein is correlated with an eightfold increase in plasma glycolate. These studies Hao1 This suggests that 55% gene editing can have physiologically beneficial effects. Fig. 3 Refer to .

[0223] Example 3 - In AGXT- / - mice (PH1 model) HAO1 Gene editing research: Model for PH1.

[0224] To understand the in vivo pharmacological effects of HAO1 editing, the aforementioned mRNA / gRNA-loaded LNPs were administered to alanine-glyoxylate aminotransferase-deficient (AGXT- / -) mice, a PH1 disease model. (Salido et al., Proc. Natl. Acad. Sci. USA,(2006) 103(48):18249-18254) is referenced, and its related disclosures are incorporated herein by reference for the subject and purpose. AGXT- / - mice exhibit complete loss of expression of both AGXT mRNA and protein and show hyperoxaluria (a 3-4 fold increase in urinary oxalates) compared to control broodmates. Male AGXT- / - mice aged 15-20 weeks were provided with a low-oxalate diet and housed in standard cages on days 1-7. On days 8-11, the mice were acclimatized to metabolic cages. Baseline urine and serum were collected on days 15-18. On days 19-20, one of two doses (low dose: 1.5 mg / kg; high dose: 3.0 mg / kg) was administered to the animals. Serum and urine were subsequently collected weekly, and the study was terminated on day 40. During the autopsy, final blood collection was performed via cardiac puncture, and PBS perfusion was performed for tissue collection.

[0225] HAO1 protein measurement

[0226] GO protein levels were measured using Jess Simple Western (Protein Simple). Approximately 50 mg of liver tissue was added to 400 µL of RIPA buffer containing a 1X protease inhibitor and homogenized using a Qiagen tissue homogenizer. The sample was centrifuged, and the supernatant was collected. Concentrations were determined using the BCA assay. The sample was standardized to 1 mg / mL and mixed with fluorescent master mix (Protein Simple, PS-ST01EZ-8). The sample was denatured by incubating at 65°C for 5 minutes. Luminol-S / peroxide, primary, and secondary antibodies were prepared for the detection of GO protein and Vinculin as a loading control. The sample was loaded onto Jess Simple Western for protein measurement.

[0227] HAO1 Gene Editing: Indel% Determination

[0228] Liver tissues were collected at the end of the study to evaluate indel levels. Approximately 250 mg samples were collected from the tail, left, medial, and right hepatic lobes, flash-frozen in liquid nitrogen, and stored at -80°C. To extract DNA for indel analysis, approximately 20 mg liver samples obtained from each of the four lobes were placed in 700 µL of Quick Extracts solution, placed on ice, and homogenized under low-temperature conditions using a Qiagen Tissuer II. NGS was performed as previously described.

[0229] Next-generation sequencing (NGS) samples were prepared by two rounds of PCR. Round 1 (PCR1) was used to amplify specific genomic regions depending on the target. Round 2 PCR (PCR2) was performed to add Illumina adapters and indices. Subsequently, the reaction products were pooled and purified by column purification. Sequencing runs were performed using a 150-cycle NextSeq 500 / 550 mid or high output v2.5 kit or a 200-cycle NovaSeq 6000 SP or S1 reagent kit v1.5.

[0230] For NGS analysis, the indel mapping function utilized the sample's fastq file, amplicon reference sequence, and forward primer sequence. For each read, the kmer-scanning algorithm was used to calculate the editing operations (match, mismatch, insertion, deletion) between the read and the reference sequence. To eliminate small amounts of primer dimers present in some samples, the first 30 nts of each read had to match the reference sequence, and reads where more than half of the mapped nucleotides were mismatched were filtered out. Up to 50,000 reads that passed this filter were used for analysis, and those containing insertions or deletions were counted as indel reads. The QC criterion for the minimum number of reads passing the filter was 10,000.

[0231] For each target, the indel ratio, which refers to the percentage of NGS reads containing indels, was calculated for each sample and its corresponding template-free control.

[0232] Biological test

[0233] GO enzyme activity and glycolate levels were tested as described above.

[0234] Urinary oxalate levels were measured by intact cell mass spectrometry (ICMS). Briefly, urine was acidified with 300 mM HCl, centrifuged to remove any particulate matter, and then diluted more than 20-fold with an internal standard of 13C2-oxalate (final concentration 5 micromolar). Ion chromatography was performed using an ICS-5000+ equipped with an AS-AP refrigerated automatic sample injector (Thermo Fisher), and mass spectrometry was performed using an ISQ-EC (Thermo Fisher).

[0235] result

[0236] The results are intrahepatic mice Hao1 It demonstrates that in vivo gene editing is dose-dependent ( Fig. 4a Also, in vivo Hao1 The efficient editing of induces more than 8 times glycolate ( Fig. 4b ) and removal of GO enzyme activity in the liver ( Fig. 4c It leads to ). Also, in the mouse Hao1 Gene editing induces a reduction of approximately 40% in urinary oxalate levels, which correlates with a decrease in urinary oxalate to the therapeutic range. Fig. 4d ).

[0237] Example 4 - AGXT - / - Long-term persistence of HAO1 gene editing, glycolate induction, and urinary oxalate levels in mice

[0238] This example is a C57BL / 6 alanine glyoxylate aminotransferase knockout ( Agxt- / - Cas12i2 B mRNA loaded on lipid nanoparticles (SEQN 23) and mouse-specific used at a single dose of 1.5 mg / kg in mice Hao1 composition containing gRNA Hao1 We explore the persistence of indel formation and the resulting pharmacodynamic effects.

[0239] Alanine glyoxylate aminotransferase is a hepatic peroxisomal enzyme that catalyzes the transfer of amino groups between L-alanine and glyoxylate to produce pyruvate and glycine, and is important for glyoxylate detoxification. A deficiency of this enzyme causes primary hyperoxaluria type I (Pey et al., 2013. Biomed Res Int. 687658). Agxt - / - The mouse Agxt The expression of both mRNA and protein was completely lost, and compared to control broodmates, hyperoxaluria (a 3 to 4-fold increase in urine oxalates) was exhibited (Salido et al., Proc. Natl. Acad. Sci. USA, (2006) 103(48):18249-18254), liver Hao1 It enables the detection of a decrease in urine oxalate induced by editing.

[0240] Due to the species specificity of gRNA in the test composition, mouse in vivo studies consist of the same LNP A and Cas12i2 B mRNA, but Hao1 A mouse targeting exon 1 Hao1 A murine surrogate using different gRNAs targeting the 20-nucleotide sequence of the gene was used.

[0241] Research Design and Methods

[0242] cock Agxt - / - Recall the mouse Example 3 They were reared under the same conditions as disclosed in. Baseline urine and serum were collected on days 15–18. Liver Hao1To evaluate the persistence of editing and oxalate reduction, Agxt - / - Mice were intravenously administered 1.5 mg / kg of the test composition or saline, and after 3 or 9 months Hao1 Editing and urine oxalate levels were measured. Males aged 14 to 17 weeks (at the time of administration) Agxt - / - Mice were treated with a single bolus dose of the test composition via retroorbital injection and monitored for 12 months.

[0243] Hao1 Gene editing and urine oxalate levels were analyzed according to the methods disclosed herein. For example, the above Example 3 Refer to .

[0244] result

[0245] A. Indel between the whole

[0246] Agxt - / - Significant levels of liver as measured by NGS 3 months after administration of a test composition at a dose of 1.5 mg / kg in mice Hao1 Editing was observed, and this level of editing persisted in animals evaluated at 6 months ( Fig. 5a ).

[0247] B. Urine oxalate

[0248] treated with saline solution Agxt - / - Urinary oxalate in mice did not change from baseline at 3 or 6 months ( Fig. 5b Urinary oxalate levels in the group treated with the 1.5 mg / kg test composition decreased at 3 months, and no further decrease in urinary oxalate levels was observed from 3 to 6 months after administration ( Fig. 5b The decrease in urinary oxalate was statistically significant at both time points compared to the saline control group.

[0249] Example 5 - Disease prevention in child subjects

[0250] This embodiment relates to the liver as a juvenile animal grows into an adult. Hao1 Evaluate the persistence of editing and the prevention of urinary oxalate accumulation.

[0251] Research Design and Methods

[0252] babyhood Agxt - / - As the mouse grows into an adult, the liver Hao1 To evaluate the persistence of editing and the reduction in urinary oxalates, children at 3 weeks of age Agxt - / - 2.0 mg / kg of the test composition was administered intravenously (IV) to mice, and the pharmacodynamic (PD) effects were evaluated. Hao1 Editing was evaluated at 1, 5, and 9 weeks after administration, and urinary oxalates were measured only at the 9-week mark in both mice treated with the test composition and mice treated with saline. Since adequate amounts of urine could not be collected at baseline from juvenile animals 3 weeks old prior to administration and the onset of the disease 12 weeks prior was not fully characterized, only urinary oxalates were measured at 9 weeks (12 weeks old) after administration.

[0253] By insertion / deletion analysis Hao1 For gene editing decisions, genomic DNA was extracted from primary tissues, and a library was prepared by two rounds of polymerase chain reaction (PCR). Subsequently, samples were pooled, column purified, and sequenced using Illumina. ExamplesRefer to [reference]. To detect low-level edits exceeding the background level, a window analysis was performed using only 20 nucleotides centered on the Cas12i2 cleavage site. In the window analysis, indels identified by NGS were removed if their length was 1 nt or if they did not overlap at least partially with the 20-nt window centered on the predicted non-target strand cleavage site. This filtering step increased the sensitivity of the analysis by reducing background signals from regions outside the cleavage site or signals potentially caused by sequencing errors. Urinary oxalate levels were measured by intact cell mass spectrometry (ICMS).

[0254] result

[0255] A. Indel between the whole

[0256] High levels 1 week after administration of the test composition at a dose of 2.0 mg / kg in mice Hao1 Editing was observed, and these levels of editing were consistently maintained until 5 and 9 weeks after administration ( Fig. 6a ). Observed across the 1-week, 5-week, and 9-week administration groups Hao1 There was no statistical difference in editing. Fig. 6a ).

[0257] B. Urine oxalate

[0258] After 3 months of administration, in the group administered a dose of 2.0 mg / kg of the test composition, treated with saline solution Agxt - / - A statistically significant 55% reduction in urinary oxalate was observed compared to mice ( Fig. 4b ).

[0259] In summary, these studies when 2.0 mg / kg was administered Agxt - / - liver in mice Hao1It demonstrates the persistence of editing and the reduction of urinary oxalates. The results of this study are from a juvenile mouse model representative of PH1 disease biology. Agxt - / - Treating mice with the test composition results in continuous liver as the animals grow into adults. Hao1 It indicates that it leads to the prevention of editing and urinary oxalate accumulation.

[0260] Example 6 - Persistence of HAO1 editing after partial hepatectomy in mice

[0261] This example involves the disclosed Cas12i2 B mRNA loaded with lipid nanoparticles and mouse-specific Hao1 mediated by a test composition containing gRNA Hao1 The persistence of editing is explored with a single dose of 2.0 mg / kg after intentional liver injury in male C57BL / 6 WT mice.

[0262] Research Design and Methods

[0263] Male C57BL / 6 mice aged 6 to 8 weeks were treated with a single bolus dose of 2 mg / kg of the test composition via retroorbital injection, and 30 to 70% hepatectomy or mock surgery was performed 10 days later. Liver biopsies were collected during surgery and at the study endpoint 28 days later. GO protein expression was evaluated in both liver biopsies to detect the persistence of test composition-mediated indel and GO protein knockdown after intentional hepatectomy. Serum albumin, a protein synthesized by hepatocytes, was measured as a marker of liver size before surgery and at the study endpoint.

[0264] GO enzyme activity was evaluated in liver samples collected at autopsy using an HPLC-based method. This assay measures glyoxylate levels after adding a sodium glycolate substrate to liver tissue homogenates. 25–50 mg of tissue was sonicated in a lysis buffer containing HEPES and 10% Triton-X. The liver lysate solution was incubated with a sodium glycolate master mix (100 mM Tris HCl, 5 mM Na₂Glycol) at 37°C for 15 minutes. After incubation, 5 M PCA was added, the sample was centrifuged for 5 minutes, and the supernatant was analyzed by HPLC to measure glyoxylate levels. GO ( Hao1 Since the enzyme encoded by the gene is responsible for the conversion of glycolate to glyoxylate, Hao1 The edited sample is expected to have lower glyoxylate levels.

[0265] result

[0266] Compared to negative control animals, liver GO protein expression was significantly reduced by approximately 88% in both resected liver biopsies collected during hepatectomy and endpoint livers collected 28 days after surgery ( Fig. 7 There was no difference in GO protein expression between the resected liver and the end-stage liver of animals that underwent hepatectomy.

[0267] This study investigated the liver induced by an HAO1 gene editing composition after 30 to 70% hepatectomy in wild-type mice. Hao1 It demonstrates the persistence of editing and GO protein knockdown. Significant gene editing levels exceeding 50% were detected in livers collected during surgery and 28 days post-surgery. Both biopsies showed an approximately 88% reduction in GO protein expression compared to negative control mice. Additionally, similar levels of serum albumin were detected in both the hepatectomy and mock surgery groups at both pre-surgery and endpoints.

[0268] In conclusion, the data show that treatment with the HAO1 gene editing composition in WT mice is significant and sustained for 28 days after intentional hepatectomy Hao1 It indicates that it causes indel and GO protein knockdown.

[0269] Example 7 - Evaluation of HAO1 Gonadal Delivery in Female Mouse Offspring Treated with HAO1 Editing Composition

[0270] This example involves the aforementioned Cas12i2 B mRNA loaded onto lipid nanoparticles and mouse-specific Hao1 We explored the germline delivery potential of a test composition containing gRNA and in the offspring of administered female C57BL / 6 WT mice Hao1 Determines the indel frequency.

[0271] Research Design and Methods

[0272] Female C57BL / 6 mice (n=38) were used to... Hao1 A test composition containing a gRNA surrogate was administered at a single IV dose of 5 mg / kg. This dose was on-target in mouse livers Hao1 It is five times the saturation dose for editing. Administered females were paired with untreated males two weeks after administration (two females per male). Tail biopsies were collected from each pup and genotyped to Hao1 The editing of was evaluated. The pharmacological activity of the test composition was confirmed in mothers, and the average between mothers Hao1 The level of redundancy was 56.3%. Inherited across a total of 583 offspring from 36 administered mothers (2-3 offspring per mother) Hao1 The presence of indels was analyzed (an indel frequency of 50% is expected, and this level is that the animal Hao1 Indicates heterozygosity with respect to knockdown).

[0273] Hao1 Gene editing and urine oxalate levels were analyzed according to the methods disclosed herein. For example, the above Example 3Refer to [link]. To detect low-level edits exceeding the background level, a window analysis was performed using only 20 nucleotides centered on the Cas12i2 cleavage site. In the window analysis, indels identified by NGS were removed if their length was 1 nt or if they did not overlap at least partially with the 20-nt window centered on the predicted non-target strand cleavage site. This filtering step increased the sensitivity of the analysis by reducing background signals from regions outside the cleavage site or signals potentially caused by sequencing errors.

[0274] result

[0275] Of the 583 offspring, 0 were positive for maternal gonadal transfer, and all animals showed less than 1% redundancy. A summary of gonadal transfer from mother to offspring administered with the test composition is Table 4 It is provided at an average level of approximately 56.31% in the maternal liver. Hao1 Although indels were present, they were present in the livers of administered female mice Hao1 It demonstrates that the likelihood of gonadal transmission of the indel occurring in the offspring is low. Based on the power analysis performed, the estimated number of offspring is 1.0% Hao1 It provides more than 99% power to detect gonadal delivery frequency and more than 80% power to detect gonadal delivery frequency of 0.3%.

[0276]

[0277] Other modes of implementation

[0278] All features disclosed herein may be combined in any combination. Each feature disclosed herein may be replaced by an alternative feature that achieves the same, equivalent, or similar purpose. Accordingly, unless expressly stated otherwise, each disclosed feature is merely one example belonging to a general family of equivalent or similar features.

[0279] From the foregoing description, those skilled in the art can easily identify the essential features of the present invention and may vary and modify the invention to adapt it to various uses and conditions without departing from the spirit and scope thereof. Accordingly, other embodiments are also included within the scope of the claims.

[0280] Equalities

[0281] Although various inventive embodiments have been described and illustrated herein, those skilled in the art will readily conceive various other means and / or structures to perform the functions described herein and / or obtain results and / or one or more advantages, and each such variation and / or modification is deemed to fall within the scope of the inventive embodiments described herein. More generally, those skilled in the art will readily understand that all parameters, dimensions, materials, and configurations described herein are exemplary, and that actual parameters, dimensions, materials, and / or configurations will vary depending on the specific application or fields of application in which the guidance of the invention is utilized. Those skilled in the art will be able to recognize or identify numerous equivalents to the specific inventive embodiments described herein by ordinary experimentation alone. Accordingly, the foregoing embodiments are presented merely as examples, and it should be understood that within the scope of the appended claims and equivalents, the inventive embodiments may be practiced differently from those specifically described and claimed. The inventive embodiments of this disclosure relate to each individual feature, system, article, material, kit, and / or method described herein. Additionally, any combination of two or more of these features, systems, articles, materials, kits, and / or methods is included within the inventive scope of this disclosure, provided that such features, systems, articles, materials, kits, and / or methods are not contradictory to one another.

[0282] All definitions defined and used herein shall be understood to take precedence over dictionary definitions, definitions in documents included by reference, and / or the ordinary meaning of the defined terms.

[0283] All references, patents, and patent applications disclosed herein are incorporated by reference in relation to the subject matter for which they are cited, and in some cases, may encompass the entire document.

[0284] The indefinite articles "a" and "an" as used in this specification and claims should be understood to mean "at least one" unless explicitly indicated otherwise.

[0285] The phrase “and / or” as used in this specification and claims should be understood to mean “either one or both” of the elements thus combined, that is, elements that exist combined in some cases and separately in others. Multiple elements listed together with “and / or” should be interpreted in the same way, that is, “one or more” of the elements thus combined. Other elements other than those specifically identified by the phrase “and / or” may optionally exist, whether or not they are related to the specifically identified elements. Accordingly, as a non-limiting example, when used with open language such as “comprising,” a reference to “A and / or B” may refer to only A (optionally including elements other than B) in one embodiment; only B (optionally including elements other than A) in another embodiment; or both A and B (optionally including other elements) in yet another embodiment.

[0286] The term “or” as used in this specification and claims should be understood to have the same meaning as the “and / or” defined above. For example, when separating items from a list, “or” or “and / or” should be interpreted to mean the comprehensive, that is, the inclusion of at least one of the multiple elements or lists, as well as the inclusion of more than one, and optionally the inclusion of additional items not listed. Only terms that clearly indicate the opposite, such as “only one of” or “exactly one of” or, when used in the claims, “consisting of”, will refer to the inclusion of exactly one of the multiple elements or lists. In general, the term “or” as used herein should be interpreted to indicate an exclusive alternative (i.e., “either one of the two and not both”) only when preceded by an exclusive term such as “one of the two,” “one of,” “only one of,” or “exactly one of.” When used in the claims, “consisting of” will have the ordinary meaning used in the field of patent law.

[0287] As used in this specification and claims, with respect to a list of one or more elements, the phrase “at least one” should be understood to mean at least one element selected from any one or more of the elements within the list of elements, and does not necessarily include at least one of each and all of the elements specifically listed within the list of elements, nor exclude any combination of the elements within the list of elements. This definition also allows for the optional existence of elements other than the specifically identified elements within the list of elements referred to by the phrase “at least one,” regardless of whether they are related to the specifically identified elements. Accordingly, as a non-limiting example, “at least one of A and B” (or equivalently “at least one of A or B”, or equivalently “at least one of A and / or B”) may refer to at least one A, including optionally more than one where B is absent (and optionally includes elements other than B); and in another embodiment, may refer to at least one B, including optionally more than one where A is absent (and optionally includes elements other than A); In another embodiment, at least one A including optionally more than one, and at least one B including optionally more than one (and optionally including other elements) may be referred to.

[0288] The term “about” or “approximately” means within an acceptable range of error for a specific value as determined by a person skilled in the art, which will depend in part on the manner in which the value is measured or determined, i.e., the limitations of the measurement system. For example, “about” may mean within an acceptable standard deviation according to the practice of the art. Alternatively, “about” may mean a range of up to ±20%, preferably up to ±10%, more preferably up to ±5%, and even more preferably up to ±1% of a given value. Alternatively, particularly in relation to biological systems or processes, this term may mean within a single digit of the value, preferably within two times. Where a specific value is described in this application and claims, unless otherwise specified, the term “about” is implied and, in this context, means within an acceptable range of error for that specific value. In some embodiments, the hinge domain is a hinge domain of a naturally occurring protein.

[0289] Furthermore, it should be understood that in any method claimed herein comprising more than one step or act, unless otherwise clearly indicated, the order of the steps or acts of the method is not necessarily limited to the order in which the steps or acts of the method are listed.

Claims

Claim 1 A composition for gene editing of a hydroxy acid oxidase 1 (HAO1) ​​gene, comprising: (a) messenger RNA (mRNA) encoding the Cas12i2 polypeptide presented in SEQ ID NO. 7, having a nucleotide sequence at least 80% identical to SEQ ID NO. 8; (b) guide RNA (gRNA) having the nucleotide sequence of SEQ ID NO. 13; and (c) a lipid excipient comprising 45-50 mol% cationic lipid, 9-11 mol% zwitterionic phospholipid, 38-42 mol% cholesterol, and 2.2-2.8 mol% pegylated lipid; wherein the cationic lipid It has the structure of, or is a pharmaceutically acceptable salt or stereoisomer thereof; and the pegylated lipid is A composition having the structure, wherein the mean n is 45-49 including both ends; and the zwitterionic phospholipid is 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC). Claim 2 A composition according to claim 1, wherein the mRNA comprises a nucleotide sequence that is at least 85% identical to SEQ ID NO.

8. Claim 3 A composition according to claim 1, wherein the mRNA comprises a nucleotide sequence that is at least 90% identical to SEQ ID NO.

8. Claim 4 A composition according to any one of claims 1 to 3, wherein the lipid excipient comprises 47.5 mol% of the cationic lipid, 10 mol% of the zwitterionic phospholipid, 40 mol% of the cholesterol, and 2.5 mol% of the pegylated lipid. Claim 5 A composition according to any one of claims 1 to 4, wherein the mRNA comprises a 5' cap moiety and a 3' polyadenylated tail. Claim 6 A composition according to any one of claims 1 to 5, wherein the mRNA comprises one or more modified nucleotides comprising pseudouridine; optionally, the mRNA comprises pseudouridine residues at 75% or more of the uridine positions within the mRNA. Claim 7 In claim 6, the composition wherein the mRNA comprises pseudouridine residues at all uridine positions within the mRNA. Claim 8 A composition according to any one of claims 1 to 7, wherein the mRNA comprises the nucleotide sequence of SEQ ID NO.

23. Claim 9 A composition according to claim 8, wherein the mRNA comprises a 5' cap moiety and pseudouridine residues at all uridine positions within the mRNA. Claim 10 A composition according to any one of claims 1 to 9, wherein the gRNA comprises one or more modifications. Claim 11 In claim 10, the composition wherein the gRNA comprises phosphorothioate bonding and 2'-O-methylation. Claim 12 In claim 11, the above modification is a composition located at the 5' and / or 3' nucleotide. Claim 13 A composition according to claim 1, wherein the gRNA comprises the nucleotide sequence of SEQ ID NO.

14. Claim 14 A composition according to any one of claims 1 to 13, wherein the nitrogen:phosphate (N / P) ratio in the composition is in the range of 3 to 9. Claim 15 A composition according to claim 14, wherein the N / P ratio in the composition is 6.0±1.

0. Claim 16 A composition according to claim 15, wherein the N / P ratio in the composition is 6.0±0.

5. Claim 17 A composition according to claim 15, wherein the N / P ratio in the composition is about 6.

0. Claim 18 A composition according to any one of claims 1 to 17, wherein the mRNA:gRNA ratio is 1.0 ± 20%. Claim 19 A composition according to claim 18, wherein the mRNA:gRNA ratio is about 1.

0. Claim 20 A method for gene editing the HAO1 gene in a subject, comprising the step of administering an effective amount of a composition for gene editing the HAO1 gene presented in any one of claims 1 to 19 to a subject requiring gene editing of the hydroxy acid oxidase 1 (HAO1) ​​gene. Claim 21 In paragraph 20, the method is a human subject having primary hyperoxaluria (PH). Claim 22 In paragraph 21, the method wherein the human subject has a pH of 1.

Images