Gene therapy for patients with fanconi anemia

Abstract

The present invention provides a composition and a method for rescuing FANCA expression in cells where FANCA gene products are reduced or absent. In particular, a method and a composition for gene therapy for Fanconi anemia are disclosed.

Description

Technology Field

[0001] Related applications

[0002] This application claims priority to U.S. Provisional Application No. 62 / 385185 filed September 8, 2016 and U.S. Provisional Application No. 62 / 412.028 filed October 24, 2016, the contents of which are incorporated herein by reference in their entirety.

[0003] Field of invention

[0004] The present invention generally involves one or more FANCA It concerns the transfer of genes into cells in which protein activity from coding proteins is reduced or absent.

[0005] Description regarding ranking

[0006] The sequence list related to this application is provided in text format instead of a paper copy and is incorporated herein by reference. The name of the text file containing the sequences is ROPA_002_01WO_ST25.txt. The text file is 46KB, was created on September 8, 2017, and is submitted as an electronic file via EFS-WEB. Background Technology

[0007] Fanconi anemia (FA) is an autosomal recessive disease (with the exception of X-linked complement group FA-B), and the median survival time for patients is 24 years (Butturini A, et al . (1994) Blood 84: 1650-1655; Kutler D.I., et al.(2003) Blood 101: 1249-1256). At birth, the blood levels of these patients are generally normal. Macrocytosis is often the first hematological abnormality detected in these patients. This usually progresses to thrombocytopenia, anemia, and pancytopenia. Bone marrow failure (BMF) is generally observed in these patients 5 to 10 years later, with the average age of hematological disease onset being 7 years. Approximately 80% of FA patients will develop signs of BMF within the first 10 years of their lives. According to epidemiological studies to date, if malignant symptoms do not appear prior to aplasia, virtually all FA patients will develop BMF before the age of 40 (Butturini A, et al . (1994) Blood 84:1650-1655; Kutler D.I., et al. (2003) Blood 101: 1249-1256), this is the main cause of mortality in these patients.

[0008] Due to the complex clinical characteristics of FA, the management of these patients is primarily focused on improving the following syndromes: bone marrow failure (BMF), myeloid leukemia, and solid tumors.

[0009] Current treatment methods involve androgens such as those composed of fluoxymesterone, oxymetholone, or stanozolol. According to a recent review by Dufour and his colleagues (Dufour, C. and Svahn, J. (2008). Bone Marrow Transplant(41 Suppl 2: S90-95), FA patients may show some response to androgens unless this treatment is initiated at a very advanced stage of the disease. About 75% of patients respond to androgens. Combination with prednisolone at 2 mg / kg / day reduces the risk of hepatotoxicity. Generally, in the absence of a suitable bone marrow donor, androgens may be considered as an alternative treatment if some hematopoietic function remains, but they are not a definitive long-term treatment.

[0010] Tischkowitz et al. It was pointed out that while patients with FA in the early stages may respond to androgens, the majority of FA patients are refractory to this treatment in the long term (Tischkowitz, M. and Dokal, I. (2004). Br J Haematol 126: 176-191).

[0011] There are no specific indications for hematopoietic growth factors in the treatment of FA. However, drugs from two pharmacological groups have been identified as having indications for the specific symptoms of FA (anemia and neutropenia): 1) erythropoietin and 2) granulocyte-colony stimulating factors (G-CSFs). Several erythropoietins (e.g., Aranesp, Nespo, Exjade) are approved for the treatment of anemia, and G-CSFs (e.g., G-CSF analogs, such as filgrastim, biogastrin, and neulasta, have been approved for the treatment of neutropenia. Although hematopoietic growth factors such as erythropoietin and granulocyte-colony-stimulating factor were tested in a limited number of FA patients, the response was partial and transient (Dufour et al.(2008). Currently, these treatments are not considered good long-term options. For the short-term treatment of patients with neutropenia, G-CSFs are used for acute infections to increase the number of peripheral neutrophils, thereby enhancing the effect of antibiotics. However, such drug treatment is far from providing reliable management for FA patients.

[0012] Currently, the only therapeutic treatment for the hematological symptoms of this disease is based on the transplantation of allogeneic hematopoietic cells. While outcomes for FA patients receiving grafts from HLA-identical sibling donors are generally satisfactory, only about 20% of FA patients will have HLA-identical siblings. A significant proportion of FA patients without sibling donors can receive transplants from other alternative donors, but these transplants are associated with higher morbidity and mortality. For the remaining FA patients, there are currently no alternative treatment methods.

[0013] Therefore, there is still an important need for an effective therapeutic regimen for FA. The present invention addresses this need and more. The problem to be solved

[0014] Embodiments of the present invention include a polynucleotide cassette for enhanced FANCA expression. In some embodiments, the polynucleotide cassette is a codon-optimized human to increase the stability of mRNA at transcription. FANCA cDNA contains a sequence that encodes.

[0015] In one embodiment, the present invention comprises an expression cassette comprising, in 5' to 3' order: (a) a human phosphoglycerate kinase (PGK) promoter sequence or a functional homolog or variant thereof; (b) a sequence encoding a human FANCA polypeptide or a functional fragment or variant thereof; and (c) a polynucleotide sequence comprising a Woodchuck hepatitis virus regulatory element (WPRE) RNA export signal sequence or a functional variant or fragment thereof, wherein the sequence encoding the human FANCA polypeptide or a functional fragment or variant thereof is operably linked to the PGK promoter sequence. In a specific embodiment, the FANCA polypeptide or a functional fragment or variant thereof comprises the sequence disclosed in SEQ ID NO: 25; the sequence encoding the FANCA polypeptide or a functional fragment or variant thereof comprises the sequence disclosed in SEQ ID NO: 8; and the PGK promoter comprises the nucleotide sequence of SEQ ID NO: 7 and / or; The WPRE element comprises the nucleotide sequence of SEQ ID NO: 23. In a specific embodiment, the cassette comprises a region of the nucleotide sequence of SEQ ID NO: 24. In a specific embodiment, the cassette further comprises one or more enhancer sequences, a polypurine track (PPT) or polyadenylation (polyA) signal sequence, a packing signal sequence, a truncated Gag sequence, and a Rev response element (RRE); a central polypurine track (cPPT), a central termination sequence (CTS), and / or, optionally, an upstream sequence element (USE) (SV40-USE) derived from monkey virus 40.

[0016] In one embodiment, the present invention provides an expression cassette comprising: a) a promoter sequence; b) a sequence encoding a polypeptide; and c) a polynucleotide sequence containing a ribonucleic acid (RNA) release signal, wherein the promoter sequence is operably linked to a sequence encoding a FANCA polypeptide (SEQ: 25), and optionally a)-c) are present in the 5' to 3' order in the expression cassette. In a specific embodiment, the promoter is a phosphoglycerate kinase (PGK) promoter. In a specific embodiment, the sequence encoding the polypeptide is codon-optimized. In some embodiments, the sequence encoding the polypeptide is a codon-optimized version of human FANCA cDNA, at least 85% identical to SEQ: 8. In a specific embodiment, the RNA release signal is a mutated post-transcriptional regulatory element (wPRE) of Woodchuck's hepatitis virus.

[0017] In certain embodiments, the mutated wPRE is a chimeric wPRE comprising a sequence having at least 80% identity with SEQ ID NO: 23. In some embodiments, the expression cassette further comprises one or more enhancer sequences. In some embodiments, the expression cassette further comprises a polypurine track (PPT) or a polyadenylation (polyA) signal sequence. In some embodiments, the expression cassette further comprises one or more of the following sequences: i) a packing signal sequence; ii) a truncated Gag sequence; iii) a Rev response element (RRE); iv) a central polypurine track (cPPT); v) a central termination sequence (CTS); and vi) an upstream sequence element (USE) (SV40-USE), optionally derived from monkey virus 40. In some embodiments, the expression cassette further comprises 5' and 3' long terminal repeat (LTR) sequences.

[0018] In a related embodiment, the present invention provides a recombinant gene delivery vector comprising the expression cassette disclosed herein. In a specific embodiment, the recombinant gene delivery vector is a virus or a viral vector. In a specific embodiment, the virus or viral vector is a lentivirus (LV).

[0019] In other related embodiments, the present invention provides a cell comprising the expression cassette or gene transfer vector disclosed herein. In some embodiments, the cell is a blood cell. In some embodiments, the cell is an erythrocyte. In some embodiments, the cell is a bone marrow cell, e.g., a lineage-depleted bone marrow cell. In specific embodiments, the cell is a hematopoietic stem cell or a CD34 + It is a cell. In some embodiments, the cell is a hematopoietic stem cell. In some embodiments, the cell is a CD34+ hematopoietic stem cell. In some embodiments, the cell is a committed hematopoietic erythrocyte progenitor cell.

[0020] In a related embodiment, the present invention provides a pharmaceutical composition comprising a pharmaceutically acceptable excipient and the recombinant gene delivery vector or cell disclosed herein. In a specific aspect of the invention, a pharmaceutical composition comprising the polynucleotide cassette of the present invention and a pharmaceutical excipient is provided. In another embodiment, the pharmaceutical composition comprises the gene delivery vector and the pharmaceutical excipient of the present invention.

[0021] The method and composition are gene therapy vector compositions comprising these genetic expression cassettes for use in the manufacture of agents useful for focused and targeted gene therapy for diseases, disorders, and dysfunctions in animals and particularly in humans, e.g., It is provided for the use of virus vectors.

[0022] In another embodiment, the present invention provides a method for treating or preventing a disease or disorder of a subject in need thereof, comprising providing the subject with the expression cassette, gene delivery vector, or pharmaceutical composition disclosed herein.

[0023] In another embodiment, the present invention comprises a method for treating Fanconi anemia in a subject in need of such anemia, comprising providing the subject with the pharmaceutical composition disclosed herein.

[0024] In a related embodiment, the present invention provides a CD34 comprising an expression cassette to a subject + A method for treating Fanconi anemia in a subject requiring this, comprising providing cells, wherein the expression cassette comprises, in 5' to 3' order: (a) a human phosphoglycerate kinase (PGK) promoter sequence or a functional homolog or variant thereof; (b) a sequence encoding a human FANCA polypeptide or a functional fragment or variant thereof; (c) a polynucleotide sequence comprising a Woodchuck hepatitis virus regulatory element (WPRE) RNA export signal sequence or a functional variant or fragment thereof, wherein the sequence encoding the human FANCA polypeptide or a functional fragment or variant thereof is operably linked to the PGK promoter sequence. In a specific embodiment, CD34 + Cells were obtained from the subject. In a specific embodiment, CD34+ cells were obtained from the subject after treating the subject with a combination of (i) G-CSF or filgrastim; and (ii) plerixaphor. In a specific embodiment, CD34 + Cells were transfected with a recombinant gene delivery vector containing an expression cassette. In one embodiment, CD34 + The cell is CD34 + Cells were transduced by contacting them with a recombinant gene transfer vector for about 24 hours.

[0025] In another embodiment, the present invention provides a method for treating Fanconi anemia in a subject requiring the same, comprising the following steps: (a) mobilizing CD34+ cells within a subject by providing the subject with a combination of (i) G-CSF or filgrastim; and (ii) plerixaphor; (b) obtaining a biological sample containing CD34+ cells from the subject, wherein the biological sample is optionally peripheral blood or bone marrow; (c) preparing a cell population enriched with CD34+ cells from the biological sample; (d) arranging the cell population enriched with CD34+ cells in 5' to 3' order: (i) a promoter sequence or a functional homolog or variant thereof; and (ii) a step of transfecting with a recombinant gene delivery vector comprising an expression cassette comprising a polynucleotide sequence including a sequence encoding a human FANCA polypeptide or a functional fragment or variant thereof, wherein said sequence encoding the human FANCA polypeptide or a functional fragment or variant thereof is operably linked to a PGK promoter sequence, and the transfected cell population enriched with CD34+ cells is brought into contact with a lentivirus vector for about 24 hours; and (e) a step of supplying the lentivirus-transfected cell population obtained from step (d) to a target. In a specific embodiment, the preparation of the cell population is the depletion of red blood cells and / or CD34 by positive selection, negative selection, or a combination thereof. + It includes cell thickening. In a specific embodiment, the method inhibits the onset of hematological signs of Fanconi anemia in a subject, stops the progression thereof and / or reverses the progression thereof. In a specific embodiment, the hematological signs of Fanconi anemia are selected from one or more of BMF, thrombocytopenia, leukopenia, pancytopenia, neutropenia, and anemia.

[0026] Other features and advantages of the present invention will become apparent from the following detailed description and claims. means of solving the problem

[0027] The present invention generally relates to the fields of molecular biology and virology, and in particular to a gene expression cassette and a vector containing the same that are useful for delivering nucleic acid segments encoding selected therapeutic constructs (e.g., peptides, polypeptides, ribozymes, and catalytic RNA molecules) to selected cells and tissues of vertebrates. In particular, these genetic constructs are useful for gene therapy for the treatment of diseases, disorders, and dysfunctions in mammals, particularly in humans, related to dysregulation of the FANCA gene product.

[0028] In a specific embodiment, the present invention provides a composition and a method for gene therapy for patients with Fanconi anemia (FA). In particular, a composition and a method for rescuing FANCA gene expression are provided. The specific method disclosed herein relates to the use of a lentiviral vector for delivering human FANCA to hematopoietic progenitor cells of a target having FA, particularly FA-A.

[0029] definition

[0030] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as generally understood by those skilled in the art to which the present invention pertains. Methods and materials similar or equivalent to those described herein may be used in the practice of the present invention, but suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated in their entirety. In the event of a conflict, this specification shall prevail, including definitions. Furthermore, the materials, methods, and embodiments described herein are merely illustrative and are not intended to be limiting.

[0031] As used herein, the term “vector” refers to a macromolecule or an association of macromolecules that may be used to mediate the delivery of a polynucleotide to a cell, comprising or associated with a polynucleotide. Exemplary vectors include, for example, plasmids, viral vectors (e.g., retroviral vectors such as lentiviral vectors), liposomes, and other gene delivery vehicles.

[0032] The term "LV" is an abbreviation for lentivirus and may be used to refer to the virus itself or its derivatives. Unless otherwise required, this term includes all subtypes and both naturally occurring and recombinant forms.

[0033] As used herein, the terms “gene” or “coding sequence” refer to a sequence of nucleotides in vitro or in vivo that encodes a gene product. In some cases, a gene consists of or is essentially composed of a coding sequence, that is, a sequence that encodes a gene product. In other cases, a gene includes additional, non-coding sequences. For example, a gene may or may not include intervening sequences (introns) between individual coding segments (exons), as well as regions before and after the coding region, e.g., a 5’ untranslated (5’ UTR) or “leader” sequence and a 3’ UTR or “trailer” sequence.

[0034] As used herein, “therapeutic gene” refers to a gene that, when expressed, confers a beneficial effect upon the cell or tissue in which it exists, or upon the mammal in which the gene is expressed. Examples of beneficial effects include the improvement of signs or symptoms of a condition or disease, the prevention or suppression of a condition or disease, or the conferment of a desired trait. Therapeutic genes include genes that correct genetic defects in cells or mammals.

[0035] As used herein, a transgene is a gene that is delivered to a cell by a vector.

[0036] As used herein, the term “gene product” refers to a desired expression product of a polynucleotide sequence, such as a polypeptide, peptide, protein, or interfering RNA including small interfering RNA (siRNA), miRNA, or small hairpin RNA (shRNA).

[0037] As used herein, the terms “polypeptide,” “peptide,” and “protein” refer to polymers of amino acids of any length. The terms also include amino acid polymers modified, for example, by disulfide bond formation, glycosylation, lipidation, phosphorylation, or conjugation with labeling components.

[0038] "Comprising" means that while the cited elements are required, for example, in a composition, method, kit, etc., other elements may be included within the scope of the claim to form, for example, a composition, method, kit, etc. For example, an expression cassette "comprising" a gene encoding a therapeutic polypeptide operably linked to a promoter is an expression cassette that may include elements other than the gene and the promoter, for example, a poly-adenylation sequence, an enhancer element, another gene, a linker domain, etc.

[0039] "Essentially composed of" means a limitation to the scope of, for example, a composition, method, kit, etc., described in a specific material or step, for example, a composition, method, kit, etc., that does not substantially affect the basic and novel properties. For example, an expression cassette "essentially comprising" a gene encoding a therapeutic polypeptide operably linked to a promoter and a polyadenylation sequence may include additional sequences, for example, a linker sequence, provided that such sequences do not substantially affect the transcription or translation of these genes. As another example, a polypeptide fragment, variant or variant "essentially composed" of the cited sequence, has about 10 more or fewer amino acid residues at the boundary of the sequence based on the whole length of the naive polypeptide from which it originated, or, for example, has 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 residue fewer than the cited boundary amino acid residue, or has a sequence of 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 more amino acid residues than the cited boundary amino acid residue.

[0040] "Consisting of" means the exclusion of any composition, method, or kit of any element, step, or component not specified in the claims. For example, an expression cassette "consisting of" a gene encoding a therapeutic polypeptide operably linked to a promoter and a post-transcriptional regulatory element consists only of the promoter, the polynucleotide sequence encoding the therapeutic polypeptide, and the post-transcriptional regulatory element. As another example, a polypeptide "consisting of" a cited sequence comprises only the cited sequence.

[0041] As used herein, "expression vectors" include vectors containing a polynucleotide encoding a gene product of interest, e.g., plasmids, mini-circles, viral vectors, liposomes, and as discussed above or known in the art, and are used to influence the expression of a gene product in intended target cells. Expression vectors also include regulatory elements operably linked to the coding region to promote the expression of the gene product in the target. For example, regulatory elements such as promoters, enhancers, UTRs, miRNA targeting sequences, and genes or combinations of genes to which they are operably linked for expression are often referred to as "expression cassettes." Many such regulatory elements are known and available in the art or can be easily constructed from components available in the art.

[0042] The term "promoter" as used herein comprises a DNA sequence that directs the binding of RNA polymerase and thereby promotes RNA synthesis, i.e., a minimal sequence sufficient to direct transcription. The expression of the promoter and the corresponding protein or polypeptide may be ubiquitous, meaning it is strongly active across a wide range of cells, tissues, and species, or cell-type specific, tissue-specific, or species-specific. The promoter may be "constitutive," meaning it is continuously active, or "inducible," meaning the promoter may be activated or deactivated by the presence or absence of biotic or abiotic factors. Additionally, an enhancer sequence, which may or may not be adjacent to the promoter sequence, is included in the nucleic acid construct or vector of the present invention. The enhancer sequence influences promoter-dependent gene expression and may be located at the 5' or 3' site of the original gene.

[0043] An "enhancer" as used herein comprises a cis-acting element that stimulates or inhibits the transcription of an adjacent gene. An enhancer that inhibits transcription is also called a "silencer." The enhancer can function in both directions over distances of up to several kilobase pairs (kb) from downstream locations of the coding sequence and transcription region (i.e., can be associated with the coding sequence).

[0044] "Termination signal sequence" as used herein includes any genetic element that causes RNA polymerase to terminate transcription, e.g., a polyadenylation signal sequence.

[0045] As used herein, the terms “operably linked” or “operably linked” refer to parallels of genetic elements, e.g., promoters, enhancers, termination signal sequences, polyadenylation sequences, etc., which are in a relationship that allows them to operate in an expected manner. For example, if a promoter assists in the transcription initiation of a coding sequence, the promoter is operably linked to the coding region. As long as this functional relationship is maintained, there may be a residue interposed between the promoter and the coding region.

[0046] As used herein, the term “heterogeneous” means derived from an individual that is genotype-distinct from the remainder of the individual being compared. For example, a polynucleotide introduced into a plasmid or vector derived from another species by genetic engineering techniques is a heterogeneous polynucleotide. As another example, a promoter removed from the original coding sequence and operatively linked to a coding sequence that is not naturally linked to it is a heterogeneous promoter. Thus, for example, an LV vector containing a heterogeneous nucleic acid encoding a heterogeneous gene product is an LV vector containing a nucleic acid not typically contained in naturally occurring wild-type LVs, and the encoded heterogeneous gene product is a gene product not typically encoded by naturally occurring wild-type LVs.

[0047] The term “endogenous” as used herein in relation to nucleotide molecules or gene products refers to nucleic acid sequences, e.g., genes or genetic elements, or gene products such as RNA, proteins, that occur naturally or are associated in a host virus or cell.

[0048] The term “original” as used herein refers to a nucleotide sequence present in a wild-type virus or cell, e.g., a gene, or a gene product such as RNA or protein.

[0049] The term “variant” as used herein refers to a variant of a reference polynucleotide or polypeptide sequence, e.g., a polynucleotide or polypeptide sequence, i.e., a variant having less than 100% sequence identity with respect to the reference polynucleotide or polypeptide sequence. In other words, the variant comprises at least one amino acid difference (e.g., amino acid substitution, amino acid insertion, amino acid deletion) with respect to the reference polynucleotide sequence, e.g., the original polynucleotide or polypeptide sequence. For example, the variant may be a polynucleotide having at least 70%, e.g., 75% or 80%, e.g., 85%, 90%, or 95%, e.g., 98% or 99% sequence identity with respect to the original polynucleotide sequence of its full length. As another example, the variant may be a polypeptide having at least 70%, e.g., 75% or 80%, e.g., 85%, 90% or 95%, e.g., 98% or 99% sequence identity with the original polypeptide sequence of its entire length. The variant also includes a variant fragment of the reference, e.g., an original sequence sharing at least 70% sequence identity with the reference fragment, e.g., a variant fragment having at least 75% or 80%, e.g., 85%, 90% or 95%, e.g., 98% or 99% identity with the original sequence.

[0050] As used herein, the terms “biological activity” and “biologically active” refer to activities attributed to specific biological elements within a cell. For example, the “biological activity” of an “immunoglobulin,” “antibody,” or a fragment or variant thereof refers to the ability to bind to an epitope and thereby promote immune function. As another example, the biological activity of a polypeptide or a functional fragment or variant thereof refers to the ability of the polypeptide or its functional fragment or variant to perform its inherent functions, such as binding or enzymatic activity. As a third example, the biological activity of a gene regulatory element, such as a promoter, enhancer, or Cozack sequence, refers to the ability of the regulatory element or its functional fragment or variant to regulate the expression of a gene operably linked to it, that is, to promote, enhance, or activate its translation.

[0051] As used herein, the terms “administering” or “introducing” refer to the delivery of a vector for recombinant protein expression to a cell, a target’s cell and / or organ, or a target. Such administration or introduction may occur in vivo, in vitro, or in vitro. A vector for the expression of a gene product may be introduced into a cell by transfection, which typically means inserting heterologous DNA into a cell by physical means (e.g., calcium phosphate transfection, electroporation, microinjection, or lipofection); infection, which typically means introduction by an infectious agent, i.e., a virus; or transduction, which typically means stable infection of a cell by a virus or the transfer of genetic material from one microorganism to another by a viral agent (e.g., a bacteriophage).

[0052] "Transformation" is commonly used to refer to bacteria containing heterologous DNA or cells that express oncogenes and are thus converted into a continuous growth mode similar to tumor cells. The vector used to "transform" the cells can be a plasmid, virus, or other vehicle.

[0053] Typically, cells are referred to as "transduced," "infected," "transfected," or "transformed" depending on the means used for administering, introducing, or inserting xenogeneic DNA (i.e., a vector) into the cell. The terms "transduced," "transfected," and "transformed" may be used interchangeably herein regardless of the method of introducing xenogeneic DNA.

[0054] As used herein, the term "host cell" refers to a cell that has been transfected, infected, transfected, or transformed by a vector. The vector may be a plasmid, a viral particle, a phage, etc. Culture conditions, such as temperature and pH, are those previously used with the host cells selected for expression and will be obvious to those skilled in the art. The term "host cell" will be understood to mean the original transfected, infected, transfected, or transformed cell and its offspring.

[0055] Terms such as "treatment" and "treating" are used herein to mean obtaining a desirable pharmacological and / or physiological effect. Such effect may be prophylactic in that it completely or partially prevents the disease or its symptoms, e.g., by reducing the likelihood of the disease or its symptoms occurring in the subject, and / or therapeutic in that it partially or completely cures the disease and / or adverse effects attributable to the disease. As used herein, "treatment" includes the treatment of a disease in mammals and includes: (a) preventing the occurrence of the disease in subjects who are susceptible but not yet diagnosed with it; (b) suppression of the disease, i.e., inhibiting its onset; or (c) remission of the disease, i.e., causing the regression of the disease. Therapeutic agents may be administered before, during, or after the onset of the disease or injury. Treatment of an ongoing disease is particularly important if the treatment stabilizes or reduces the patient's undesirable clinical symptoms. Such treatment is preferably performed before the complete loss of function in the affected tissue. Treatment of the subject will preferably be administered during the symptomatic phase of the disease, and in some cases, after the symptomatic phase of the disease.

[0056] The terms “individual,” “host,” “subject,” and “patient” are used interchangeably herein and refer to mammals, including but not limited to human and non-human primates, including humans and monkeys; mammalian sports animals (e.g., horses); mammalian farm animals (e.g., sheep, goats, etc.); mammalian pets (dogs, cats, etc.); and rodents (e.g., mice, rats, etc.). The terms used herein are merely for describing specific embodiments and are not intended to limit the invention. As used herein, the singular forms “one,” “one,” and “he” are intended to include the plural forms unless the context otherwise indicates. Additionally, the terms “comprising,” “comprising,” “having,” “to have,” “to have,” or variations thereof are intended to be inclusive in a manner similar to the term “comprising,” to the extent that they are used in the detailed description and / or claims.

[0057] The term “about” or “approximately” means within an acceptable range of error for a specific value as determined by a person skilled in the art, which will depend in part on how the value is measured or determined, i.e., the limits of the measurement system. For example, “about” may mean a standard deviation of within 1 or greater than 1 according to the practice of the art. Alternatively, “about” may mean a range of 20% or less of a given value, preferably 10% or less, more preferably 5% or less, and even more preferably 1% or less. Alternatively, particularly in relation to biological systems or processes, this term may mean within 10 times the value, preferably within 5 times, and more preferably within 2 times. Where a specific value is stated in the specification and claims, unless otherwise noted, the term “about” means within an acceptable range of error for said specific value.

[0058] Unless otherwise specified, the practice of the present invention utilizes the ordinary techniques of cell biology, molecular biology (including recombination techniques), microbiology, biochemistry, and immunology, which are within the scope of those skilled in the art. Such techniques are, for example, "Molecular Cloning: A Laboratory Manual", second edition (Sambrook et al. , 1989); “Oligonucleotide Synthesis” (MJ Gait, ed., 1984); “Animal Cell Culture” (RI Freshney, ed., 1987); “Methods in Enzymology” (Academic Press, Inc.); “Handbook of Experimental Immunology” (DM Weir & CC Blackwell, eds.); “Gene Transfer Vectors for Mammalian Cells” (JM Miller & MP Calos, eds., 1987); “Current Protocols in Molecular Biology” (FM Ausubel et al. , eds., 1987); "PCR: The Polymerase Chain Reaction", (Mullis et al. , eds., 1994); and “Current Protocols in Immunology” (JE Coligan et al. This is described in detail in literature such as , eds., 1991), each of which is explicitly incorporated herein by reference.

[0059] Various aspects of the present invention are described below with reference to exemplary applications for illustrative purposes. It should be understood that many specific details, relationships, and methods are disclosed to provide a complete understanding of the present invention. However, those skilled in the art will readily recognize that the present invention may be practiced without one or more specific details or in other ways. The present invention is not limited by the described order of actions or events, as some actions may occur in different orders and / or simultaneously with other actions or events. Furthermore, not all described actions or events are required to implement the method according to the present invention.

[0060] Unless otherwise indicated, all terms used herein have the same meaning as understood by those skilled in the art, and the practice of the present invention will utilize the ordinary techniques of microbiology and recombinant DNA technology, which are within the scope of knowledge of those skilled in the art.

[0061] In specific embodiments, the present invention discloses a polynucleotide, a polynucleotide cassette, and an expression vector for the expression of a gene in a cell. Additionally, pharmaceutical compositions and methods are provided for using any composition to promote the expression of a gene in a cell, for example, in an individual, for example, for the treatment or prevention of a disorder. These and other objects, advantages, and features of the present invention will become apparent to those skilled in the art by understanding the details of the compositions and methods described in more detail below.

[0062] In a specific embodiment, the method and composition are, for example, This gene therapy vector composition, such as a viral vector, containing these gene expression cassettes is provided for use in the manufacture of agents useful for intensive and targeted gene therapy for diseases, disorders, and dysfunctions in animals and especially in humans.

[0063] In some embodiments, the present invention FANCA We provide a gene therapy for Fanconi anemia based on an LV vector containing an hPGK eukaryotic promoter that induces cDNA expression. This therapeutic vector can be used to transfect human hematopoietic stem cells (HSCs), which can then be transplanted into humans with Fanconi anemia.

[0064] In a specific embodiment, the present invention provides an FNACA LV vector for the genetic correction of Fanconi anemia. Collectively, the results suggest the feasibility of gene therapy for FA using an LV designed for clinical application.

[0065] The disclosed compositions can be used in various investigation, diagnostic, and therapeutic regimens, including the prevention and treatment of various human diseases. Various compositions and methods of the present invention are described below.

[0066] While specific compositions and methods are exemplified herein, it is understood that a number of alternative compositions and methods are applicable and suitable for use in carrying out the invention. Furthermore, it will be understood that the expression constructs and methods of the invention can be evaluated using standard procedures in the art.

[0067] Fanconi anemia

[0068] Fanconi anemia (FA) is a rare inherited chromosomal instability syndrome characterized primarily by bone marrow failure (BMF) and a predisposition to cancer (Butturini A et al . Blood. 1994; 84: 1650-1655; Kutler D.I. et al. Blood. 2003; 101: 1249-1256.). The prevalence of FA is 1–5 per million people, and the frequency of heterozygous carriers is estimated to be 1 in 300 (Tamary H et al. Eur J Haematol. 2004; 72: 330-335).

[0069] FA is heterogeneous both genetically and phenotypically. To date, 13 complement groups associated with mutations in the corresponding 13 Fanconia Anemia Complementation group (FANC) genes have been reported (FA-A, B, C, D1, D2, E, F, G, I, J, L, M, and N): FANCA , FANCB , FANCC , FANCD1 / BRCA2 , FANCD2 , FANCE , FANCF , FANCG / XRCC9 , FANCI , BRIP1 / FANCJ , FANCL , FANCM / Hef and FANCN / PABLB2 (Wang W. Nat Rev Genet. 2007; 8: 735-748). In the case of FA-B patients( FANCB Except for (which is located on the X chromosome), FA is autosomal recessive.

[0070] Proteins encoded by FA genes participate in a biochemical pathway known as the FA / BRCA pathway (see Wang N. Rev Genet. 2007; 8: 735-748). Thirteen FA proteins have been identified in the FA pathway, each of which participates in one of the three FA protein complexes identified in this pathway to date. The upstream complex, the FA core complex, is integrated by eight FA proteins (FANCA, FANCB, FANCC, FANCE, FANCF, FANCG, FANCL, FANCM) and two FA-related proteins (FAAP24 and FAAP100). The second complex is formed by FANCD2 and FANCI, which work together in the FA-ID complex. Due to the E3 ligase activity (FANCL) of the FA core complex, FANCD2 and FANCI are mono-ubiquitinated and loaded onto chromatin, which can form large nuclear lesions in response to DNA damage or replication interruption. Finally, mono-ubiquitinated FANCD2 / FANCI interacts with downstream FA proteins such as FANCJ / BRIP1, FANCN / PALB2, and FANCD1 / BRCA2, which form stable complexes with proteins involved in homology-directed repair (HDR), such as BRCA1 and RAD51.

[0071] FA-A is the most frequent FA complement group, comprising approximately 50% to 80% of FA patients corresponding to the FA complement group (Casado JA et al, J Med Genet., 2007; 44: 241-249; Levitus M et al Blood, 2004, 103: 2498-2503, Taniguchi T, D' andrea AD. Blood, 2006, 107: 4223-4233). As a result of the deficiency or null expression of FANCA, the FA core complex cannot be formed. This interferes with the activation of the ID complex, and thus these proteins migrate into the chromatin, resulting in the characteristic phenotype of FA cells.

[0072] As reviewed by D' Andrea et al. (Blood, 1997, 90: 1725-1736), FA cells are characterized by different cell phenotypes associated primarily with defects in cell survival, DNA repair, and genomic stability.

[0073] FA is primarily characterized by congenital malformations, the development of bone marrow failure, and a high risk of acute myeloid leukemia and certain solid tumors. On average, 70% of FA patients have congenital defects. Skeletal abnormalities (radiation, hip, scoliosis, ribs) and normal skin hyperpigmentation, such as café-au-lait spots, are present in 60–70% of FA patients. Most patients have short stature, and about one-third suffer from microphthalmia and renal abnormalities. No obvious congenital abnormalities were observed in about 30% of FA patients (Tischkowitz M, Dokal I. Br J Haematol., 2004; 126:176-191).

[0074] The most important clinical feature of FA patients is hematological. Bone marrow failure (BMF) is a major characteristic of this disease. It generally appears between the ages of 5 and 10. Among 15-year-old patients, 80% develop BMF, and by age 40, the statistical risk of BMF exceeds 90% (Butturini et al., 1994; Kutler et al., 2003). Thrombocytopenia or leukopenia typically precedes anemia. Pancytopenia generally worsens over time. Neutropenia is associated with an increased risk of infection.

[0075] Patients with FA also tend to develop cancer, primarily acute myeloid leukemia (AML) and myelodysplastic syndrome (MDS). The majority of tumors associated with FA occur after the age of 13, with an average age of 23. The relative risk of AML increases 785-fold; the median age of FA patients with AML is 14, and the cumulative incidence of hematological malignancies by age 40 is 30–55% (Kutler et al., 2003; Rosenberg PS). et al . Blood, 2003; 101: 822-826). In addition, older FA patients also have a higher risk of developing solid tumors, primarily squamous cell carcinoma (SCC). The median age of onset for solid tumors in these patients is 26 years, and the cumulative incidence of solid tumors by age 40 is 30% (Kutler et al., 2003, Rosenberg et al., 2003).

[0076] Due to the complex clinical manifestations of FA, the management of these patients focuses primarily on reducing symptoms of bone marrow failure (BMF), myeloid leukemia, and solid tumors. The limitations of each current treatment for FA patients are reported in the orphan drug document on lentiviral vectors carrying the FANCA gene, sponsored by CIEMAT / CIBER for Rare Diseases (Bueren, J. (2010). Center for Biomedical Network Research on Rare Diseases Ref EU / 3 / 10 / 822).

[0077] In a specific embodiment, the method and composition are, for example, This gene therapy vector composition, such as a viral vector, comprising these gene expression cassettes is provided for use in the manufacture of agents useful for intensive and targeted gene therapy for diseases, disorders, and dysfunctions in animals and especially in humans.

[0078] In some embodiments, the present invention FANCA We provide a gene therapy for Fanconi anemia based on an LV vector containing an hPGK eukaryotic promoter that induces cDNA expression. This therapeutic vector can be used to transfect human hematopoietic stem cells (HSCs), which can then be transplanted into humans with Fanconi anemia.

[0079] In a specific embodiment, the present invention provides an FNACA LV vector for the genetic correction of Fanconi anemia. Collectively, the results suggest the feasibility of gene therapy for FA using an LV designed for clinical application.

[0080] The present invention comprises a gene expression cassette (e.g., a therapeutic cassette), a gene delivery cassette comprising the gene expression cassette (e.g., an integration cassette), a plasmid comprising the gene delivery cassette, and a gene delivery vector comprising the gene delivery cassette. The gene expression cassette, the gene delivery cassette, the plasmid, and the gene delivery vector comprise a polynucleotide sequence encoding a therapeutic gene product operably linked to a promoter sequence. In certain embodiments, the polynucleotide sequence is DNA or RNA. In certain embodiments, the gene expression cassette is a polynucleotide, the gene delivery cassette is a polynucleotide, and the vector is a virus, e.g., a lentivirus.

[0081] In a specific embodiment, the therapeutic gene product is the FANCA protein or a functional fragment or variant thereof, optionally the wild-type human FANCA protein.

[0082] In a specific embodiment, the gene expression cassette includes a promoter region, a coding sequence, and a post-transcriptional regulatory element. In a specific embodiment, the promoter region includes a promoter sequence or a functional fragment thereof. In one embodiment, the promoter is a human PGK promoter. In some embodiments, the expression cassette also includes an RNA release signal. The RNA release signal may include a wPRE sequence. In some embodiments, a mutant wPRE sequence lacking any residual open reading frame (Schambach, Bohne et al. 2006) is included to improve the expression level and stability of the therapeutic gene.

[0083] Some embodiments of the present invention include a gene expression cassette for enhanced expression of the FANCA gene product. In some embodiments, the polynucleotide cassette is wild-type to increase mRNA stability during transcription. FANCA cDNA encoding sequence, or human FANCAIncludes a codon-optimized version of cDNA. For optimization, GeneArt® software can be used to increase GC content and remove cryptic splice sites to prevent transcriptional silencing, thereby increasing transgenic expression. Alternatively, any optimization method known in the art may be used.

[0084] In some aspects of the present invention, a pharmaceutical composition comprising a gene transfer vector and a pharmaceutical excipient of the present invention is provided. In some embodiments, the pharmaceutical composition comprises a gene transfer vector and a pharmaceutical excipient of the present invention.

[0085] In some aspects of the present invention, a method for expressing a transgenic gene in mammalian cells is provided. In some embodiments, the method comprises contacting one or more mammalian cells with an effective amount of the polynucleotide cassette of the present invention or the gene delivery vector of the present invention, wherein the transgenic gene is expressed at a detectable level in one or more mammalian cells. In some embodiments, the method comprises contacting one or more mammalian cells with an effective amount of the polynucleotide cassette of the present invention or the gene delivery vector of the present invention, wherein the transgenic gene is expressed at a therapeutic level in one or more mammalian cells. In some embodiments, the method is in vitro. In other embodiments, the method is in vivo.

[0086] In some aspects of the present invention, a method for treating or preventing a disease or disorder in a mammal requiring treatment or prevention of the disease or disorder is provided. In some embodiments, the method comprises administering an effective amount of a pharmaceutical composition of the present invention to a mammal, wherein the coding sequence encodes a therapeutic gene product.

[0087] composition

[0088] In some aspects of the present invention, a composition is provided for the expression of a FANCA transgene in eukaryotic cells. In a specific embodiment, the eukaryotic cell is a mammalian cell. In one embodiment, the mammalian cell is a hematopoietic stem cell (HSC). In one embodiment, the mammalian cell is a hematopoietic progenitor cell. In one embodiment, the mammalian cell is CD34+. In one embodiment, the mammalian cell is a human cell. In a specific embodiment, the cell is a human CD34+ cell derived from a subject diagnosed with FA that is treated with CD34+ cells after being transfected by the gene transfer disclosed herein, and comprises the disclosed gene expression cassette.

[0089] In one specific embodiment, the present invention comprises a lentiviral vector comprising a gene expression cassette comprising a polynucleotide sequence encoding a therapeutic FANCA protein or a functional fragment or variant thereof. As used herein, a functional variant of a reference polynucleotide or polypeptide comprises one or more amino acid or nucleic acid deletions, additions, or substitutions compared to the reference sequence and retains at least 50%, at least 80%, at least 90%, or 99% of the functional activity of the reference polynucleotide or polypeptide. As used herein, a functional fragment is a fragment of the reference polynucleotide or polypeptide and retains at least 50%, at least 80%, at least 90%, or 99% of the functional activity of the reference polynucleotide or polypeptide.

[0090] In one embodiment, the backbone of the lentiviral vector is identical to that corresponding to the pharmaceutical product “Lentiviral vector carrying Wiscott-Aldrich syndrome protein (WASP-LV)" (Ref141 / 2000), but for FA therapy, the promoter is a human phosphoglycerate kinase (hPGK) promoter characterized by stable in vivo activity and improved safety characteristics compared to other promoters already used in gene therapy (Modlich U, Navarro S, Zychlinski D et al. Insertional Transformationof Hematopoietic Cells by Self-Inactivating Lentiviral And Gammaretroviral Vectors. Mol Ther. 2009; 17: 1919-1928; Montini E, Cesana D, Schmidt M et al. Hematopoietic Stem Cell Gene Transfer in a Tumor prone Mouse Model Uncovers Low Genotoxicity Of Lentiviral Vector Integration. Nat Biotechnol. 2006; 24:687-696.).

[0091] In some embodiments of the present disclosure, the composition comprises a polynucleotide cassette. "Polynucleotide cassette" means a polynucleotide sequence comprising two or more functional polynucleotide sequences typically operably linked to one another, e.g., a regulatory element, a translation initiation sequence, a coding sequence, a termination sequence, etc. Likewise, "polynucleotide cassette for expression of a transposable gene in mammalian cells" means a combination of two or more functional polynucleotide sequences that promote the expression of a transposable gene in a cell, e.g., a promoter, an enhancer, a 5'UTR, a translation initiation sequence, a coding sequence, a termination sequence, etc. Gene expression cassettes and gene transfer cassettes are examples of polynucleotide cassettes.

[0092] In some embodiments, the polynucleotide cassette of the present disclosure provides enhanced expression of a transgenic gene in mammalian cells. As demonstrated by the embodiments of the present invention, the inventors have discovered a number of polynucleotide elements that provide enhanced expression of a transgenic gene in mammalian cells individually and synergistically, namely elements improved over those known in the art. In certain embodiments, an arrangement of two or more functional polynucleotide sequences within the polynucleotide cassette of the present disclosure provides for enhanced expression of a transgenic gene in mammalian cells. "Enhanced" means that the expression of a transgenic gene in a cell carrying the polynucleotide cassette of the present disclosure is increased, enhanced, or stronger compared to a cell carrying a transgenic gene operably linked to a comparable regulatory element, for example, as known in the art. In other words, the expression of a transgenic gene from the polynucleotide cassette of the present disclosure is increased, enhanced, or stronger compared to the expression from a polynucleotide cassette that does not contain one or more of the optimized elements of the present disclosure, for example, a reference control. In certain embodiments, enhanced expression is specific to or limited to one or more desired cell types.

[0093] For example, the expression of a transgene may be enhanced, augmented, or stronger in a cell containing a polynucleotide cassette containing the promoter disclosed herein than in a cell carrying a transgene operably linked to a different promoter known in the art, for instance. As another example, the expression of a transgene may be enhanced, increased, augmented, or stronger in a cell containing a polynucleotide cassette containing the enhancer sequence disclosed herein than in a cell carrying a transgene operably linked to a different enhancer.

[0094] Without being bound by theory, enhanced expression of a transgenic gene in a cell is thought to be due to the more rapid formation of the gene product in the cell or a more stable gene product in the cell. Accordingly, enhanced expression of a transgenic gene by the polynucleotide cassette of the present disclosure can be observed in a number of ways. For example, enhanced expression can be observed by detecting the expression of the transgenic gene after the polynucleotide cassette comes into contact with the cell earlier than the expression that can be detected when the transgenic gene is operably linked to a comparable regulatory element, such as those known in the art, e.g., 2 days earlier, 7 days earlier, 2 weeks earlier, 3 weeks earlier, 4 weeks earlier, 8 weeks earlier, or 12 weeks or more earlier. Enhanced expression can also be observed as an increase in the amount of gene product per cell. For example, in the amount of gene product per mammalian cell, there may be a twofold or greater increase, e.g., a threefold or greater increase, a fourfold or greater increase, a fivefold or greater increase, or a tenfold or greater increase. Enhanced expression can also be observed as an increase in the number of mammalian cells expressing the transgenic gene carried by the polynucleotide cassette at a detectable level. For example, there may be a twofold or greater increase in the number of mammalian cells expressing the transgenic gene at a detectable level, e.g., a threefold or greater increase, a fourfold or greater increase, a fivefold or greater increase, or a tenfold or greater increase.

[0095] As another example, the polynucleotide of the present invention can promote transgenic expression to a detectable level in a greater proportion of cells compared to a conventional polynucleotide cassette; for example, where a conventional cassette can promote transgenic expression to a detectable level in, for example, less than 5% of cells in a specific region, the polynucleotide of the present invention promotes expression to a detectable level in 5% or more of the cells in that region; for example, 10% or more, 15% or more, 20% or more, 25% or more, 30% or more, 35% or more, 40% or more, or 45% or more, in some cases 50% or more, 55% or more; 60% or more, 65% or more, 70% or more, or 75% or more, for example, 80% or more, 85% or more, 90% or more, or 95% or more of the contacted cells will express a detectable level of gene product. Enhanced expression may also be observed as a change in cell viability and / or function.

[0096] The polynucleotide cassette of the present invention typically comprises a promoter region. Any suitable promoter region or the promoter sequence therein may be used in the polynucleotide cassette of the present invention, provided that the promoter region promotes the expression of the coding sequence in eukaryotic cells. In certain embodiments, the promoter region promotes the expression of the coding sequence in mammalian cells. In some examples, the promoter is a ubiquitous promoter, that is, a promoter active in a wide range of cells, tissues, and species. In other cases, the promoter is a human PGK promoter.

[0097] Promoter and enhancer elements may be tissue-specific or stage-specific. For example, tissue-specific promoters or enhancers preferentially induce expression (or higher levels of expression) in one or more specific cell types. Examples of cell types include, but are not limited to, hematopoietic stem cells, long-term hematopoietic stem cells, short-term hematopoietic stem cells, multipotent progenitor cells, hematopoietic CD34+ cells, and any cluster differentiation subpopulation within the CD34+ population. Stage-specific promoters or enhancers preferentially induce expression (or higher levels of expression) during one or more specific stages of the cell cycle or development. These include, but are not limited to, beta-globin locus control regions, spectrin promoters, and erythrocyte-specific promoters.

[0098] In some embodiments, the polynucleotide comprises one or more enhancers. The enhancers are nucleic acid elements known in the art for enhancing transcription and may be located anywhere in relation to the gene they regulate, for example, upstream, downstream, within an intron, etc. Any enhancer element may be used in the polynucleotide cassette and gene therapy vector of the present invention, provided that it enhances gene expression when used in combination with a promoter.

[0099] The coding sequence expressed in the cell may be any polynucleotide sequence, e.g., cDNA encoding a gene or gene product, e.g., polypeptide or RNA-based therapeutic (siRNA, antisense, ribozyme, shRNA, etc.). The coding sequence may be heterogeneous to the promoter sequence operably linked thereto, that is, not naturally operably linked. Alternatively, the coding sequence may be endogenous to the promoter sequence operably linked thereto, i.e., naturally linked to that promoter. The gene product may act intrinsically in mammalian cells or exogenously, e.g., secreted. For example, if the transgene is a therapeutic gene, the coding sequence may be any gene encoding a desired gene product or a functional fragment or variant thereof that can be used as a therapeutic agent to treat a disease or disorder. In various preferred embodiments, the transgene encodes human FANCA, i.e., SEQ ID NO: 25.

[0100] In one embodiment of the present invention, a transgene coding sequence is modified or "codon optimized" to enhance expression by replacing rare codons with more frequent codons. The coding sequence is a part of an mRNA sequence that encodes amino acids for translation. During translation, each of the 61 trinucleotide codons is translated into one of 20 amino acids, causing degeneracy or duplication in the genetic code. However, different cell types and different animal species use tRNAs (each containing an anticodon) that encode the same amino acids at different frequencies. When the gene sequence contains rare codons by the corresponding tRNA, the ribosomal translation machinery may slow down, which delays efficient translation. Although the coding sequence is modified to encode the same protein sequence, expression may be improved through "codon optimization" for a specific species by utilizing codons that are highly expressed or / or utilized by highly expressed human proteins (Cid-Arregui et al., 2003, J. Virol., 77: 4928). In one aspect of the invention, the coding sequence of a transgene is modified to replace codons that are rarely expressed in mammals or primates with codons that are frequently expressed in primates. For example, in some embodiments, the coding sequence encoded by the transgene encodes a polypeptide having at least 85% sequence identity, e.g., at least 90% sequence identity, e.g., at least 95% sequence identity, at least 98% identity, or at least 99% identity with the polypeptide encoded by the sequence disclosed herein or above. At least one codon of the above coding sequence has a higher tRNA frequency in humans than the corresponding codon of the sequence disclosed above or herein.

[0101] In a further embodiment of the present invention, a transgene encoding sequence is modified to enhance expression by terminating or removing an open reading frame (ORF) that does not encode the target transgene. An open reading frame (ORF) is a nucleic acid sequence that follows a start codon and does not contain a stop codon. The ORF may be forward or reverse and may be "in frame" or "out frame" relative to the gene of interest. Such open reading frames have the potential to be expressed in the expression cassette along with the gene of interest and may result in undesirable adverse effects. In one aspect of the present invention, the transgene encoding sequence is modified to remove the open reading frame by further altering the codon usage. This is achieved by removing the start codon (ATG) from the reverse or out-of-frame ORF and introducing a stop codon (TAG, TAA, or TGA) while preserving the amino acid sequence and retaining the highly utilized codons of the gene of interest (i.e., avoiding codons with <20% frequency). In the present invention, the transgenic coding sequence may be optimized by either codon optimization or the removal of non-transgenic ORFs, or by using both techniques. As will be apparent to those skilled in the art, it is preferable to remove or minimize non-transgenic ORFs after codon optimization in order to remove ORFs introduced during codon optimization.

[0102] In some embodiments, the polynucleotide cassette comprises the following:

[0103] (i) Phosphoglycerate kinase (PGK) promoter sequence or a functional variant or fragment thereof;

[0104] (ii) a sequence encoding the human FANCA protein or a functional fragment or variant thereof; and

[0105] (iii) Post-transcriptional regulatory elements of Woodchurk's hepatitis virus (WPRE) sequences.

[0106] In some embodiments, the polynucleotide cassette comprises the following:

[0107] (i) Human phosphoglycerate kinase (PGK) promoter sequence;

[0108] (ii) Sequence encoding the human FANCA protein; and:

[0109] (iii) Mutant WPRE sequence.

[0110] In some embodiments, the polynucleotide cassette comprises the following:

[0111] a) 5' LTR, optionally modified 5' LTR;

[0112] b) cPPT sequence;

[0113] c) PGK promoter sequence, selectively human PGK promoter sequence;

[0114] d) a sequence encoding the human FANCA protein, optionally a cDNA sequence or a codon-optimized sequence;

[0115] e) mutant wPRE sequence; and

[0116] f) 3' LTR, optionally modified 3' LTR.

[0117] In one embodiment, the modified WPRE is referred to as WPRE*. WPRE* is a modified WPRE lacking an open reading frame (e.g., See Schambach et al, 2006 Gene Ther. 13: 641-645).

[0118] In a specific embodiment, the gene transfer cassette comprises one or more additional elements, e.g., one or more elements selected from the following: 5' LTR, 3' LTR, cPPT, CTS, RRE, enhancer sequence, and packaging sequence.

[0119] The RRE sequence increases the efficiency of gene transfer. In any specific embodiment of the expression cassette and gene transfer vector described herein, the RRE sequence comprises or consists of any of the following sequences, or a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity with the following sequences:

[0120] (AGGAGCTTTGTTCCTTGGGTTCTTGGGAGCAGCAGGAAGCACTATGGGCGCAGCGTCAATGACGCTGACGGTACAGGCCAGACAATTATTGTCTGGTATAGTGCAGCAGCAGAACAATTTGCTGAGGGCTATTGAGGCGCAACAGCATCTGTTGCAACTCACAGTCTGGGGCATCAAGCAGCTCCAGGCAAGAATCCTGGCTGTGGAAAGATACCTAAAGGATCAACAGCTCCT (SEQ ID NO: 1); or

[0121] Sequence No. 24: A sequence containing or composed of nucleotides 2649-2882.

[0122] The retrovirus leader region contains a packaging signal (Ψ) involved in packaging the retrovirus genome into the viral capsid. It was thought that the LV vector required a Gag gene of approximately 300 bp in this region. Currently, this Gag sequence has been reduced to only 40 bp (Fig. 65). In any specific embodiment of the expression cassette and gene transfer vector described herein, the Ψ sequence is an HIV-1 Ψ sequence, or the Ψ sequence comprises or consists of any of the following sequences, or a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity with the following sequences:

[0123] CTCTCTCGACGCAGGACTCGGCTTGCTGAAGCGCGCACGGCAAGAGGCGAGGGGCGGCGACTGGTGAGTACGCCAAAAATTTTGACTAGCGGAGGCTAGAAGGAGAGAGATGGGTGCGAGAGCGTC (SEQ ID NO: 2); or

[0124] A sequence comprising or composed of the polynucleotide sequence 2031-2156 of SEQ ID NO: 24.

[0125] In any specific embodiment of the expression cassette and gene transfer vector described herein, the truncated HIV-1 5' LTR comprises or consists of any of the following sequences, or a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity with the following sequences:

[0126] GGGTCTCTCTGGTTAGACCAGATCTGAGCCTGGGAGCTCTCTGGCTAACTAGGGAACCCACTGCTTAAGCCTCAATAAAGCTTGCCTTGAGTGCTTCAAGTAGTGTGTGCCCGTCTGTTGTGTGACTCTGGTAACTAGAGATCCCTCAGACCCTTTTAGTCAGTGTGGAAAATCTCTAGCA (SEQ ID NO: 3); or

[0127] A sequence comprising or composed of the 1586-9495 polynucleotide sequence of SEQ ID NO: 24.

[0128] In any specific embodiment of the expression cassette and gene transfer vector described herein, the HIV-1 self-inactivation 3' LTR sequence comprises or consists of any of the following sequences, or a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity with the following sequences:

[0129] TGGAAGGGCTAATTCACTCCCAACGAAGACAAGATCTGCTTTTTGCTTGTACTGGGTCTCTCTGGTTAGACCAGATCTGAGCCTGGGAGCTCTCTGGCTAACTAGGGAACCCACTGCTTAAGCCTCAATAAAGCTTGCCTTGAGTGCTTCAAGTAGTGTGTGCCCGTCTGTTGTTGACTCTGGTAACTAGAGATCCCTCAGACCCTTTTAGTCAGTGTGGAAAATCTCTAGCA (SEQ ID NO: 4); or

[0130] A sequence comprising or composed of the 9262-9495 polynucleotide sequence of SEQ ID NO: 24.

[0131] In a specific embodiment of any expression cassette and gene transfer vector described herein, the human cytomegalovirus (CMV) immediate early promoter comprises or consists of any of the following sequences, a functional fragment thereof, or a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity with the following sequences:

[0132] GTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCT (SEQ ID NO: 5); or

[0133] A sequence comprising or composed of the 1586-1789 polynucleotide sequence of SEQ ID NO: 24.

[0134] cPPT, which promotes the nuclear translocation of the pre-integration complex together with CTS involved in the separation of reverse transcriptase, has been shown to improve viral titers (Zennou et al. 2000; Follenzi et al. 2000). In specific embodiments of any expression cassette and gene transfer vector described herein, the central polypurine tract and central termination sequence (cPPT / CTS) of HIV-1 comprises or consists of any of the following sequences, functional fragments thereof, or sequences having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity with the following sequences:

[0135] TTTTAAAAGAAAAGGGGGGATTGGGGGGTACAGTGCAGGGGAAAGAATAGTAGACATAATAGCAACAGACATACAAACTAAAGAATTACAAAAACAAATTACAAAAATTCAAAATTTT (SEQ ID NO: 6);

[0136] TTTAAAAGAAAAGGGGGGATTGGGGGGT (Sequence No.: 12); or

[0137] A sequence comprising or composed of the polynucleotide sequences 3378-3495 of SEQ ID NO: 24.

[0138] In specific embodiments of any expression cassette and gene transfer vector described herein, the human phosphoglycerate kinase 1 (PGK) promoter comprises or consists of any of the following sequences, a functional fragment thereof, or a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity with the following sequences:

[0139] GGGGTTGGGGTTGCGCCTTTTCCAAGGCAGCCCTGGGTTTGCGCAGGGACGCGGCTGCTCTGGGCGTGGTTCCGGGAAACGCAGCGGCGCCGACCCTGGGTCTCGCACATTCTTCACGTCCGTTCGC AGCGTCACCCGGATCTTCGCCGCTACCCTTGTGGGCCCCCCGGCGACGCTTCCTGCTCCGCCCCTAAGTCGGGAAGGTTCCTTGCGGTTCGCGGCGTGCCGGACGTGAACAAACGGAAGCCGCACGTCT CACTAGTACCCTCGCAGACGGACAGCGCCAGGGAGCAATGGCAGCGCGCCGACCGCGATGGGCTGTGGCCAATAGCGGCTGCTCAGCAGGGCGCGCCGAGAGCAGCGGCCGGGAAGGGGCGGTGCGGG AGGCGGGGTGTGGGGCGGTAGTGTGGGCCCTGTTCCTGCCCGCGCGGTGTTCCGCATTCTGCAAGCCTCCGGAGCGCACGTCGGCAGTCGGCTCCCTCGTTGACCGAATCACCGACCTCTCTCCCCAG (SEQ ID NO: 7); or

[0140] A sequence comprising or composed of the polynucleotide sequence 3541-4051 of SEQ ID NO: 24.

[0141] Since most FA patients belong to the FA-A complement group (Casado et al., 2007, Levitus et al., 2004, Taniguchi et al., 2006), in a specific embodiment, the coded therapeutic gene product includes FANCA, but the present invention considers that FA proteins from other complement groups may also be delivered and thus, for example, may be encoded in the expression cassette disclosed herein instead of FANCA.

[0142] In specific embodiments of any expression cassette and gene transfer vector described herein, the polynucleotide sequence encoding FANCA comprises or consists of any of the following sequences, a functional fragment thereof, or a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity with the following sequences. FANCA It is a cDNA sequence:

[0143]

[0144] The present invention comprises a plasmid comprising the expression cassette or delivery cassette described herein. In a specific embodiment, the plasmid is pCCL-PGK-FANCA-WPRE* (Fig. 41; SEQ ID NO: 24).

[0145] In a specific embodiment, the present invention comprises a cell containing the plasmid described herein, e.g., a packaging cell or a packaging cell line, e.g., 293 cells. In a specific embodiment, the cell contains the plasmid depicted in FIGS. 38-41.

[0146] In certain embodiments, the delivery cassette or plasmid disclosed herein comprises one or more additional elements, e.g., a CMV promoter and / or enhancer, an SV40 polyA sequence, a replication origin, e.g., an SV40 ori sequence, or any sequence disclosed herein.

[0147] In a specific embodiment of any delivery cassette, plasmid, or vector described herein, the human CMV enhancer comprises or consists of any of the following sequences, a functional fragment thereof, or a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity with the following sequences:

[0148] GACATTGATTATTGACTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTG ACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATG (SEQ ID NO: 9).

[0149] In any specific embodiment of the delivery cassette, plasmid, or vector described herein, the monkey virus 40 (SV40) poly(A) signal comprises or consists of any of the following sequences, functional fragments thereof, or a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity with the following sequences:

[0150] AACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAATTTCACAAATAAAGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTATCTTA (SEQ ID NO: 10).

[0151] In any specific embodiment of the transfer cassette, plasmid, or vector described herein, the SV40 replication origin comprises or consists of any of the following sequences, a functional fragment thereof, or a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity with the following sequences:

[0152] ATCCCGCCCCTAACTCCGCCCAGTTCCGCCCATTCTCCGCCCCATGGCTGACTAATTTTTTTTATTTATGCAGAGGCCGAGGCCGCCTCGGCCTCTGAGCTATTCCAGAAGTAGTGAGGAGGCTTTTTTGGAGGCC (SEQ ID NO: 11).

[0153] In an embodiment of any transfer cassette, plasmid, or part of a vector described herein, the dNEF signal present in any expression cassette or gene transfer vector disclosed herein comprises or consists of any of the following sequences, a functional fragment thereof, or a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity with the following sequences:

[0154] GAATTCGAGCTCGGTACCTTTAAGACCAATGACTTACAAGGCAGCTGTAGATCTTAGCCACTTTTTTAAAAGAAAAGGGGGGAC (SEQ ID NO: 13).

[0155] In any specific embodiment of the delivery cassette, plasmid, or vector described herein, the KanR sequence present in any expression cassette or gene delivery vector disclosed herein comprises or consists of the following sequence:

[0156] ATGATTGAACAAGATGGATTGCACGCAGGTTCTCCGGCGGCTTGGGTGGAGAGGCTATTCGGCTATGACTGGGCACAACAGACAATCGGCTGCTCTGATGCCGCCGTGTTCCGGCTGTCAGCGCAGGGGCGTCCGGTTCTTTTTGTCAAGACCGACCTGTCCGGTGCCTGAATGAACTGCAAGACGAGGCAGCGCGG CTATCGTGGCTGGCGACGACGGGCGTTCCTTGCGCGGCTGTGCTCGACGTTGTCACTGAAGCGGGAAGGGACTGGCTGCTATTGGGCGAAGTGCCGGGGCAGGATCTCCTGTCATCTCACCTTGCTCCTGCCGAGAAAGTATCCATCATGGCTGATGCAATGCGGCGGCTGCATACGCTTGATCCGGCTACCTGCCCAT TCGACCACCAAGCGAAACATCGCATCGAGCGAGCACGTACTCGGATGGAAGCCGGTCTTGTCGATCAGGATGATCTGGACGAAGAGCATCAGGGGCTCGCGCCAGCCGAACTGTTCGCCAGGCTCAAGGCGTCTATGCCCGACGGCGAGGATCTCGTCGTGACCCACGGCGATGCCTGCTTGCCGAATATCATGGTGGA AAATGGCCGCTTTTCTGGATTCATCGACTGTGGCCGTCTGGGTGTGGCGGACCGCTATCAGGACATAGCGTTGGCTACCCGTGATATTGCTGAAGAGCTTGGCGGCGAATGGGCTGACCGCTTCCTTGTGCTTTACGGTATCGCCGCGCCCGATTCGCAGCGCATCGCCTTCTATCGCCTTCTTGACGAGTTCTTCTGA (SEQ ID NO: 14)

[0157] In an embodiment of any delivery cassette, plasmid, or part of a vector described herein, an rrnG terminator present in any expression cassette or gene delivery vector disclosed herein ( E.coliThe transcription terminator of the ribosomal RNA rrnG operon (Albrechtsen et al., 1991) includes or consists of the following sequences:

[0158] GCATTGGCGCAGAAAAAAATGCCTGATGCGACGCTGCGCGTCTTATACTCCCACATATTGCCAGATTCAGCAACGGATACGGCTTCCCCAACTTGCCCACTTCCATACGTGTCCTCCTTACCAGAAATTTATCCTTAA (SEQ ID NO: 15).

[0159] In an embodiment of any transfer cassette, plasmid, or part of a vector described herein, an origin (high-copy-number ColE1 / pMB1 / pBR322 / pUC replication origin) present in any expression cassette or gene transfer vector disclosed herein comprises or consists of any of the following sequences, a functional fragment thereof, or a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity with the following sequences:

[0160] TTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGT TCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACC GGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCC GGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAA (SEQ ID NO: 16).

[0161] In an embodiment of any transfer cassette, plasmid, or part of a vector described herein, a CAP binding site present in any expression cassette or gene transfer vector disclosed herein comprises or consists of any of the following sequences, a functional fragment thereof, or a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity with the following sequences:

[0162] TAATGTGAGTTAGCTCACTCAT (Sequence No.: 17).

[0163] In an embodiment of any delivery cassette, plasmid, or part of a vector described herein, present in any expression cassette or gene delivery vector disclosed herein E.coli lac The promoter It comprises or consists of any of the following sequences, a functional fragment thereof, or a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity with the following sequences:

[0164] TTTACACTTTATGCTTCCGGCTCGTATGTTG (Sequence No.: 18).

[0165] In an embodiment of any delivery cassette, plasmid, or part of a vector described herein, the lac operator present in any expression cassette or gene delivery vector disclosed herein is It comprises or consists of any of the following sequences, a functional fragment thereof, or a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity with the following sequences:

[0166] TTGTGAGCGGATAACAA (Sequence No.: 19).

[0167] In an embodiment of any transfer cassette, plasmid, or part of a vector described herein, the T3 promoter (promoter of bacteriophage T3 RNA polymerase) present in any expression cassette or gene transfer vector disclosed herein comprises or consists of any of the following sequences, a functional fragment thereof, or a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity with the following sequences:

[0168] AATTAACCCTCACTAAAGG (Sequence No.: 20).

[0169] In an embodiment of any transfer cassette, plasmid, or part of a vector described herein, the T7 promoter (promoter of bacteriophage T7 RNA polymerase) present in any expression cassette or gene transfer vector disclosed herein comprises or consists of any of the following sequences, a functional fragment thereof, or a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity with the following sequences:

[0170] CCTATAGTGAGTCGTATTA (Sequence No.: 21).

[0171] In an embodiment of any transfer cassette, plasmid, or part of a vector described herein, the f1 origin (replication origin of bacteriophage f1) present in any expression cassette or gene transfer vector disclosed herein comprises or consists of any of the following sequences, a functional fragment thereof, or a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity with the following sequences:

[0172] ACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTAGGGTGATGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACTCAACCCTATCTCGGTCTATTCTTTTGATTTATAAGGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTAACGCGAATT (서열번호: 22).

[0173] As discussed herein, the polynucleotide cassette of the present invention may include RNA release signals. Exemplary RNA release sequences include, but are not limited to, wPRE. wPRE significantly increases transgenic expression in target cells by increasing RNA stability in transgenic genes in a promoter and vector-independent manner (Zuffrey et al, 1999). However, this can express a truncated 60-amino acid protein derived from the WHV X gene involved in liver cancer (Kingsman et al, 2005). Therefore, most preclinical protocols and clinical trials include mutated versions of the wPRE element (Zanta-Boussif et al, 2009). On the other hand, the use of two SV40-USE elements in the SIN-LV vector was shown to be more efficient than the wPRE sequence in inhibiting transcriptional readout (Schambach et al, 2007). More precisely, the wPRE disclosed herein is a chimeric wPRE carrying 589 nucleotides (nucleotides 1-589) from a modified WPRE performed by Axel Schambach (WO 2008136670 A2, [5]) and 88 nucleotides (nucleotides 590-677) from a previous wPRE (Zuffrey et al, 1999). The data disclosed herein indicate that this chimeric wPRE performs better than the previous wPRE. The chimeric wPRE sequence comprises the following sequences, their functional fragments, or sequences having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity with the following sequences:

[0174] CGAGCATCTTACCGCCATTTATTCCCATATTTGTTCTGTTTTTCTTGATTTGGGTATACATTTAAATGTTAATAAAACAAAATGGTGGGGCAATCATTTACATTTTTAGGGATATGTAATTACTAGTTCAGGTGTATTGCCACAAGACAAACATGTTAAGAAAACTTTCC CGTTATTTACGCTCTGTTCCTGTTAATCAACCTCTGGATTACAAAATTTGTGAAAGATTGACTGATATTCTTAACTATGTTGCTCCTTTTACGCTGTGTGGATATGCTGCTTTAATGCCTCTGTATCATGCTATTGCTTCCCGTACGGCTTTCGTTTTCTCCTCCTTGT ATAAATCCTGGTTGCTGTCTCTTTATGAGGAGTTGTGGCCCGTTGTCCGTCAACGTGGCGTGGTGTGCTCTGTGTTTGCTGACGCAACCCCCACTGGCTGGGGCATTGCCACCACCTGTCAACTCCTTTCTGGGACTTTCGCTTTCCCCCTCCCGATCGCCACGGCAGA ACTCATCGCCGCCTGCCTTGCCCGCTGCTGGACAGGGGCTAGGTTGCTGGGCACTGATAATTCCGTGGTGTTGTCGGGGAAGGGCCTGCTGCCGGCTCTGCGGCCTCTTCCGCGTCTTCGCCTTCGCCCTCAGACGAGTCGGATCTCCCTTTGGGCCGCCTCCCCGCCTG (SEQ ID NO: 23).

[0175] In a specific embodiment, the mutated wPRE sequence comprises or consists of a WPRE* corresponding to nucleotides 8502-9178 of SEQ ID NO: 24 or having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity with this region of SEQ ID NO: 24.

[0176] Other combinations of elements disclosed in this specification or known in the art will be readily understood by those skilled in the art.

[0177] Additionally, as is recognized by those skilled in the art, the polynucleotide cassette may include, but is not limited to, restriction enzyme sites to facilitate cloning and regulatory elements for specific gene expression vectors, and may optionally include other elements.

[0178] In some aspects of the present invention, the polynucleotide cassette is used to deliver a gene to a cell, for example, to determine the effect of the gene on cell viability and / or function, to treat cell disorders, etc. In various embodiments, the delivery of a viral vector to a cell by transduction may occur in vitro, in vitro, or in vitro. Accordingly, in some aspects of the present invention, a composition that provides expression of a transgenic gene in a mammalian cell is a gene delivery vector, said gene delivery vector comprises the polynucleotide cassette of the present invention, for example, a gene delivery cassette.

[0179] Any convenient gene delivery vector for finding use in delivering polynucleotide sequences to mammalian cells is included by the gene delivery vector of the present invention. For example, the vector may comprise single or double-stranded nucleic acids, for example, single-stranded or double-stranded DNA. For example, the gene delivery vector may be DNA, for example, naked DNA such as a plasmid, minicircle, etc. The vector may comprise single-stranded or double-stranded RNA containing a modified form of RNA. In other examples, the gene delivery vector may be RNA, for example, mRNA or modified mRNA.

[0180] As another example, the gene delivery vector may be a viral vector derived from a virus, e.g., adenovirus, adeno-associated virus, lentivirus (LV), herpes virus, alphavirus, or retrovirus, e.g., Moloney rat leukemia virus (M-MuLV), Moloney rat sarcoma virus (MoMSV), Harvey rat sarcoma virus (HaMuSV), rat mammary tumor virus (MuMTV), gibbon leukemia virus (GaLV), feline leukemia virus (FLV), Friend rat leukemia virus, rat stem cell virus (MSCV), or malignant sarcoma virus (RSV). Embodiments involving the use of LV will be described in more detail below, but those skilled in the art will recognize that similar knowledge and skills in the art can also be applied to non-LV gene therapy vectors.

[0181] In some embodiments, the gene transfer vector is a self-restricting LV. In any specific embodiment of the expression cassette and gene transfer vector described herein, the transfer cassette is the pCCL-SIN-cPPT / CTS-hPGK-hFANCA-WPRE of the present invention (Fig. 41) comprising or composed of the following sequence, or a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity with SEQ ID NO: 24. SEQ ID NO: 24 corresponds to the pCCL-PGK-FANCA-WPRE* plasmid of Fig. 41.

[0182] In one embodiment, the FANCA gene is delivered via a lentiviral vector (LV). The FANCA LV described herein utilizes a self-inactivating lentiviral vector (LV). In one embodiment, the FANCA LV contains a promoter of the human phosphoglycerate (PGK) gene. The safety characteristics of this vector are significantly improved compared to gamma-retroviral vectors already used in clinical settings that possess a potent viral promoter.

[0183] In a specific embodiment, the lentiviral vector is PGK-FANCA.WPRE*LV, comprising the gene delivery cassette shown in FIG. 1, which comprises the sequence disclosed in SEQ ID NO: 24. The PGK-FANCA-WPRE*LV gene expression cassette portion comprises a human PGK promoter, a FANCA cDNA encoding sequence, and WPRE*; corresponding to nucleotides 3541 to 9178 of SEQ ID NO: 24. The PGK-FANCA-WPRE*LV delivery cassette portion comprises the approximately 5' LTR (U5) to the approximately 3' LTR (U5) of the sequence shown in FIG. 41. Regarding SEQ ID NO: 24, nucleotides 1586-1789 of SEQ ID NO: 24 comprise a human CMV immediate early promoter. Nucleotides 2031-2156 of SEQ ID NO: 24 comprise an HIV1 psi packaging signal. Nucleotides 2649-2882 of SEQ ID NO: 24 contain the HIV1 RRE element. Nucleotides 3378-3495 of SEQ ID NO: 24 contain the HIV cPPT / CTS element. Nucleotides 3541-4051 of SEQ ID NO: 24 contain the hPGK promoter. Nucleotides 4078-8445 of SEQ ID NO: 24 contain human FANCA-A cDNA. Nucleotides 8502-9178 of SEQ ID NO: 24 contain the mutated WPRE element. Nucleotides 9262-9495 of SEQ ID NO: 24 contain the HIV Delta U 3' LTR.

[0184] In another embodiment, the lentivirus vector contains the following elements:

[0185] (i) Backbone of a lentiviral vector derived from the initial pCCLsin-cppt-hPGK-eGFP-WPRE (Dull et al., 1998; J. Virol 72 (11), 9873-9880). The pCCL backbone obtains high levels of viral RNA transcription in producer cells using a heterozygous CMV-HIV 5' LTR. This heterozygous LTR makes the construct independent of the need to use HIV Tat protein for the production of rHIV particles, and is therefore safe. The U3 region of the 3' LTR contains a 400 bp deletion that confers self-inactivation properties to the vector, as described in the literature (Zufferey et al., J. Virol, 1998);

[0186] (ii) cDNA of the human FANCA gene encoding the FANCA protein (1455AA) under the regulation of the human PGK promoter (4368bp GenBank accession number: X_99226 or as disclosed herein). The promoter is characterized by stable in vivo activity and improved stability characteristics compared to other promoters previously used in gene therapy; and

[0187] (iii) A mutated version of the Woodchurk hepatitis virus post-transcriptional regulatory element (WPRE) or WPRE* in which the 3' region of the sequence encoding the X protein and any ORF residue described by Schambach et al. (Gene therapy, 2006; 13, 641-645) are deleted.

[0188] The gene therapy vector encapsulating the polynucleotide cassette of the present invention can be manufactured using standard methodologies. For example, in the case of an LV virion, an LV expression vector according to the present invention may be introduced into a producer cell, and then an LV helper construct may be introduced, wherein the helper construct may be expressed in the producer cell and includes an LV coding region that complements an LV helper function not present in the LV vector. Subsequently, a helper virus and / or additional vector are introduced into the producer cell, and this helper virus and / or additional vector provides an accessory function capable of supporting effective LV virus production. The producer cell is then cultured to produce an LV. This step is performed using standard methodologies. In a specific embodiment, the plasmid depicted in FIGS. 38-41 is used to produce the gene transfer vector.

[0189] Any suitable method for producing viral particles for the delivery of the polynucleotide cassette of the present invention may be used, including but not limited to the examples described below. The concentration of viral particles for effectively transducing mammalian cells may be prepared for contacting mammalian cells in vitro or in vivo. For example, the viral particles are 10 per ml 8 More than 10 vector genomes, e.g., 5 x 10 per mL 8 10 vector genomes; 10 per mL 9 10 vector genomes; 5 x 10 per mL 9 10 vector genomes, 10 per mL 10 10 vector genomes, 5x10 per mL 10 10 vector genomes; 10 per mL 11 10 vector genomes; 5 x 10 per mL 11 10 vector genomes; 10 per mL 12 10 vector genomes; 5x10 per mL 12 10 vector genomes; 10 per mL 13Can vector genomes; 1.5 x 10⁶ per mL 13 Can vector genomes; 3x10 per mL 13 Dog vector genomes; 5x10 per mL 13 Can vector genomes; 7.5 x 10⁶ per mL 13 10 vector genomes; 9x10 per mL 13 Can vector genomes; 1x10 per mL 14 10 vector genomes, 5x10 per mL 14 More than 1 x 10 vector genomes, typically 1 x 10 per mL 15 It can be formulated at a concentration below that of the vector genome.

[0190] In preparing the LV composition of the present invention, any host cell for producing an LV virion may be used, for example, including mammalian cells (e.g., 293 cells), insect cells (e.g., SF9 cells), microorganisms, and yeast. The host cell may be a host cell in which the LV vector genome is stably maintained and packaged, or a packaging cell in which the LV rep and cap genes are stably maintained in the producer cell. Exemplary packaging and producer cells are derived from SF-9, 293, A549, or HeLa cells. The LV vector is purified and formulated using standard techniques known in the art.

[0191] In a specific embodiment, the present invention comprises a cell comprising a gene expression cassette, a gene transfer cassette, or a gene transfer vector disclosed herein. In a related embodiment, the cell is transfected with a gene transfer vector comprising an expression cassette disclosed herein, or has an expression cassette disclosed herein integrated into the cell genome.

[0192] In a specific embodiment, the cell is a cell used to produce a viral gene delivery vector, e.g., a packaging cell.

[0193] In another embodiment, the cell is a cell delivered to a subject to provide the subject with a gene product encoded by an expression cassette. Thus, in a specific embodiment, the cell is autologous to the subject to be treated or is obtained from the subject to be treated. In another embodiment, the cell is allogeneic to the subject to be treated or is obtained from a donor other than the subject to be treated. In a specific embodiment, the cell is a mammalian cell, e.g., a human cell. In a specific embodiment, the cell is a blood cell, erythrocyte, hematopoietic progenitor cell, bone marrow cell, e.g., a lineage-depleted bone marrow cell, hematopoietic stem cell (e.g., CD34+), or a committed erythrocyte progenitor cell. In a specific embodiment, the cell is a CD34+ cell obtained from the subject to be treated with the cell after being transduced by the gene transfer vector disclosed herein. In a specific embodiment, the cell is a CD34+ FA cell obtained from a subject diagnosed with FA.

[0194] The present invention comprises a pharmaceutical composition comprising the polynucleotide cassette, gene transfer vector, or cell described herein and a pharmaceutically acceptable carrier, diluent, or excipient. The target polynucleotide cassette, gene transfer vector, or cell may be combined with a pharmaceutically acceptable carrier, diluent, and reagent that is generally safe, non-toxic, and useful for preparing a desirable formulation, and may include an excipient suitable for use in primates. Such excipients may be solid, liquid, semi-solid, or gas in the case of an aerosol composition. Examples of such excipients, carriers, or diluents include, but are not limited to, water, saline solution, Ringer's solution, dextrose solution, and 5% human serum albumin. A supplementary active compound may also be incorporated into the formulation. The solution or suspension used in the formulation may be a sterile diluent such as water for injection, saline solution, fixative oil, polyethylene glycols, glycerin, propylene glycol, or other synthetic solvents; It includes antimicrobial compounds, such as benzyl alcohol or methyl parabens; antioxidants, such as ascorbic acid or sodium bisulfite; chelating compounds, such as ethylenediaminetetraacetic acid (EDTA); buffers, such as acetate, citrate, or phosphate; detergents, such as Tween 20, to prevent aggregation; and tension-regulating compounds, such as sodium chloride or dextrose. The pH may be adjusted with an acid or base, such as hydrochloric acid or sodium hydroxide. In specific embodiments, the pharmaceutical composition is sterile.

[0195] A pharmaceutical composition suitable for use in the present invention further comprises a sterile aqueous solution or dispersion and a sterile powder for the immediate preparation of a sterile injectable solution or dispersion.

[0196] A sterile solution can be prepared by incorporating the required amount of the active compound into a suitable solvent with one or a combination of the components listed above, as needed, and then filtering and sterilizing. Generally, a dispersion is prepared by incorporating the active compound into a sterile vehicle containing a basic dispersion medium and other necessary components from those listed above. In the case of a sterile powder for the preparation of a sterile injectable solution, the preparation method is vacuum drying and freeze-drying to produce any additional desirable components from the powder of the active ingredient and the previously sterile filtered solution thereof.

[0197] In one embodiment, the composition is prepared as a carrier to protect a gene cassette or expression vector from rapid removal from the body, such as a controlled-release formulation comprising an implant and a microencapsulated delivery system. Biodegradable, biocompatible polymers such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid may be used. Methods for preparing such formulations will be obvious to those skilled in the art. These materials may also be commercially available.

[0198] It is particularly advantageous to formulate oral, ocular, or parenteral compositions in the form of dosing units for ease of administration and uniformity of dosage. The dosing unit forms used herein refer to physically separated units suitable as a single dose for a subject to be treated; each unit contains a predetermined amount of active compound calculated to produce the desired therapeutic effect in relation to the required pharmaceutical carrier. The detailed description of the dosing unit forms of the present invention is determined and dependent on the inherent characteristics of the active compound and the specific therapeutic effect to be achieved, as well as the inherent limitations of the field in which such active compounds are formulated for the treatment of an individual.

[0199] The pharmaceutical composition may be contained in a container, pack, or dispenser, for example, a syringe, for example, a pre-filled syringe, along with administration instructions.

[0200] The pharmaceutical composition of the present invention comprises any pharmaceutically acceptable salt, ester, or salt of such ester, or any other compound that, when administered to animals including humans, may provide (directly or indirectly) a biologically active metabolite or a residue thereof.

[0201] The term “pharmaceutically acceptable salt” refers to a physiologically and pharmaceutically acceptable salt of the compound of the present invention, that is, a salt that retains the desirable biological activity of the parent compound and does not impart undesirable toxic effects thereon. Various pharmaceutically acceptable salts are known in the art and are described, for example, in the literature [“Remington’s Pharmaceutical Sciences”, 17th edition, Alfonso R. Gennaro (Ed.), Mark Publishing Company, Easton, PA, USA, 1985 (and the latest edition thereof), “Encyclopaedia of Pharmaceutical Technology”, 3rd edition, James Swarbrick (Ed.), Informa Healthcare USA (Inc.), NY, USA, 2007, and J. Pharm. Sci. 66: 2 (1977)]. In addition, for a review of suitable salts, refer to the literature [Handbook of Pharmaceutical Salts: Properties, Selection, and Use by Stahl and Wermuth (Wiley-VCH, 2002)].

[0202] Pharmaceutically acceptable base addition salts are formed from metals or amines, such as alkali and alkaline earth metals or organic amines. Metals used as cations include sodium, potassium, magnesium, calcium, etc. Amines include N-N'-dibenzylethylenediamine, chloroprocaine, choline, diethanolamine, dicyclohexylamine, ethylenediamine, N-methylglucarmine, and procaine (Berge et al., "Pharmaceutical Salts", J. Pharma Sci., 1977, 66, 119). The base addition salts of the acidic compounds are prepared by contacting the free acid form with a sufficient amount of the desired base to produce the salt in a conventional manner. The free acid form can be regenerated by contacting the salt form with the acid and separating the free acid in a conventional manner. The free acid form differs from each of these salt forms in certain physical properties, such as solubility in polar solvents, but otherwise is equivalent to each of these free acids for the purposes of the present invention.

[0203] The polynucleotide cassette, gene transfer vector, e.g., recombinant virus (virion), or cell (e.g., cell transfected with the gene transfer vector disclosed herein) of the present invention may be incorporated into a pharmaceutical composition for administration to mammalian patients, particularly primates, and more specifically, to humans. The polynucleotide cassette, gene transfer vector, e.g., virion, or cell of the present invention may be formulated in a non-toxic, inert, pharmaceutically acceptable aqueous carrier at a pH range of preferably 3 to 8, more preferably 6 to 8. Such a sterile composition will comprise a vector or virion comprising a nucleic acid encoding a therapeutic molecule dissolved in an aqueous buffer having an acceptable pH upon reconstitution.

[0204] In some embodiments, the pharmaceutical composition provided herein comprises a therapeutically effective amount of the cell, vector, or virion disclosed herein mixed with a pharmaceutically acceptable carrier and / or excipient, e.g., saline solution, phosphate-buffered saline solution, phosphate and amino acid, polymer, polyol, sugar, buffer, preservative and other protein. Exemplary amino acids, polymers, and sugars, etc. include octylphenoxy polyethoxy ethanol compounds, polyethylene glycol monostearate compounds, polyoxyethylene sorbitan fatty acid esters, sucrose, fructose, dextrose, maltose, glucose, mannitol, dextran, sorbitol, inositol, galactitol, xylitol, lactose, trehalose, bovine or human serum albumin, citrate, acetate, Ringer's and Hank's solutions, cysteine, arginine, carnitine, alanine, glycine, Lysine, valine, leucine, polyvinylpyrrolidone, polyethylene, and glycol. Preferably, this formulation is stable for at least 6 months at 4°C.

[0205] In some embodiments, the pharmaceutical composition provided herein comprises a buffer such as phosphate-buffered saline (PBS) or sodium phosphate / sodium sulfate, Tris buffer, glycine buffer, sterile water, and other buffers known to those skilled in the art, such as those described in the literature [Good et al. (1966) Biochemistry 5: 467]. The pH of the buffer containing the pharmaceutical composition containing a tumor suppressor gene in an adenovirus vector delivery system may be 6.5 to 7.75, preferably 7 to 7.5, most preferably 7.2 to 7.4.

[0206] In a specific implementation, the virus vector is 1x10 8 Vector genome anomalies, e.g., 1x10 9, 1x10 10, 1x10 11, 1x10 12 or 1x10 13 It may be formulated into any suitable unit dose containing, without limitation, vector genome abnormalities, and in some cases 1 x 10⁶ 14 It is a vector genome, but usually 4x10 15 It is not more than the vector genome. In some cases, the unit dose is up to approximately 5 x 10 15 Vector genome, e.g., 1x10 14 Vector genome below, for example, 1x10 13 , 1x10 12 , 1x10 11 , 1x10 10 or 1x10 9 Vector genome or smaller, 1x10 in specific cases 8 Vector genome or smaller, typically 1x10 8 It is not smaller than the vector genome. In certain cases, the unit dose is 1 x 10⁻⁶ 10 Up to 1x10 11 It is a vector genome. In some cases, the unit dose of the drug is 1 x 10 10 from 3x10 12 It is a vector genome. In some cases, the unit dose is 1 x 10 9from 3x10 13 It is a vector genome. In some cases, the unit dose is 1 x 10 8 Up to 3x10 14 It is a vector genome. In one embodiment, the range is approximately 5x10 10 to about 1x10 11 It is a vector genome. In some embodiments, the range is approximately 1x10 9 From about 1x10 10 It is a vector genome.

[0207] In some cases, the unit dose of a pharmaceutical composition may be measured using the Moment of Infection (MOI). MOI refers to the ratio or multiple of the vector or viral genome to the cells to which the nucleic acid can be delivered. In some cases, the MOI is 1 x 10⁻¹⁰ 6 It can be. In some cases, the MOI is 1x10 5 -1x10 7 It can be. In some cases, the MOI is 1x10 4 -1x10 8 It may be. In some cases, the recombinant virus of the present invention is at least about 1 x 10 1 , 1x10 2 , 1x10 3 , 1x10 4 , 1x10 5 , 1x10 6, 1x10 7 , 1x10 8 , 1x10 9 , 1x10 10 , 1x10 11 , 1x10 12 , 1x10 13 , 1x10 14 , 1x10 15 , 1x10 16 , 1x10 17 and 1x10 18 It is the MOI. In some cases, the recombinant virus of the present invention is 1 x 10 8 Up to 3x10 14 The MOI is approximately 1 x 10⁻¹⁰. In some cases, the recombinant virus of the present invention is about 1 x 10⁻¹⁰ 1 , 1x102 , 1x10 3 , 1x10 4 , 1x10 5 , 1x10 6, 1x10 7 , 1x10 8 , 1x10 9 , 1x10 10 , 1x10 11 , 1x10 12 , 1x10 13 , 1x10 14 , 1x10 15 , 1x10 16 , 1x10 17 and 1x10 18 MOI is. In some embodiments, the range is about 20 to about 400 MOI.

[0208] In some respects, the amount of the pharmaceutical composition is about 1 x 10 8 to about 1x10 15 Recombinant virus, about 1 x 10⁻⁶ 9 to about 1x10 14 Recombinant virus, about 1 x 10⁻⁶ 10 to about 1x10 13 Recombinant virus, or about 1 x 10⁻⁶ 11 to about 3x10 12 It is a recombinant virus.

[0209] method

[0210] As discussed in more detail below, the polynucleotide cassettes and gene transfer vectors of the present invention, collectively referred to herein as the “target compositions,” transfer genes, for example, in animal, e.g., mammalian or human cells. FANCAIt is used to express. For example, the target composition may be used in studies to determine, for example, the effect of a gene on cell viability and / or function. As another example, the target composition may be used in medicine to treat disorders such as FA, for example. Accordingly, in some aspects of the present invention, a method for expressing a gene in cells is provided, the method comprising the step of bringing cells into contact with the composition of the present invention. In some embodiments, contact takes place in vitro. In some embodiments, contact takes place in vivo, that is, the target composition is administered to a target.

[0211] When mammalian cells are contacted in vitro or in vivo with a target polynucleotide cassette or a gene transfer vector containing a target polynucleotide cassette, the cells may be obtained from any mammalian species, e.g., rodents (e.g., mouse, rat, gerbil, squirrel), rabbit, cat, dog, goat, sheep, pig, horse, cattle, primates, and humans. The cells may be derived from an established cell line or may be primary cells, wherein “primary cell,” “primary cell line,” and “primary culture” are used interchangeably herein to refer to cells and cell cultures grown in vitro for a limited number of passages, i.e., cleavage, derived from the target. For example, a primary culture is a culture that may have been passaged 0, 1, 2, 4, 5, 10, or 15 times, although not sufficient to pass through a crisis phase. Typically, the primary cell line of the present invention is maintained in vivo for fewer than 10 passages.

[0212] Embodiments of the present invention include mammalian cells (e.g., CD34+ cells) transfected with a viral delivery vector, e.g., an LV vector containing the human FANCA gene. Additionally, the present invention comprises a method for transfecting mammalian cells, e.g., human hematopoietic stem cells or other cells disclosed herein, wherein the method comprises contacting the cells with a gene delivery vector, e.g., an LV vector disclosed herein or a vector comprising an expression cassette disclosed herein. In specific embodiments, the cells are obtained from a subject to be treated or another donor. In specific embodiments, the subject was diagnosed with Fanconi anemia, and the cells were transfected with an LV containing an expression cassette encoding the FANCA coding region or cDNA. It is understood that the disclosed method, e.g., a method used to deliver a FANCA gene product to a subject using a FANCA cDNA sequence, may also be used to treat Fanconi anemia. In specific embodiments, Transduced cells are a population of cells obtained from a subject with FA, and once they are transduced, they are treated as cells. The cells may be obtained from bone marrow or blood. In a specific embodiment, after the subject with FA is treated with a agent to mobilize stem cells, blood is extracted from the subject, red blood cells are removed, and CD34+ cells are selected. After selection, the cells are transduced. In a specific embodiment, the transduced cells are stored or frozen before use, whereas in a specific embodiment, the cells are provided to the subject immediately after they are transduced or rapidly thereafter, e.g., within 1 hour, 2 hours, or 4 hours.

[0213] In certain embodiments, when cells are transfected with the gene transfer vector disclosed herein, the cells are in contact with the gene transfer vector for about 30 minutes, about 1 hour, about 1.5 hours, about 2 hours, about 2.5 hours, about 3 hours, about 3.5 hours, about 4 hours, about 5 hours, about 6 hours, about 7 hours, about 8 hours, about 12 hours, about 16 hours, about 18 hours, about 20 hours, about 24 hours, about 36 hours, about 48 hours, and about 60 hours. In some embodiments, the cells are transfected for less than 60 hours, less than 48 hours, less than 36 hours, or less than 24 hours.

[0214] A target polynucleotide cassette or a gene delivery vector comprising a target polynucleotide cassette may be delivered to target cells one or more times, e.g., once, twice, three times, or more than three times, and the cells are incubated with the drug(s) for a certain period after each contact event, e.g., 16 to 24 hours, after which the medium is replaced with fresh medium and the cells are further cultured. Cell contact may occur in any culture medium and under any culture conditions that promote cell viability. The culture may contain growth factors to which the cells respond. Growth factors as defined herein are molecules capable of promoting cell viability, growth, and / or differentiation in cultured or intact tissues through specific effects on transmembrane receptors. Growth factors include polypeptide and non-polypeptide factors.

[0215] Typically, an effective amount of a target gene delivery vector or transfected cell containing a target polynucleotide cassette is provided to induce expression of the transgene in the cell. As discussed elsewhere in this application, the effective amount can be easily determined empirically, for example, by detecting the presence or level of the transgenic gene product, or by detecting the effect on the viability or function of the cell. Typically, an effective amount of the target polynucleotide cassette or a gene delivery vector containing the target polynucleotide cassette will promote the expression of the transgene in the cell more than the same amount of polynucleotide cassette known in the art. Typically, expression will be enhanced by at least twofold, e.g., threefold, fourfold, or fivefold, and in some cases tenfold, twentyfold, or fiftyfold, e.g., 100fold, compared to expression from a reference or control polynucleotide cassette.

[0216] For example, when a cell comes into in vivo contact with a target polynucleotide cassette or a gene transfer vector containing a target polynucleotide cassette, the target may be any mammal, for example, a rodent (e.g., mouse, rat, gerbil), a rabbit, a cat, a dog, a goat, a sheep, a pig, a horse, a cow, or a primate. In a further preferred embodiment, the primate is a human. In a further embodiment, the cell is a CD34+ cell.

[0217] The method and composition of the present invention are used, for example, in the treatment of Fanconi anemia.

[0218] In some embodiments, the present method results in a therapeutic benefit, e.g., prevention of onset of a disorder, cessation of progression of the disorder, reversal of progression of the disorder. E.g., in one embodiment, the disorder is BMF. In one embodiment, the disorder is thrombocytopenia. In another embodiment, the disorder is leukopenia. In one embodiment, the disorder is pancytopenia. In one embodiment, the disorder is neutropenia. In another embodiment, the disorder is anemia. In some embodiments, the present method includes the step of detecting that a therapeutic benefit has been achieved. Those skilled in the art will recognize that such measurement of therapeutic efficacy is applicable to specific diseases in which modifications are made, and that appropriate detection methods are used to measure therapeutic efficacy.

[0219] In another embodiment, the present invention comprises a method for treating a disease in a subject requiring treatment, the method comprising providing the subject with an effective amount of cells transfected with a gene delivery vector, e.g., a viral vector, that expresses a therapeutic gene product. In a specific embodiment, the cells are autologous to the subject. In a specific embodiment, the cells are red blood cells, e.g., hematopoietic stem cells or entrusted red blood cell progenitor cells. In some embodiments, the cells are bone marrow cells, e.g., lineage-depleted bone marrow cells. In a specific embodiment, the method is used to treat FA, and the viral vector is an LV comprising a human PGK promoter operably linked to the FANCA gene cDNA or coding sequence and an expression construct disclosed herein comprising the mutated wPRE disclosed herein. In a specific embodiment, the cells are provided to the subject parenterally, e.g., via intravenous injection.

[0220] In another embodiment, the present invention comprises a method for treating FA in a subject requiring it, the method comprising providing the subject with an effective amount of autologous CD34+ stem cells transduced into an LV vector expressing FANCA cDNA in the cells, wherein the LV vector comprises a human PGK promoter operably linked to the FANCA cDNA or coding sequence and the mutated wPRE sequence disclosed herein. In a specific embodiment, the cells are hematopoietic stem cells or hematopoietic erythrocyte progenitor cells, e.g., bone marrow cells. In a specific embodiment, the cells are provided to the subject parenterally, e.g., via intravenous injection.

[0221] The expression of the target transgenic gene is expected to be robust. Therefore, in some cases, the expression of the transgenic gene detected by measuring the level of the gene product or measuring therapeutic efficacy may be observed for 2 months or less after administration, for example, 4, 3, or 2 weeks or less after administration, for example, 1 week after administration of the target composition. The expression of the transgenic gene is also expected to persist over time. Therefore, in some cases, the expression of the transgenic gene detected by measuring the level of the gene product or measuring therapeutic efficacy may be observed for 2 months or more after administration of the target composition, for example, 4, 6, 8, or 10 months or more, in some cases for 1 year or more, for example, 2, 3, 4, or 5 years, and in certain cases, for 5 years or more.

[0222] In a specific embodiment, the method comprises the step of detecting the expression of a transgenic gene in a cell or target, wherein the expression is enhanced compared to the expression from a polynucleotide cassette that does not contain one or more improved elements of the present invention. Typically, the expression will be enhanced by at least 2 times, e.g., 3 times, 4 times, or 5 times, in some cases 10 times, 20 times, or 50 times, e.g., 100 times, compared to a reference, i.e., expression from a control polynucleotide cassette as known in the art, e.g., as demonstrated by early detection, high levels of gene product, a more potent functional effect on the cell, etc.

[0223] Typically, when the target composition is an LV comprising the target polynucleotide cassette of the present invention, the effective amount for achieving the change is about 1 x 10 8 Vector genomic abnormalities, in some cases 1x10 9 , 1x10 10 , 1x10 11 , 1x10 12 , or 1x10 13 Vector genome abnormalities, in certain cases 1x10 14 It will be a vector genome or larger, usually 1x10 15 It is not more than the vector genome. In some cases, the amount of vector genome delivered is up to approximately 1 x 10⁻⁶ 15 Vector genome, e.g., 1x10 14 Vector genome below, for example, 1x10 13 , 1x10 12 , 1x10 11 , 1x10 10 or 1x10 9 Vector genome or smaller, 1x10 in specific cases 8 Vector genome, and typically 1x10 8 It is not less than the vector genome. In some cases, the amount of the vector genome delivered is 1 x 10⁶ 10 from 1x10 11It is a vector genome. In some cases, the amount of vector genome delivered is 1 x 10⁶ 10 from 3x10 12 It is a vector genome. In some cases, the amount of vector genome delivered is 1 x 10⁶ 9 from 3x10 13 It is a vector genome. In some cases, the amount of vector genome delivered is 1 x 10⁶ 8 from 3x10 14 It is a vector genome.

[0224] In some cases, the amount of pharmaceutical composition to be administered may be measured using the Momentum of Infection (MOI). In some cases, MOI may refer to the ratio or multiple of a vector or viral genome that can be delivered to a nucleated cell. In some cases, MOI is 1 x 10⁻¹⁰ 6 It can be. In some cases, the MOI is 1x10 5 -1x10 7 It can be. In some cases, the MOI is 1x10 4 -1X10 8 It may be. In some cases, the recombinant virus of the present invention is at least about 1 x 10 1 , 1x10 2 , 1x10 3 , 1x10 4 , 1x10 5 , 1x10 6, 1x10 7 , 1x10 8 , 1x10 9 , 1x10 10 , 1x10 11 , 1x10 12 , 1x10 13 , 1x10 14 , 1x10 15 , 1x10 16 , 1x10 17 and 1x10 18 It is the MOI. In some cases, the recombinant virus of the present invention is up to 1x10 1 , 1x10 2 , 1x10 3 , 1x10 4 , 1x105 , 1x10 6, 1x10 7 , 1x10 8 , 1x10 9 , 1x10 10 , 1x10 11 , 1x10 12 , 1x10 13 , 1x10 14 , 1x10 15 , 1x10 16 , 1x10 17 and 1x10 18 It is MOI.

[0225] In some respects, the amount of the pharmaceutical composition is about 1 x 10 8 to about 1x10 15 Recombinant virus particles, about 1 x 10⁻⁶ 9 to about 1x10 14 Recombinant virus particles, about 1 x 10⁻⁶ 10 to about 1x10 13 Recombinant virus particles, or about 1 x 10⁻⁶ 11 to about 3x10 12 It may contain recombinant viruses of the particles.

[0226] Any total number of virus particles suitable for providing appropriate transduction of cells to impart a desired effect or treat a disease may be administered to mammals. In various preferred embodiments, at least 10 8 ; 5x10 8 ; 10 9 ; 5x10 9 , 10 10 , 5x10 10 ; 10 11 ; 5 x10 11 ; 10 12 ; 5x10 12 ; 10 13 ; 1.5x10 13 ; 3x10 13 ; 5x10 13 ; 7.5x10 13 ; 9x10 13 , 1x10 14 Virus particles, or 5x1014 Virus particles are larger than, but generally 1 x 10⁶ 15 A number of virus particles or fewer are injected. Any appropriate number of vectors may be administered into the eyes of mammals or primates. In one embodiment, the method comprises a single administration; in another embodiment, multiple administrations are performed over time as deemed appropriate by the attending physician. In some embodiments, at least 5 x 10 at a single administration (24-hour transduction) 5 2 x 10 cells / ml 8 VG / ml or higher is required to obtain high transduction efficacy. Individual doses are typically not less than the amount required to produce a measurable effect on the subject and can be determined based on pharmacokinetics and pharmacology regarding the absorption, distribution, metabolism, and excretion (“ADME”) of the target composition or its byproducts, and thus the propensity of the composition within the subject. This includes consideration of the dose as well as the route of administration. Effective doses and / or dose regimens can be easily determined empirically from preclinical studies, safety and step-scale and dose-range studies, individual clinician-patient relationships, as well as in vitro and in vivo analyses as described herein and depicted in the examples.

[0227] In some embodiments, the volume of cells administered to the patient by injection is obtained from the transduction process. In various preferred embodiments, at least 1 x 10⁶ of the patient's body weight 1 , 1x10 2 , 1x10 3 , 1x10 4 , 1x10 5 , 1x10 6, 1x10 7 , 1x10 8 More than 10 CD34+ cells / kg are infused into the patient. In some embodiments, 1 x 10 times the patient's body weight 6 and 4x10 6CD34+ cells / kg are infused into the patient. In another embodiment, 3 x 10 times the patient's body weight 5 and 4x10 6 CD34 + Cells / kg are injected into the patient. In some embodiments, the cells will be injected into the patient as a single dose. In other embodiments, the cells will be injected into the patient as multiple doses. The transfected cells may be injected immediately after the transfection process is completed.

[0228] Once integrated, therapeutic proteins (e.g., human FANCA protein) are expressed by the cells. Transduced FA cells are genetically modified to activate the FA pathway through the mono-ubiquitination of FANCD2 and FANCI. These proteins migrate to DNA damage sites and, in cooperation with other DNA repair proteins, promote DNA repair in these cells just as it occurs in healthy cells.

[0229] As described in more detail in the examples, preclinical in vitro data using BM samples from human FA patients have already demonstrated the efficacy of FANCA LV for correcting the phenotype of these cells.

[0230] Accordingly, the present invention provides a method for treating hematological signs of FA. In one embodiment, the hematological signs of FA are selected from one or more of BMF, thrombocytopenia, leukopenia, pancytopenia, neutropenia, and anemia. In a specific embodiment, the hematological sign is bone marrow failure (BMF) that occurs in pediatric age in most FA patients. In one embodiment, the hematological sign is thrombocytopenia. In another embodiment, the hematological sign is leukopenia. In one embodiment, the hematological sign is pancytopenia. In one embodiment, the hematological sign is neutropenia. In another embodiment, the hematological sign is anemia. In one embodiment, the hematological sign is a combination of two or more of BMF, thrombocytopenia, leukopenia, pancytopenia, neutropenia, and anemia.

[0231] FANCA LV does not directly treat solid tumors that may develop at more advanced stages of the disease. Nevertheless, the improvement in the hematological status of FA patients treated with hematopoietic gene therapy can enhance immune surveillance against the development of solid tumors. Therefore, indirect anti-tumor effects may also occur as a result of treating FA patients with FANCA LV.

[0232] To achieve successful gene therapy in FA, it is beneficial to collect a sufficient number of hematopoietic stem cells (HSCs) from the target.

[0233] In one embodiment, HSCs are obtained or collected from a bone marrow sample. In one embodiment, the bone marrow sample is depleted of red blood cells. In some embodiments, the bone marrow sample is depleted of CD16+ leukocytes. In some embodiments, the cells remaining after the depletion technique are washed. In another embodiment, a non-specific IgG is added to the washed cells. In some embodiments, the non-specific IgG is flebogamma. Subsequently, CD34+ cells can be selected from the washed cells. In one embodiment, CD34+ cells can be selected from the bone marrow sample. The method for selecting CD34+ cells may be positive screening, negative screening, or a combination thereof.

[0234] In another embodiment, HSCs are obtained from peripheral blood. In one embodiment, the peripheral blood sample is depleted of red blood cells. In some embodiments, the blood sample is depleted of CD16+ leukocytes. In some embodiments, residual blood cells are washed after the depletion technique. In another embodiment, a non-specific IgG is added to the washed cells. In some embodiments, the non-specific IgG is phlebogamma. Subsequently, CD34+ cells can be selected from the washed cells. In one embodiment, CD34+ cells can be selected from the peripheral blood sample. The method of selecting CD34+ cells may be positive screening, negative screening, or a combination thereof.

[0235] In some embodiments of the present invention, HSCs may be obtained from the target after mobilization. Mobilization may be achieved by causing the migration of stem cells from the bone marrow to the blood and by treating the target with a drug or compound. The stem cells may be collected and stored. In some embodiments, mobilization is achieved by treating the target with G-CSF (filgrastim). In another embodiment, mobilization is achieved by treating the target with plerixapor. In yet another embodiment, mobilization is achieved by treating the target with a combination of filgrastim and plerixapor (Figs. 11 and 14).

[0236] In one embodiment, at least 1 to 4 x 10 per kilogram of patient body weight 6 Corrected CD34 + Cells (e.g., FANCA-transduced HSCs) are administered to restore hematopoietic function in unconditioned FA patients. In some embodiments, the transduced cells are infused or administered to the patient immediately after transduction (Fig. 11). In other embodiments, the transduced cells are frozen before infusion or administration to the patient (Fig. 11).

[0237] Genetic correction of HSCs from FA patients following autologous transplantation of these cells (hematopoietic gene therapy) is a good alternative for FA patients, particularly those without siblings with the same HLA. In one embodiment, hematopoietic gene therapy is a desirable treatment regimen for patients without siblings with the same HLA. In another embodiment, hematopoietic gene therapy is a desirable treatment regimen for patients with siblings who have the same HLA.

[0238] All publications mentioned herein are incorporated herein by reference to disclose and describe the manner and / or materials in which such publications are cited. It is understood that the disclosures of this application replace any disclosures of any publications included herein, to the extent that contradictions exist.

[0239] It should also be noted that a claim may be drafted to exclude any optional elements. Accordingly, this statement is intended to serve as a precedence for the use of exclusive terms such as "alone," "only," etc., in connection with the citation of claim elements or the use of "negative" limitations.

[0240] The publications discussed herein are provided only for their disclosure prior to the filing date of this application. Additionally, the dates of the provided publications may differ from the actual dates of disclosure, which may need to be verified independently.

[0241] Because FA-A is the most frequent complement group in FA patients (Casado et al., 2007, Taniguchi et al., 2006), the examples focus on vectors expressing the FANCA gene and / or the EGFP marker gene; however, other FANCA genes can be similarly used to process other complement groups. Brief explanation of the drawing

[0242] Fig. 1 is a schematic diagram of an exemplary construct, PGK-FANCA.WPRE*LV. Fig. 2A This illustrates a schematic representation of an LV expressing FANCA under the control of different internal promoters. Fig. 2B This illustrates a Western blot analysis of FANCA showing that MMC-hypersensitivity in hematopoietic progenitor cells of gene-therapyd FA-A mice was corrected in FA-A cells transfected with the vector shown in Panel A. FA-A bone marrow (BM) cells were transfected with PGK_FANCA-WPRE* or control SF1-EGFP LVs and transplanted into irradiated FA-A mice. BM samples were collected at 7 months post-transplantation and cultured in methylcellulose in the presence of increasing concentrations of mitomycin C (MMC). Fig. 3This represents data showing the functional analysis of a lentiviral vector expressing FANCA under the regulation of different internal promoters. Fig. 3A Figure 1 illustrates the reversal of MMC sensitivity in FA-A lymphoblast cell lines (LCL) transduced with LVs. The mean values ​​of three different experiments are plotted. Fig. 3B This illustrates the recovered formation of nuclear FANCD2 lesions in FA-A LCLs transduced with a vector and exposed to mitomycin C (MMC). Fig. 4 This represents data showing the in vivo efficacy and safety of FA gene therapy using PGK-FANCA.Wpre* LV. Fig. 4A illustrates the above construct. Fig. 4B This describes a method of transfecting bone marrow (BM) cells from FA-A mice into FANCA LV and then transplanting them into irradiated FA-A recipient mice. Fig. 4C It shows that transplanted FA-A mouse-derived BM samples were cultured in methylcellulose in the absence or presence of MMC. Fig. 5 FANCA that received transplants of synonyms bone marrow cells previously transduced with a lentiviral vector carrying a therapeutic FANCA gene under the regulation of a PGK promoter - / - Plots the number of provirus copies in mice. PB = Peripheral blood; BM = Bone marrow. Fig. 6 The table shows data demonstrating that MMC-hypersensitivity in hematopoietic progenitor cells of FAA mice that received gene therapy with a drug was corrected. FA-A bone marrow (BM) cells were transduced with PGK_FANCA-WPRE* or SF1-EGFP LVs and transplanted into irradiated FA-A mice. BM samples were collected at 7 months post-transplant and cultured in methylcellulose in the presence of increasing concentrations of MMC. Fig. 7This depicts increased transduction efficiency in cryopreserved bone marrow progenitor cells from three patients with Fanconi anemia. The samples were adapted to standard transduction (white bars; 1xS) consisting of a single transduction cycle (16 hours) following 2 hours of static preloading, or enhanced transduction (gray bars; 3xD) consisting of three transduction cycles (2 hours + 2 hours + 12 hours) using a lentiviral vector. Fig. 8 This illustrates the relevance of WPRE sequences to the functional characteristics of a lentiviral vector expressing FANCA under the regulation of a PGK promoter. Fig. 8A: Reversal of (MMC) sensitivity of FA-A LCLs transduced with PGK-FANCA and PGK-FANCA-WPRE LVs. The mean values ​​of three different experiments are plotted. Fig. 8B: Reversal of MMC sensitivity in FA-A hematopoietic progenitor cells (colony-forming cells, CFCs) transduced with SFFV-FANCA LV and PGK-FANCA LVs ("Experiment 1") and PGK-FANCA and PGK-FANCA-WPRE LVs ("Experiment 2"). White bars = no MMC; black bars = 10 nM MMC. MMC = mitomycin C Fig. 9 This illustrates the effectiveness of GALV-TR and VSV-G pseudotyping lentivirus vectors for transducing hematopoietic progenitor cells obtained from the bone marrow of patients with Fanconi anemia into EGFP-LVs. Fig. 10 It demonstrates the in vitro transformation ability of a lentivirus containing an hPGK promoter. Fig. 10A : Description of a vector. Fig. 10B : Transformation ability measured by re-smear frequency according to copy number. Fig. 11 This is a description of an exemplary hematopoietic stem cell (HSC) collection and gene therapy trial for FA-A patients. Fig. 12 This illustrates the hematological parameters of the patients recruited for the study described in the examples. Fig. 12A It shows the results for hemoglobin. Fig. 12BIt plots the results for neutrophils. Fig. 12C It shows the results for platelets. Fig. 12D It shows the results for CD34+ cells. Fig. 13 This describes a two-phase study of the Fancostem protocol to evaluate the safety and efficacy of CD34+ cell mobilization and collection after treatment with Plerixafor (MOZOBIL) and Filgrastim (also known as G-CSF) (NEUPOGENE) in patients with Fanconi anemia. The number of patients is 10. Fig. 14 This illustrates the mobilization of G-CSF / plericsaphor-mediated CD34+ in FA-A patients. Fig. 15 This illustrates the mobilization of G-CSF / plericsaphor-mediated CFCs in FA-A patients. Fig. 16 This is a summary of CD34+ cells collected from patients with FA-A mediated by G-CSF / plerixapor. Fig. 16A illustrates CD34+ collection in FANCOSTEM and Fig. 16B It illustrates a comparison with prior studies. Fig. 17 This is a chart showing a comparison between the predicted CD34+ cells in the bone marrow (BM) and the actual number mobilized in the peripheral blood (mPB). Fig. 18 This is a chart regarding the collection and purification of mobilized peripheral blood (mPB) FA-A CD34+ cells. Fig. 19 This shows CD34 expression before and after immunoselection in mobilized peripheral blood (mPB) CD34+ cells from healthy donor (HD) and FA patients. Fig. 20 It shows that patient FA 02005 meets the criteria for both the FANCOSTEM and FANCOLEN studies. Fig. 20A represents the number of cells; Fig. 20B It plots hematopoietic stem cell (HSC) content versus age. Fig. 21 (AE) This represents the test results showing the FA diagnosis of patient FA-02005 before gene therapy. Fig. 22Figure 2005 illustrates the subsequent parameters of the cell manufacturing process for FA-A patient 02005. Fig. 23 This is a graph depicting the number of vector copies in patient FA-02005 before gene therapy, and after 2, 4, 6 weeks, 2, 3, 4 months, and 5 months of gene therapy. Fig. 24 This represents the follow-up examination of the first unconditioned FA-A patient (FA-02005) before and after gene therapy, as measured by the amount of hemoglobin after gene therapy. Fig. 25 This represents the follow-up examination of the first unconditioned FA-A patient (FA-02005) before and after gene therapy, as measured by the amount of neutrophils after gene therapy. Fig. 26 This represents the follow-up examination of the first unconditioned FA-A patient (FA-02005) before and after gene therapy, as measured by the amount of platelets after gene therapy. Fig. 27 This is a chart regarding the hematological evolution of patient FA-A 02002. Fig. 28 Absence of mosaic phenomenon; homozygous FANCA c.239 C>T p.Gln99*MMC Hypersensitivity; FANC It shows the diagnosis of FA 02002 by reinforcement by. Fig. 29 This illustrates the cell manufacturing process in patient FA-A 02002. Fig. 30 This represents an analysis of CD34 expression in healthy donor (HD) and FA-mobilized peripheral blood (mPB) during other steps required for LV-transduction in patient FA 02002. Fig. 31 This is a graph depicting the number of vector copies before and after gene therapy in patient FA 02002. Fig. 32 This represents follow-up data from a follow-up examination of patient FA-A 02002, into whom cryopreserved cells were injected, as measured by the amount of hemoglobin. Fig. 33 This represents follow-up data from the follow-up examination of patient FA-A 02002, who was injected with cryopreserved cells as measured by the amount of neutrophils. Fig. 34This represents follow-up data from a follow-up examination of patient FA-A 02002, into whom cryopreserved cells were injected as measured by platelet volume. Fig. 35 This illustrates the transduction of fresh mobilized peripheral blood (mPB) CD34+ cells obtained from FA-A patients under confirmed conditions. Fig. 35A represents the protocol. Fig. 35B It plots the result graph obtained from patient 02002. Fig. 35C It plots the result graph obtained from patient 02003. Fig. 35D It plots the result graph obtained from patient 02004. Fig. 36 This shows data on the engraftment of corrected FA-A mPB CD34+ cells in NSG mice. Fig. 36A represents the protocol. Fig. 36B shows the results for patient 02002. Panel C shows the results for patient 02003. Fig. 36D Figure 02004 shows the results. mPB = mobilized peripheral blood. Fig. 37 In vivo of corrected FA HPCs obtained from patient 02002 in NOD skid gamma (NSG) rats Describes the choice. Fig. 37A illustrates the protocol. Fig. 37B This is a graph regarding CFCs pre-transplantation. Fig. 37C This is a graph of hCFCs 30 days after transplantation. Fig. 38 It is a map of a 5.7kb plasmid encoding the VSV envelope G glycoprotein under the control of the CMV promoter, and carries a kanamycin resistance gene for screening purposes. Fig. 39 is HIV-1 under the control of the CMV promoter rev It is a map of a 3.5kb plasmid encoding a gene, and carries a kanamycin resistance gene for screening purposes. Fig. 40It is a map of an 8.8kb plasmid containing HIV-1 gag and pol genes encoding HIV-1 construct and enzyme proteins under the control of the CMV promoter. It contains human beta-globin (HBB2) intron 2, HIV-1 Rev response factor (RRE), and kanamycin resistance genes. Fig. 41 is a map of the 11,621 base pairs of the pCCL-SIN-cPPT / CTS-hPGK-hFANCA-WPRE delivery cassette. Fig. 42 This represents the LAM-PCR analysis of the FANCA-LV insertion site in FA hematopoietic stem cells (HSC). Fig. 43 This depicts the LAM-PCR results tracking FANCA-LV-treated cells. Fig. 43A describes the protocol Fig. 43B is a chart about data. Fig. 44 This illustrates the clonal diversity of Fanca- / - recipients transplanted into LV-corrected HSCs. Fig. 4A Is Drawing the protocol Fig. 44B It represents a graph regarding the data. Specific details for implementing the invention

[0243] Example 1: FANCA Lentivirus Vector

[0244] Due to the integration pattern of LV, which is safer compared to RV (Gonzalez-Murillo et al. , 2008; Modlich et al. , 2009; Montini et al. , 2006; Mitchell RS, Beitzel BF, Schroder AR et al. Plos Biol. 2004;2:E234; Montini E et al. J Clin Invest. 2009; 119: 964-975; Schroder A.R. et al. Cell. 2002; 110: 521-529), the goal was to develop LV as a therapeutic vector to correct the phenotype of FA cells (Gonzalez-Murillo). et al. , 2009). Furthermore, because recent studies have confirmed that LVs containing strong internal promoters can trans-activate nearby genes (Modlich et al. ( , 2009), LV was considered for clinical use as a trade-off between pre-therapeutic efficacy and the risk of transactivating nearby genes. Therefore, the objective was to define a threshold level of FANCA expression that could be therapeutic in order to limit the risk of gene transactivation by enhancers / promoters that induce the expression of therapeutic genes. The efficacy of FANCA LV was confirmed first in FA-A LCLs in vitro, then in primary BM samples from FA-A patients, and finally in vivo in FA-A mouse models.

[0245] For this purpose, LVs expressing FANCA were constructed under the control of different promoters: vav, PGK, CMV, and SFFV promoters. Fig. 1 This is a schematic diagram of a medical product. Fig. 2A Figure [Figure] illustrates a schematic diagram of an LV expressing FANCA under the regulation of another internal promoter. Additionally, the inventors investigated the influence of post-transcriptional WPRE factors on both the expression levels of FANCA and the therapeutic efficacy of the LV. Initially, all LVs were packaged in a chimeric GALV-TR envelope. 1-2x10 6 Titers of tu / ml were typically obtained, and transduction was performed with an estimated MOI of 1-2 tu / cell. Fig. 2B This illustrates the Western blot analysis of FANCA in transduced FA-A mouse cells.

[0246] To determine the levels of FANCA mRNA conferred by each vector, transfected FA-A lymphocyte cell lines (LCL) were screened with 30 nM MMC for 5 days. After the screening process, the transfected FA-A LCL contained 0.81 to 3.04 copies of each LV per cell (Table 1). Unscreened FA-A LCL transfected with EGFP-LVs and LCLs from healthy donors (HD) were used as controls.

[0247] Relative FANCA mRNA levels per LV copy as well as total FANCA mRNA levels were determined in LCLs transfected with different LVs ( Table 1 Compared to the FANCA mRNA levels observed in HD LCL, similar levels of FANCA mRNA / copy were observed in FA-A cells transfected with vav-FANCA and PGK-FANCA LV. CMV-FANCA and, more significantly, SFFV-FANCA LV conferred ultraphysiological levels of FANCA mRNA / copy (3.6-fold and 5.6-fold, respectively). PGK-FANCA LV containing WPRE or mutated WPRE* sequences (Schambach et al., 2006) increased FANCA mRNA levels 2.3–2.6-fold compared to PGK-LV without WPRE. This is consistent with other studies (Schambach et al. , 2006; Zanta-Boussif MA, Charrier S, Brice-Ouzet A Et al..Validation of a Mutated Pre Sequence Allowing High and Sustained Transgene Expression While Abrogating WHV-X Protein Synthesis: Application to the Gene Therapy of WAS. Gene Ther. 2009;16:605-619; Zufferey R, Donello JE, Trono D, Hope TJ. Woodchuck Hepatitis Virus Posttranscriptional Regulatory Element Enhances Expression of Transgenes Delivered by Retroviral Vectors. J Virol. 1999; 73: 2886-2892), insertion of WPRE or WPRE* sequences significantly increased FANCA mRNA levels in cells transfected with PGK-FANCA LV. Because the wild-type WPRE element encodes a truncated version of the hepatitis C virus X protein that can mediate tumorogenic effects (Bouchard MJ, Schneider RJ. The Enigmatic X Gene Of Hepatitis B Virus. J Virol. 2004; 78: 12725-12734.2004; Kingsman SM, Mitrophanous K, Olsen JC. Potential Oncogene Activity of the Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE). Gene Ther. 2005; 12: 3-4), LVs with mutated WPRE* sequences that lack any residual open reading frame (Schambach et al., 2006) are considered more suitable for clinical use.

[0248] Table 1.FANCA expression levels in FA-A LCLS transfected with a FANCA-expressing lentiviral vector.

[0249]

[0250] To estimate the levels of FANCA mRNA and FANCA protein per copy of FANCA, two copies of genomic FANCA from healthy donor LCL were considered.

[0251] To test whether differences in FANCA mRNA expression were confirmed at the protein level, Western blot analysis ( Fig. 2B ) was performed using the samples presented in Table 1. Since it was performed by determining FANCA mRNA, FANCA protein values ​​were associated with protein loading as well as the number of proviral copies determined in each transfected FA-LCL. Compared to the FANCA levels / copy determined in HD-LCL, all tested FANCA-LVs, with the exception of SFFV-FANCA LV, were essentially conferred normal levels of FANCA / copy. In this case, the relative FANCA levels / copy were 3.4 times higher than those determined in HD-LCL. According to Western blots re-stained with anti-FANCD2, FA-A LCLs transfected with the control vector were unable to mono-ubiquitinate FANCD2, whereas FA-A LCLs transfected with any type of FANCA-LV expressed both non-ubiquitinated and mono-ubiquitinated forms of FANCD2, which is consistent with the functional FA pathway in these cells.

[0252] When comparing the FANCA expression levels conferred by different LVs in FA-A LCL with those observed in healthy donor (HD) LCL (2 copies of FANCA), the inventors concluded that, with the exception of SFFV-LVs, the insertion of 2 LV copies per cell can result in physiological levels of the therapeutic protein, which will confer superphysiological levels of FANCA. Achieving this copy number may meet the clinical trial requirements for FA patients, where at least 50% transduction efficiency is required due to the low number of progenitor cells present in the BM (Gonzalez-Murillo). et al. , 2009, Jacome et al. , 2006, Kelly et al. , 2007; Larghero J, Marrolleau JP, Soulier J et al. Hematopoietic Progenitor Cell Harvest and Functionality in Fanconi Anemia Patients. Blood. 2002; 100:3051).

[0253] To analyze possible differences in therapeutic efficacy of different FANCA-expressing LVs, the efficiency of each vector for correcting MMC hypersensitivity in FA-A lymphocyte cell lines (LCL) was measured. For this purpose, FA-A LCL was different LV ( Fig. 3A After being transfected with ), the cells were exposed to increasing concentrations of MMC. Subsequently, the viability of the transfected cells was measured. Fig. 3A As shown in [figure], all tested FANCA-LVs were equally efficient in restoring FA-A LCL hypersensitivity. Similarly, all vectors promoted the formation of nuclear FANCD2 lesions in MMC-treated cells, consistent with the functional FA pathway in FA-A cells transfected with any one FANCA-LV ( Fig. 3B ).

[0254] Example 2: Mouse Model Study

[0255] To evaluate the repopulating characteristics of BM samples from FA patients, whether genetically corrected or not, several groups transplanted BM cells from FA patients into immunodeficient mice. Nevertheless, no significant engraftment was reported in any case, which appears to be due to a decrease in the number of hematopoietic progenitor cells and HSCs present in the BM of these patients.

[0256] To evaluate the in vivo effects of the drug, a mouse model of FA-A containing a deletion in the Fanca gene was used. Unlike FA patients, these animals do not develop obvious hematological defects. Nevertheless, their BM progenitor cells are highly sensitive to MMC, as in FA patients (Rio et al. , 2002). Therefore, FANCA LV ( Fig. 4A To determine whether ) stably corrected the phenotype of HSCs from FA-A mice in vivo, BM cells from FA-A mice were transformed into FANCA LV and then transplanted into irradiated FA-A recipients ( Fig. 4B To evaluate whether the hematopoietic progenitor cell phenotype was corrected after transplantation of genetically corrected cells, BM samples from transplanted FA-A mice were cultured in methylcellulose in the absence and presence of MMC ( Fig. 4C Additional data confirming the integration of the treatment cassette Figs. 42-44 It is presented in [the document]. Linear Amplification Mediated (LAM) PCR is a method for searching for sites of integration into the genome of different integration vectors. It identifies the location of vector integration within the genome by generating a PCR product that starts from a known sequence of the vector and extends through an unknown adjacent genome, and determining the base sequence. Fig. 42This represents the LAM-PCR analysis of the FANCA-LV insertion site in FA hematopoietic stem cells (HSC). Fig. 43 This depicts the LAM-PCR results for tracking FANCA-LV-treated cells. Fig. 44 This illustrates the clonal diversity of Fanca- / - recipients transplanted into LV-corrected HSCs.

[0257] One month after transplantation, normal hematological values ​​were observed in these animals, and LV did not exhibit apparent toxicity. At this point, the number of proviral FANCA copies per cell varied between 0.5 and 10 copies / cell (similar results were observed at 3 and 6 months after transplantation). Fig. 5 To evaluate whether the phenotype of hematopoietic progenitor cells was corrected after transplantation of gene-edited cells, BM samples from transplanted FA-A mice were cultured in methylcellulose in the absence and presence of MMC.

[0258] Fig. 6 As shown in [figure], significant correction of MMC hypersensitivity was observed in hematopoietic progenitor cells of FA mice treated with FANCA LV compared to the SF1-EGFP LV control. FA-A bone marrow (BM) cells were transduced with PGK_FANCA-WPRE* or the control SF1-EGFP LV and transplanted into irradiated FA-A mice. BM samples were collected at 7 months post-transplant and cultured in methylcellulose in the presence of progressively increasing concentrations of mitomycin C (MMC).

[0259] Therefore, these data indicate that FANCA LV can restore the hematopoietic progenitor cell phenotype in FA-A mice after in vivo transplantation. In terms of safety, none of the 30 mice transplanted with BM cells previously transduced with FANCA LV showed symptoms of myeloproliferative disorders or leukemia (data up to 1 year post-transplant).

[0260] Example 3: Efficient transduction of fresh hematopoietic progenitor cells obtained from FA patients using lentiviral vectors

[0261] Since it was found that the transduction of cryopreserved FA hematopoietic stem cells (HSCs) was less effective compared to the transduction of fresh grafts (Jacome et al., 2009), efforts were made to optimize the efficiency of transduction of cryopreserved FA BM samples. Fig. 7 As shown in [figure], performing three transduction cycles significantly increased the transduction efficiency of FA CFCs compared to the value obtained after a single transduction cycle (45.7 ± 4.2% vs. 13.5 ± 5.1%, respectively). It was adapted to standard transduction (white bar; 1xS) including a single transduction cycle (16 hours) after 2 hours of static preloading, or enhanced transduction (gray bar; 3xD) consisting of three transduction cycles (2 hours + 2 hours + 12 hours) using a lentivirus vector.

[0262] Example 4: The PGK-FANCA-WPRE* lentiviral vector efficiently corrects the phenotype of bone marrow progenitor cells in FA-A patients.

[0263] Due to the LV efficacy induced by the PGK promoter, and safety (Follenzi A et al. Nat Genet.2000; 25: 217-222) and the low genotoxicity characteristics of LVs carrying PGK promoters (Modlich et al ., 2009, Montini et al., 2006, Montini et al Based on previous research (2009), additional experiments were performed using LCLs and also PGK-FANCA LVs that did not contain any WPRE elements or WPRE or WPRE* sequences in the bone marrow cells of FA-A patients. Fig. 8A As shown in [figure], all three of these vectors gave the same return in the hypersensitivity of FA-A LCL to MMC.

[0264] To compare the efficacy of SFFV-FANCA and PGK-FANCA LV for correcting the hematopoietic progenitor cell phenotype in FA-A patients, red blood cell-depleted BM samples from FA-A patients were transduced as recently described (Jacome et al Erythrocyte-depleted BM cells were transduced for 16 hours on plates preloaded with LV supernatant as recently described (Gonzalez-Murillo). et al ., 2009). After 14 days, the number of colonies grown in the absence and presence of 10 nM MMC was recorded to determine the proportion of drug-resistant progenitor cells.

[0265] Fig. 8B As shown in [figure], when samples were transfected with EGFP-LV, almost no colonies were formed in the presence of MMC. In contrast to this observation, transfection of FA-A BM cells with SFFV-FANCA and PGK-FANCA LVs allowed for 26% and 38% growth of colonies recorded in cultures without MMC. The efficacy of PGK-FANCA LV containing WPRE and WPRE* sequences was compared with PGK-FANCA LV without WPRE. Fig. 8B As shown in [figure], all three LVs mediated similar and high levels of protection against MMC. Although the insertion of the post-transcriptional regulatory element WPRE* (Schambach et al., 2006) is not essential for enhancing the efficacy of PGK-FANCA LV, this element will provide an additional factor for maintaining long-term therapeutic levels of ectopic FANCA in patients.

[0266] Taken together, the data from these studies strongly suggest that PGK-FANCA-WPRE* LVs provide a level of FANCA expression sufficient to correct the hematopoietic phenotype in FA-A patients. These results support the stability of PGK-LVs (Follenzi et al. ., 2000) and safety characteristics (Modlich et al., 2009, Montini et al., 2006, Montini et al ., 2009), efficacy of mutated WPRE* post-transcriptional factors (Schambach et al. Together with previous observations showing (2006), this strengthens the hypothesis that PGK-FANCA-WPRE* LV can constitute an efficient and safe vector for gene therapy in FA-A patients.

[0267] Example 5: Analysis of the efficacy of GALV-TR and VSV-G packaged lentiviral vectors for transduction of hematopoietic progenitor cells in FA patients

[0268] Since LV can be pseudotyped by both GALV-TR and VSV-G envelopes, a new experiment was performed to transform unselected bone marrow cells from FA patients under optimal conditions in which EIFFP-LV was pseudotyped by two envelopes.

[0269] For GALV-TR pseudotyped LV, non-concentrated LV (estimated titer: 2×10 5 Two transduction cycles were performed using IU / mL; estimated MOI: 2 IU / cell).

[0270] In the case of VSV-G pseudotyped LV, concentrated and purified LV (estimated titer: 10 8 One transduction cycle using IU / mL; Estimated MOI: 50 IU / cell).

[0271] Fig. 9 As shown in [figure], similar transduction of hematopoietic progenitor cells from FA patients was obtained in both conditions, which indicates that manufacturing compromises can determine the best outer layer for packaging.

[0272] Example 6: Stability Study

[0273] Fig. 10A The transformation ability of the lentivirus vector shown in was measured as the replating frequency relative to the copy number. Fig. 10B As shown in [figure], the transforming ability of the lentiviral backbone corresponding to PGK-FANCA-WPRE* LV (PGK-derived lentiviral vector) is significantly lower than that of the transforming ability of the vector containing the viral promoter, which is a vector already used in X1-SCID and CGD clinical trials.

[0274] In relation to an in vivo study of mice transplanted with BM cells transduced with PGK-FANCA-WPRE* LV, 30 mice were transplanted, and none of the transplanted animals showed symptoms of myeloproliferative disorder or leukemia up to one year after transplantation.

[0275] Example 7: Pharmaceutical product

[0276] The FANCA lentiviral vector is a third-generation self-inactivated rHIV1-derived vector that encodes human FANCA cDNA under the regulation of the human PGC promoter and is regulated at the post-transcriptional level by a mutant WPRE deficient in X protein ORF ( Fig. 1 , Fig. 41 and SEQ ID NO: 24). These FANCA lentiviral vectors offer several advantages over previously used gamma-retroviral vectors in FA gene therapy, particularly the ability to transduce cells despite a short pre-activation protocol, which is advantageous for preserving the multi-lineage potential of hematopoietic stem cells.

[0277] To generate therapeutic lentivirus vectors, providing all helper proteins necessary for vector packaging ( Figs. 38-40 (Reference), 293T cells transfected with three additional plasmids will contain the PGK-FANCA-WPRE* drug. (Fig. 41).

[0278] The PGK-FANCA-WPRE* LV therapeutic cassette comprises a human PGK promoter, a sequence encoding FANCA cDNA and a WPRE* enhancer, and contains nucleotides 3541 to 9178 of SEQ ID NO: 24. It comprises a human CMV immediate early promoter, an HIV packaging sequence, ga and RRE elements, a therapeutic cassette, and an HIV self-inactivating 3' LTR, wherein the delivery cassette region of the therapeutic cassette comprising the human PGK promoter, the FANCA cDNA sequence and the WPRE* enhancer is encoded by nucleotides 1586 to 9495 of SEQ ID NO: 24.

[0279] Nucleotides 1586–1789 of SEQ ID NO: 24 contain the human CMV immediate early promoter. Nucleotides 2031–2156 of SEQ ID NO: 24 contain the HIV1 psi packaging signal. Nucleotides 2649–2882 of SEQ ID NO: 24 contain the HIV1 RRE element. Nucleotides 3378–3495 of SEQ ID NO: 24 contain the HIV cPPT / CTS element. Nucleotides 3541–4051 of SEQ ID NO: 24 contain the hPGK promoter. Nucleotides 4078–8445 of SEQ ID NO: 24 contain human FANCA-A cDNA. Nucleotides 8502–9178 of SEQ ID NO: 24 contain the mutated WPRE element. Nucleotides 9262–9495 of SEQ ID NO: 24 contain the HIV Delta U 3' LTR.

[0280] Example 8: FANCOSTEM Clinical Study

[0281] In the United States, two gene therapy trials were conducted in FA-A and FA-C patients but were clinically ineffective (Liu, JM, et al. (1999). Engraftment of hematopoietic progenitor cells transduced with the Fanconi anaemia group C gene (FANCC). Hum.Gene Ther. 10: 2337-2346; Kelly, P. F., et al. (2007). Stem cell collection and gene transfer in fanconi anaemia. Mol Ther 15: 211-219). The efficacy of the aforementioned test can be significantly improved through various optimizations. Two clinical trials were conducted simultaneously to determine the feasibility of the process of collecting and purifying a sufficient number of CD34+ cells for future clinical use (FANCOSTEM), and in parallel to evaluate the safety and efficacy of gene therapy in patients with FA of complement group A (FA-A) (FANCOLEN). Fig. 11 reference.

[0282] The primary inclusion criteria for FANCOSTEM are a diagnosis of AF, testing for chromosomal instability using diepoxybutane or mitomycin C, being over 1 year of age, and having at least one of the following parameters higher than: 1) Hemoglobin: 8.0 g / dL, 2) Neutrophils: 750 / mm³ 3 , 3) Platelets: 30,000 / mm 3 10 patients were recruited, 9 were screened, and 2 failed (mosaic patients). Fig. 12shows the hematological indicators of the recruited patients. Seven patients were treated with G-CSF and plerixafor. Mobilization therapy utilized the administration of G-CSF (neupogen; 12 μg / kg / 12 hours) and plerixafor (mozobil; 240 μg / kg body weight / day). Mobilized peripheral blood (mPB) CD34+ cells were subjected to a short-term in vitro transduction protocol ( Fig. 13 Transduction to PGK-FANCA-WPRE* LV was performed under GMP conditions using ). Two patients aged 15 and 16 did not reach threshold levels in peripheral blood CD34+ cell levels, but apheresis was possible in five patients aged 3 to 5 years. In these patients, the median CD34+ cell / kg was 6.6 x 10^6 (range: 1.6 x 10^6 to 7.6 x 10^6). After CD34+ cell screening, CD34+ cell / kg was 2.0 x 10^6 (range: 8.5 x 10^5 and 5.1 x 10^6). No serious adverse events associated with mobilization therapy were detected in treated patients up to 2.5 years.

[0283] Fig. 14 It illustrates G-CSF / plericsaphor-mediated CD34+ mobilization in FA-A patients and Fig. 15 This illustrates the recruitment of G-CSF / plericsaphor-mediated colony-forming cells (CFCs) in FA-A patients. Fig. 16A illustrates CD34+ cell collection in FANCOSTEM and Fig. 16B It illustrates a comparison with prior studies.

[0284] Fig. 17 It plots the number of CD34+ cells predicted in the bone marrow (BM) versus the actual number mobilized in the peripheral blood (mPB). Fig. 18 CD34 in FA-A patients mobilized with G-CSF / plerixafor + This is a summary regarding the cell collection. The CD34+ number after screening is the CD34 in the BM on day 0. +It is correlated with cells / μl (data not plotted).

[0285] Fig. 19 This shows CD34 expression before and after immunoselection of mPB CD34+ cells from healthy donors (HD) and FA patients.

[0286] From these data, compared to other clinical studies, a clear improvement in the collection of CD34+ cells in patients treated with filgrastim (G-CSF) and plerixaphor was observed, and it was concluded that only FA patients in the early stages of the disease were suitable for the collection of a clinically relevant number of HSCs.

[0287] Example 9: FANCOLEN Clinical Study

[0288] The second parallel clinical trial (FANCOLEN) aimed to evaluate the safety and efficacy of gene therapy in patients with FA complement group A (FA-A). An optimized vector and transduction protocol were developed to restore hematopoiesis in FA patients by injecting genetically modified autologous HSCs. Specifically, this was a Phase I / II clinical trial to evaluate the safety and efficacy of injecting autologous CD34+ cells transduced with a lentiviral vector carrying the FANCA gene (an orphan drug) in patients with Fanconi anemia subtype A.

[0289] The primary inclusion criteria were patients aged > 1 year diagnosed with FA-A, and at least one of the following parameters had to be below the threshold: 1) Hemoglobin: 8.0 g / dL; 2) Neutrophils: 1,000 / mm³ 3 ; 3) Platelets: 50,000 / mm 3.

[0290] More specific inclusion criteria include the following: 1) patients with complement group FA-A; 2) at least one of the following parameters must be below the indicated value: hemoglobin: 8.0 g / dL; neutrophils: 750 / mm³ 3 Platelets: 30,000 / mm3 ; 3) Minimum age: 1 year; 4) Maximum age: 21 years; 5) Lasnky index > 60% 6) Mild organ dysfunction; 7) Informed consent provided in accordance with current law; 8) Cell count: at least 3x10 5 Purified CD34+ cells / patient body weight kg; 9) Women of childbearing age must have a negative urine pregnancy test at the baseline visit and must accept the use of effective contraception while participating in the study.

[0291] Exclusion criteria include the following: 1) patients with an HLA-identical family donor; 2) signs of myelodysplastic syndrome or leukemia, or cytogenetic abnormalities predicting these conditions in bone marrow aspiration analysis. This assessment must be performed via a valid study 2 months prior to the patient's entry into the clinical trial; 3) evidence that the patient has signs of somatic mosaicism with improved hematology; 4) concomitant diseases or conditions that, in the investigator's opinion, are considered unsuitable for participation in the study; 5) pre-existing sensory or motor impairments >= Grade 2 according to National Cancer Institute (NCI) criteria; 6) pregnant or breastfeeding women.

[0292] Route of administration: The patient received cells transduced with a therapeutic vector via intravenous infusion.

[0293] Cell dosage: The amount of cells administered to the patient via transfusion is 3x10 5 Up to 4x10 6 It was obtained from the transformation of purified CD34+ cells / patient body weight kg.

[0294] In particular, considering that this clinical trial will be administered to non-conditioned patients, 3x10 5 CD34 +A cell count of less than 1 / kg indicates a very low probability of producing a patient graft from the transduced cells. In a gene therapy trial for patients with Fanconi anemia conducted by Dr. Williams (Kelly et al., 2007), the number of cells injected into two patients (FAAGT1001 and 1003) was 4.5 x 10⁶ per kg of patient body weight, respectively. 5 and 3.25 x10 5 The cells were nucleated. In both patients, Hb and platelet counts improved transiently, but the associated presence of the transgenic gene could not be demonstrated. Unlike Dr. Williams's trial, in which cells were transfected with a gamma-retroviral vector for 4 days, in this clinical trial, cells were transfected with a more effective lentiviral vector, and transfection will be performed for up to 48 hours, which is shorter than the 4 days used in the previous protocol. Given this, the inventors [provided] 3 x 10 per kg of patient body weight 5 Purified CD34+ cells were considered a reasonable lower limit for this test.

[0295] Since a larger number of cells increases the likelihood of transplantation, 4x10 6 The upper limit of purified CD34+ cells / kg is not based on the need to limit the number of cells injected. Rather, 4 x 10 per kg of the patient's body weight 6 The limitation of purified CD34+ cells stems from the difficulty of mobilizing and collecting cells exceeding this level in patients with Fanconi anemia, which is characterized by a decrease in the number of CD34+ cells in the bone marrow (Jacome et al , 2009).

[0296] Administration regimen: Cells transfected with a therapeutic vector were injected into the patient as a single dose. This was due to two main reasons: 1) All hematopoietic gene therapy trials performed to date have been conducted using a single injection of transfected cells (Naldini, 2011). Based on this prior experience, the inventors did not intend to change this parameter. 2) A single injection of all transfected cells would increase the likelihood of a larger graft compared to fractionated injections of the same dose.

[0297] Recruitment Period: Patients are recruited over a period of 3 years. Because patients with subtype FA-A are the most frequent in the FA patient population (approximately 80% of Spanish patients with FA belong to this complement group (Casado et al. (2007))), the designed therapeutic vector is FANCA It carries the gene. Therefore, only patients with FA belonging to the subtype FA-A could participate in this study. All pediatric or adult patients belonging to this complement group were included in this study if they met the defined inclusion and exclusion criteria.

[0298] A specific description of the primary and, if any, secondary variables to be evaluated in the clinical trial includes the following: 1) Primary variable: A) AutoCD34 transduced with a therapeutic lentiviral vector in patients with Fanconi anemia subtype A. + Determination of toxicity associated with cell infusion B) AutoCD34 transduced with a therapeutic lentiviral vector in a patient with Fanconi anemia subtype A + Determination of the degree of transplantation associated with cell infusion. 2) Secondary variable: Determination of clinical response associated with the infusion of autologous CD34+ cells transduced with a therapeutic lentiviral vector in patients with Fanconi anemia subtype A.

[0299] CD34 derived from bone marrow and / or mobilized in peripheral blood from patients with Fanconi anemia subtype A (FA-A)+ Cells (fresh and / or cryopreserved) FANCA Transfection was performed in vitro using a lentivirus vector carrying a gene (rare disease drug). Fig. 11 After cell transduction, patients were injected with these genetically modified stem cells to restore hematopoiesis.

[0300] Evaluation: Before initiating treatment, the patient was evaluated with informed consent. A standard physical examination (including weight and height), peripheral blood cell count, basic biochemistry, and an evaluation were performed one month prior to the infusion of genetically modified cells via bone marrow aspiration.

[0301] Genetically corrected CD34 + Cell Transduction and Injection: Purified CD34 + Cell populations were transfected in vitro using a therapeutic lentivirus vector. After cell transfection, product quality control evaluations were performed, partial samples were cryopreserved for future research, and the product was prepared for injection into a patient.

[0302] If we assume two patients are injected with an acceptable number of transformed cells (at least 1 million injected cells / kg body weight in a subspecies where at least 0.3 copies of the vector / cell are detected after 7 days of in vitro culture), then at least 0.1 copies of the vector / cell are not observed in the bone marrow or peripheral blood 6 months after injection, and subsequent patients will undergo a conditioning process before cell injection.

[0303] For patients eligible for any type of conditioning, there must be a suitable method to rescue potential bone marrow aplasia associated with the conditioning of transduced cells and possible transplant failure. The rescue method includes units of umbilical cord blood or hematopoietic cells from a haploidentical donor. The cells will be infused intravenously.

[0304] The dose of cells obtained from the transduction process and administered to the patient by injection is 3 x 10 times the patient's body weight. 5 Up to 4x10 6 It is between CD34+ cells / kg.

[0305] The cells are injected into the patient as a single dose.

[0306] The transduced cells were injected immediately after the transduction process was completed.

[0307] The injected product consists of a suspension of CD34+ cells packaged in a sterile bag for injection by CIEMAT’s CLINISTEM GMP Laboratory.

[0308] Recruitment period: 3 years after the first patient's infusion.

[0309] Follow-up period: 2 years from the injection of transgenic cells. However, patients are monitored for 10 years outside of clinical trials.

[0310] Monitoring of the transduced cell grafts will be performed on peripheral blood and bone marrow samples.

[0311] First 72 hours after infusion: During this period, vital signs were recorded every 8 hours, and critical organ functions (electrolyte tests, hematology, renal and liver function) were monitored every 24 hours.

[0312] Afterwards, the following checks Table 2 It was performed as shown in.

[0313] Table 2.

[0314]

[0315] Patients diagnosed with FA and belonging to complement group FA-A will be included in this study. Cell phenotype correction FANCA Patients were considered if proven by transduction with a vector carrying the gene or if a bi-allelic pathogenic mutation was proven in this gene.

[0316] Patient FA 02005 is Fig. 20 As summarized in [here], it meets the criteria for FANCOSTEM and FANCOLEN. Fig. 21 The graph shows the test indicating the FA diagnosis of patient FA-02005 prior to gene therapy, and Fig. 22 This represents the follow-up measures of the cell manufacturing process for FA-02005 patient. Fig. 23 Figure 1 represents the number of patient FA02005 vector copies before gene therapy and at 2, 4, 6 weeks, 2, 3, 4, and 5 months after gene therapy. In the follow-up of the first unconditioned FA-A patient before and after gene therapy, patient FA02005 (4 years old) hemoglobin ( Fig. 24 ), neutrophil ( Fig. 25 ) and platelets ( Fig. 26 Displays for ).

[0317] In the case of patient FA02002, hematological evolution Fig. 27 Presented in, and the diagnosis is Fig. 28 It appears in, and the follow-up measures of the cell manufacturing process are Fig. 29 It appears in. Fig. 30 This shows the analysis of CD34 expression during different steps required for LV-transduction to patient FA-02002 from healthy donors and FA mPB. Fig. 31 Figure 1 shows the vector copy number in patient FA02002 before gene therapy and at 2, 4, and 6 weeks after gene therapy. Follow-up of patient FA02002 (injected with cryopreserved cells) showed hemoglobin ( Fig. 32 ), neutrophil ( Fig. 33 ) and platelets ( Fig. 34 It is displayed for ).

[0318] Data from these two patients support the conclusion that a significant number of gene-edited mobilized peripheral blood (mPB) CD34+ cells were infused to the patients. No serious adverse events were observed in either of the two treated patients. Gene marking levels of approximately 1–5 copies / 1,000 peripheral blood cells were detected in the treated patients between 15 days and 5 months after GT administration and increased gradually over time. This viral copy count was approximately 100 times higher than the peak value detected at 3 weeks post-GT in a previous study (3 copies / 10^5 cells; Kelly et al. 2007).

[0319] Example 6: Fresh mPB CD34 obtained from an FA-A patient + Cell transduction

[0320] Short-term transduction using a therapeutic vector on small subsamples of mobilized peripheral blood (mPB) CD34+ samples from patients treated with G-CSF / plerixafor showed transduction efficiencies of 17 to 45% ( Fig. 35 A small subset of this sample was transplanted into NSG mice treated with 1.5 Gy. Most of the transplanted samples engrafted into the NSG mice (1–10% of the BM cells were hCD45+ / mCD45-). Fig. 36 Furthermore, a clear screening advantage of corrected CD34+FA-A cells was observed in transplanted mice ( Fig. 37 ).

[0321] These results demonstrate that transduced FA-A mPB CD34+ cells are transplanted into NSG mice and that corrected human FA-A regrowth cells have an in vivo proliferative advantage in NSG recipient mice.

Claims

Claim 1 A recombinant gene delivery vector comprising an expression cassette, wherein the expression cassette comprises a polynucleotide sequence arranged in 5' to 3' order including: (a) a promoter sequence; (b) a sequence encoding a human FANC polypeptide; and (c) a chimeric Woodchurk hepatitis virus regulatory element (WPRE) sequence, wherein the sequence encoding the human FANC polypeptide is operably linked to the promoter sequence, and the expression cassette comprises the sequence of nucleotides 3541 to 9178 of SEQ ID NO:

24. Claim 2 A recombinant gene transfer vector according to claim 1, further comprising one or more enhancer sequences. Claim 3 In claim 1, (d) a recombinant gene transfer vector further comprising a polypurine track (PPT) or polyadenylation (polyA) signal sequence. Claim 4 The recombinant gene transfer vector of claim 1, further comprising one or more of the following sequences: (e) a packaging signal sequence; (f) a truncated Gag sequence; (g) a Rev response element (RRE); (h) a central polypurine track (cPPT); and (i) a central termination sequence (CTS). Claim 5 A recombinant gene transfer vector according to claim 1, wherein the recombinant gene transfer vector is a virus or a viral vector. Claim 6 A recombinant gene transfer vector according to paragraph 5, wherein the virus or viral vector is a lentivirus (LV). Claim 7 A recombinant gene delivery vector according to claim 1, wherein the expression cassette is delivered to autologous cells obtained from a subject having Fanconi anemia. Claim 8 Isolated cells transfected with a recombinant gene transfer vector of any one of claims 1 to 7 and comprising an expression cassette. Claim 9 In paragraph 8, the isolated cell is a hematopoietic stem cell. Claim 10 In paragraph 8, the cell is CD34 + Isolated cell that is a cell. Claim 11 A pharmaceutical composition for the treatment of Fanconi anemia, comprising a pharmaceutically acceptable excipient and a recombinant gene delivery vector of any one of claims 1 to 7. Claim 12 A pharmaceutical composition for the treatment of Fanconi anemia comprising pharmaceutically acceptable excipients and the cells of claim 8. Claim 13 CD34 containing expression cassettes + A drug for treating Fanconi anemia in subjects requiring treatment for Fanconi anemia, including cells, wherein the expression cassette comprises a polynucleotide sequence including the following in 5' to 3' order: (a) a promoter sequence; (b) a sequence encoding a human FANC polypeptide; and (c) a chimeric Woodchurk hepatitis virus regulatory element (WPRE) sequence, wherein the sequence encoding the human FANC polypeptide is operably linked to the promoter sequence, and the expression cassette comprises the sequence of nucleotides 3541 to 9178 of SEQ ID NO:

24. Claim 14 In Paragraph 13, CD34 + A drug obtained from a cell. Claim 15 In Paragraph 14, CD34 + A drug in which the cells are obtained from fresh or cryopreserved peripheral blood and / or bone marrow. Claim 16 In Paragraph 13, CD34 + A drug obtained from a target after cells have been treated with a combination of (i) G-CSF or filgrastim; and (ii) Plerixafor. Claim 17 In any one of paragraphs 14 through 16, CD34 + A drug produced by depleting red blood cells in cells. Claim 18 In any one of paragraphs 13 through 16, CD34 + A drug prepared by enriching cells through positive selection, negative selection, or a combination thereof. Claim 19 In any one of paragraphs 13 through 16, CD34 + A drug in which cells are transduced with a recombinant gene delivery vector containing an expression cassette. Claim 20 In Paragraph 19, CD34 + The cell, CD34 + A drug that is transduced by contacting cells with a recombinant gene delivery vector for 16 to 24 hours. Claim 21 In Paragraph 19, CD34 + The cell, CD34 through 3 transduction cycles + A drug that is transduced by bringing cells into contact with a recombinant gene delivery vector. Claim 22 In paragraph 21, the three transduction cycles were CD34 for 2 hours, 2 hours, and 12 hours, respectively. + A drug that is performed by bringing cells into contact with a recombinant gene delivery vector. Claim 23 In any one of paragraphs 13 through 16, CD34 + The cells are 3 x 10⁶ per single infusion. 5 Up to 4x10 6 Refined CD34 + A drug administered in kg of cell / subject body weight. Claim 24 In any one of paragraphs 13 through 16, CD34 + A drug that inhibits the onset of hematological signs of Fanconi anemia in a cell and / or stops / or reverses the progression thereof. Claim 25 In paragraph 24, a drug in which the hematological signs of Fanconi anemia are selected from one or more of bone marrow failure (BMF), thrombocytopenia, leukopenia, pancytopenia, neutropenia, and anemia.

Images