Oligonucleotide compositions and methods thereof

Abstract

The present invention, in particular, provides oligonucleotides, compositions, and methods for preventing and / or treating various pathological conditions, disorders, or diseases. In some embodiments, the provided oligonucleotides comprise nucleobase modifications, sugar modifications, internucleotide linkage modifications, and / or patterns thereof, and have improved properties, activity, and / or selectivity. In some embodiments, the present invention provides oligonucleotides, compositions, and methods for HTT-related pathological conditions, disorders, or diseases, e.g., Huntington's disease.

Description

Background Technology

[0001] Cross-reference with related applications

[0002] This application claims priority to U.S. Provisional Application No. 62 / 800,409 filed February 1, 2019, and U.S. Provisional Application No. 62 / 911,335 filed October 6, 2019, the entirety of each of which is incorporated herein by reference.

[0003] Oligonucleotides that target specific genes are useful for various applications, e.g., therapeutic, diagnostic, and / or research applications, including but not limited to the treatment of various disorders associated with the target gene.

[0004] In some embodiments, the present invention provides oligonucleotides and compositions thereof with significantly improved properties and / or activity. In particular, the present invention provides techniques for designing, manufacturing, and utilizing such oligonucleotides and compositions. In particular, in some embodiments, the present invention provides useful patterns of internucleotide linkages [e.g., types, modifications, and / or arrangements of chiral linkages ( R p or S p) etc.] and / or patterns of sugar modifications (e.g., types, patterns, etc.) provided, which, when combined with one or more other structural elements described herein, e.g., base sequences (or parts thereof), nucleobase modifications (and patterns thereof), internucleotide linkage modifications (and patterns thereof), additional chemical moiety, etc., may provide oligonucleotides and compositions having high activity and / or desired properties, including but not limited to allele-specific knockdown of mutant alleles of the HTT (Huntingtin) gene, wherein the mutant allele is located on the same (or homotopic with) chromosome as the extended CAG repeat region associated with Huntington's disease.

[0005] In some embodiments, the target HTT nucleic acid is a mutant containing, for example, an extended CAG repeat region (e.g., more than about 36 CAGs), which includes both distinguishing sites and mutations associated with Huntington's disease. In some embodiments, the reference or non-target HTT nucleic acid is wild-type, contains different distinguishing site variants, and lacks an extended CAG repeat region (e.g., the CAG repeat region contains fewer than about 35 CAGs and is not associated with Huntington's disease). In some embodiments, an HTT oligonucleotide (an oligonucleotide targeting the HTT target HTT nucleic acid) can distinguish between the target HTT nucleic acid and the reference HTT nucleic acid and can mediate allele-specific knockdown of the target HTT nucleic acid. In some embodiments, the distinguishing site is a single-nucleotide polymorphism (SNP) site, a point mutation, etc. In some embodiments, the target HTT nucleic acid sequence and the reference HTT nucleic acid sequence contain different bases at the SNP site. In some embodiments, a site in the target HTT nucleic acid is fully complementary to a site in the oligonucleotide of the present invention, whereas a corresponding site in the reference HTT nucleic acid is not. For example, in some embodiments, the target HTT nucleic acid sequence contains rs362273 and is A at this SNP site, and its allele contains an extended CAG repeat (e.g., 36 or more) and is associated with Huntington's disease; the reference HTT nucleic acid sequence contains rs362273 and is G at this SNP site, and its allele contains fewer CAG repeats (e.g., 35 or fewer) and is less associated with or not associated with Huntington's disease. In some embodiments, the sequence of the provided oligonucleotide, e.g., GUUGATCTGTAGCAGCAGCT, is complementary to the target HTT nucleic acid sequence at a specific site, e.g., an SNP site (e.g., GUUGATCTG T In the case of AGCAGCAGCT, T is at the SNP rs362273 locationA It is complementarity).

[0006] In some embodiments, the HTT oligonucleotide has a base sequence that is not different from the target mutant HTT nucleic acid and the wild-type HTT nucleic acid. In some embodiments, these oligonucleotides can knock down the levels, expression, and / or activity of both the mutant and the wild-type HTT; and the oligonucleotide can be designed as a pan-specific oligonucleotide or an allele-nonspecific oligonucleotide.

[0007] In some embodiments, the provided oligonucleotides and compositions are useful for preventing and / or treating various conditions, disorders, or diseases, including Huntington's disease, particularly HTT-related conditions, disorders, or diseases. In some embodiments, the provided oligonucleotides and compositions selectively reduce the levels of HTT transcripts and / or products encoded by them associated with Huntington's disease. In some embodiments, the provided oligonucleotides and compositions selectively reduce the levels of HTT transcripts and / or products encoded by them, comprising extended CAG repeats (e.g., 36 or more).

[0008] In particular, the present invention includes the recognition that control of structural elements of an HTT oligonucleotide can have a significant effect on the properties and / or activity of the oligonucleotide, including knockdown of the HTT target gene (or its product) (e.g., reduction in activity, expression, and / or level). In some embodiments, Huntington's disease is associated with the presence of a mutant HTT allele comprising CAG elongation (e.g., an increase in the length of a region containing multiple CAG repeats). In some embodiments, the knockdown is allele-specific (wherein the mutant allele of HTT is preferentially knocked down compared to the wild type). In some embodiments, the knockdown is pan-specific (wherein both the mutant and wild-type alleles of HTT are significantly knocked down). In some embodiments, the knockdown of the HTT target gene is mediated by RNase H and / or steric hindrance, which affects translation. In some embodiments, the knockdown of the HTT target gene is mediated by a mechanism involving RNA interference. In some embodiments, the controlled structural elements of the HTT oligonucleotide include, but are not limited to: base sequences, chemical modifications (e.g., modifications of linkages between sugars, bases, and / or nucleotides) or patterns thereof, changes in stereochemistry (e.g., stereochemistry of linkages between backbone chiral nucleotides) or patterns thereof, the structure of a first or second wing or core, and / or conjugation with additional chemical moiety (e.g., carbohydrate moiety, targeting moiety, etc.). In particular, in some embodiments, the present invention demonstrates that controlling the stereochemistry of the backbone chiral center (stereochemistry of the linkage nucleotide) by optionally controlling other aspects of oligonucleotide design and / or the incorporation of carbohydrate moiety can significantly improve the properties and / or activity of the HTT oligonucleotide.

[0009] In some embodiments, the present invention relates to any HTT oligonucleotide that operates through any mechanism and comprises any sequence, structure, or format (or part thereof) described herein, wherein the oligonucleotide comprises at least one natural non-occurring modification of a base, sugar, or nucleotide linkage.

[0010] In some embodiments, the present invention provides an oligonucleotide composition comprising a plurality of oligonucleotides, wherein the oligonucleotides are at least one linkage between chiral control nucleotides [linkage factor R p and S Not a random combination of p R p or S or in the p array R p or S p-configuration-rich internucleotide linkages (e.g., 80%–100%, 85%–100%, 90%–100%, 95%–100%, or 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more of all identical oligonucleotides in the composition share the same stereochemistry at the linkage), such internucleotide linkages are also [stereo-defined internucleotide linkages], e.g., linkage R p or S It includes a p-phosphorothioate linkage. In some embodiments, the number of linkages between chiral control nucleotides is 1 to 100, 1 to 50, 1 to 40, 1 to 35, 1 to 30, 1 to 25, 1 to 20, 5 to 100, 5 to 50, 5 to 40, 5 to 35, 5 to 30, 5 to 25, 5 to 20, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25. In some embodiments, at least one linkage between nucleotides is a linkage between chiral control nucleotides. Sp and / or, at least one nucleotide linkage is a chiral control nucleotide linkage, and R p. In some embodiments, the pattern of the backbone chiral center of the oligonucleotide or a part thereof (e.g., the core) is R p( S p)2 or includes the same. In some embodiments, the pattern of the backbone chiral center of the oligonucleotide or a part thereof (e.g., the core) is ( N p)t[( R p)n( S p)m]y or includes the same, where each t, ​​n, m, and y is independently as described herein.

[0011] In some embodiments, the present invention relates to a -1, +1, or +3 position relative to a distinguishing position (a position where the base or complementary base thereto can be distinguished from the target mutant HTT nucleic acid and the reference wild-type HTT nucleic acid). R It is demonstrated that oligonucleotides containing linkages between p chiral control nucleotides can provide high activity and / or selectivity and, in some embodiments, may be particularly useful for reducing levels of disease-associated transcripts and / or products encoded by them. Unless otherwise specified, R In the case of specifying the p-nucleotide linkage location, "-" is a counting from the nucleoside at the distinguishing position toward the 5'-terminus of the oligonucleotide, where the nucleotide linkage at the -1 position is the linkage between nucleotides bonded to the 5'-carbon of the nucleoside at the distinguishing position, and "+" is a counting from the nucleoside at the distinguishing position toward the 3'-terminus of the oligonucleotide, where the nucleotide linkage at the +1 position is the linkage between nucleotides bonded to the 3'-carbon of the nucleoside at the distinguishing position. In some embodiments, at the -1 position R p provided increased activity and selectivity. In some embodiments, at the +1 position Rp provided increased activity and selectivity. In some embodiments, at the +3 position R p provided increased activity. For example, as presented herein, the HTT oligonucleotides WV-12281 (one phosphorothioate of the Rp sequence at position -1 for the SNP site), WV-12282 (+1), and Wv-12284 (+3) can provide high selectivity when used for allele-specific knockdown of mutant alleles.

[0012] In some embodiments, the present invention relates to an HTT oligonucleotide composition comprising at least one chiral nucleotide linkage that is not chiral controlled.

[0013] In some embodiments, the oligonucleotide comprises one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) negatively charged nucleotide linkages. In some embodiments, the oligonucleotide comprises one or more neutral nucleotide linkages. In some embodiments, the HTT oligonucleotide comprises negatively charged or neutral nucleotide linkages. In some embodiments, the present invention provides an oligonucleotide, wherein the base sequence of the oligonucleotide comprises 10 or more junction bases of a base sequence identical to or complementary to the base sequence of the HTT gene or its transcript, the oligonucleotide comprises at least one negatively charged nucleotide linkage, and the oligonucleotide may reduce the level, expression, and / or activity of the HTT target gene or its gene product.

[0014] In some embodiments, the present invention includes the recognition that various optional additional chemical moiety, such as a carbohydrate moiety, a targeting moiety, etc., when incorporated into an oligonucleotide, can improve one or more properties and / or activities.

[0015] In some embodiments, additional chemical moiety is selected from: GalNAc, glucose, GluNAc (N-acetylamine glucosamine), and anisamide moiety and derivatives thereof, or any additional chemical moiety described herein and / or known in the art. In some embodiments, the oligonucleotide may comprise two or more additional chemical moietys, wherein said additional chemical moiety is of the same category (e.g., carbohydrate moiety, sugar moiety, targeting moiety, etc.) or is not of the same category. In some embodiments, a specific additional chemical moiety facilitates the delivery of the oligonucleotide to a desired cell, tissue, and / or organ; facilitates the internalization of the oligonucleotide; and increases the stability of the oligonucleotide.

[0016] In some embodiments, the present invention provides a chiral-controlled oligonucleotide composition comprising a plurality of oligonucleotides sharing the following:

[0017] 1) Common nucleotide sequence;

[0018] 2) Common backbone connection pattern; and

[0019] 3) Common backbone chiral center pattern (the above composition is a substantially pure preparation of a single oligonucleotide in that non-random or controlled levels of the oligonucleotide in the composition have a common base sequence, a common backbone linkage pattern, and a common backbone chiral center pattern).

[0020] In some embodiments, the oligonucleotide composition is a chiral-controlled oligonucleotide composition comprising a plurality of oligonucleotides of a specific oligonucleotide type, and the composition is chiral-controlled in that the oligonucleotides of the specific oligonucleotide type are abundant compared to a substantially racemic preparation of oligonucleotides having the same base sequence and a linkage pattern between chiral nucleotides.

[0021] In some embodiments, the present invention provides a chiral-controlled oligonucleotide composition comprising a plurality of oligonucleotides capable of indicating HTT knockdown, wherein the plurality of oligonucleotides are of a specific oligonucleotide type, and the composition is chiral-controlled in that the oligonucleotides of the specific oligonucleotide type are abundant compared to a substantially racemic formulation of oligonucleotides having the same base sequence.

[0022] In some embodiments, the provided oligonucleotide comprises one or more blocks. In some embodiments, the blocks comprise one or more consecutive nucleosides and / or nucleotides and / or sugars, or bases and / or nucleotide links that share a common chemistry (e.g., a link between a sugar, base, or nucleotide, or a combination or pattern thereof, or at least one common variation of a pattern of stereochemistry) that is not present in adjacent blocks, and vice versa. In some embodiments, the HTT oligonucleotide comprises three or more blocks, wherein the blocks at one end are not identical and thus the oligonucleotide is asymmetric. In some embodiments, the blocks are wings or cores. In some embodiments, the core is also referred to as a gap.

[0023] In some embodiments, the oligonucleotide comprises at least one wing and at least one core, wherein the wing is structurally different from the core in that the wing of the oligonucleotide comprises a structure [e.g., stereochemistry in the linkage between sugars, bases, or nucleotides, or chemical modification (or pattern thereof)] that is not present in the core, and vice versa. In some embodiments, the structure of the oligonucleotide comprises a wing-core-wing structure. In some embodiments, the structure of the oligonucleotide comprises a wing-core, core-wing, or wing-core-wing structure, wherein one wing is structurally different from the other wing and core (e.g., asymmetric oligonucleotide) in terms of [e.g., stereochemistry in the linkage between sugars, bases, or nucleotides, additional chemical moiety, or chemical modification (or pattern thereof)].

[0024] In some embodiments, the wing comprises a sugar modification or a pattern thereof that is absent in the core. In some embodiments, the wing comprises a sugar modification that is absent in the core. In some embodiments, one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) sugars of the wing are modified independently. In some embodiments, each wing sugar is modified independently. In some embodiments, each sugar of the wing is identical. In some embodiments, at least one sugar of the wing is different from another sugar of the wing. In some embodiments, one or more sugar modifications and / or sugar modification patterns in the first wing (e.g., 5'-wing) of the oligonucleotide are different from one or more sugar modifications and / or sugar modification patterns in the second wing (e.g., 3'-wing) of the oligonucleotide. In some embodiments, the modification is a 2'-OR modification, where R is as described herein. In some embodiments, R is an optional substitution C 1-4It is an alkyl. In some embodiments, the modification is 2'-OMe. In some embodiments, the modification is 2'-MOE. In some embodiments, the modified sugar is a high-affinity sugar, e.g., a bicyclic sugar (e.g., LNA sugar), 2'-MOE, etc. In some embodiments, the sugar of the 3'-wing is a high-affinity sugar. In some embodiments, the 3'-wing comprises one or more high-affinity sugars. In some embodiments, each sugar of the 3'-wing is independently a high-affinity sugar. In some embodiments, the high-affinity sugar is a 2'-MOE sugar. In some embodiments, the high-affinity sugar is attached to a negatively uncharged internucleotide linkage.

[0025] In some embodiments, the wing comprises one or more non-negatively charged internucleotide connections. In some embodiments, the non-negatively charged internucleotide connections are neutral internucleotide connections. In some embodiments, each non-negatively charged internucleotide connection is independently a neutral internucleotide connection. In some embodiments, as demonstrated herein, an oligonucleotide comprising a wing comprising one or more non-negatively charged internucleotide connections can deliver high activity and / or selectivity. In some embodiments, for the description of internucleotide connections and their patterns (including stereochemical patterns), the internucleotide connections connecting the wing nucleoside and the core nucleoside are considered as part of the core. In some embodiments, the non-negatively charged internucleotide connections are chirally controlled, and R p or S It is p.

[0026] In some embodiments, the core sugar is a natural DNA sugar that does not contain a substitution at the 2' position (two -Hs at the 2'-carbon). In some embodiments, each core sugar is a natural DNA sugar that does not contain a substitution at the 2' position (two -Hs at the 2'-carbon).

[0027] In some embodiments, the distinguishing location (e.g., an SNP location or other mutation distinguishing the wild-type target sequence from the disease-related sequence or the mutant sequence) is location 4, 5, or 6 from the 5'-terminus of the core region. In some embodiments, the 4th, 5th, or 6th nucleobase of the core region (from the 5'-terminus of the core) is a feature of the sequence and distinguishes the sequence from another sequence (e.g., an SNP). In some embodiments, the distinguishing location is location 4 from the 5'-terminus of the core region. In some embodiments, the distinguishing location is location 5 from the 5'-terminus of the core region. In some embodiments, the distinguishing location is location 6 from the 5'-terminus of the core region. In some embodiments, the distinguishing location is location 9, 10, or 11 from the 5'-terminus of the oligonucleotide. In some embodiments, the distinguishing location is location 9 from the 5'-terminus of the oligonucleotide. In some embodiments, the distinguishing position is position 10 from the 5'-terminus of the oligonucleotide. In some embodiments, the distinguishing position is position 11 from the 5'-terminus of the oligonucleotide.

[0028] In some embodiments, the oligonucleotide or oligonucleotide composition is useful for preventing or treating a pathological condition, disorder, or disease. In some embodiments, the HTT oligonucleotide or HTT oligonucleotide composition is useful for a method of treating an HTT-related pathological condition, disorder, or disease, such as Huntington's disease, in a subject requiring treatment for an HTT-related pathological condition, disorder, or disease, such as Huntington's disease.

[0029] In some embodiments, the oligonucleotide or oligonucleotide composition is useful for the manufacture of a medicine for the treatment of a condition, disorder, or disease such as Huntington's disease in subjects requiring treatment of a condition, disorder, or disease such as Huntington's disease. In some embodiments, the HTT oligonucleotide or HTT oligonucleotide composition is useful for the manufacture of a medicine for the treatment of an HTT-related condition, disorder, or disease such as Huntington's disease in subjects requiring treatment of an HTT-related condition, disorder, or disease such as Huntington's disease. Brief explanation of the drawing

[0030] Figures 1a–1d. Figures 1a–1d show various formats that can be used wholly or partially for oligonucleotides, e.g., HTT oligonucleotides. Specific details for implementing the invention

[0031] The technology of the present invention can be more easily understood by referring to the following detailed description of specific embodiments.

[0032] definition

[0033] As used herein, the following definitions shall apply unless otherwise indicated. For the purposes of the present invention, chemical elements are identified according to the literature [Periodic Table of the Elements, CAS version, Handbook of Chemistry and Physics, 75th Ed.]. Additionally, general principles of organic chemistry are described in the literature ["Organic Chemistry", Thomas Sorrell, University Science Books, Sausalito: 1999] and the literature ["March's Advanced Organic Chemistry", 5th Ed., Ed.: Smith, MB and March, J., John Wiley & Sons, New York: 2001].

[0034] As used herein in the invention, unless otherwise evident from the context, (i) the singular term (“a” or “an”) may be understood to mean “at least one”; (ii) the term “or” may be understood to mean “and / or”; (iii) the terms “comprising,” “comprising,” “containing” (whether or not used with “not limited to”) and “containing” (whether or not used with “not limited to”) may be understood to include item-specific components or steps, whether provided alone or with one or more additional components or steps; (iv) the term “another” may be understood to mean at least one additional / second one or more; (v) the terms “about” and “approximately” may be understood to allow for standard variations as understood by those skilled in the art; and (vi) where a range is provided, an endpoint is included.

[0035] Unless otherwise specified, the description of oligonucleotides and their elements (e.g., base sequence, sugar modification, internucleotide linkage, linkage stereochemistry, etc.) is from 5' to 3'. Unless otherwise specified, the oligonucleotides described herein may be provided and / or used in salt form, particularly in pharmaceutically acceptable salt form. As will be recognized by those skilled in the art after reading this disclosure, in some embodiments, oligonucleotides may be provided as salts, e.g., sodium salts. As will be recognized by those skilled in the art, in some embodiments, individual oligonucleotides in a composition may be considered to have the same composition and / or structure, even though specific such oligonucleotides may exist in different salt form(s) at a given moment within such composition (e.g., liquid composition) (and may be soluble and the oligonucleotide chains may exist in anionic form (e.g., when in a liquid composition)). For example, those skilled in the art will recognize that at a given pH, the link between individual nucleotides along an oligonucleotide chain may exist in the form of an acid (H) or in one of a plurality of possible salt forms (e.g., a sodium salt, or a salt of another cation (depending on which ion may be present in the formulation or composition)), and that if the acid form (e.g., if any, all cations are replaced with H) is of the same composition and / or structure, these individual oligonucleotides may be appropriately considered to have the same composition and / or structure.

[0036] aliphaticAs used herein, “aliphatic” means a straight (i.e., unbranched) or branched, substituted or unsubstituted hydrocarbon chain that is fully saturated or contains one or more unsaturated units, or a substituted or unsubstituted monocyclic, dicyclic, or polycyclic hydrocarbon ring (but not aromatic) that is fully saturated or contains one or more unsaturated units, or a combination thereof. In some embodiments, the aliphatic group comprises 1 to 50 aliphatic carbon atoms. In some embodiments, the aliphatic group comprises 1 to 20 aliphatic carbon atoms. In other embodiments, the aliphatic group comprises 1 to 10 aliphatic carbon atoms. In other embodiments, the aliphatic group comprises 1 to 9 aliphatic carbon atoms. In other embodiments, the aliphatic group comprises 1 to 8 aliphatic carbon atoms. In other embodiments, the aliphatic group comprises 1 to 7 aliphatic carbon atoms. In other embodiments, the aliphatic group comprises 1 to 6 aliphatic carbon atoms. In another embodiment, the aliphatic group comprises 1 to 5 aliphatic carbon atoms, and in yet another embodiment, the aliphatic group comprises 1, 2, 3, or 4 aliphatic carbon atoms. Suitable aliphatic groups include, but are not limited to, linear or branched, substituted or unsubstituted alkyl, alkenyl, alkynyl, and hybrids thereof, such as (cycloalkyl)alkyl, (cycloalkenyl)alkyl, or (cycloalkyl)alkenyl.

[0037] Alkenil As used herein, the term “alkenyl” refers to an aliphatic group having one or more double bonds as defined herein.

[0038] alkylAs used herein, the term "alkyl" is given its ordinary meaning in the art and may include straight-chain alkyl groups, branched-chain alkyl groups, cycloalkyl (alicyclic) groups, alkyl-substituted cycloalkyl groups, and saturated aliphatic groups including cycloalkyl-substituted alkyl groups. In some embodiments, the alkyl has 1 to 100 carbon atoms. In certain embodiments, the straight-chain or branched-chain alkyl has about 1 to 20 carbon atoms in its backbone (e.g., C1-C in the case of the straight chain). 20 , in the case of branched chains, C2-C 20 ), alternatively having about 1 to 10 carbon atoms. In some embodiments, the cycloalkyl ring has about 3 to 10 carbon atoms, alternatively about 5, 6, or 7 carbons within its ring structure (wherein such a ring is monocyclic, dicyclic, or polycyclic). In some embodiments, the alkyl group may be a lower alkyl group, wherein the lower alkyl group comprises 1 to 4 carbon atoms (e.g., C1-C4 for a straight-chain lower alkyl).

[0039] Alkinil As used herein, the term “alkynyl” refers to an aliphatic group having one or more triple bonds as defined herein.

[0040] Analogue: The term “analogous” includes any chemical moiety that is structurally different from a reference chemical moiety or moiety class but can perform at least one function of such reference chemical moiety or moiety class. Non-limiting examples include nucleotide analogs that are structurally different from nucleotides but perform one or more functions of nucleotides; nucleobase analogs that are structurally different from nucleobases but perform one or more functions of nucleobases; and others.

[0041] animal:As used herein, the term “animal” refers to any member of the animal kingdom. In some embodiments, “animal” refers to a human at any stage of development. In some embodiments, “animal” refers to a non-human animal at any stage of development. In certain embodiments, the non-human animal is a mammal (e.g., rodent, mouse, rat, rabbit, monkey, dog, cat, sheep, cattle, primates, and / or pig). In some embodiments, the animal includes, but is not limited to, mammals, birds, reptiles, amphibians, fish, and / or worms. In some embodiments, the animal may be a transgenic animal, a genetically modified animal, and / or a clone.

[0042] antisense As used herein, the term “antisense” refers to the property of an oligonucleotide or other nucleic acid having a base sequence that is complementary or substantially complementary to a target HTT nucleic acid that can be hybridized. In some embodiments, the target HTT nucleic acid is a target gene mRNA. In some embodiments, hybridization is required for or causes a decrease in one activity, e.g., the level, expression, or activity of the target HTT nucleic acid or its gene product. As used herein, the term “antisense oligonucleotide” refers to an oligonucleotide that is complementary to the target HTT nucleic acid. In some embodiments, the antisense oligonucleotide may induce a decrease in the level, expression, or activity of the target HTT nucleic acid or its product. In some embodiments, the antisense oligonucleotide may induce a decrease in the level, expression, or activity of the target HTT nucleic acid or its product through a mechanism involving RNaseH, steric hindrance, and / or RNA interference.

[0043] Aril:As used herein, the term “aryl,” used alone or as part of a larger moiety as in “aralkyl,” “aralkoxy,” or “aryloxyalkyl,” refers to a monocyclic, bicyclic, or polycyclic ring system having a total of 5 to 30 ring members, wherein at least one ring in the system is aromatic. In some embodiments, the aryl group is a monocyclic, bicyclic, or polycyclic ring system having a total of 5 to 14 ring members, wherein at least one ring in the system is aromatic and each ring in the system comprises 3 to 7 ring members. In some embodiments, the aryl group is a biaryl group. The term “aryl” may be used interchangeably with the term “aryl ring.” In specific embodiments of the invention, “aryl” refers to an aromatic ring system that may have one or more substituents, including but not limited to phenyl, biphenyl, naphthyl, binaphthyl, anthracyl, etc. As used herein, the category of the term "aryl" includes groups in which an aromatic ring is fused to one or more non-aromatic rings, such as indanyl, phthalimidyl, naftimidyl, phenantridinyl, or tetrahydronaphthyl.

[0044] Chiral control:As used herein, “chiral control” refers to the control of the stereochemical designation of a chiral linker in a chiral nucleotide-to-chiral linkage within an oligonucleotide. As used herein, a chiral nucleotide-to-chiral linkage is a linkage between nucleotides in which the linker is chiral. In some embodiments, control is achieved through a chiral element absent in the sugar and base moiety of the oligonucleotide, for example, in some embodiments, control is achieved through the use of one or more chiral co-agents during the preparation of the oligonucleotide as described in the present invention, said chiral co-agents are often parts of the chiral phosphoramidite used during the preparation of the oligonucleotide. In contrast to chiral control, those skilled in the art recognize that if conventional oligonucleotide synthesis without the use of chiral co-agents is used to form chiral nucleotide-to-chiral linkages, such conventional oligonucleotide synthesis cannot control the stereochemistry in the chiral nucleotide-to-chiral linkages. In some embodiments, the stereochemical designation of each chiral linker in each chiral nucleotide-to-chiral linkage within the oligonucleotide is controlled.

[0045] Chiral-controlled oligonucleotide composition: As used herein, terms such as "chiral-controlled oligonucleotide composition," "chiral-controlled nucleic acid composition," etc. refer to a composition comprising a plurality of oligonucleotides (or nucleic acids) sharing 1) a common base sequence, 2) a common backbone linkage pattern, and 3) a common backbone modification pattern, wherein the plurality of oligonucleotides (or nucleic acids) share the same linkage stereochemistry in one or more chiral nucleotide-linkages (chiral-controlled or stereodefining nucleotide-linkages (the chiral linkage factors thereof are random as non-chiral-controlled nucleotide-linkages in the composition). R p and S Not a p combination, R p or Sp("stereographically defined"))). The levels of a plurality of oligonucleotides (or nucleic acids) in a chiral-controlled oligonucleotide composition are predetermined / controlled (e.g., through the preparation of chiral-controlled oligonucleotides to stereoselectively form linkages between one or more chiral nucleotides). In some embodiments, about 1% to 100% of all oligonucleotides in the chiral-controlled oligonucleotide composition (e.g., about 5% to 100%, 10% to 100%, 20% to 100%, 30% to 100%, 40% to 100%, 50% to 100%, 60% to 100%, 70% to 100%, 80% to 100%, 90% to 100%, 95% to 100%, 50% to 90%, or about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%, or at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) are multiple oligonucleotides.In some embodiments, about 1% to 100% of all oligonucleotides in the chiral control oligonucleotide composition sharing a common base sequence, a common backbone linkage pattern, and a common backbone variant pattern (e.g., about 5% to 100%, 10% to 100%, 20% to 100%, 30% to 100%, 40% to 100%, 50% to 100%, 60% to 100%, 70% to 100%, 80% to 100%, 90% to 100%, 95% to 100%, 50% to 90%, or about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%, or at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) are multiple oligonucleotides.In some embodiments, the level is about 1% to 100% (e.g., about 5% to 100%, 10% to 100%, 20% to 100%, 30% to 100%, 40% to 10%, 50% to 100%, 60% to 100%, 80% to 100%, 90% to 100%, 95% to 100%, of all oligonucleotides in the composition sharing a common base sequence (e.g., a plurality of oligonucleotides or oligonucleotide types), or all oligonucleotides in the composition sharing a common base sequence, a common backbone linkage pattern, and a common backbone variant pattern, or all oligonucleotides in the composition sharing a common base sequence, a common base variant pattern, a common sugar variant pattern, a common internucleotide linkage type pattern, and / or a common internucleotide linkage variant pattern) of all oligonucleotides in the composition sharing a common base sequence, a common base variant pattern, a common sugar variant pattern, a common internucleotide linkage type pattern, and / or a common internucleotide linkage variant pattern. 50% to 90%, or about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%, or at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%). In some embodiments, a plurality of oligonucleotides share the same stereochemistry in the linkage between about 1 to 50 (e.g., about 1 to 10, 1 to 20, 5 to 10, 5 to 20, 10 to 15, 10 to 20, 10 to 25, 10 to 30, or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20, or at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20) chiral nucleotides.In some embodiments, a plurality of oligonucleotides are about 1% to 100% (e.g., about 5% to 100%, 10% to 100%, 20% to 100%, 30% to 100%, 40% to 100%, 50% to 100%, 60% to 100%, 70% to 100%, 80% to 100%, 90% to 100%, 95% to 100%, 50% to 90%, about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%, or at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99%) of the chiral nucleotides share the same stereochemistry in their linkages. In some embodiments, multiple oligonucleotides (or nucleic acids) are of the same composition. In some embodiments, the level of a plurality of oligonucleotides (or nucleic acids) is about 1% to 100% (e.g., about 5% to 100%, 10% to 100%, 20% to 100%, 30% to 100%, 40% to 100%, 50% to 100%, 60% to 100%, 70% to 100%, 80% to 100%, 90% to 100%, 95% to 100%, 50% to 90%, or about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, of all oligonucleotides (or nucleic acids) in a composition sharing the same composition as said plurality of oligonucleotides (or nucleic acids). 95%, 96%, 97%, 98%, 99%, or 100%, or at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%). In some embodiments, the linkage between each chiral nucleotide is a linkage between chiral controlled nucleotides, and the composition is a completely chiral controlled oligonucleotide composition.In some embodiments, a plurality of oligonucleotides (or nucleic acids) are structurally identical. In some embodiments, the chiral-controlled internucleotide linkages have a diastereometric purity of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5%, typically at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5%. In some embodiments, the chiral-controlled internucleotide linkages have a diastereometric purity of at least 95%. In some embodiments, the chiral-controlled internucleotide linkages have a diastereometric purity of at least 96%. In some embodiments, the chiral-controlled internucleotide linkage has a diastereometric purity of at least 97%. In some embodiments, the chiral-controlled internucleotide linkage has a diastereometric purity of at least 98%. In some embodiments, the chiral-controlled internucleotide linkage has a diastereometric purity of at least 99%. In some embodiments, a predetermined level of percentage is (DS). nc This or at least (DS) nc and, where DS is a diastereform purity as described in the present invention (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5% or more), and nc is the number of chiral-controlled nucleotide linkages as described in the present invention (e.g., 1–50, 1–40, 1–30, 1–25, 1–20, 5–50, 5–40, 5–30, 5–25, 5–20, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more). In some embodiments, a predetermined level of percentage is (DS) nc This or at least (DS) ncand, where DS is 95% to 100%. For example, if DS is 99% and nc is 10, the above percentage is 90% or at least 90% ((99%) 10 0.90 = 90%). In some embodiments, the levels of multiple oligonucleotides in the composition are expressed as the product of the diastereforms of the linkages between each chiral control nucleotide in the oligonucleotide. In some embodiments, the diastereform of the linkages between two nucleosides in the oligonucleotide (or nucleic acid) is expressed as the diastereform of the linkages between the nucleotides of the dimer linking the two nucleosides, wherein the dimer is prepared using comparable conditions, in some cases the same synthesis cycle conditions (e.g., in the linkage between Nx and Ny in oligonucleotide ....NxNy....., the dimer is NxNy). In some embodiments, not all chiral linkages are chiral control nucleotide linkages, and the composition is a partially chiral control oligonucleotide composition. In some embodiments, the linkage between chiral non-controlled nucleotides has a distereometric purity of about 80%, 75%, 70%, 65%, 60%, less than 55%, or about 50%, as typically observed in stereorandom oligonucleotide compositions (e.g., by traditional oligonucleotide synthesis, e.g., the phosphoramidite method, as understood by those skilled in the art). In some embodiments, a plurality of oligonucleotides (or nucleic acids) are of the same type. In some embodiments, the chiral controlled oligonucleotide composition comprises types of individual oligonucleotides or nucleic acids at non-random or controlled levels. For example, in some embodiments, the chiral controlled oligonucleotide composition comprises one and one or fewer types of oligonucleotides. In some embodiments, the chiral controlled oligonucleotide composition comprises more than one type of oligonucleotide. In some embodiments, the chiral controlled oligonucleotide composition comprises a plurality of oligonucleotide types.In some embodiments, the chiral-controlled oligonucleotide composition is a composition of oligonucleotides of a predetermined oligonucleotide type, and the composition comprises a plurality of oligonucleotides of the said oligonucleotide type at non-random or controlled levels.

[0046] Comparable: As used herein, the term “comparable” is used to describe two sets (or more) of conditions or situations that are sufficiently similar to one another to enable a comparison of the obtained results or observed phenomena. In some embodiments, the sets of comparable conditions or situations are characterized by a plurality of substantially identical features and one or fewer various features. Those skilled in the art will understand that sets of conditions are similar to one another if they are characterized by a number and type of substantially identical features sufficient to warrant a reasonable conclusion that the difference in the obtained results or observed phenomena under different sets of conditions or situations is caused by or indicates variations in various features.

[0047] Jihwan tribe:The terms “alicyclic,” “carbon ring,” “carboclyl,” “carbon-cyclic radical,” and “carbon-cyclic ring” are used interchangeably and refer to saturated or partially unsaturated, non-aromatic, cyclic aliphatic monocyclic, dicyclic, or polycyclic ring systems (as described herein and having 3 to 30 ring members unless otherwise specified). The alicyclic group includes, without limitation, cyclopropyl, cyclobutyl, cyclopentyl, cyclopentenyl, cyclohexyl, cyclohexenyl, cycloheptyl, cycloheptenyl, cyclooctyl, cyclooctenyl, norbornyl, adamantyl, and cyclooctadienyl. In some embodiments, the alicyclic group has 3 to 6 carbons. In some embodiments, the alicyclic group is saturated and is cycloalkyl. Additionally, the term “aliphatic” may include an aliphatic ring fused to one or more aromatic or non-aromatic rings, such as decahydronaphthyl or tetrahydronaphthyl. In some embodiments, the aliphatic group is dicyclic. In some embodiments, the aliphatic group is tricyclic. In some embodiments, the aliphatic group is polycyclic. In some embodiments, “aliphatic” refers to a C3-C6 monocyclic hydrocarbon, or a C8-C6 hydrocarbon that is fully saturated or contains one or more unsaturated units but is not aromatic and has a single attachment point to the rest of the molecule. 10 A dicyclic or polycyclic hydrocarbon, or a C9-C that is fully saturated or contains one or more unsaturated units but is not aromatic and has a single attachment site to the rest of the molecule 16 It refers to polycyclic hydrocarbons.

[0048] GapmerAs used herein, the term “gammer” refers to an oligonucleotide characterized by comprising a core having 5’ and 3’ wings on its sides. In some embodiments, in the gammer, at least one internucleotide linkage of the oligonucleotide is a natural phosphate linkage. In some embodiments, more than one internucleotide linkage of the oligonucleotide strand is a natural phosphate linkage. In some embodiments, the gammer is a sugar-modified gammer, wherein each wing sugar independently contains a sugar modification, and the core sugar does not contain a sugar modification found in the wing sugars. In some embodiments, each core sugar does not contain a modification and is 2’-unsubstituted (as in natural DNA). In some embodiments, each wing sugar is independently a 2’-modified sugar. In some embodiments, at least one wing sugar is a bicyclic sugar. In some embodiments, each wing unit has the same wing variant (e.g., 2'-OMe (2'-OMe wing), 2'-MOE (2'-MOE wing), etc.). In some embodiments, each wing unit has the same variant. The core and wings may have various lengths. In some embodiments, the wings are nucleosides of length 2, 3, 4, 5, 6, 7, 8, 9, 10 or more (in many embodiments, 3, 4, 5, or 6 or more), and the core is a nucleoside of length 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more (in many embodiments, 8, 9, 10, 11, 12 or more). In some embodiments, the oligonucleotide comprises or consists of a wing-core-wing structure of 2-9-6, 3-9-3, 3-9-4, 3-9-5, 4-7-4, 4-9-4, 4-9-5, 4-10-5, 4-11-4, 4-11-5, 5-7-5, 5-8-6, 5-9-3, 5-9-5, 5-10-4, 5-10-5, 6-7-6, 6-8-5, or 6-9-2.In some embodiments, the oligonucleotide is a gapmer.

[0049] Hetero-regional people As used herein, the term “heteroaliphatic” is given its ordinary meaning in the art and refers to an aliphatic group as described herein in which one or more carbon atoms are independently replaced by one or more heteroatoms (e.g., oxygen, nitrogen, sulfur, silicon, phosphorus, etc.). In some embodiments, one or more units selected from C, CH, CH2, and CH3 are independently replaced by one or more heteroatoms (including their oxidized and / or substituted forms). In some embodiments, the heteroaliphatic group is heteroalkyl. In some embodiments, the heteroaliphatic group is heteroalkenyl.

[0050] heteroalkyl As used herein, the term “heteroalkyl” is given its ordinary meaning in the art and refers to an alkyl group as described herein in which one or more carbon atoms are independently replaced by one or more heteroatoms (e.g., oxygen, nitrogen, sulfur, silicon, phosphorus, etc.). Examples of heteroalkyl groups include, but are not limited to, alkoxy, poly(ethylene glycol)-, alkyl-substituted amino, tetrahydrofuranyl, piperidinyl, morpholinyl, etc.

[0051] HeteroarylAs used herein, the terms “heteroaryl” and “heteroar-”, used alone or as part of a larger moiety (e.g., “heteroaralkyl” or “heteroaralkoxy”), refer to a monocyclic, bicyclic, or polycyclic ring system having a total of 5 to 30 ring members, wherein at least one ring in the system is aromatic and at least one aromatic ring atom is a heteroatom. In some embodiments, the heteroaryl group is a group having 5 to 10 ring atoms (i.e., monocyclic, bicyclic, or polycyclic), and in some embodiments, 5, 6, 9, or 10 ring atoms. In some embodiments, the heteroaryl group has 6, 10, or 14 π electrons shared in a cyclic array; and has 1 to 5 heteroatoms in addition to carbon atoms. The heteroaryl group comprises, without limitation, thienyl, furanyl, pyrrolyl, imidazolyl, pyrazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, isothiazolyl, thiadiazolyl, pyridyl, pyridazinyl, pyrimidinyl, pyrazinyl, indolizinyl, furinyl, naphthiridinyl, and pteridinyl. In some embodiments, the heteroaryl is a heterobiaryl group, e.g., bipyridyl. As used herein, the terms “heteroaryl” and “heteroar-” also comprise a group in which a heteroaromatic ring is fused to one or more aryl, alicyclic, or heterocyclyl rings, wherein the radical or attachment site is on the heteroaromatic ring. Non-limiting examples include indolyl, isoindolyl, benzothienyl, benzofuranil, dibenzofuranil, indazollyl, benzimidazolyl, benzthiazolyl, quinolyl, isoquinolyl, cinnolinil, phthalazinil, quinazolinil, quinoxalinil, 4 H-Includes quinoliginyl, carbazolyl, acrridinyl, phenazinyl, phenothiazinyl, phenoxazinyl, tetrahydroquinolinyl, tetrahydroisoquinolinyl, and pyrido[2,3-b]-1,4-oxazine-3(4H)-one. The heteroaryl group may be monocyclic, bicyclic, or polycyclic. The term "heteroaryl" may be used interchangeably with the terms "heteroaryl ring," "heteroaryl group," or "heteroaromatic," any of which includes an optionally substituted ring. The term "heteroaralkyl" refers to an alkyl group substituted with a heteroaryl group, wherein the alkyl and heteroaryl portions are independently and optionally substituted.

[0052] heteroatom As used herein, the term “heteroatom” means an atom that is not carbon or hydrogen. In some embodiments, the heteroatom is boron, oxygen, sulfur, nitrogen, phosphorus, or silicon (any oxidized form of nitrogen, sulfur, phosphorus, or silicon; any quaternized form of basic nitrogen or substitutable nitrogen of a heterocyclic ring (e.g., N(3,4-dihydro-2)). H -as in pyrrolyl), NH (as in pyrrolidinyl) or NR + (including, as in N-substituted pyrrolidinyl, etc.); and in some embodiments, the heteroatom is oxygen, sulfur, or nitrogen.

[0053] complex callAs used herein, the terms “heterocyclic,” “heterocyclic radical,” and “heterocyclic ring” (as used herein) are used interchangeably and refer to a monocyclic, bicyclic, or polycyclic ring moiety (e.g., 3 to 30 members) that is saturated or partially unsaturated and has one or more heterocyclic ring atoms. In some embodiments, the heterocyclic group is a stable 5 to 7-membered monocyclic or 7 to 10-membered bicyclic heterocyclic moiety that is saturated or partially unsaturated and has one or more, preferably 1 to 4, heterocyclic atoms in addition to the carbon atom, as defined above. When used in relation to the ring atoms of the heterocyclic, the term “nitrogen” includes substituted nitrogen. As an example, in a saturated or partially unsaturated ring having 0 to 3 heteroatoms selected from oxygen, sulfur, and nitrogen, nitrogen is N(3,4-dihydro-2 H- As in pyrrolyl), NH (as in pyrrolidinyl), or + NR( N- It may be (as in substituted pyrrolidinyl). The heterocyclic ring may be attached to its pendant group at any heteroatom or carbon atom (which results in a stable structure), and any ring atom may be optionally substituted. Examples of such saturated or partially unsaturated heterocyclic radicals include, without limitation, tetrahydrofuranyl, tetrahydrothienyl, pyrrolidinyl, piperidinyl, pyrrolinyl, tetrahydroquinolinyl, tetrahydroisoquinolinyl, decahydroquinolinyl, oxazolidinyl, piperazinyl, dioxanyl, dioxolanyl, diazefinyl, oxazefinyl, thiazefinyl, morpholinyl, and quinuclidinyl. The terms "complex," "heterocyclil," "heterocyclil ring," "complex group," "complex moiety," and "complex radical" are used interchangeably herein, and also refer to a group in which a heterocyclil ring is fused to one or more aryl, heteroaryl, or cycloaliphatic rings, e.g., indolinyl, 3 H-Includes indolyl, chromanyl, phenanthridinyl, or tetrahydroquinolinyl. The heterocyclyl group may be monocyclic, bicyclic, or polycyclic. The term "heterocyclylalkyl" refers to an alkyl group substituted with a heterocyclyl, wherein the alkyl and heterocyclyl portions are independently and optionally substituted.

[0054] Homology"Homology," "identity," or "similarity" refers to sequence similarity between two nucleic acid molecules. Homology and identity may each be determined by comparing positions in each sequence that can be aligned for comparison purposes. If equivalent positions in the sequences being compared are occupied by the same base, the molecules are identical at that position; if equivalent sites are occupied by identical or similar nucleic acid residues (e.g., similar stereochemical and / or electronic properties), the molecules may be referred to as homologous (similar) at that position. Expressions of homology / similarity or identity as a percentage refer to a function of the number of identical or similar nucleic acids at positions shared by the sequences being compared. In some embodiments, "unrelated" or "non-homologous" sequences share less than 40% identity, less than 35% identity, less than 30% identity, or less than 25% identity with the sequences described herein. When comparing two sequences, the absence of residues (amino acids or nucleic acids) or the presence of extra residues also reduces identity and homology / similarity. In some embodiments, polymer molecules (e.g., oligonucleotides, nucleic acids, proteins, etc.) are considered to be "homologous" to each other if their sequences are at least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% identical. In some embodiments, polymer molecules are considered to be "homologous" to each other if their sequences are at least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% similar.

[0055] In some embodiments, the term “homology” describes a mathematically based comparison of sequence similarities used to identify genes having similar functions or motifs. The nucleic acid sequences described herein may be used as “query sequences” to perform a search on public databases to identify, for example, other family members, related sequences, or homologs. In some embodiments, such a search is based on the literature [Altschul, et al This can be performed using the NBLAST and XBLAST programs (version 2.0) of [Altschul (1990) J. Mol. Biol. 215:403-10]. In some embodiments, BLAST nucleotide search may be performed using the NBLAST program, score=100, word length=12 to obtain nucleotide sequences homologous to the nucleic acid molecule of the present invention. In some embodiments, Gapped BLAST may be utilized to obtain gap alignment for comparison purposes, which is [Altschul et al As described in [., (1997) Nucleic Acids Res. 25(17):3389-3402]. When using BLAST and Gapped BLAST programs, the default parameters of each program (e.g., XBLAST and BLAST) may be used (see www.ncbi.nlm.nih.gov).

[0056] samenessAs used herein, the term "identity" refers to the overall relationship between polymer molecules, e.g., between nucleic acid molecules (e.g., oligonucleotides, DNA, RNA, etc.) and / or between polypeptide molecules. In some embodiments, polymer molecules are considered "substantially identical" to one another if their sequences are at least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% identical. For example, the calculation of the identity percentage of two nucleic acid or polypeptide sequences may be performed by aligning the two sequences for the purpose of optimal comparison (e.g., gaps may be introduced in one or both of the first and second sequences for optimal alignment, and non-identical sequences may be ignored for the purpose of comparison). In a specific embodiment, the length of the sequence aligned for comparison purposes is at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or substantially 100% of the length of the reference sequence. Then, nucleotides at corresponding positions are compared. If a position in the first sequence is occupied by the same residue (e.g., nucleotide or amino acid) as a corresponding position in the second sequence, the molecules are identical at that position. The percentage identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the length and number of gaps for each gap that need to be introduced for optimal alignment of the two sequences. Sequence comparison and determination of the percentage identity between the two sequences can be achieved using a mathematical algorithm. For example, the percentage of identity between two nucleotide sequences can be determined using the algorithm of Meyers and Miller (reference [CABIOS, 1989, 4: 11-17]) integrated into the ALIGN program (version 2.0).In some exemplary embodiments, nucleic acid sequence comparison performed by the ALIGN program uses a PAM120 weighted residue table, a gap length penalty of 12, and a gap penalty of 4. Alternatively, the percentage of identity between two nucleotide sequences can be determined using the GAP program of the GCG software package using the NWSgapdna.CMP matrix.

[0057] Links between nucleotides: As used herein, the phrase “internucleotide linkage” generally refers to a linkage connecting nucleoside units of an oligonucleotide or nucleic acid. In some embodiments, the internucleotide linkage is a phosphodiester linkage (a natural phosphate linkage (-OP(=O)(OH)O-)) which is widely found in naturally occurring DNA and RNA molecules and may exist in salt form as recognized by those skilled in the art). In some embodiments, the internucleotide linkage is a modified internucleotide linkage (not a natural phosphate linkage). In some embodiments, the internucleotide linkage is a “modified internucleotide linkage” in which at least one oxygen atom or -OH of the phosphodiester linkage is replaced by a different organic or inorganic moiety. In some embodiments, such organic or inorganic moiety is =S, =Se, =NR', -SR', -SeR', -N(R')2, B(R') 3,Selected from -S-, -Se-, and -N(R')-, wherein each R' is independently defined and described in the present invention. In some embodiments, the internucleotide linkage is a phosphotriester linkage, a phosphothioate linkage (or a phosphothioate diester linkage, -OP(=O)(SH)O- (which may exist in salt form as recognized by those skilled in the art), or a phosphothioate tryster linkage). In some embodiments, the modified internucleotide linkage is a phosphothioate linkage. In some embodiments, the internucleotide linkage is one of, for example, a PNA (peptide nucleic acid) or a PMO (phosphorodiamidate morpholino oligomer) linkage. In some embodiments, the modified internucleotide linkage is a non-negatively charged internucleotide linkage. In some embodiments, the modified internucleotide linkage is a neutral internucleotide linkage (e.g., n001 in the specific oligonucleotides provided). Those skilled in the art will recognize that the internucleotide linkage is an anion or at a given pH due to the presence of an acid or base moiety in the linkage. It is understood that it may exist as a cation. In some embodiments, the modified internucleotide linkages are modified internucleotide linkages denoted as s, s1, s2, s3, s4, s5, s6, s7, s8, s9, s10, s11, s12, s13, s14, s15, s16, s17 and s18 as described in WO 2017 / 210647.

[0058] In a test tube As used herein, the term "in a test tube" refers to events occurring in an artificial environment, such as a test tube or reaction vessel, cell culture, etc., rather than within an organism (e.g., animal, plant, and / or microorganism).

[0059] In vivoAs used herein, the term "in vivo" refers to events occurring within an organism (e.g., animals, plants, and / or microorganisms).

[0060] connection As defined herein, the phrase “linking phosphorus” is used to indicate that the specific phosphorus atom mentioned is a phosphorus atom present in an internucleotide linkage, said phosphorus atom corresponds to the phosphorus atom in phosphodiester internucleotide linkages found in naturally occurring DNA and RNA. In some embodiments, the linking phosphorus atom is present in a modified internucleotide linkage, wherein each oxygen atom of the phosphodiester linkage is optionally and independently replaced by an organic or inorganic moiety. In some embodiments, the linking phosphorus atom is P of Formula I as defined herein. In some embodiments, the linking phosphorus atom is a chiral atom. In some embodiments, the linking phosphorus atom is an achiral atom (e.g., as in natural phosphate linkages).

[0061] LinkerThe terms “linker,” “linking moiety,” etc. refer to any chemical moiety that links one chemical moiety to another chemical moiety. As recognized by those skilled in the art, a linker may be divalent, trivalent, or more, depending on the number of chemical moietyes that the linker links. In some embodiments, the linker is a moiety that links one oligonucleotide to another oligonucleotide in a multimer. In some embodiments, the linker is a moiety that is optionally located between a terminal nucleoside and a solid support, or between a terminal nucleoside and another nucleoside, nucleotide, or nucleic acid. In some embodiments, in an oligonucleotide, the linker links a chemical moiety (e.g., targeting moiety, lipid moiety, carbohydrate moiety, etc.) to the oligonucleotide chain (e.g., through its 5'-terminus, 3'-terminus, nucleobase, sugar, nucleotide-nucleotide bonding, etc.).

[0062] Lower alkyl : The term "lower alkyl" is C 1-4 It refers to straight-chain or branched alkyl groups. Exemplary lower alkyl groups include methyl, ethyl, propyl, isopropyl, butyl, isobutyl, and tert-butyl.

[0063] lower haloalkyl : The term "lower haloalkyl" refers to C substituted with one or more halogen atoms. 1-4 It refers to a straight-chain or branched alkyl group.

[0064] Modified nucleobases:Terms such as “modified nucleobase,” “modified base,” etc. refer to a chemical moiety that is chemically distinct from a nucleobase but can perform one or more functions of a nucleobase. In some embodiments, the modified nucleobase is a nucleobase that includes a modification. In some embodiments, the modified nucleobase is capable of one or more functions of a nucleobase and, for example, can form a moiety in a polymer capable of forming base pairs with a nucleic acid containing at least a complementary base sequence. In some embodiments, the modified nucleobase is a substituted A, T, C, G, or U, or a substituted tautomer of A, T, C, G, or U. In some embodiments, in the context of an oligonucleotide, the modified nucleobase refers to a nucleobase that is not A, T, C, G, or U.

[0065] Modified nucleoside: The term “modified nucleoside” refers to a moiety that is derived from or chemically similar to a natural nucleoside but includes chemical modifications that distinguish it from the natural nucleoside. Non-limiting examples of modified nucleosides include modifications in bases and / or sugars. Non-limiting examples of modified nucleosides include having a 2’ modification in a sugar. Non-limiting examples of modified nucleosides also include non-basic nucleosides (lacking a nucleobase). In some embodiments, the modified nucleoside may be capable of one or more functions of a nucleoside and may form a moiety in a polymer capable of forming base pairs with a nucleic acid containing at least a complementary base sequence.

[0066] Modified nucleotide:The term “modified nucleotide” comprises any chemical moiety that is structurally different from a natural nucleotide but is capable of performing one or more functions of a natural nucleotide. In some embodiments, the modified nucleotide comprises modifications in the sugar, base, and / or nucleotide linkages. In some embodiments, the modified nucleotide comprises a modified sugar, a modified nucleobase, and / or modified nucleotide linkages. In some embodiments, the modified nucleotide is capable of one or more functions of a nucleotide and may form a subunit in a polymer capable of forming base pairs with a nucleic acid comprising at least a complementary base sequence.

[0067] Modified sugar The term "modified sugar" refers to a moiety capable of replacing a sugar. Modified sugars mimic the spatial arrangement, electronic properties, or some other physicochemical properties of a sugar. In some embodiments, as described in the present invention, the modified sugar is a substituted ribose or deoxyribose. In some embodiments, the modified sugar includes a 2'-modification. Examples of useful 2'-modifications are widely used in the art and are described herein. In some embodiments, the 2'-modification is 2'-OR, where R is an optionally substituted C 1-10 It is aliphatic. In some embodiments, the 2'-modification is 2'-OMe. In some embodiments, the 2'-modification is 2'-MOE. In some embodiments, the modified sugar is a bicyclic sugar (e.g., a sugar used in LNA, BNA, etc.). In some embodiments, in the context of an oligonucleotide, the modified sugar is a sugar other than ribose or deoxyribose typically found in natural RNA or DNA.

[0068] nucleic acidsAs used herein, the term “nucleic acid” comprises any nucleotide and polymers thereof. As used herein, the term “polynucleotide” refers to a polymeric form of nucleotides of any length, such as ribonucleotides (RNA) or deoxyribonucleotides (DNA) or combinations thereof. These terms refer to the primary structure of molecules and thus include double-stranded and single-stranded DNA, and double-stranded and single-stranded RNA. These terms include, as equivalents, analogs of RNA or DNA comprising modified nucleotides and / or modified polynucleotides, such as but not limited to methylated, protected, and / or capped nucleotides or polynucleotides. The terms include poly- or oligo-ribonucleotides (RNA) and poly- or oligo-deoxyribonucleotides (DNA); RNA or DNA derived from N-glycosides or C-glycosides of nucleobases and / or modified nucleobases; nucleic acids derived from sugars and / or modified sugars; and includes nucleic acids derived from phosphate crosslinks and / or modified internucleotide linkages. The terms include nucleic acids containing any combination of a nucleobase, a modified nucleobase, a sugar, a modified sugar, a phosphate crosslink, or a modified internucleotide linkage. Examples include, but are not limited to, nucleic acids containing a ribose moiety, nucleic acids containing a deoxyribose moiety, nucleic acids containing both ribose and deoxyribose moiety, and nucleic acids containing ribose and a modified ribose moiety. Unless otherwise specified, the prefix poly- refers to nucleic acids containing 2 to about 10,000 nucleotide monomer units, and the prefix oligo- refers to nucleic acids containing 2 to about 200 nucleotide monomer units.

[0069] nucleus base: The term “nucleobase” refers to a portion of nucleic acid involved in hydrogen bonding that binds one nucleic acid strand to another complementary strand in a sequence-specific manner. The most common naturally occurring nucleobases are adenine (A), guanine (G), uracil (U), cytosine (C), and thymine (T). In some embodiments, the naturally occurring nucleobase is modified adenine, guanine, uracil, cytosine, or thymine. In some embodiments, the naturally occurring nucleobase is methylated adenine, guanine, uracil, cytosine, or thymine. In some embodiments, the nucleobase comprises a heteroaryl ring in which the ring atom is nitrogen, and when in a nucleoside, said nitrogen is bound to a sugar moiety. In some embodiments, the nucleobase comprises a heterocyclic ring in which the ring atom is nitrogen, and when in a nucleoside, said nitrogen is bound to a sugar moiety. In some embodiments, the nucleobase is a “modified nucleobase” that is a nucleobase other than adenine (A), guanine (G), uracil (U), cytosine (C), and thymine (T). In some embodiments, the modified nucleobase is a substituted A, T, C, G, or U. In some embodiments, the modified nucleobase is a substituted tautomer of A, T, C, G, or U. In some embodiments, the modified nucleobase is methylated adenine, guanine, uracil, cytosine, or thymine. In some embodiments, the modified nucleobase mimics the spatial arrangement, electronic properties, or some other physicochemical properties of the nucleobase and possesses the property of hydrogen bonding that binds one nucleic acid strand to another in a sequence-specific manner. In some embodiments, the modified nucleobase may pair with all five naturally occurring bases (uracil, thymine, adenine, cytosine, or guanine) without substantially affecting melting behavior, recognition by intracellular enzymes, or the activity of the oligonucleotide duplex. As used herein, the term “nucleobase” also includes structural analogs used in place of natural or naturally occurring nucleotides, such as the modified nucleobase and nucleobase analogs.In some embodiments, the nucleobase is an optional substitution A, T, C, G, or U, or an optional substitution tautomer of A, T, C, G, or U. In some embodiments, "nucleobase" refers to a nucleobase unit in an oligonucleotide or nucleic acid (e.g., A, T, C, G, or U as in an oligonucleotide or nucleic acid).

[0070] nucleoside : The term “nucleoside” refers to a moiety in which a nucleobase or a modified nucleobase is covalently bonded to a sugar or a modified sugar. In some embodiments, the nucleoside is a natural nucleoside, e.g., adenosine, deoxyadenosine, guanosine, deoxyguanosine, thymidine, uridine, cytidine, or deoxycytidine. In some embodiments, the nucleoside is a modified nucleoside, e.g., a substituted natural nucleoside (selected from adenosine, deoxyadenosine, guanosine, deoxyguanosine, thymidine, uridine, cytidine, and deoxycytidine). In some embodiments, the nucleoside is a substituted tautomer of a natural nucleoside selected from adenosine, deoxyadenosine, guanosine, deoxyguanosine, thymidine, uridine, cytidine, and deoxycytidine. In some embodiments, "nucleoside" refers to a nucleoside unit in an oligonucleotide or nucleic acid.

[0071] nucleoside Analogue: The term "nucleoside analog" refers to a chemical moiety that is chemically distinct from a natural nucleoside but can perform one or more functions of a nucleoside. In some embodiments, nucleoside analogs include sugar analogs and / or nucleobase analogs. In some embodiments, the modified nucleoside is capable of one or more functions of a nucleoside and can form a moiety in a polymer capable of forming base pairs with a nucleic acid containing a complementary base sequence, for example.

[0072] Nucleotide: As used herein, the term “nucleotide” refers to a monomeric unit of a polynucleotide consisting of a nucleobase, a sugar, and one or more nucleotide-to-nucleotide linkages (e.g., phosphate linkages in natural DNA and RNA). It should be understood that naturally occurring bases [guanine (G), adenine (A), cytosine (C), thymine (T), and uracil (U)] are derivatives of purines or pyrimidines, but also include naturally occurring and naturally non-natural base analogs. It should be understood that naturally occurring sugars are pentose (pentose sugars) deoxyribose (which forms DNA) or ribose (which forms RNA), but also include naturally occurring and naturally non-natural sugar analogs. Nucleotides are linked through nucleotide-to-nucleotide linkages to form nucleic acids or polynucleotides. Many nucleotide-to-nucleotide linkages (such as, but not limited to, phosphates, phosphorothioates, boranophosphates, etc.) are known in the art. Artificial nucleic acids include PNA (peptide nucleic acid), phosphotriesters, phosphorothionates, H-phosphonates, phosphoramidates, boranophosphates, methylphosphonates, phosphonoacetates, thiophosphonoacetates, and other variants of the phosphate backbone of natural nucleic acids, such as those described herein. In some embodiments, natural nucleotides comprise naturally occurring bases, sugars, and linkages between nucleotides. As used herein, the term “nucleotide” also includes structural analogs used in place of natural or naturally occurring nucleotides, such as modified nucleotides and nucleotide analogs. In some embodiments, “nucleotide” refers to an oligonucleotide or a nucleotide unit in nucleic acid.

[0073] Oligonucleotide: The term "oligonucleotide" refers to a polymer or oligomer of nucleotides and may include any combination of natural and non-natural nucleobases, sugars, and linkages between nucleotides.

[0074] Oligonucleotides may be single-stranded or double-stranded. Single-stranded oligonucleotides may have a double-stranded region (formed by two parts of the single-stranded oligonucleotide), and double-stranded oligonucleotides comprising two oligonucleotide chains may have a single-stranded region, for example, in a region where the two oligonucleotide chains are not complementary to each other. Exemplary oligonucleotides include, but are not limited to, structural genes, genes containing control and termination regions, self-replicating systems such as viral or plasmid DNA, single-stranded and double-stranded RNAi agents and other RNA interference reagents (RNAi agents or iRNA agents), shRNA, antisense oligonucleotides, ribozymes, microRNA, microRNA mimics, supermir, aptamer, antimir, antagomir, Ul adapter, triplex-forming oligonucleotides, G-quadruplex oligonucleotides, RNA activators, immunostimulatory oligonucleotides, and decoy oligonucleotides.

[0075] The oligonucleotides of the present invention may be of various lengths. In certain embodiments, the oligonucleotides may have a length ranging from about 2 to about 200 nucleosides. In various related embodiments, single-stranded, double-stranded, or triple-stranded oligonucleotides may have a length ranging from about 4 to about 10 nucleosides, about 10 to about 50 nucleosides, about 20 to about 50 nucleosides, about 15 to about 30 nucleosides, or about 20 to about 30 nucleosides. In some embodiments, the oligonucleotides have a length of about 9 to about 39 nucleosides. In some embodiments, the oligonucleotide is at least 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleosides in length. In some embodiments, the oligonucleotide is at least 4 nucleosides in length. In some embodiments, the oligonucleotide is at least 5 nucleosides in length. In some embodiments, the oligonucleotide is at least 6 nucleosides in length. In some embodiments, the oligonucleotide is at least 7 nucleosides in length. In some embodiments, the oligonucleotide is at least 8 nucleosides in length. In some embodiments, the oligonucleotide is at least 9 nucleosides in length. In some embodiments, the oligonucleotide is at least 10 nucleosides in length. In some embodiments, the oligonucleotide is a nucleoside of at least 11 lengths. In some embodiments, the oligonucleotide is a nucleoside of at least 12 lengths. In some embodiments, the oligonucleotide is a nucleoside of at least 15 lengths. In some embodiments, the oligonucleotide is a nucleoside of at least 15 lengths. In some embodiments, the oligonucleotide is a nucleoside of at least 16 lengths.In some embodiments, the oligonucleotide is at least 17 nucleosides long. In some embodiments, the oligonucleotide is at least 18 nucleosides long. In some embodiments, the oligonucleotide is at least 19 nucleosides long. In some embodiments, the oligonucleotide is at least 20 nucleosides long. In some embodiments, the oligonucleotide is at least 25 nucleosides long. In some embodiments, the oligonucleotide is at least 30 nucleosides long. In some embodiments, the oligonucleotide is a duplex of complementary strands having at least 18 nucleosides long. In some embodiments, the oligonucleotide is a duplex of complementary strands having at least 21 nucleosides long. In some embodiments, each nucleoside counted in the oligonucleotide length independently comprises A, T, C, G, or U, or an optionally substituted tautomer of A, T, C, G, or U.

[0076] Oligonucleotide Type: As used herein, the phrase "oligonucleotide type" refers to a specific base sequence, a backbone linkage pattern (i.e., a type of linkage between nucleotides, e.g., a pattern of phosphate, phosphorothioate, phosphorothioate triester, etc.), and a pattern of backbone chiral centers [i.e., a pattern of stereochemistry of linkage ( R p / S p)], and backbone pattern of modification (e.g., "-XLR in Formula I as defined herein) 1" It is used to define oligonucleotides having a pattern of (group). In some embodiments, oligonucleotides of the common notation "type" are structurally identical to each other.

[0077] Those skilled in the art will understand that the synthesis method of the present invention provides a certain degree of control during the synthesis of an oligonucleotide strand, so that each nucleotide unit of the oligonucleotide strand may be pre-designed and / or selected to have a specific stereochemistry in the linking phosphate and / or a specific modification in the linking phosphate and / or a specific base and / or a specific sugar. In some embodiments, the oligonucleotide strand is pre-designed and / or selected to have a specific combination of stereocenters in the linking phosphate. In some embodiments, the oligonucleotide strand is designed and / or determined to have a specific combination of modifications in the linking phosphate. In some embodiments, the oligonucleotide strand is designed and / or selected to have a specific combination of bases. In some embodiments, the oligonucleotide strand is designed and / or selected to have a specific combination of one or more of the structural features. In some embodiments, the present invention provides a composition comprising or consisting of a plurality of oligonucleotide molecules (e.g., a chiral-controlled oligonucleotide composition). In some embodiments, all such molecules are of the same type (i.e., structurally identical to one another). However, in some embodiments, the provided composition typically contains a plurality of different types of oligonucleotides in predetermined relative amounts.

[0078] Optionally substitutedAs described herein, compounds of the present invention, e.g., oligonucleotides, may comprise optionally substituted moieties and / or substituted moieties. Generally, the term “substituted” means that one or more hydrogens of the indicated moieties are replaced by suitable substituents, whether or not the term “optional” precedes. Unless otherwise indicated, the “optionally substituted” group may have suitable substituents at each substitutable position of the group, and where more than one position in any given structure may be substituted with more than one substituent selected from the specific group, the substituents may be the same or different at all positions. In some embodiments, the optionally substituted group is unsubstituted. The combination of substituents conceived by the present invention preferably results in the formation of a stable or chemically feasible compound. As used herein, the term “stable” refers to a compound that is not substantially altered when conditions are applied to enable the generation, detection, and, in certain embodiments, the recovery, purification, and use for one or more of the purposes disclosed herein. Specific substituents are described below.

[0079] Substitutable atoms, e.g., suitable monovalent substituents on suitable carbon atoms, are independently halogens; -(CH2) 0-4 R°; -(CH2) 0-4 OR°; -O(CH2) 0-4 R o , -O-(CH2) 0-4 C(O)OR°; -(CH2) 0-4 CH(OR°)2; -(CH2) that can be substituted with R° 0-4 -(CH2) that can be replaced by Ph; R° 0-4 O(CH2) 0-1 Ph; -CH=CHPh that can be replaced by R°; -(CH2) that can be replaced by R° 0-4 O(CH2) 0-1-피리딜; -NO2; -CN; -N3; -(CH2) 0-4 N(R°)2; -(CH2) 0-4 N(R°)C(O)R°; -N(R°)C(S)R°; -(CH2) 0-4 N(R°)C(O)NR°2; -N(R°)C(S)NR°2; -(CH2) 0-4 N(R°)C(O)OR°; -N(R°)N(R°)C(O)R°; -N(R°)N(R°)C(O)NR°2; -N(R°)N(R°)C(O)OR°; -(CH2) 0-4 C(O)R°; -C(S)R°; -(CH2) 0-4 C(O)OR°; -(CH2) 0-4 C(O)SR°; -(CH2) 0-4 C(O)OSiR°3; -(CH2) 0-4 OC(O)R°; -OC(O)(CH2) 0-4 SR°, -SC(S)SR°; -(CH2) 0-4 SC(O)R°; -(CH2) 0-4 C(O)NR°2; -C(S)NR°2; -C(S)SR°; -(CH2) 0-4 OC(O)NR°2; -C(O)N(OR°)R°; -C(O)C(O)R°; -C(O)CH2C(O)R°; -C(NOR°)R°; -(CH2) 0-4 SSR°; -(CH2) 0-4 S(O)2R°; -(CH2) 0-4 S(O)2OR°; -(CH2) 0-4 OS(O)2R°; -S(O)2NR°2; -(CH2) 0-4S(O)R°; -N(R°)S(O)2NR°2; -N(R°)S(O)2R°; -N(OR°)R°; -C(NH)NR°2; -Si(R°)3; -OSi(R°)3; -B(R°)2; -OB(R°)2; -OB(OR°)2; -P(R°)2; -P(OR°)2; -P(R°)(OR°); -OP(R°)2; -OP(OR°)2; -OP(R°)(OR°); -P(O)(R°)2; -P(O)(OR°)2; -OP(O)(R°)2; -OP(O)(OR°)2; -OP(O)(OR°)(SR°); -SP(O)(R°)2; -SP(O)(OR°)2; -N(R°)P(O)(R°)2; -N(R°)P(O)(OR°)2; -P(R°)2[B(R°)3]; -P(OR°)2[B(R°)3]; -OP(R°)2[B(R°)3]; -OP(OR°)2[B(R°)3]; -(C 1-4 Straight-chain or branched alkylene)ON(R°)2; or -(C 1-4 (Straight-chain or branched alkylene)C(O)ON(R°)2, wherein each R° may be substituted as defined herein and independently hydrogen, C 1-20 Aliphatic, C having 1 to 5 heteroatoms independently selected from nitrogen, oxygen, sulfur, silicon, and phosphorus 1-20 Heteroaliphatic, -CH2-(C 6-14 Aril), -O(CH2) 0-1 (C 6-14 aryl), -CH2-(5-14 member heteroaryl ring), 5-20 member, monocyclic, dicyclic, or polycyclic, saturated, partially unsaturated, or aryl ring (having 0-5 heteroatoms independently selected from nitrogen, oxygen, sulfur, silicon, and phosphorus), or, notwithstanding the above definition, two independently existing R° are taken together with their intervening atom(s) to form a 5-20 member, monocyclic, dicyclic, or polycyclic, saturated, partially unsaturated, or aryl ring (having 0-5 heteroatoms independently selected from nitrogen, oxygen, sulfur, silicon, and phosphorus), which may be substituted as defined below.

[0080] Suitable monovalent substituents on R° (or the ring formed by two independently existing R° with their intervening atoms) are independently halogens, -(CH2) 0-2 R ● , -(HalloR ● ), -(CH2) 0-2 OH, -(CH2) 0-2 OR ● , -(CH2) 0-2 CH(OR ● )2; -O(HalloR ● ), -CN, -N3, -(CH2) 0-2 C(O)R ● , -(CH2) 0-2 C(O)OH, -(CH2) 0-2 C(O)OR ● , -(CH2) 0-2 SR ● , -(CH2) 0-2 SH, -(CH2) 0-2 NH2, -(CH2) 0-2 NHR ● , -(CH2) 0-2 NR ● 2, -NO2, -SiR ● 3, -OSiR ● 3, -C(O)SR ● , -(C 1-4 Straight-chain or branched alkylene)C(O)OR ● , or -SSR ● and, here, each R ● It is unsubstituted, or, where "halo" precedes it, is substituted with only one or more halogens, and independently C 1-4 Aliphatic, -CH2Ph, -O(CH2) 0-1 It is selected from pH, and 5-6 saturated, partially unsaturated, or aryl rings (having 0-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur). Suitable divalent substituents on the saturated carbon atom of R° include =O and =S.

[0081] For example, suitable divalent substituents on a suitable carbon atom are independently the following: =O, =S, =NNR * 2, =NNHC(O)R * , =NNHC(O)OR * , =NNHS(O)2R * , =NR * , =NOR * , -O(C(R * 2)) 2-3 O-, or -S(C(R * 2)) 2-3 S-(where R, each existing independently * is hydrogen, C which can be substituted as defined below 1-6 Selected from aliphatic, and unsubstituted 5-6-membered saturated, partially unsaturated, or aryl rings (having 0-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur). Suitable divalent substituents bonded to adjacent substitutable carbons of the "optionally substituted" group include: -O(CR * 2) 2-3 O-(where R, each existing independently * is hydrogen, C which can be substituted as defined below 1-6 Selected from aliphatic, and unsubstituted 5-6-membered saturated, partially unsaturated, and aryl rings (having 0-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur).

[0082] R * Suitable substituents on the aliphatic group of are independently halogens, -R ● , -(HalloR ● ), -OH, -OR ● , -O(haloR ● ), -CN, -C(O)OH, -C(O)OR ● , -NH2, -NHR ● , -NR ● 2, or -NO2, where each R ●is unsubstituted, or, where "halo" precedes, is substituted with only one or more halogens, and independently C 1-4 Aliphatic, -CH2Ph, -O(CH2) 0-1 It is a 5-6 saturated, partially unsaturated, or aryl ring (having 0-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur).

[0083] In some embodiments, a suitable substituent on the replaceable nitrogen is independently -R † , -NR † 2, -C(O)R † , -C(O)OR † , -C(O)C(O)R † , -C(O)CH2C(O)R † , -S(O)2R † , -S(O)2NR † 2, -C(S)NR † 2, -C(NH)NR † 2, or -N(R † )S(O)2R † and; here, each R † C, which can be independently substituted for hydrogen as defined below. 1-6 It is an aliphatic, unsubstituted -OPh, or unsubstituted 5-6-membered saturated, partially unsaturated, or aryl ring (having 0-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur), or, notwithstanding the above definition, two independently existing R † It forms, together with its intervening atoms, an unsubstituted 3- to 12-membered saturated, partially unsaturated, or aryl monocyclic or dicyclic ring (having 0-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur).

[0084] R † Suitable substituents on the aliphatic group of are independently halogens, -R ● , -(HalloR ● ), -OH, -OR ● , -O(haloR ●), -CN, -C(O)OH, -C(O)OR ● , -NH2, -NHR ● , -NR ● 2, or -NO2, where each R ● is unsubstituted, or, where "halo" precedes, is substituted with only one or more halogens, and independently C 1-4 Aliphatic, -CH2Ph, -O(CH2) 0-1 It is a 5-6 saturated, partially unsaturated, or aryl ring (having 0-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur).

[0085] oral: As used herein, the phrases "oral administration" and "to be administered orally" have the meaning understood in the art of this field, referring to the administration of a compound or composition by the mouth.

[0086] P-variant: As used herein, the term “P-modification” refers to any modification in the linking factor other than stereochemical modification. In some embodiments, P-modification includes the addition, substitution, or removal of a pendant moiety covalently attached to the linking factor. In some embodiments, “P-modification” refers to -XLR 1 and, where X, L and R respectively 1 is as defined and described independently in the present invention.

[0087] Non-parenteral area: As used herein, the terms “parenteral administration” and “to be parenterally administered” have the meaning understood in the field of the art to refer to a method of administration other than intestinal and local administration by injection, and include, without limitation, intravenous, intramuscular, intra-arterial, intravertebral, intrasacral, intraorbital, intracardiac, intradermal, intraperitoneal, transcanal, subcutaneous, subcutaneous, intra-articular, subcapsular, subarachnoid, intramedullary, and intrasternal injections and infusions.

[0088] Partially unsaturated:As used herein, the term “partially unsaturated” refers to a ring moiety comprising at least one double or triple bond. The term “partially unsaturated” is intended to include a ring having multiple unsaturated sites, but is not intended to include an aryl or heteroaryl moiety as defined herein.

[0089] Pharmaceuticals Composition: As used herein, the term “pharmaceutical composition” refers to an active agent formulated with one or more pharmaceutically acceptable carriers. In some embodiments, the active agent is present in a unit dose amount appropriate for administration in a therapeutic regimen that represents a probability of achieving a statistically significant desired therapeutic effect when administered to a relevant population. In some embodiments, the pharmaceutical composition may be specifically formulated for administration in solid or liquid form, including those modified for: e.g., drenches (aqueous or non-aqueous solutions or suspensions), tablets, e.g., buccal, sublingual, and those targeted for systemic absorption; for oral administration such as boluses, powders, granules, or pastes for application to the tongue; e.g., antiseptic solutions or suspensions, or sustained-release formulations for parenteral administration, e.g., subcutaneous, intramuscular, intravenous, or epidural injection; for topical application, e.g., as creams, ointments, or controlled-release patches or sprays applied to the skin, lungs, or oral cavity. For example, for vaginal or rectal administration as a pessary, cream, or foam; for sublingual administration; for ocular administration; for transdermal administration; or for administration to the nasal cavity, lungs, and other mucosal surfaces.

[0090] Constraint-acceptable:As used herein, the phrase “pharmaceutical acceptable” refers to compounds, substances, compositions, and / or dosage forms suitable for use in contact with human and animal tissues without excessive toxicity, irritation, allergic reactions, or other problems or complications, within the scope of sound medical judgment and corresponding to a reasonable benefit / risk ratio.

[0091] Constraints allowable carrier: As used herein, the term “pharmaceutical acceptable carrier” means a pharmaceutically acceptable substance, composition, or vehicle, such as a liquid or solid filler, diluent, excipient, or solvent-encapsulated material, involved in carrying or transporting a target compound from one organ or part of the body to another organ or part of the body. Each carrier must be “acceptable” in the sense that it is compatible with other components of the formulation and is not harmful to the patient. Some examples of substances that may serve as pharmaceutically acceptable carriers include: sugars, such as lactose, glucose, and sucrose; starches, such as corn starch and potato starch; cellulose and its derivatives, such as sodium carboxymethyl cellulose, ethyl cellulose, and cellulose acetate; powdered tragacanth; malt; gelatin; talc; excipients, such as cocoa butter and suppository waxes; oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil, and soybean oil; glycols, such as propylene glycol; Polyols, e.g., glycerin, sorbitol, mannitol, and polyethylene glycol; esters, e.g., ethyl oleate and ethyl laurate; agar; buffers, e.g., magnesium hydroxide and aluminum hydroxide; alginic acid; non-pyrogenous water; isotonic saline; Ringer's solution; ethyl alcohol; pH buffer solution; polyesters, polycarbonates, and / or polyanhydrides; and other non-toxic, compatible materials used in pharmaceutical formulations.

[0092] Pharmaceutically acceptable salts:As used herein, the term “pharmaceutical acceptable salt” refers to a salt of a compound suitable for use in a pharmaceutical context, that is, a salt that is suitable for use in contact with tissues of humans and lower animals within the scope of sound medical judgment without excessive toxicity, irritation, allergic reactions, etc., and corresponds to a reasonable benefit-risk ratio. Pharmaceutically acceptable salts are well known in the art. For example, SM Berge et al. describe pharmaceutically acceptable salts in detail in the literature [J. Pharmaceutical Sciences, 66: 1-19 (1977)]. In some embodiments, pharmaceutically acceptable salts include, but are not limited to, non-toxic acid addition salts that are salts of amino groups formed by inorganic acids such as hydrochloric acid, hydrobromide, phosphoric acid, sulfuric acid, and perchloric acid, or organic acids such as acetic acid, maleic acid, tartaric acid, citric acid, succinic acid, or malonic acid, or by other methods used in the art, such as ion exchange. In some embodiments, pharmaceutically acceptable salts are adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentanepropionate, digluconate, dodecylsulfate, ethanesulfonate, formate, fumarate, glucoheptonate, glycerophosphate, gluconate, hemisulfate, heptanoate, hexanoate, hydroiodide, 2-hydroxy-ethanesulfonate, lactobionate, lactate, laurate, lauryl sulfate, maleate, maleate, malonate, methanesulfonate, 2-naphthalenesulfonate, nicotinate, nitrate, oleate, oxalate, palmitate, pamoate, Pectinate, persulfate, 3-phenylpropionate, phosphate, picrate, pivalate, propionate, stearate, succinate, sulfate, tartrate, thiocyanate, p- Includes, but is not limited to, toluenesulfonate, undecanoate, valerate salts, etc. In some embodiments, the provided compound comprises one or more acidic groups, e.g., oligonucleotides, and the pharmaceutically acceptable salt is an alkali, alkaline earth metal, or ammonium salt (e.g., an ammonium salt of N(R)3 (wherein each R is independently defined and described in the present invention)). Representative alkali or alkaline earth metal salts include sodium, lithium, potassium, calcium, magnesium, etc. In some embodiments, the pharmaceutically acceptable salt is a sodium salt. In some embodiments, the pharmaceutically acceptable salt is a potassium salt. In some embodiments, the pharmaceutically acceptable salt is a calcium salt. In some embodiments, the pharmaceutically acceptable salt comprises, where appropriate, non-toxic ammonium, quaternary ammonium, and amine cations formed using counterions such as halides, hydroxylates, carboxylates, sulfates, phosphates, nitrates, alkyls having 1 to 6 carbon atoms, sulfonates, and aryl sulfonates. In some embodiments, the provided compounds comprise more than one acid group, and, for example, oligonucleotides may comprise two or more acidic groups (e.g., in natural phosphate linkages and / or modified nucleotide linkages). In some embodiments, the pharmaceutically acceptable salt of these compounds, or generally the salt, comprises two or more cations that may be the same or different. In some embodiments, in a pharmaceutically acceptable salt (or generally a salt), all ionizable hydrogen in the acidic group (e.g., about 11, 10, 9, 8, 7, 6, 5, 4, 3 or 2 or less; in some embodiments about 7 or less; in some embodiments about 6 or less; in some embodiments about 5 or less; in some embodiments about 4 or less; in some embodiments about 3 or less in an aqueous solution) is replaced with cations.In some embodiments, each phosphorothioate and phosphate group exists independently in its salt form (e.g., -OP(O)(SNa)-O- and -OP(O)(ONa)-O-, respectively, in the case of a sodium salt). In some embodiments, the link between each phosphorothioate and phosphate nucleotide exists independently in its salt form (e.g., -OP(O)(SNa)-O- and -OP(O)(ONa)-O-, respectively, in the case of a sodium salt). In some embodiments, the pharmaceutically acceptable salt is the sodium salt of the oligonucleotide. In some embodiments, the pharmaceutically acceptable salt is the sodium salt of the oligonucleotide in which each acidic phosphate and modified phosphate group (e.g., phosphorothioate, phosphate, etc.) exists, if present, in salt form (all sodium salts).

[0093] Protector: As used herein, the term "protector" is well known in the art and literature [ Protecting Groups in Organic Synthesis , TW Greene and PGM Wuts, 3 rd [including what is described in detail in edition, John Wiley & Sons, 1999], the entirety of which is incorporated herein by reference. Reference [ Current Protocols in Nucleic Acid Chemistry , edited by Serge L. Beaucage et al.Protecting groups specifically modified for nucleoside and nucleotide chemistry as described in [06 / 2012] (the entirety of Chapter 2 is incorporated herein by reference) are also included. Suitable amino-protecting groups include, but are not limited to, those described herein and / or below: WO 2018 / 022473, WO 2018 / 098264, WO 2018 / 223056, WO 2018 / 223073, WO 2018 / 223081, WO 2018 / 237194, WO 2019 / 032607, WO 2019 / 055951, and / or WO 2019 / 075357 (descriptions of each of these protecting groups are independently incorporated herein by reference).

[0094] Object: As used herein, the term “subject” or “test subject” refers to any organism to which the provided compound (e.g., the provided oligonucleotide) or composition is administered according to the present invention for, for example, experimental, diagnostic, preventive, and / or therapeutic purposes. Typical subjects include animals (e.g., mammals, e.g., mice, rats, rabbits, non-human primates, and humans; insects; worms, etc.) and plants. In some embodiments, the subject is a human. In some embodiments, the subject may have or be susceptible to a disease, disorder, and / or pathological condition.

[0095] In practical terms:As used herein, the term “substantially” refers to a qualitative state indicating the full or nearly full extent or degree of a feature or characteristic of interest. A base sequence that is substantially complementary to the second sequence is not identical to the second sequence, but is mostly identical or nearly identical to the second sequence. Furthermore, a person skilled in the art of biology will understand that biological and chemical phenomena are rarely completed or / or never reach completeness, or achieve or avoid absolute results. Accordingly, the term “substantially” is used herein to capture the potential lack of completeness inherent in many biological and / or chemical phenomena.

[0096] sugar:The term “sugar” refers to a monosaccharide or polysaccharide in a closed and / or open form. In some embodiments, the sugar is a monosaccharide. In some embodiments, the sugar is a polysaccharide. The sugar includes, but is not limited to, ribose, deoxyribose, pentopuranose, pentopyranoose, and hexopyranoose moiety. As used herein, the term “sugar” also includes structural analogs used in place of conventional sugar molecules, such as glycols (polymers thereof form the backbone of nucleic acid analogs), glycol nucleic acids (“GNA”), etc. As used herein, the term “sugar” also includes structural analogs used in place of natural or naturally occurring nucleotides, such as modified sugars and nucleotide sugars. In some embodiments, the sugar is an RNA or DNA sugar (ribose or deoxyribose). In some embodiments, the sugar is a modified ribose or deoxyribose sugar, such as a 2’-modified, 5’-modified, etc. As described herein, in some embodiments, when used in oligonucleotides and / or nucleic acids, the modified sugar may provide one or more desired properties, activities, etc. In some embodiments, the sugar is an optionally substituted ribose or deoxyribose. In some embodiments, "sugar" refers to a sugar unit in an oligonucleotide or nucleic acid.

[0097] Easy to catch: An entity "susceptible" to a disease, disorder, and / or condition is an entity with a higher risk of developing that disease, disorder, and / or condition than members of the general public. In some embodiments, an entity susceptible to a disease, disorder, and / or condition has a predisposition to having that disease, disorder, and / or condition. In some embodiments, an entity susceptible to a disease, disorder, and / or condition may not have been diagnosed with that disease, disorder, and / or condition. In some embodiments, an entity susceptible to a disease, disorder, and / or condition may exhibit symptoms of that disease, disorder, and / or condition. In some embodiments, an entity susceptible to a disease, disorder, and / or condition may not exhibit symptoms of that disease, disorder, and / or condition. In some embodiments, an entity susceptible to a disease, disorder, and / or condition will develop that disease, disorder, and / or condition. In some embodiments, an entity susceptible to a disease, disorder, and / or condition will not develop that disease, disorder, and / or condition.

[0098] remedy:As used herein, the term “therapeutic agent” generally refers to any agent that, when administered to a subject, produces a desired effect (e.g., a desired biological, clinical, or pharmacological effect). In some embodiments, an agent is considered a therapeutic agent if it produces a statistically significant effect over an appropriate population. In some embodiments, an appropriate population is a group of subjects who have or are susceptible to a disease, disorder, or pathology. In some embodiments, an appropriate population is a group of model organisms. In some embodiments, an appropriate population may be determined by one or more criteria such as age group, sex, genetic background, pre-existing clinical condition, or prior exposure to a therapy. In some embodiments, a therapeutic agent is a substance that, when administered to a subject in an effective amount, alleviates, improves, mitigates, suppresses, prevents, delays, reduces, or decreases the severity of one or more symptoms or features of a disease, disorder, and / or pathology in the subject. In some embodiments, the “therapeutic agent” is a drug that has been approved by or is required to be approved by a government agency before it can be sold for human administration. In some embodiments, the “therapeutic agent” is a drug that requires a medical prescription for administration to humans. In some embodiments, the therapeutic agent is the provided compound, e.g., the provided oligonucleotide.

[0099] Therapeutic effective dose:As used herein, the term “therapeutic effective dose” means an amount of a substance (e.g., therapeutic agent, composition, and / or formulation) that induces a desired biological response when administered as part of a therapeutic regimen. In some embodiments, the therapeutic effective dose of a substance is an amount sufficient for the treatment, diagnosis, prevention, and / or delay of onset of a disease, disorder, and / or condition when administered to a subject suffering from or susceptible to such disease, disorder, and / or condition. As understood by those skilled in the art, the effective dose of a substance may vary depending on factors such as the desired biological endpoint, the substance being delivered, the target cell or tissue, etc. For example, the effective dose of a compound in a formulation for treating a disease, disorder, and / or condition is an amount that alleviates, improves, mitigates, suppresses, and / or prevents, delays, reduces, or decreases the severity of one or more symptoms or features of the disease, disorder, and / or condition. In some embodiments, the therapeutic effective dose is administered as a single dose; In some embodiments, multiple unit doses are required to deliver a therapeutically effective amount.

[0100] treat: As used herein, the terms “treat,” “treat,” or “treating” refer to any method used for the partial or complete relief, improvement, alleviation, suppression, prevention, delay of onset, reduction of severity, and / or reduction of occurrence of one or more symptoms or features of a disease, disorder, and / or condition. The therapeutic agent may be administered to subjects who do not exhibit signs of the disease, disorder, and / or condition. In some embodiments, the therapeutic agent may be administered to subjects who exhibit only early signs of the disease, disorder, and / or condition, for example, to reduce the risk of developing a condition associated with the disease, disorder, and / or condition.

[0101] Unsaturated:As used herein, the term "unsaturated" means that the moiety has one or more unsaturated units.

[0102] Wild type: As used herein, the term “wild type” has the meaning understood in the art to refer to an entity having a structure and / or activity found in nature in a “normal” state or context (as opposed to mutation, diseased, altered, etc.). Those skilled in the art will understand that wild-type genes and polypeptides often exist in a number of different forms (e.g., alleles).

[0103] For the purposes of the present invention, chemical elements are referenced in the literature [Periodic Table of the Elements, CAS version, Handbook of Chemistry and Physics This is confirmed according to the [inner cover] of , 67th Ed., 1986-87.

[0104] As understood by those skilled in the art, the methods and compositions described herein in relation to the provided compounds (e.g., oligonucleotides) also apply to pharmaceutically acceptable salts of such compounds.

[0105] Oligonucleotides are useful tools for a wide variety of applications. For example, HTT oligonucleotides are useful in therapeutic, diagnostic, and research applications, including the treatment of various HTT-related conditions, disorders, and diseases, such as Huntington's disease. The use of naturally occurring nucleic acids (e.g., unmodified DNA or RNA) is limited by their sensitivity to, for example, endo- and exo-nucleases. As such, various synthetic counterparts have been developed to avoid these drawbacks and / or to further improve various properties and activities. These counterparts include synthetic oligonucleotides containing chemical modifications, such as base modifications, sugar modifications, backbone modifications, etc., which make these molecules less susceptible to degradation and improve other properties and / or activities. From a structural perspective, modifications to the linkages between nucleotides can introduce chirality, and specific properties can be influenced by the arrangement of atoms that form the linkages of the oligonucleotide. For example, binding affinity, sequence-specific binding to complementary RNA, stability against nucleases, cleavage, delivery, and pharmacokinetic properties of target HTT nucleic acids can be influenced, in particular, by the chirality of backbone linkage atoms. In particular, the present invention provides a technique for controlling and / or utilizing various structural elements in oligonucleotides, e.g., sugar modifications and patterns thereof, nucleobase modifications and patterns thereof, modified internucleotide linkages and patterns thereof, linkage stereochemistry and patterns thereof, additional chemical moiety (moiety not typically present in the oligonucleotide chain) and patterns thereof, and various combinations of one or more or all of these structural elements.

[0106] In some embodiments, the provided oligonucleotide is an oligonucleotide that targets HTT and can reduce the levels of mutant HTT transcripts and / or one or more products encoded by them. Such oligonucleotides are particularly useful for preventing and / or treating HTT-related conditions, disorders, and / or diseases, including Huntington's disease.

[0107] In some embodiments, the HTT oligonucleotide comprises a sequence that is completely identical or substantially identical to, or completely complementary or substantially complementary to, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, typically 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more junction bases of the HTT genome sequence or a transcript derived therefrom (e.g., pre-mRNA, mRNA, etc.). Those skilled in the art will understand that the “HTT oligonucleotide” may have a nucleotide sequence that is identical (or substantially identical) to, or complementary (or substantially complementary) to, the HTT base sequence (e.g., genome sequence, transcript sequence, mRNA sequence, etc.) or a part thereof.

[0108] In some embodiments, the present invention provides, for example, an HTT oligonucleotide as disclosed in the table, or an HTT oligonucleotide having a base sequence comprising 10 or more junction bases of the oligonucleotide disclosed herein.

[0109] In some embodiments, the present invention provides an HTT oligonucleotide having, for example, the base sequence disclosed in the table, or a part thereof (including at least 10 junction bases), wherein the HTT oligonucleotide is stereorandom or not chiral controlled.

[0110] In some embodiments, the internucleotide linkages of the oligonucleotide comprise or consist of 1 to 5, 1 to 10, 1 to 15, 1 to 20, 1 to 25, 1 to 30, 1 to 40, 1 to 50, or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 or more chiral-controlled internucleotide linkages. In some embodiments, the oligonucleotide composition of the present invention comprises oligonucleotides of the same composition, wherein one or more internucleotide linkages are chiral-controlled and one or more internucleotide linkages are stereorandom (not chiral-controlled). In some embodiments, the present invention provides an HTT oligonucleotide composition comprising at least one chiral-controlled internucleotide linkage of the HTT oligonucleotide. In some embodiments, the present invention provides an HTT oligonucleotide composition in which the HTT oligonucleotide is stereorandom or not chiral controlled. In some embodiments, in the HTT oligonucleotide, at least one nucleotide linkage is stereorandom and at least one nucleotide linkage is chiral controlled.

[0111] In some embodiments, the internucleotide linkage of the oligonucleotide comprises or consists of one or more negatively charged internucleotide linkages (e.g., phosphorothioate internucleotide linkages, natural phosphate linkages, etc.). In some embodiments, the internucleotide linkage of the oligonucleotide comprises or consists of one or more negatively charged chiral internucleotide linkages (e.g., phosphorothioate internucleotide linkages). In some embodiments, the internucleotide linkage of the oligonucleotide comprises or consists of one or more non-negatively charged internucleotide linkages. In some embodiments, the internucleotide linkage of the oligonucleotide comprises one or more neutral chiral internucleotide linkages. In some embodiments, the present invention relates to an HTT oligonucleotide comprising at least one neutral or non-negatively charged internucleotide linkage as described in the present invention.

[0112] HTT

[0113] In some embodiments, HTT refers to a gene from any species or a gene product thereof (a nucleic acid comprising, but not limited to, DNA or RNA, or comprising, but not limited to, a wild-type or mutant protein encoded by it) (this may also be known as: HTT, HD, IT15, huntingtin, Huntingtin, or LOMARS; External ID: OMIM: 613004, MGI: 96067, HomoloGene: 1593, GeneCards: HTT; Species: Human: Entrez: 3064; Ensembl: ENSG00000197386; UniProt: P42858; RefSeq(mRNA): NM_002111; RefSeq(protein): NP_002102; Location (UCSC): Chr 4: 3.04 ~ 3.24 Mb; Species: Mouse: Entrez: 15194; Ensembl: ENSMUSG00000029104; UniProt: P42859; RefSeq(mRNA): NM_010414; RefSeq(protein): NP_034544; Location (UCSC): Chr 5: 34.76 ~ 34.91 Mb. Additional HTT sequences (including variants thereof) from humans, mice, rats, monkeys, etc. are readily available to those skilled in the art. In some embodiments, the HTT is a wild-type or mutant human or mouse HTT.

[0114] In some embodiments, the HTT protein is unmodified or modified. In some embodiments, the HTT protein has any one or more of the following modifications: 9 N6-acetylysine; 176 N6-acetylysine; 234 N6-acetylysine; 343 N6-acetylysine; 411 phosphoserine; 417 phosphoserine; 419 phosphoserine; 432 phosphoserine; 442 N6-acetylysine; 640 phosphoserine; 643 phosphoserine; 1179 phosphoserine; 1199 phosphoserine; 1870 phosphoserine; or 1874 phosphoserine.

[0115] Without being bound by any particular theory, the present invention notes that, according to reports, mutations in HTT (e.g., CAG repeat prolongation) are a key factor in diseases and disorders such as Huntington's disease.

[0116] In some embodiments, the mutant HTT is denoted as mHTT, muHTT, m HTT, mu HTT, MU HTT, etc., where m or mu represents the mutant. In some embodiments, the wild-type HTT is denoted as wild-type HTT, wtHTT, wt HTT, WT HTT, WTHTT, etc., where wt represents the wild-type. In some embodiments, the mutant HTT comprises an extended CAG repeat region (e.g., repeats of 36–121, 36–250, 37–121, 40–121, or longer than these). In some embodiments, the mutant HTT comprises a mutant allele of one or more SNPs (an allele on the same DNA strand or chromosome as the extended CAG repeat region). In some embodiments, the mutant HTT comprises both the extended CAG repeat region and the mutant allele of a specific SNP on the same chromosomal strand.

[0117] In some embodiments, human HTT is denoted as hHTT. In some embodiments, mutant HTT is denoted as mHTT. In some embodiments, where a mouse is used, mouse HTT may be referred to as mHTT as understood by those skilled in the art.

[0118] In some embodiments, the HTT oligonucleotide is complementary to a portion of the HTT nucleic acid sequence, e.g., an HTT gene sequence, an HTT mRNA sequence, etc. In some embodiments, the base sequence of such portion is characteristic of HTT in that no other genome or transcript sequence has the same sequence as said portion. In some embodiments, the portion of the gene complementary to the oligonucleotide is referred to as the target sequence of the oligonucleotide.

[0119] In some embodiments, the HTT gene sequence (or part thereof, e.g., complementary to the HTT oligonucleotide) is an HTT gene sequence (or part thereof) known in the art or reported in the literature. Specific nucleotide and amino acid sequences of human HTT can be found in public sources, e.g., one or more publicly available databases, such as GenBank, UniProt, OMEVI, etc. Those skilled in the art will recognize that if the described nucleic acid sequence may be or may include a genome sequence, transcript, splicing product and / or coded protein, etc., such sequence may be readily recognizable from such genome sequence.

[0120] In some embodiments, the HTT gene (or a part thereof having a sequence complementary to the HTT oligonucleotide) contains a single nucleotide polymorphism or SNP. Numerous HTT SNPs have been reported and can be found, for example, in NCBI dbSNP (see, for example, www.ncbi.nlm.nih.gov / snp). Non-limiting examples of SNPs within the HTT gene can be found in NCBI dbSNP Accession, including, for example, those described herein. In some embodiments, the HTT oligonucleotide targets an SNP allele that is on the same (e.g., in phase with) the CAG repeat extension and is not present in the wild-type allele (which does not contain the CAG repeat extension).

[0121] Huntington's disease (HD) is a neurodegenerative disorder reported to be caused by mutations in the HTT (huntingtin) gene. Alterations in this single, widely expressed gene are reported to result in a progressive, neurodegenerative disorder with a large number of characteristic symptoms. In some embodiments, HD-related mutations are extensions of the CAG repeat region in the HTT gene, where, according to reports, greater extensions result in greater severity and an earlier age of onset of the disease. It has been reported that these mutations cause various motor, emotional, and cognitive symptoms and lead to the formation of huntingtin aggregates in the brain.

[0122] It has been reported that CAG elongation results in the elongation of the poly-glutamine tract in the 350 kDa protein huntingtin (Huntington Disease Collaborative Research Group, 1993. Cell. 72:971-83). The sizes of normal and elongated HD alleles have been reported to be, for example, CAG 6–37 and CAG 35–121 repeats or longer, respectively. Longer repeat sequences have been reported to be associated with earlier disease onset. It has been reported that the absence of the HD phenotype in individuals with a deletion of a single copy of huntingtin, or increased disease severity in individuals homozygous for the elongation, suggest that the mutation does not result in loss of function (Trottier et al., 1995, Nature Med., 10:104-110). Transcriptional deregulation and loss of function of transcriptional co-activator proteins have been reported to be associated with the pathogenesis of HD. It has been reported that mutant huntingtin specifically interferes with activator-dependent transcription in the pathogenesis of HD in the early stages (Dunah et al., 2002. Science 296:2238-2243).

[0123] In one report, gene profiling of human blood identified 322 mRNAs exhibiting significantly altered expression in HD blood samples compared to normal or pre-symptomatic individuals. The expression of marker genes was similarly substantially altered in post-mortem brain samples from the HD caudate, suggesting that the upregulation of genes in blood samples reflects disease mechanisms found in the brain. Monitoring of gene expression can provide a sensitive and quantitative method for monitoring disease progression, particularly in the early stages of the disease, in both animal models and human patients (Reference [Borovecki et al., 2005, Proc. Natl. Acad. Sci. USA 102:11023-11028]).

[0124] Huntington's disease is reported to be an autosomal dominant disorder that typically develops in middle age, although cases have been documented from childhood to age over 70. Reportedly, an earlier age of onset is associated with paternal inheritance, with 70% of pediatric cases inherited from the father.

[0125] In some embodiments, the symptoms of Huntington's disease involve emotional, motor, and cognitive components. One symptom, chorea, is a characteristic feature of movement disorders defined as sudden, excessive, and irregularly timed, randomly distributed voluntary movements. This can range from almost imperceptible to severe. Other frequently observed symptoms or abnormalities include dystonia, rigidity, bradykinesia, ocular motor dysfunction, and tremors. Voluntary movement disorders as symptoms include fine motor incoordination, dysarthria, and dysphagia. Affective disorders or symptoms generally include depression and irritability, while cognitive components include subcortical dementia (Mangiarini et al. 1996. Cell 87:493-506). Changes in the HD brain are extensive and include neuronal loss and gliosis (particularly in the cortex and striatum), as has been reported (Vonsattel and DiFiglia. 1998. J. Neuropathol. Exp. Neurol. 57:369-384).

[0126] Specific information regarding HTT and HTT-related pathologies, disorders, or diseases is referenced, for example [Kremer et al. 1994. NEJ Med. 330: 1401]; [Kordasiewicz et al. 2012 Neuron 74: 1031-1044]; [Carroll et al. 2011 Mol. Ther. 19: 2178-2185]; [Warby et al. 2009 Am. J. Hum. Genet. 84: 351-366]; [Pfister et al. 2009 Current Biol. 19: 774-778]; [Kay et al. 2015 Mol. Ther. 23: 1759-1771]; [Kay et al. 2014 Clin. Genet. [86: 29-36]; [Lee et al. 2015. Am. J. Hum. Genet. 97: 435-444]; [Skotte et al. 2014. PLOS ONE 9: e107434]; [Southwell et al. 2014. Mol. Ther. 22: 2093-2106]; Australian Patent Publications AU2017276286 and AU2007210038; European Patent Publications EP3277814 and EP3210633; International Patent Publication WO2018145009; and U.S. Patent Publication Us20180273945.

[0127] In some embodiments, an HTT oligonucleotide capable of reducing the level, activity, and / or expression of the HTT gene is useful for preventing or treating HTT-related pathological conditions, disorders, or diseases, e.g., Huntington's disease, and / or delaying the onset and / or severity of one or more Huntington's disease symptoms.

[0128] In some embodiments, the present invention provides a method for preventing or treating an HTT-related condition, disorder, or disease by administering a therapeutically effective amount of the provided HTT oligonucleotide or a composition thereof to a subject who suffers from or is susceptible to such condition, disorder, or disease. In some embodiments, the composition is a chiral-controlled oligonucleotide composition.

[0129] HTT oligonucleotide

[0130] In particular, the present invention provides oligonucleotides of various designs that may include various nucleobases and patterns thereof, sugars and patterns thereof, internucleotide linkages and patterns thereof, and / or additional chemical moieties and patterns thereof as described in the present invention. In some embodiments, the provided oligonucleotides are HTT oligonucleotides. In some embodiments, the provided HTT oligonucleotides may induce a decrease in the expression, level, and / or activity of the HTT gene and / or one or more of its products (e.g., transcripts, mRNA, proteins, etc.). In some embodiments, the provided HTT oligonucleotides may induce a decrease in the expression, level, and / or activity of the HTT gene and / or one or more of its products in any cell of a subject or patient. In some embodiments, the cell is any cell that normally expresses HTT or produces HTT proteins. In some embodiments, the provided HTT oligonucleotide may induce a reduction in the expression, level and / or activity of an HTT target gene or gene product and has a base sequence consisting of, including, or comprising a portion thereof (e.g., a span of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or more junctional bases), and the oligonucleotide comprises at least one naturally occurring modification of a base, sugar and / or nucleotide linkage.

[0131] In some embodiments, the HTT oligonucleotide comprises one or more carbohydrate moietys. In some embodiments, the HTT oligonucleotide comprises one or more lipid moietys. In some embodiments, the HTT oligonucleotide comprises one or more targeting moietys. Non-limiting examples of such additional chemical moietyes that may be conjugated to the oligonucleotide chain are described herein.

[0132] In some embodiments, the provided oligonucleotide may induce a decrease in the expression, level, and / or activity of a target gene, e.g., an HTT target gene, or its product. In some embodiments, the provided oligonucleotide may induce a decrease in the expression, level, and / or activity of an HTT target gene or its product through RNase H-mediated knockdown. In some embodiments, the provided oligonucleotide may induce a decrease in the expression, level, and / or activity of an HTT target gene or its product by binding to the HTT target gene mRNA and then sterically blocking translation, and / or by altering or interfering with mRNA splicing. However, the present invention is not limited to any specific mechanism. In some embodiments, the present invention provides an oligonucleotide, composition, method, etc., which may operate through double-stranded RNA interference, single-stranded RNA interference, RNase H-mediated knockdown, steric hindrance of translation, or a combination of two or more of these mechanisms.

[0133] In some embodiments, the HTT oligonucleotide is an antisense oligonucleotide (ASO) in that it is an oligonucleotide having a base sequence that is antisense (e.g., complementary) to a target HTT sequence. In some embodiments, the HTT oligonucleotide is a double-stranded siRNA. In some embodiments, the HTT oligonucleotide is a single-stranded siRNA. The provided oligonucleotides and their compositions can be used for many purposes. For example, the provided HTT oligonucleotides may be co-administered or used as part of a therapeutic regimen with one or more agents for Huntington's disease or its symptoms, including but not limited to: aptamers, lncRNAs, lncRNA inhibitors, antibodies, peptides, small molecules, other oligonucleotides for HTT or other targets, and / or other agents capable of inhibiting the expression of HTT transcripts and / or reducing the levels and / or activity of HTT gene products, or inhibiting the expression of genes or reducing the gene products of genes that increase the expression, activity and / or levels of HTT transcripts or HTT gene products, or genes or gene products associated with HTT-related disorders.

[0134] In some embodiments, an oligonucleotide, e.g., HTT oligonucleotide, comprises, in the above embodiments, structural elements or parts thereof described in the table. In some embodiments, an oligonucleotide, e.g., HTT oligonucleotide, comprises a base sequence (or parts thereof), a chemical modification or a pattern of chemical modification (or parts thereof), and / or a format or parts thereof (as described herein). In some embodiments, an oligonucleotide, e.g., HTT oligonucleotide, comprises, in the above embodiments, a base sequence (or parts thereof), a pattern of chemical modification (or parts thereof), and / or a format of an oligonucleotide disclosed in the above embodiments, e.g., in Table 1 or in the drawings, or otherwise disclosed herein. In some embodiments, such oligonucleotides, e.g., HTT oligonucleotides, reduce the expression, level, and / or activity of a gene, e.g., the HTT gene or its gene product.

[0135] In particular, the provided oligonucleotide may hybridize to its target HTT nucleic acid (e.g., free-mRNA, mature mRNA, etc.). For example, in some embodiments, the HTT oligonucleotide may hybridize to an HTT nucleic acid derived from a DNA strand (any strand of the HTT gene). In some embodiments, the HTT oligonucleotide may hybridize to an HTT transcript. In some embodiments, the HTT oligonucleotide may hybridize to an HTT nucleic acid of any step of RNA processing, including but not limited to free-mRNA or mature mRNA. In some embodiments, the HTT oligonucleotide may hybridize to any element of the HTT nucleic acid or its complement, which includes but is not limited to: a promoter region, an enhancer region, a transcription stop region, a translation start signal, a translation stop signal, a coding region, a non-coding region, an exon, an intron, an intron / exon or exon / intron junction, a 5' UTR or a 3' UTR.

[0136] In some embodiments, the oligonucleotide is hybridized to two or more variants of a transcript derived from the sense strand. In some embodiments, the HTT oligonucleotide is hybridized to two or more variants of HTT derived from the sense strand. In some embodiments, the HTT oligonucleotide is hybridized to all variants of HTT derived from the sense strand. In some embodiments, the HTT oligonucleotide is hybridized to two or more variants of HTT derived from the antisense strand. In some embodiments, the HTT oligonucleotide is hybridized to all variants of HTT derived from the antisense strand.

[0137] In some embodiments, the HTT target of the HTT oligonucleotide is HTT RNA rather than mRNA.

[0138] In some embodiments, the HTT oligonucleotide contains an increased level of one or more isotopes. In some embodiments, the provided oligonucleotide is labeled, for example, by one or more isotopes of one or more elements, such as hydrogen, carbon, nitrogen, etc. In some embodiments, the provided oligonucleotide in the provided composition, for example, the oligonucleotide of a plurality of compositions, comprises a base modification, a sugar modification, and / or an internucleotide linkage modification, wherein the oligonucleotide contains an enhanced level of deuterium. In some embodiments, the provided oligonucleotide is labeled with deuterium at one or more positions (- 1 H - 2 (Replaced with H). In some embodiments, one or more of an oligonucleotide chain or any moiety conjugated to the oligonucleotide chain (e.g., targeting moiety, etc.). 1 H is 2 It is substituted with H. Such oligonucleotides can be used in the compositions and methods described herein.

[0139] In some embodiments, the present invention provides an oligonucleotide composition comprising a plurality of oligonucleotides, wherein the plurality of oligonucleotides

[0140] 1) having a common nucleotide sequence that is complementary to a target sequence (e.g., HTT target sequence) in the transcript;

[0141] 2) Includes one or more modification moietyes and / or connections between modification nucleotides.

[0142] In some embodiments, oligonucleotides having a common base sequence, e.g., HTT oligonucleotides, may have the same pattern of nucleoside modifications, e.g., sugar modifications, base modifications, etc. In some embodiments, the pattern of nucleoside modifications may be indicated by a combination of position and modification. In some embodiments, the backbone linkage pattern includes the position and type of linkage between each nucleotide (e.g., phosphate, phosphorothioate, substituted phosphorothioate, etc.).

[0143] In some embodiments, the modified internucleotide linkage has the structure of Formula I. In some embodiments, the modified internucleotide linkage has the structure of Formula Ia. In some embodiments, the internucleotide linkage has the structure of Formula I, Ia, Ib, Ic, In-1, In-2, In-3, In-4, II, II-a-1, II-a-2, II-b-1, II-b-2, II-c-1, II-c-2, II-d-1, or II-d-2, or a salt form thereof.

[0144] In some embodiments, the HTT oligonucleotide comprises one or more internucleotide links, each of which independently has the structure of formula I, Ia, Ib, Ic, In-1, In-2, In-3, In-4, II, II-a-1, II-a-2, II-b-1, II-b-2, II-c-1, II-c-2, II-d-1, or II-d-2.

[0145] In some embodiments, for example, a plurality of oligonucleotides in the provided composition are of the same oligonucleotide type. In some embodiments, oligonucleotides of a given oligonucleotide type have a common sugar modification pattern. In some embodiments, oligonucleotides of a given oligonucleotide type have a common base modification pattern. In some embodiments, oligonucleotides of a given oligonucleotide type have a common nucleoside modification pattern. In some embodiments, oligonucleotides of a given oligonucleotide type have the same composition. In some embodiments, oligonucleotides of a given oligonucleotide type are identical. In some embodiments, a plurality of oligonucleotides are identical. In some embodiments, a plurality of oligonucleotides share the same composition.

[0146] In some embodiments, as illustrated herein, an oligonucleotide, e.g., an HTT oligonucleotide, is chiral-controlled and comprises a linkage between one or more chiral-controlled nucleotides. In some embodiments, the provided oligonucleotide is stereochemically pure. In some embodiments, the provided oligonucleotide is substantially separated from other stereoisomers.

[0147] In some embodiments, the oligonucleotide, e.g., HTT oligonucleotide, comprises one or more modified nucleobases, one or more modified sugars, and / or one or more links between modified nucleotides.

[0148] In some embodiments, the oligonucleotide, e.g., HTT oligonucleotide, comprises one or more modified sugars. In some embodiments, the oligonucleotide of the present invention comprises one or more modified nucleobases. Various modifications may be introduced to the sugars and / or nucleobases according to the present invention. For example, in some embodiments, the modification is a modification described in US 9006198. In some embodiments, the variations are variations described in US 9394333, US 9744183, US 9605019, US 9982257, US 20170037399, US 20180216108, US 20180216107, US 9598458, WO 2017 / 062862, WO 2018 / 067973, WO 2017 / 160741, WO 2017 / 192679, WO 2017 / 210647, or WO 2018 / 098264, each of which a sugar, base, and nucleotide linkage variation is independently incorporated herein by reference.

[0149] As used in the present invention, in some embodiments, one or more is one. In some embodiments, one or more are two. In some embodiments, one or more are three. In some embodiments, one or more are four. In some embodiments, one or more are five. In some embodiments, one or more are six. In some embodiments, one or more are seven. In some embodiments, one or more are eight. In some embodiments, one or more are nine. In some embodiments, one or more are ten. In some embodiments, one or more are at least one. In some embodiments, one or more are at least two. In some embodiments, one or more are at least three. In some embodiments, one or more are at least four. In some embodiments, one or more are at least five. In some embodiments, one or more are at least six. In some embodiments, one or more are at least seven. In some embodiments, one or more are at least 8. In some embodiments, one or more are at least 9. In some embodiments, one or more are at least 10.

[0150] In some embodiments, the HTT oligonucleotide is or includes the HTT oligonucleotide described in the table or figure.

[0151] As demonstrated in the present invention, in some embodiments, the provided oligonucleotide (e.g., HTT oligonucleotide) is characterized by an improvement in the knockdown of its target (e.g., HTT transcript for HTT oligonucleotide, mutant HTT transcript containing an extended CAG repeat, etc.) when it comes into contact with a transcript in a knockdown system compared to that observed under reference conditions (e.g., selected from the group consisting of the absence of a composition, the presence of a reference composition, and combinations thereof). In some embodiments, the knockdown is 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000 times or more It increases.

[0152] In some embodiments, the oligonucleotide is provided in the form of a salt. In some embodiments, the oligonucleotide is provided as a salt comprising negatively charged internucleotide linkages (e.g., phosphorothioate internucleotide linkages, natural phosphate linkages, etc.) present in its salt form. In some embodiments, the oligonucleotide is provided as a pharmaceutically acceptable salt. In some embodiments, the oligonucleotide is provided as a metal salt. In some embodiments, the oligonucleotide is provided as a sodium salt. In some embodiments, the oligonucleotide is provided as a metal salt, e.g., a sodium salt, wherein each negatively charged internucleotide linkage is independently in the form of a salt (e.g., in the sodium salt, -OP(O)(SNa)-O- for phosphorothioate internucleotide linkages, -OP(O)(ONa)-O- for natural phosphate linkages, etc.).

[0153] In some embodiments, the HTT oligonucleotide or HTT oligonucleotide composition is chirally controlled (e.g., stereopurified).

[0154] In some embodiments, the HTT oligonucleotide or the HTT oligonucleotide is stereorandom.

[0155] In some embodiments, the HTT oligonucleotide targets HTT SNPs rs362272, rs362273, rs362273, rs362307, rs362331, or rs363099.

[0156] In some embodiments, the HTT oligonucleotide targets the SNP rs362272 and has a sequence comprising: ACATAGAGGACGCCGTGCAG, AGAGGACGCCGTGCAGGGCT, ATAGAGGACGCCGTGCAGGG, CACATAGAGGACGCCGTGCA, CATAGAGGACGCCGTGCAGG, GCACATAGAGGACGCCGTGC, or TAGAGGACGCCGTGCAGGGC (wherein each T may be independently substituted for U, and vice versa).

[0157] In some embodiments, the HTT oligonucleotide targets the SNP rs362273 and has a sequence comprising: AGCTGCTGCTACAGATCAAC, AGCTGCTGCTGCAGATCAAC, GGTTGATCTGTAGCAGCAGCT, GTTGATCTGTAGCAGCAGCT, GTTGATCTGTAGCAGCAGCT, or TTGATCTGTAGCAGCAGCT (wherein each T may be independently substituted for U, and vice versa).

[0158] In some embodiments, the HTT oligonucleotide targets the SNP rs362273 and has a sequence comprising: GTTGATCTGTAGCAGCAGCT (wherein each T may be independently substituted for U, and vice versa).

[0159] In some embodiments, the HTT oligonucleotide targets the SNP rs362307 and has a sequence comprising: CACAAGGGCACAGACTTCCA, GGCACAAGGGCACAGAC, GGCACAAGGGCACAGACT, GGCACAAGGGCACAGACTT, or GGCACAAGGGCACAGACTTC (wherein each T may be independently substituted with U, and vice versa).

[0160] In some embodiments, the HTT oligonucleotide targets the SNP rs362331 and has a sequence comprising: AGTGCACACAGTAGATGAGG, GTGCACACAGTAGATGAGGG, or TGCACACAGTAGATGAGGGA (wherein each T may be independently substituted for U, and vice versa).

[0161] In some embodiments, the HTT oligonucleotide targets the SNP rs363099 and has a sequence comprising: AAGGCTGAGCGGAGAAACCC, AGGCTGAGCGGAGAAACCCT, CAAGGCTGAGCGGAGAAACC, CTGAGCGGAGAAACCCTCCA, GCTGAGCGGAGAAACCCTCC, GGCTGAGCGGAGAAACCCTC, or TGAGCGGAGAAACCCTCCAA (wherein each T may be independently substituted for U, and vice versa).

[0162] In some embodiments, the HTT oligonucleotide targets the SNP rs362272 and has the following base sequence: ACATAGAGGACGCCGTGCAG, AGAGGACGCCGTGCAGGGCT, ATAGAGGACGCCGTGCAGGG, CACATAGAGGACGCCGTGCA, CATAGAGGACGCCGTGCAGG, GCACATAGAGGACGCCGTGC, or TAGAGGACGCCGTGCAGGGC (wherein each T may be independently substituted for U, and vice versa).

[0163] In some embodiments, the HTT oligonucleotide targets the SNP rs362273 and has the following base sequences: AGCTGCTGCTACAGATCAAC, AGCTGCTGCTGCAGATCAAC, GGTTGATCTGTAGCAGCAGCT, GTTGATCTGTAGCAGCAGCT, GTTGATCTGTAGCAGCAGCT, or TTGATCTGTAGCAGCAGCT (wherein each T may be independently substituted for U, and vice versa).

[0164] In some embodiments, the HTT oligonucleotide targets the SNP rs362273 and has the following sequence: GTTGATCTGTAGCAGCAGCT

[0165] (Here, each T can be independently substituted for U, and vice versa).

[0166] In some embodiments, the HTT oligonucleotide targets the SNP rs362307 and has the following base sequence: CACAAGGGCACAGACTTCCA, GGCACAAGGGCACAGAC, GGCACAAGGGCACAGACT, GGCACAAGGGCACAGACTT, or GGCACAAGGGCACAGACTTC (wherein each T may be independently substituted with U, and vice versa).

[0167] In some embodiments, the HTT oligonucleotide targets the SNP rs362331 and has the following base sequence: AGTGCACACAGTAGATGAGG, GTGCACACAGTAGATGAGGG, or TGCACACAGTAGATGAGGGA (wherein each T may be independently substituted with U, and vice versa).

[0168] In some embodiments, the HTT oligonucleotide targets the SNP rs363099 and has the following base sequences: AAGGCTGAGCGGAGAAACCC, AGGCTGAGCGGAGAAACCCT, CAAGGCTGAGCGGAGAAACC, CTGAGCGGAGAAACCCTCCA, GCTGAGCGGAGAAACCCTCC, GGCTGAGCGGAGAAACCCTC, or TGAGCGGAGAAACCCTCCAA (wherein each T may be independently substituted for U, and vice versa).

[0169] In some embodiments, the HTT oligonucleotide targets the SNP rs362272 and has a sequence comprising at least 15 junction bases including the location of the SNP, as follows: ACATAGAGGACGCCGTGCAG, AGAGGACGCCGTGCAGGGCT, ATAGAGGACGCCGTGCAGGG, CACATAGAGGACGCCGTGCA, CATAGAGGACGCCGTGCAGG, GCACATAGAGGACGCCGTGC, or TAGAGGACGCCGTGCAGGGC (wherein each T may be independently substituted for U, and vice versa).

[0170] In some embodiments, the HTT oligonucleotide targets the SNP rs362273 and has a sequence comprising at least 15 junction bases including the location of the SNP, as follows: AGCTGCTGCTACAGATCAAC, AGCTGCTGCTGCAGATCAAC, GGTTGATCTGTAGCAGCAGCT, GTTGATCTGTAGCAGCAGCT, GTTGATCTGTAGCAGCAGCT, or TTGATCTGTAGCAGCAGCT (wherein each T may be independently substituted for U, and vice versa).

[0171] In some embodiments, the HTT oligonucleotide targets the SNP rs362273 and has a sequence comprising at least 15 junction bases including the location of the SNP, as follows: GTTGATCTGTAGCAGCAGCT (wherein each T may be independently substituted for U, and vice versa).

[0172] In some embodiments, the HTT oligonucleotide targets the SNP rs362307 and has a sequence comprising at least 15 junction bases including the location of the SNP, such as CACAAGGGCACAGACTTCCA, GGCACAAGGGCACAGAC, GGCACAAGGGCACAGACT, GGCACAAGGGCACAGACTT, or GGCACAAGGGCACAGACTTC (wherein each T may be independently substituted with U, and vice versa).

[0173] In some embodiments, the HTT oligonucleotide targets the SNP rs362331 and has a sequence comprising at least 15 junction bases including the location of the SNP, as follows: AGTGCACACAGTAGATGAGG, GTGCACACAGTAGATGAGGG, or TGCACACAGTAGATGAGGGA (wherein each T may be independently substituted for U, and vice versa).

[0174] In some embodiments, the HTT oligonucleotide targets the SNP rs363099 and has a sequence comprising at least 15 junction bases including the location of the SNP, as follows: AAGGCTGAGCGGAGAAACCC, AGGCTGAGCGGAGAAACCCT, CAAGGCTGAGCGGAGAAACC, CTGAGCGGAGAAACCCTCCA, GCTGAGCGGAGAAACCCTCC, GGCTGAGCGGAGAAACCCTC, or TGAGCGGAGAAACCCTCCAA (wherein each T may be independently substituted for U, and vice versa).

[0175] In some embodiments, the HTT oligonucleotide targets the SNP rs362272 and has a sequence comprising at least 10 junction bases including the location of the SNP, as follows: ACATAGAGGACGCCGTGCAG, AGAGGACGCCGTGCAGGGCT, ATAGAGGACGCCGTGCAGGG, CACATAGAGGACGCCGTGCA, CATAGAGGACGCCGTGCAGG, GCACATAGAGGACGCCGTGC, or TAGAGGACGCCGTGCAGGGC (wherein each T may be independently substituted for U, and vice versa).

[0176] In some embodiments, the HTT oligonucleotide targets the SNP rs362273 and has a sequence comprising at least 10 junction bases including the location of the SNP, as follows: AGCTGCTGCTACAGATCAAC, AGCTGCTGCTGCAGATCAAC, GGTTGATCTGTAGCAGCAGCT, GTTGATCTGTAGCAGCAGCT, GTTGATCTGTAGCAGCAGCT, or TTGATCTGTAGCAGCAGCT (wherein each T may be independently substituted for U, and vice versa).

[0177] In some embodiments, the HTT oligonucleotide targets the SNP rs362273 and has a sequence of at least 10 junction bases including the location of the SNP, as follows: GTTGATCTGTAGCAGCAGCT (wherein each T may be independently substituted for U, and vice versa).

[0178] In some embodiments, the HTT oligonucleotide targets the SNP rs362307 and has a sequence comprising at least 10 junction bases including the location of the SNP, such as: CACAAGGGCACAGACTTCCA, GGCACAAGGGCACAGAC, GGCACAAGGGCACAGACT, GGCACAAGGGCACAGACTT, or GGCACAAGGGCACAGACTTC (wherein each T may be independently substituted for U, and vice versa).

[0179] In some embodiments, the HTT oligonucleotide targets the SNP rs362331 and has a sequence comprising at least 10 junction bases including the location of the SNP, as follows: AGTGCACACAGTAGATGAGG, GTGCACACAGTAGATGAGGG, or TGCACACAGTAGATGAGGGA (wherein each T may be independently substituted for U, and vice versa).

[0180] In some embodiments, the HTT oligonucleotide targets the SNP rs363099 and has a sequence comprising at least 10 junction bases including the location of the SNP, as follows: AAGGCTGAGCGGAGAAACCC, AGGCTGAGCGGAGAAACCCT, CAAGGCTGAGCGGAGAAACC, CTGAGCGGAGAAACCCTCCA, GCTGAGCGGAGAAACCCTCC, GGCTGAGCGGAGAAACCCTC, or TGAGCGGAGAAACCCTCCAA (wherein each T may be independently substituted for U, and vice versa).

[0181] In some embodiments, the HTT oligonucleotide does not target an SNP, wherein each U can be independently substituted with T and vice versa.

[0182] In some embodiments, the HTT oligonucleotide is pan-specific and does not target SNPs, wherein each U can be independently substituted with T and vice versa.

[0183] In some embodiments, the HTT oligonucleotide is pan-specific and does not target SNPs, and has a sequence comprising, or comprising, or comprising at least 15 junctional bases of, or at least 10 junctional bases of: ACCGCCATCCCCGCCGTAGC, CCGCCATCCCCGCCGTAGCC, CGCCATCCCCGCCGTAGCCT, CTCAGTAACATTGACACCAC, GCCATCCCCGCCGTAGCCTG, GGCTCTGGGTTGCTGGGTCA, GGTGTCCCTCATGGGCTCTG, or GTTACCGCCATCCCCGCCGT (wherein each U may be independently substituted for T, and vice versa).

[0184] In some embodiments, the HTT oligonucleotide has a base sequence comprising the following sequences: ACCGCCATCCCCGCCGTAGC, CCGCCATCCCCGCCGTAGCC, CGCCATCCCCGCCGTAGCCT, CTCAGTAACATTGACACCAC, GCCATCCCCGCCGTAGCCTG, GGCTCTGGGTTGCTGGGTCA, GGTGTCCCTCATGGGCTCTG, or GTTACCGCCATCCCCGCCGT (wherein each U may be independently substituted with T, and vice versa).

[0185] In some embodiments, the HTT oligonucleotide has a base sequence that is as follows: ACCGCCATCCCCGCCGTAGC, CCGCCATCCCCGCCGTAGCC, CGCCATCCCCGCCGTAGCCT, CTCAGTAACATTGACACCAC, GCCATCCCCGCCGTAGCCTG, GGCTCTGGGTTGCTGGGTCA, GGTGTCCCTCATGGGCTCTG, or GTTACCGCCATCCCCGCCGT (wherein each U may be independently substituted with T, and vice versa).

[0186] In some embodiments, the HTT oligonucleotide has a base sequence comprising at least 15 junction bases of the following sequence: ACCGCCATCCCCGCCGTAGC, CCGCCATCCCCGCCGTAGCC, CGCCATCCCCGCCGTAGCCT, CTCAGTAACATTGACACCAC, GCCATCCCCGCCGTAGCCTG, GGCTCTGGGTTGCTGGGTCA, GGTGTCCCTCATGGGCTCTG, or GTTACCGCCATCCCCGCCGT (wherein each U may be independently substituted with T, and vice versa).

[0187] In some embodiments, the HTT oligonucleotide has a base sequence comprising at least 10 junction bases of the following sequence: ACCGCCATCCCCGCCGTAGC, CCGCCATCCCCGCCGTAGCC, CGCCATCCCCGCCGTAGCCT, CTCAGTAACATTGACACCAC, GCCATCCCCGCCGTAGCCTG, GGCTCTGGGTTGCTGGGTCA, GGTGTCCCTCATGGGCTCTG, or GTTACCGCCATCCCCGCCGT (wherein each U may be independently substituted with T, and vice versa).

[0188] In some embodiments, the HTT oligonucleotide is any of the HTT oligonucleotides disclosed herein, or a salt thereof.

[0189] In some embodiments, the HTT oligonucleotide is any of the following: WV-10786, WV-10787, WV-10790, WV-10791, WV-10806, WV-10810, WV-10811, WV-12282, WV-12283, WV-12284, WV-14914, WV-15078, WV-15080, WV-17782, WV-19824, WV-19825, WV-19840, WV-19841, WV-21178, WV-21179, WV-21180, WV-21181, WV-21267, WV-21271, WV-21274, WV-21403, WV-21404, WV-21405, WV-21406, WV-21409, WV-21410, WV-21412, WV-21447, WV-21448, WV-23689, WV-23690, WV-23691, WV-23692, WV-28152, WV-28153, WV-28154, WV-28155, WV-28156, WV-28157, WV-28158, WV-28159, WV-28160, WV-28161, WV-28162, WV-28163, WV-28164, WV-28165, WV-28166, WV-28167, WV-28168, or WV-9679, or a salt thereof (wherein each U can be independently substituted for T, and vice versa).

[0190] In some embodiments, the HTT oligonucleotide is any stereopurity (chiral control) HTT oligonucleotide comprising any of the following base sequences: WV-10786, WV-10787, WV-10790, WV-10791, WV-10806, WV-10810, WV-10811, WV-12282, WV-12283, WV-12284, WV-14914, WV-15078, WV-15080, WV-17782, WV-19824, WV-19825, WV-19840, WV-19841, WV-21178, WV-21179, WV-21180, WV-21181, WV-21267, WV-21271, WV-21274, WV-21403, WV-21404, WV-21405, WV-21406, WV-21409, WV-21410, WV-21412, WV-21447, WV-21448, WV-23689, WV-23690, WV-23691, WV-23692, WV-28152, WV-28153, WV-28154, WV-28155, WV-28156, WV-28157, WV-28158, WV-28159, WV-28160, WV-28161, WV-28162, WV-28163, WV-28164, WV-28165, WV-28166, WV-28167, WV-28168, or WV-9679, or a salt thereof (wherein each U can be independently substituted for T, and vice versa).

[0191] In some embodiments, the HTT oligonucleotide is any stereopurity (chiral control) HTT oligonucleotide having any of the following base sequences: WV-10786, WV-10787, WV-10790, WV-10791, WV-10806, WV-10810, WV-10811, WV-12282, WV-12283, WV-12284, WV-14914, WV-15078, WV-15080, WV-17782, WV-19824, WV-19825, WV-19840, WV-19841, WV-21178, WV-21179, WV-21180, WV-21181, WV-21267, WV-21271, WV-21274, WV-21403, WV-21404, WV-21405, WV-21406, WV-21409, WV-21410, WV-21412, WV-21447, WV-21448, WV-23689, WV-23690, WV-23691, WV-23692, WV-28152, WV-28153, WV-28154, WV-28155, WV-28156, WV-28157, WV-28158, WV-28159, WV-28160, WV-28161, WV-28162, WV-28163, WV-28164, WV-28165, WV-28166, WV-28167, WV-28168, or WV-9679, or a salt thereof (wherein each U can be independently substituted for T, and vice versa).

[0192] In some embodiments, the HTT oligonucleotide is any stereopurity (chiral control) HTT oligonucleotide having a base sequence comprising at least 15 junction bases of any of the following base sequences: WV-10786, WV-10787, WV-10790, WV-10791, WV-10806, WV-10810, WV-10811, WV-12282, WV-12283, WV-12284, WV-14914, WV-15078, WV-15080, WV-17782, WV-19824, WV-19825, WV-19840, WV-19841, WV-21178, WV-21179, WV-21180, WV-21181, WV-21267, WV-21271, WV-21274, WV-21403, WV-21404, WV-21405, WV-21406, WV-21409, WV-21410, WV-21412, WV-21447, WV-21448, WV-23689, WV-23690, WV-23691, WV-23692, WV-28152, WV-28153, WV-28154, WV-28155, WV-28156, WV-28157, WV-28158, WV-28159, WV-28160, WV-28161, WV-28162, WV-28163, WV-28164, WV-28165, WV-28166, WV-28167, WV-28168, or WV-9679, or a salt thereof (wherein each U can be independently substituted for T, and vice versa).

[0193] In some embodiments, the HTT oligonucleotide is any stereopurity (chiral control) HTT oligonucleotide or HTT oligonucleotide having a base sequence comprising at least 10 junction bases of any of the following base sequences: WV-10786, WV-10787, WV-10790, WV-10791, WV-10806, WV-10810, WV-10811, WV-12282, WV-12283, WV-12284, WV-14914, WV-15078, WV-15080, WV-17782, WV-19824, WV-19825, WV-19840, WV-19841, WV-21178, WV-21179, WV-21180, WV-21181, WV-21267, WV-21271, WV-21274, WV-21403, WV-21404, WV-21405, WV-21406, WV-21409, WV-21410, WV-21412, WV-21447, WV-21448, WV-23689, WV-23690, WV-23691, WV-23692, WV-28152, WV-28153, WV-28154, WV-28155, WV-28156, WV-28157, WV-28158, WV-28159, WV-28160, WV-28161, WV-28162, WV-28163, WV-28164, WV-28165, WV-28166, WV-28167, WV-28168, or WV-9679, or a salt thereof (wherein each U can be independently substituted for T, and vice versa).

[0194] In some embodiments, the present invention relates to a composition comprising an HTT oligonucleotide and a pharmaceutical carrier.

[0195] In some embodiments, the present invention relates to a method of using HTT oligonucleotide in the treatment and / or prevention of Huntington's disease.

[0196] In some embodiments, the present invention relates to a method of using HTT oligonucleotide to treat, / or prevent, or delay the onset of, or reduce the severity of, at least one symptom of Huntington's disease.

[0197] In some embodiments, the present invention relates to a method for manufacturing a medicine comprising an HTT oligonucleotide.

[0198] In some embodiments, the HTT oligonucleotide is any individual HTT oligonucleotide or HTT oligonucleotide genus described herein.

[0199] base sequence

[0200] In some embodiments, an oligonucleotide, e.g., an HTT oligonucleotide comprises the base sequence described herein or a portion thereof (e.g., 5 to 50, 5 to 40, 5 to 30, 5 to 20, or 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or at least 10, or at least 15 spans of junctional nucleotides) (having a mismatch of 0 to 5 (e.g., 0, 1, 2, 3, 4, or 5). In some embodiments, the oligonucleotide, e.g., HTT oligonucleotide, comprises the base sequence described herein or part thereof, wherein part is a span of at least 15 junctional nucleotides or a span of at least 15 junctional nucleotides (having 1 to 5 mismatches). In some embodiments, the provided oligonucleotide comprises the base sequence described herein or part thereof, wherein part is a span of at least 10 junctional nucleotides or a span of at least 10 junctional nucleotides having 1 to 5 mismatches. In some embodiments, the base sequence of the oligonucleotide is 10 to 50 base sequences (e.g., approximately or at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45) that are identical to or complementary to the base sequence of the HTT gene or its transcript (e.g., mRNA); in some embodiments, at least 15; in some embodiments, at least 16; in some embodiments, at least 17; in some embodiments, at least 18; in some embodiments, at least 19; in some embodiments, at least 20; in some embodiments, at least 21; in some embodiments, at least 22; in some embodiments, at least 23; in some embodiments, at It comprises or consists of 24 (in some embodiments, at least 25) concatenated bases.

[0201] As understood by those skilled in the art, the base sequence of the provided oligonucleotide typically has a length sufficient to mediate target-specific knockdown and is complementary to its target, e.g., RNA transcripts (e.g., free-mRNA, mature mRNA, etc.). In some embodiments, the base sequence of the HTT oligonucleotide has a length sufficient to mediate target-specific knockdown and is identical to the HTT transcript target. In some embodiments, the HTT oligonucleotide is complementary to a portion of the HTT transcript (HTT transcript target sequence). In some embodiments, the base sequence of the HTT oligonucleotide has 90% or more identity with the base sequence of the oligonucleotide disclosed in the table. In some embodiments, the base sequence of the HTT oligonucleotide has 95% or more identity with the base sequence of the oligonucleotide disclosed in the table. In some embodiments, the base sequence of the HTT oligonucleotide comprises a continuous span of 15 or more bases of the oligonucleotide disclosed in the table (except where one or more bases within the span are non-basic (e.g., a nucleobase is absent in the nucleotide)). In some embodiments, the base sequence of the HTT oligonucleotide comprises a continuous span of 19 or more bases of the HTT oligonucleotide disclosed herein (except where one or more bases within the span are non-basic (e.g., a nucleobase is absent in the nucleotide)). In some embodiments, the base sequence of the HTT oligonucleotide comprises a continuous span of 19 or more bases of the oligonucleotide disclosed herein, except for a difference of one or two bases at the 5' end and / or 3' end of the base sequence.

[0202] In some embodiments, the base sequence of the oligonucleotide is TCTCCATTCT ATCTTATGTT, or includes the same, or includes 10 to 20 of the same, e.g., 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 concatenated bases, wherein each T can be independently replaced with U.

[0203] In some embodiments, the base sequence of the oligonucleotide is GTTGATCTGTAGTAGCAGCT or GTTGATCTGTAGCAGCAGCT, or comprises the same, or comprises 10 to 20, e.g., 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 concatenated bases, wherein each T can be independently replaced with U.

[0204] In some embodiments, the base sequence of the oligonucleotide is GTGCACACAG TAGATGAGGG, or includes the same, or includes 10 to 20 of the same, e.g., 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 concatenated bases, wherein each T can be independently replaced with U.

[0205] In some embodiments, the base sequence of the oligonucleotide is GTGCAACACA GTAGATGAGGG, or includes the same, or includes 10 to 20 of the same, e.g., 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 concatenated bases, wherein each T can be independently replaced with U.

[0206] In some embodiments, the base sequence of the oligonucleotide is GGCACAAGGG CACAGACTTC, or includes the same, or includes 10 to 20 of the same, e.g., 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 concatenated bases, wherein each T can be independently replaced with U.

[0207] In some embodiments, the base sequence of the oligonucleotide is GGCACAAAGG GCACAGACTTC, or includes the same, or includes 10 to 20 of the same, e.g., 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 concatenated bases, wherein each T can be independently replaced with U.

[0208] In some embodiments, the base sequence of the oligonucleotide is CAAGGGCACA GACTTC, or includes the same, or includes 10 to 20 of the same, e.g., 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 concatenated bases, wherein each T can be independently replaced with U.

[0209] In some embodiments, the base sequence of the oligonucleotide is AAGGGCACAG ACTTC, or includes the same, or includes 10 to 20, e.g., 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 concatenated bases, wherein each T can be independently replaced with U.

[0210] In some embodiments, the base sequence of the HTT oligonucleotide is complementary to the base sequence of the HTT transcript or a part thereof.

[0211] In some embodiments, the HTT target gene is an allele of the HTT gene. In some embodiments, the HTT oligonucleotide is allele-specific and is designed to target a specific allele of HTT (e.g., an allele associated with an HTT-related condition, disorder, or disease). In some embodiments, the base sequence of the oligonucleotide is fully complementary to the sequence of the HTT transcript (or part thereof) from the allele associated with the condition, disorder, or disease, and is not fully complementary to the sequence of the HTT transcript (or part thereof) that is less or unrelated to the condition, disorder, or disease. In some embodiments, the disorder-related allele of HTT contains an SNP, a mutation, or other sequence variation, and the HTT oligonucleotide is designed to be complementary to this sequence. In some embodiments, the base sequence of the oligonucleotide is complementary to one allele of the SNP and is not complementary to the other. In some embodiments, the base sequence of the oligonucleotide is complementary to one allele of the SNP, and this allele lies on the same DNA strand as the extended CAG repeat. In some embodiments, the base sequence of the oligonucleotide is fully complementary to the sequence of the HTT transcript (or part thereof) from the allele containing the extended CAG repeat, but is not fully complementary to the sequence of the HTT transcript (or part thereof) from the allele containing the normal CAG repeat. In some embodiments, the HTT oligonucleotide is pan-specific and is designed to target all alleles of HTT (e.g., all or most known alleles of HTT contain the same sequence or a sequence complementary thereto within the span of bases recognized by the HTT oligonucleotide). In some embodiments, the oligonucleotide reduces the expression, level, and / or activity of wild-type HTT and mutant HTT, and / or their transcripts and / or products.

[0212] In some embodiments, the HTT oligonucleotide comprises the base sequence or part thereof described in the table, the sugar, nucleobase, and / or internucleotide linkage modifications described herein, and / or additional chemical moiety described herein (in addition to the oligonucleotide chain, e.g., target moiety, lipid moiety, carbohydrate moiety, etc.).

[0213] In some embodiments, the terms “complementary,” “fully complementary,” and “substantially complementary” may be used in relation to base matching between an oligonucleotide (e.g., an HTT oligonucleotide) and a target sequence (e.g., an HTT target sequence) as understood by those skilled in the art in the context of their use. As a non-limiting example, if the target sequence has the base sequence 5’-GCAUAGCGAGCGAGGGAAAAC-3’, an oligonucleotide having the base sequence 5’GUUUUCCCUCGCUCGCUAUGC-3’ is complementary (fully complementary) to this target sequence. It is noted that substituting U with T or vice versa generally does not change the amount of complementarity. As used herein, an oligonucleotide that is “substantially complementary” to a target sequence is largely or mostly complementary but not 100% complementary. In some embodiments, a substantially complementary sequence (e.g., HTT oligonucleotide) has one, two, three, four, or five mismatches when aligned with its target sequence. In some embodiments, the HTT oligonucleotide has a base sequence that is substantially complementary to the HTT target sequence. In some embodiments, the HTT oligonucleotide has a base sequence that is substantially complementary to the complement of the HTT oligonucleotide sequence disclosed herein. As understood by those skilled in the art, in some embodiments, the sequence of the oligonucleotide does not need to be 100% complementary to its target for the oligonucleotide to perform its function (e.g., knockdown of the target HTT nucleic acid). In some embodiments, homology, sequence identity, or complementarity is 60% to 100%, e.g., approximately or at least 60%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, or 100%.In some embodiments, the provided oligonucleotide has a sequence complementarity of 75% to 100% (e.g., approximately or at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, or 100%) with respect to a target region (e.g., target sequence) within its target HTT nucleic acid. In some embodiments, the percentage is approximately 80% or more. In some embodiments, the percentage is approximately 85% or more. In some embodiments, the percentage is approximately 90% or more. In some embodiments, the percentage is approximately 95% or more. For example, the provided oligonucleotide having a length of 20 nucleotides will have 90% complementarity if 18 of the 20 nucleotides are complementary. Typically, when determining complementarity, A and T (or U) are complementary nucleotides, and C and G are complementary nucleotides.

[0214] In some embodiments, the present invention provides an HTT oligonucleotide comprising a sequence found in the oligonucleotides described in the table. In some embodiments, the present invention provides an HTT oligonucleotide comprising a sequence found in the oligonucleotides described in the table, wherein one or more Us are independently and optionally replaced with T, and vice versa. In some embodiments, the HTT oligonucleotide may comprise at least one T and / or at least one U. In some embodiments, the present invention provides an HTT oligonucleotide comprising a sequence found in the oligonucleotides described in the table, wherein the identity with the sequence of the oligonucleotide described in the table is greater than 50%. In some embodiments, the present invention provides an HTT oligonucleotide comprising a sequence of the oligonucleotide disclosed in the table. In some embodiments, the present invention provides an HTT oligonucleotide in which the base sequence is the sequence of the oligonucleotide disclosed in the table. In some embodiments, the present invention provides an HTT oligonucleotide comprising a sequence found in the oligonucleotides of the table, wherein the oligonucleotide has a backbone linkage pattern, a backbone chiral center pattern, and / or a backbone variant pattern of the said oligonucleotide or another oligonucleotide in the table thereof.

[0215] In particular, the present invention presents various oligonucleotides in Table 1 and elsewhere, each having a defined base sequence. In some embodiments, the present invention provides an oligonucleotide having a base sequence that comprises, or part thereof, the base sequence of an oligonucleotide disclosed herein, for example, in the table, for example in Table 1 of the present invention. In some embodiments, the present invention provides an oligonucleotide having a base sequence that is, or comprises, or part thereof, the base sequence of an oligonucleotide disclosed herein, for example in the table, wherein the oligonucleotide further comprises the chemical modification, stereochemistry, format, additional chemical moiety (e.g., targeting moiety, lipid moiety, carbohydrate moiety, etc.), and / or other structural features described herein.

[0216] In some embodiments, "part" (e.g., part of a base sequence or a modified pattern) has a length of at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 monomer units (e.g., in the case of a base sequence, a length of at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 bases). In some embodiments, "part" of the base sequence has a length of at least 5 bases. In some embodiments, "part" of the base sequence has a length of at least 10 bases. In some embodiments, "part" of the base sequence has a length of at least 15 bases. In some embodiments, "part" of the base sequence has a length of at least 20 bases. In some embodiments, part of the base sequence consists of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or more junctional bases (continuous bases). In some embodiments, part of the base sequence consists of 15 or more junctional bases (continuous bases).

[0217] In some embodiments, the present invention provides an oligonucleotide (e.g., HTT oligonucleotide) whose base sequence is the base sequence of the oligonucleotide in the table or a part thereof. In some embodiments, the present invention provides an HTT oligonucleotide of the sequence of the oligonucleotide in the table, wherein the oligonucleotide may induce a decrease in the expression, level, and / or activity of the HTT gene or its gene product. As understood by those skilled in the art, in the provided base sequence, each U may be optionally and independently replaced with T, and vice versa, and the sequence may contain a combination of U and T. In some embodiments, C may be optionally and independently replaced with 5mC.

[0218] In some embodiments, some are spans of at least 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 total nucleotides. In some embodiments, some are spans of at least 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 total nucleotides having 0 to 3 mismatches. In some embodiments, some are spans of at least 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 total nucleotides having 0 to 3 mismatches, wherein the span having 0 mismatches is complementarity and the span having 1 or more mismatches is a non-limiting example of substantial complementarity. In some embodiments, the base comprises a characteristic portion of a nucleic acid (e.g., a gene), such that said portion is identical or complementary to said nucleic acid or a portion of its transcript, and is not identical or complementary to any other nucleic acid (e.g., a gene) or a portion of its transcript in the same genome. In some embodiments, said portion is characteristic of human HTT. In some embodiments, said portion is characteristic of human mHTT.

[0219] In some embodiments, the HTT oligonucleotide has a total nucleotide length of about 49, 45, 40, 30, 35, 25, or 23 or fewer as described herein. In some embodiments where the sequence cited herein begins with U or T at the 5'-terminus, U may be deleted and / or replaced with another base. In some embodiments, the oligonucleotide has a base sequence of the oligonucleotide in the table having the format or part of the format disclosed herein, or a base sequence comprising or part thereof.

[0220] In some embodiments, the oligonucleotide, e.g., HTT oligonucleotide, is stereorandom. In some embodiments, the oligonucleotide, e.g., HTT oligonucleotide, is chiral controlled.

[0221] In some embodiments, the oligonucleotide, e.g., HTT oligonucleotide, is chiral pure (or "stereo-pure," "stereochemically pure"), wherein the oligonucleotide exists in a monostereoisomer form (in many cases, because multiple chiral centers may be present in the oligonucleotide, e.g., linking nucleotides, sugar carbons, etc., in a monodiastereoisomer (or "diastereoisomer") form). As understood by those skilled in the art, the chiral pure oligonucleotide is separated from its other stereoisomer forms (to the extent that some impurities may be present, as chemical and biological processes, selectivity and / or purification, etc., are rarely absolutely complete). In the chiral pure oligonucleotide, each chiral center is defined independently of its arrangement (e.g., linkage between chiral nucleotides, R p or S pThe chiral linkage in is stereodefined or chiral controlled (these internucleotide linkages are stereodefined internucleotide linkages or chiral controlled internucleotide linkages). In contrast to chiral controlled and chiral pure oligonucleotides containing stereodefined linkages, racemic (or "stereorandom", "chiral uncontrolled") oligonucleotides containing chiral linkages (e.g., from the synthesis of traditional phosphoramidite oligonucleotides without stereochemical control during the coupling step combined with traditional sulfation; generating stereorandom phosphorothioate internucleotide linkages) refer to a random mixture of various stereoisomers (typically diastereomers (or "diastereomers") because there are multiple chiral centers in the oligonucleotide). For example, in the case of A*A*A (where * is a link between phosphorothioate nucleotides (which includes a chiral linking phosphate)), the racemioligonucleotide formulation contains the following four diastereomers[2 2 = 4, considering the two chiral connected factors above, each of them is two arrays ( S p or R p) may exist as one of the following: A *SA *SA, A *SA *RA, A *RA *SA, and A *RA *RA(where, *S is S p represents the linkage between phosphorothioate nucleotides, and *R is R p represents the linkage between phosphorothioate nucleotides). In the case of a chiral pure oligonucleotide, e.g., A *SA *SA, it exists in a monostereomeric form, which is separated from other stereoisomers (e.g., diastereomers A *SA *RA, A *RA *SA, and A *RA *RA). In some embodiments, R p Phosphorothioate is represented as *S or *S. In some embodiments, R p Phosphorothioate is represented as *R or *R.

[0222] In some embodiments, an oligonucleotide, e.g., an HTT oligonucleotide, is a linkage between 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more stereorandom nucleotides (in the linkage between nucleotides R p and S It comprises a combination of p-linking factors (e.g., from traditional chiral uncontrolled oligonucleotide synthesis). In some embodiments, the oligonucleotide, e.g., HTT oligonucleotide, comprises one or more (e.g., 1–50, 1–40, 1–30, 1–25, 1–20, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more) chiral controlled nucleotide linkages (in the nucleotide linkages). R p or S It includes a p-link (e.g., from chiral-controlled oligonucleotide synthesis). In some embodiments, the nucleotide linkage is a phosphorothioate nucleotide linkage. In some embodiments, the nucleotide linkage is a stereorandom phosphorothioate nucleotide linkage. In some embodiments, the nucleotide linkage is a chiral-controlled phosphorothioate nucleotide linkage.

[0223] In particular, the present invention provides a technology for producing chiral-controlled (stereochemically pure in some embodiments) oligonucleotides. In some embodiments, the oligonucleotides are stereochemically pure. In some embodiments, the oligonucleotide of the present invention has a purity of about 5% to 100%, 10% to 100%, 20% to 100%, 30% to 100%, 40% to 100%, 50% to 100%, 60% to 100%, 70% to 100%, 80% to 100%, 90% to 100%, 95% to 100%, 50% to 90%, or about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%, or at least about 5%, 10%, It is 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99%. In some embodiments, the internucleotide linkages of the oligonucleotide comprise or consist of one or more (e.g., 1 to 50, 1 to 40, 1 to 30, 1 to 25, 1 to 20, 5 to 50, 5 to 40, 5 to 30, 5 to 25, 5 to 20, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more) internucleotide linkages, each of which independently comprises at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, It has a distereochemical purity of 98%, 99%, or 99.5%, typically at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5%. In some embodiments, the oligonucleotide of the present invention, e.g., HTT oligonucleotide, (DS) CILIt has a diastereometric purity, wherein DS is a diastereometric purity as described in the present invention (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5% or more), and CIL is the number of linkages between chiral control nucleotides (e.g., 1–50, 1–40, 1–30, 1–25, 1–20, 5–50, 5–40, 5–30, 5–25, 5–20, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, (23, 24, 25 or more). In some embodiments, DS is 95% to 100%. In some embodiments, each linkage between nucleotides is independently chiral controlled, and CIL is the number of chiral-controlled linkages between nucleotides.

[0224] Various HTT oligonucleotides are described and / or mentioned herein.

[0225] ONT-450, ONT-451, ONT-452, ONT-453, ONT-454, WV-902, WV-903, WV-904, WV-905, WV-906, WV-907, WV-908, WV-909, WV-910, WV-911, WV-912, WV-913, WV-914, WV-915, WV-916, WV-917, WV-918, WV-919, WV-920, WV-921, WV-922, WV-923, WV-924, WV-925, WV-926, WV-927, WV-928, WV-929, WV-930, WV-931 WV-932, WV-933, WV-934, WV-935, WV-936, WV-937, WV-938, WV-939, WV-940, WV-941, WV-944, WV-945, WV-948, WV-949, WV-950, WV-951, WV-952, WV-953, WV-954, WV-955, WV-956, WV-957, WV-958, WV-959, WV-960, WV-961, WV-962, WV-963, WV-964, WV-965, WV-973, WV-974, WV-975, WV-982, WV-983 WV-984, WV-985, WV-986, WV-987, WV-1001, WV-1002, WV-1003, WV-1004, WV-1005, WV-1006, WV-1007, WV-1008, WV-1009, WV-1010, WV-1011, WV-1012, WV-1013, WV-1014, WV-1015, WV-1016, WV-1017, WV-1018, WV-1019, WV-1020, WV-1021, WV-1022, WV-1023, WV-1024, WV-1025, WV-1026, WV-1027 WV-1028, WV-1029, WV-1030, WV-1031, WV-1032, WV-1033, WV-1034, WV-1035, WV-1036, WV-1037, WV-1038, WV-1039, WV-1040, WV-1041, WV-1042, WV-1043, WV-1044, WV-1045,WV-1046, WV-1047, WV-1048, WV-1049, WV-1050, WV-1051, WV-1052, WV-1053, WV-1054, WV-1055, WV-1056, WV-1057, WV-1058, WV-1059, WV-1060, WV-1061, WV-1062, WV-1063, WV-1064, WV-1065, WV-1066, WV-1067, WV-1068, WV-1069, WV-1070, WV-1071, WV-1072, WV-1073, WV-1074, WV-1075 WV-1076, WV-1077, WV-1078, WV-1079, WV-1080, WV-1081, WV-1082, WV-1083, WV-1084, WV-1085, WV-1086, WV-1087, WV-1088, WV-1089, WV-1090, WV-1091, WV-1092, WV-1234, WV-1235, WV-1497, WV-1508, WV-1509, WV-1510, WV-1511, WV-1654, WV-1655, WV-1788, WV-1789, WV-1790, WV-1799 WV-2022, WV-2023, WV-2024, WV-2025, WV-2026, WV-2027, WV-2028, WV-2029, WV-2030, WV-2031, WV-2032, WV-2033, WV-2034, WV-2035, WV-2036, WV-2037, WV-2038, WV-2039, WV-2040, WV-2041, WV-2042, WV-2043, WV-2044, WV-2045, WV-2046, WV-2047, WV-2048, WV-2049, WV-2050, WV-2051 WV-2052, WV-2053, WV-2054, WV-2055, WV-2056, WV-2057, WV-2058, WV-2059, WV-2060, WV-2061, WV-2062, WV-2063, WV-2064, WV-2065, WV-2066, WV-2067, WV-2068, WV-2069, WV-2070, WV-2071, WV-2072,WV-2073, WV-2074, WV-2075, WV-2076, WV-2077, WV-2078, WV-2079, WV-2080, WV-2081, WV-2082, WV-2083, WV-2084, WV-2085, WV-2086, WV-2087, WV-2088, WV-2089, WV-2090, WV-2163, WV-2164, WV-2269, WV-2270, WV-2271, WV-2272, WV-2374, WV-2375, WV-2376, WV-2377, WV-2378, WV-2379, WV-2380, WV-2416, WV-2417, WV-2418, WV-2419, WV-2431, WV-2589, WV-2590, WV-2591, WV-2592, WV-2593, WV-2594, WV-2595, WV-2596, WV-2597, WV-2598, WV-2599, WV-2600, WV-2601, WV-2602, WV-2603, WV-2604, WV-2605, WV-2606, WV-2607, WV-2608, WV-2609, WV-2610, WV-2611, WV-2612, WV-2613, WV-2614, WV-2615, WV-2616, WV-2617, WV-2618, WV-2619, WV-2620, WV-2623, WV-2638, WV-2639, WV-2640, WV-2641, WV-2642, WV-2643, WV-2659, WV-2671, WV-2672, WV-2673, WV-2674, WV-2675, WV-2676, WV-2682, WV-2683, WV-2684, WV-2685, WV-2686, WV-2687, WV-2688, WV-2689, The base sequences and structures of various HTT oligonucleotides, including but not limited to WV-2690, WV-2691, WV-2692, and WV-2732, are described in WO 2017 / 015555 and WO 2017 / 192664, andDisclosures relating to these oligonucleotides are incorporated by reference. Additional HTT oligonucleotides are described herein.

[0226] For example, specific HTT oligonucleotides comprising specific exemplary base sequences, nucleobase modifications and patterns thereof, sugar modifications and patterns thereof, internucleotide linkages and patterns thereof, linkage stereochemistry and patterns thereof, linkers, and / or additional chemical moieties are presented in Table 1 below. In particular, these oligonucleotides can be used to target HTT transcripts, for example, to reduce the levels of HTT transcripts and / or their products.

[0227] [Table 1] Exemplary HTT oligonucleotide.

[0228]

[0229]

[0230]

[0231]

[0232]

[0233]

[0234]

[0235]

[0236]

[0237]

[0238]

[0239]

[0240]

[0241]

[0242]

[0243]

[0244]

[0245]

[0246]

[0247]

[0248]

[0249]

[0250]

[0251]

[0252]

[0253]

[0254]

[0255]

[0256]

[0257]

[0258]

[0259]

[0260]

[0261]

[0262]

[0263]

[0264]

[0265]

[0266]

[0267]

[0268]

[0269]

[0270]

[0271]

[0272]

[0273]

[0274]

[0275]

[0276]

[0277]

[0278]

[0279]

[0280]

[0281]

[0282]

[0283]

[0284]

[0285]

[0286]

[0287]

[0288]

[0289]

[0290]

[0291]

[0292]

[0293]

[0294]

[0295]

[0296]

[0297]

[0298]

[0299]

[0300]

[0301]

[0302]

[0303]

[0304]

[0305]

[0306]

[0307]

[0308]

[0309]

[0310]

[0311]

[0312]

[0313]

[0314]

[0315]

[0316]

[0317]

[0318]

[0319]

[0320]

[0321]

[0322]

[0323]

[0324]

[0325]

[0326]

[0327]

[0328]

[0329]

[0330]

[0331]

[0332]

[0333]

[0334]

[0335]

[0336]

[0337]

[0338]

[0339]

[0340]

[0341]

[0342]

[0343]

[0344]

[0345]

[0346]

[0347]

[0348]

[0349]

[0350]

[0351]

[0352]

[0353]

[0354]

[0355]

[0356]

[0357]

[0358]

[0359]

[0360] main:

[0361] Descriptions, base sequences, and stereochemistry / linking may be divided into multiple lines in Table 1 due to their lengths. Unless otherwise specified, all oligonucleotides in Table 1 are single-stranded. As understood by those skilled in the art, nucleoside units are unmodified and contain unmodified nucleobases and 2'-deoxy sugars unless otherwise indicated by modification (e.g., modified by r, m, m5, eo, etc.); linking is a natural phosphate linkage unless otherwise indicated; and acidic / basic groups may exist independently in the form of their salts. As understood by those skilled in the art, where the linkage between two nucleoside units is not specified, the linkage between nucleotides is a phosphodiester linkage (a natural phosphate linkage), and unless otherwise indicated, the sugar is a natural DNA sugar that does not contain substitutions at the 2' position (two -Hs at the 2'-carbon). Moiety and modification in oligonucleotides (or other compounds, e.g., useful for preparing the provided oligonucleotides containing such moiety or modification):

[0362] m: 2'-OMe;

[0363] m5: Methyl at the 5-position of C (the nucleobase is 5-methylcytosine);

[0364] m5Ceo: 5-methyl 2'-O-methoxyethyl C;

[0365] m5mC: 5-methyl 2'-OMe C;

[0366] m5lC: Methyl at the 5-position of C (the nucleobase is 5-methylcytosine), the sugar is an LNA sugar;

[0367] eo: 2'-MOE (2'-OCH2CH2OCH3);

[0368] f: 2'-F;

[0369] r: 2'-OH;

[0370] O, PO: Phosphodiester (phosphate). This may be a terminal group or linkage, e.g., a linkage between a linker and an oligonucleotide chain, a linkage between nucleotides (natural phosphate linkage), etc. Phosphodiesters are typically indicated as "O" in the stereochemistry / linkage column and typically not indicated in the description column (if this is a terminal group, e.g., a 5'-terminal group, this is indicated in the description and typically not in the stereochemistry / linkage column); if a linkage is not indicated in the description column, this is typically a phosphodiester unless otherwise indicated. A phosphate linkage between a linker (e.g., L001) and an oligonucleotide chain may not be indicated in the description column and may not be indicated as "O" in the stereochemistry / linkage column. For example, in the description of WV-10631 (Mod012L001mG * SmUmGmCmA ... ), the phosphodiester link between L001 and the oligonucleotide chain (starting with mG * SmUmGmCmA ...) is not indicated; this internucleotide link is indicated by the first "O" in OSOOO... in stereochemistry / linkage.

[0371] *, PS: Phosphorothioate. This can be a terminal group (if this is a terminal group, e.g., a 5'-terminal group, this is indicated in the description and typically not indicated in stereochemistry / linking), or a linkage, e.g., a linkage between a linker (e.g., L001) and an oligonucleotide chain, a linkage between nucleotides (phosphorothioate linkage between nucleotides), etc.

[0372] R , R p: R Phosphorothioate of the p-seat. In the description, * R is R Note that it indicates a single phosphorothioate linkage of the p locus;

[0373] S , S p: SPhosphorothioate of the p-seat. In the description, * S is S Note that it indicates a single phosphorothioate linkage of the p locus;

[0374] X: Stereorandom Phosphorothioate;

[0375] l: LNA per;

[0376] n001: ;

[0377] nX or Xn: stereorandom n001;

[0378] n001R or nR: R n001 of the p array;

[0379] n001S or nS: S n001 of the p array;

[0380] L001: As indicated at the -CH2- linkage site, if present, to the Mod via -NH-, and a phosphate linkage (which may exist in salt form and may be represented as O or PO, -OP(O)(OH)-O-) or a phosphorothioate linkage (which may exist in salt form and may be represented as * if the phosphorothioate is not chiral controlled; or if the phosphorothioate is chiral controlled and S If you have a p array, *S, S, or S It can be represented as p, or the phosphorothioate is chiral controlled and R If you have a p array, *R, R, or R A -NH-(CH2)6- linker (also known as a C6 linker, C6 amine linker, or C6 amino linker) connected to the 5'-terminus or 3'-terminus of the oligonucleotide chain via any one of -OP(O)(SH)-O- which can be represented by p. If Mod is absent, L001 is connected to -H via -NH-;

[0381] L004: A linker having the structure -NH(CH2)4CH(CH2OH)CH2- (wherein -NH- is connected to Mod(-C(O)-) or -H, and the -CH2- linkage site is connected, e.g., a phosphodiester (which may exist in salt form and can be represented as O or PO, such as -OP(O)(OH)-O-), a phosphorothioate (which may exist in salt form and can be represented as * if the phosphorothioate is not chiral controlled; or the phosphorothioate is chiral controlled and S If you have a p array, *S, S, or S It can be represented as p, or the phosphorothioate is chiral controlled and R If you have a p array, *R, R, or R (-OP(O)(SH)-O-, which can be denoted by p), or phosphodithioate (which may exist in salt form and can be denoted by PS2 or : or D, -OP(S)(SH)-O-) is connected to the oligonucleotide chain (e.g., at the 3'-terminus) via a linkage). For example, an asterisk immediately preceding L004 (e.g., *L004) indicates that the linkage is a phosphodiester linkage, and the absence of an asterisk immediately preceding L004 indicates that the linkage is a phosphodiester linkage. For example, in an oligonucleotide ending in ...mAL004, the linker L004 is connected via a phosphodiester linkage to the 3' position of the 3'-terminal sugar (modified by 2'-OMe and connected to nucleobase A) (via the -CH2- site), and the L004 linker is connected to -H via -NH-. Similarly, in one or more oligonucleotides, the L004 linker is connected to the 3' position of the 3'-terminal sugar via a phosphodiester linkage (through the -CH2- site), and L004 is connected via -NH-, e.g., Mod012, Mod085, Mod086, etc.;

[0382] Mod012 (including -C(O)- which connects to the -NH- of a linker such as L001 or L004):

[0383]

[0384] Mod039 (including -C(O)- which connects to the -NH- of a linker such as L001 or L004):

[0385]

[0386] Mod062 (including -NH- linked to the -C(O)- of the linker such as L008):

[0387]

[0388] L008: A linker having the structure -C(O)-(CH2)9- (wherein -C(O)- is connected to a Mod (via -NH-) or -OH (if Mod is not indicated), and the -CH2- linkage site is connected, e.g., a phosphodiester (which may exist in salt form and may be represented as O or PO, such as -OP(O)(OH)-O-), a phosphorothioate (which may exist in salt form and may be represented as * if the phosphorothioate is not chiral controlled; or the phosphorothioate is chiral controlled and S If you have a p array, *S, S, or S It can be represented as p, or the phosphorothioate is chiral controlled and R If you have a p array, *R, R, or R(-OP(O)(SH)-O-, which can be denoted by p), or phosphorodithioate (which may exist in salt form and is connected to the oligonucleotide chain (e.g., at the 5'-terminus) via a linkage of -OP(O)(SH)-O-, which can be denoted by PS2 or : or D). For example, in WV-11571, L008 is connected to -OH via -C(O)- and to the 5'-terminus of the oligonucleotide chain via a phosphate linkage (indicated by "O" in "stereochemistry / linkage"); in WV-11569, L008 is connected to Mod062 via -C(O)- and to the 5'-terminus of the oligonucleotide chain via a phosphate linkage (indicated by "O" in "stereochemistry / linkage");

[0389] Mod001(including -C(O)- linked to the -NH- of the same linker as L001):

[0390]

[0391] Mod085 (including -C(O)- which connects to the -NH- of a linker such as L001 or L004):

[0392]

[0393] Mod086 (including -C(O)- which connects to the -NH- of a linker such as L001 or L004):

[0394]

[0395] Mod094(in WV-11570, phosphate group (which is not exemplified below and may exist in salt form; indicated by "O" in "Stereochemistry / Linking"(...XXXX O Binded to the 3'-terminus (3'-carbon of the 3'-terminal sugar) of the oligonucleotide chain via )):

[0396]

[0397] BrdU: The nucleobase is BrU( ) and a nucleoside unit in which the sugar is 2-deoxyribose (as widely found in natural DNA; 2'-deoxy(d)) );

[0398] tgal mc6T: A modified thymidine containing a modified thymine and having the following structure:

[0399]

[0400] d2AP: nucleobase is 2-aminopurine ( , 2AP), a nucleoside unit in which the sugar is 2-deoxyribose (as widely found in natural DNA; 2'-deoxy(d)) , BA = 2AP);

[0401] dDAP: nucleobase is 2,6-diaminopurine ( , DAP) and a nucleoside unit in which the sugar is 2-deoxyribose (as widely found in natural DNA; 2'-deoxy(d)) , BA = DAP);

[0402] dmtr: Unless otherwise indicated, DMTR, in which 4,4'-dimethoxytrityl is attached to the 5' -O- of a sugar. For example, in dmtrmA: .

[0403] Additional structural elements of HTT oligonucleotides are described, for example, in WO 2018 / 022473, WO 2018 / 098264, WO 2018 / 223056, WO 2018 / 223073, WO 2018 / 223081, WO 2018 / 237194, WO 2019 / 032607, WO 2019 / 055951, and / or WO 2019 / 075357, and structural elements of their oligonucleotides are incorporated herein by reference.

[0404] length

[0405] As understood by those skilled in the art, oligonucleotides may have various lengths to provide desired properties and / or activities for various applications. Many techniques for evaluating, selecting, and / or optimizing oligonucleotide lengths are available in the art and can be utilized according to the present invention. As demonstrated herein, in many embodiments, the provided oligonucleotide is of a length suitable for hybridizing with its target and reducing the levels of its target and / or its encoded product. In some embodiments, the oligonucleotide is long enough to recognize a target HTT nucleic acid (e.g., HTT mRNA). In some embodiments, the oligonucleotide is long enough to distinguish the target HTT nucleic acid from other nucleic acids (e.g., nucleic acids having a non-HTT base sequence) to reduce off-target effects. In some embodiments, the oligonucleotide, e.g., an HTT oligonucleotide, is short enough to reduce the complexity of manufacturing or production and to reduce product costs.

[0406] In some embodiments, the base sequence of the oligonucleotide is about 10 to 500 nucleotides in length. In some embodiments, the base sequence is about 10 to 500 nucleotides in length. In some embodiments, the base sequence is about 10 to 50 nucleotides in length. In some embodiments, the base sequence is about 15 to 50 nucleotides in length. In some embodiments, the base sequence is about 15 to about 30 nucleotides in length. In some embodiments, the base sequence is about 10 to about 25 nucleotides in length. In some embodiments, the base sequence is about 15 to about 22 nucleotides in length. In some embodiments, the provided oligonucleotide has a base sequence of approximately 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides.

[0407] In some embodiments, each nucleobase independently comprises a selectively substituted monocyclic, bicyclic, or polycyclic ring, wherein at least one ring atom is nitrogen. In some embodiments, each nucleobase independently comprises a selectively substituted adenine, cytosine, guanosine, thymine, or uracil, or a selectively substituted tautomer of adenine, cytosine, guanosine, thymine, or uracil.

[0408] Region, wing, and core of HTT oligonucleotide

[0409] In some embodiments, the oligonucleotide, e.g., HTT oligonucleotide, comprises several regions, each of which independently comprises one or more consecutive nucleosides and optionally one or more internucleotide linkages. In some embodiments, a given region differs from its neighboring region(s) in that it comprises one or more structural features that are different from the corresponding structural features of its neighboring region(s). Exemplary structural features include nucleobase modifications and patterns thereof, sugar modifications and patterns thereof, internucleotide linkages and patterns thereof (which may be types of internucleotide linkages (e.g., phosphate, phosphorothioate, phosphorothioate triester, neutral internucleotide linkages, etc.) and patterns thereof, linkage modifications (backbone modifications) and patterns thereof (e.g., when the internucleotide linkages have the structure of Formula I -XLR 1 Patterns of), backbone chiral centers (links) stereochemistry and patterns thereof [e.g., chiral-controlled internucleotide links of R p and / or SIt includes [a combination of p (sequentially from 5' to 3') and optionally chiral uncontrolled nucleotide linkages and / or natural phosphate linkages (if any) (e.g., OSOOO RSSRS SSSRS SOOOS of Table 1). In some embodiments, the region includes chemical modifications (e.g., sugar modifications, base modifications, nucleotide linkages, or stereochemistry of nucleotide linkages) that are not present in its neighboring region(s). In some embodiments, the region lacks chemical modifications present in its neighboring region(s).

[0410] In some embodiments, an oligonucleotide, e.g., an HTT oligonucleotide, comprises or consists of two or more regions. In some embodiments, the oligonucleotide comprises or consists of three or more regions. In some embodiments, the oligonucleotide comprises or consists of two adjacent regions, wherein one region is denoted as a wing region and the other region is denoted as a core region. The structure of such an oligonucleotide comprises or consists of a wing-core or core-wing structure. In some embodiments, the oligonucleotide comprises or consists of three adjacent regions, wherein two adjacent regions are located on the sides of one region. In some embodiments, the intermediate region is denoted as a core region, and each of the side regions is denoted as a wing region (a 5'-wing if connected to the 5'-terminus of the core, and a 3'-wing if connected to the 3'-terminus of the core). The structure of such an oligonucleotide comprises or consists of a wing-core-wing structure.

[0411] In some embodiments, the first region (e.g., wing) differs from the second region (e.g., core) in that the first region includes a variation(s) or a pattern thereof that is absent in the second region. In some embodiments, the first (e.g., wing) region includes a variation that is absent in the second (e.g., core) region. In some embodiments, the variation is a 2'-variant. In some embodiments, the 2'-variant is a 2'-OR, where R is an optional substitution C 1-6 It is aliphatic. In some embodiments, the 2'-variant is 2'-OR, where R is an optional substitution C 1-6 It is alkyl. In some embodiments, the 2'-modification is 2'-MOE. In some embodiments, the 2'-modification is 2'-OMe. In some embodiments, the modified sugar is a bicyclic sugar, e.g., LNA sugar. In some embodiments, each sugar in the region is modified independently. In some embodiments, each sugar in the region (e.g., wing) independently includes modifications that may be identical or different from one another. In some embodiments, each sugar in the region (e.g., wing) includes the same modification, e.g., 2'-modification (as described in the present invention). In some embodiments, the sugar in the region (e.g., core) is not modified. In some embodiments, each sugar in the region (e.g., core) is an unmodified DNA sugar (having two -Hs at the 2'-position). In some embodiments, the structure of the provided oligonucleotide comprises or consists of a wing-core, core-wing, or wing-core-wing structure, wherein each wing independently comprises one or more sugar modifications, and each sugar in the core is a natural DNA sugar (having two -Hs at the 2' position).

[0412] Additionally or alternatively, the first region (e.g., wing) may include nucleotide-to-nucleotide connection(s) or a pattern thereof that is different from another region (e.g., core or another wing). In some embodiments, the region (e.g., wing) includes two or more consecutive natural phosphate linkages. In some embodiments, the region (e.g., core) does not include consecutive natural phosphate linkages. In some embodiments, the structure of the provided oligonucleotide includes or is composed of a wing-core, core-wing, or wing-core-wing structure, wherein at least one wing independently includes two or more consecutive natural phosphate linkages, and the core does not include consecutive natural phosphate linkages. In some embodiments, in a wing-core-wing structure, each wing independently includes two or more consecutive nucleotide-to-nucleotide linkages. Unless otherwise noted, for the stereochemistry of a wing-core-wing structure, the nucleotide linkage connecting the core and the wing is included in the core (e.g., see above).

[0413] In some embodiments, the region is a 5'-wing, a 3'-wing, or a core. In some embodiments, the 5'-wing is at the 5' end of the oligonucleotide, the 3'-wing is at the 3'-end of the oligonucleotide, the core is between the 5'-wing and the 3'-wing, and the oligonucleotide comprises or is composed of a wing-core-wing structure or format. In some embodiments, the core comprises a span of junctional natural DNA sugars (2'-deoxyribose). In some embodiments, the core comprises a span of at least five junctional natural DNA sugars (2'-deoxyribose). In some embodiments, the core comprises a span of at least ten junctional natural DNA sugars (2'-deoxyribose). In some embodiments, the core is referred to as a gap. In some embodiments, an oligonucleotide comprising or composed of a wing-core-wing structure is described as a gapmer. In some embodiments, the structure of the provided oligonucleotide comprises or consists of a wing-core structure. In some embodiments, the structure of the provided oligonucleotide comprises or consists of a core-wing structure. Non-limiting examples of oligonucleotides having a core-wing structure include WV-2023 and WV-2025. In some embodiments, the structure of the oligonucleotide comprises or consists of an oligonucleotide chain comprising or consisting of a wing-core-wing, wing-core, or wing-core structure, wherein the oligonucleotide chain is optionally conjugated to an additional chemical moiety through a linker as described in the present invention. In some embodiments, the present invention provides an oligonucleotide that targets HTT and has a structure comprising one or two wings and a core, comprising or consisting of a wing-core-wing, core-wing, or wing-core structure.

[0414] Ribonuclease H (RNase H, e.g., RNase H1, RNase H2, etc.) is reported to recognize structures containing RNA-DNA hybrids (e.g., heteroduplexes) and cleave the RNA. In some embodiments, an oligonucleotide containing spans of junctional natural DNA sugars (2'-deoxyribose) (e.g., in the core region) may be annealed to RNA, such as mRNA, to form a heteroduplex; this heteroduplex structure may be recognized by RNase H and the RNA may be cleaved by RNase H. In some embodiments, the core of the provided oligonucleotide contains 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more junctional natural DNA sugars, and the core may be specifically annealed to a target transcript [e.g., HTT transcripts (e.g., pre-mRNA, mature mRNA, etc.)]; The formed structure can be recognized by RNase H and the transcript can be cleaved by RNase H. In some embodiments, the core of the provided oligonucleotide contains five or more junctional DNA sugars.

[0415] Regions, e.g., wings, cores, etc., may be of various suitable lengths. In some embodiments, the region (e.g., wings, cores, etc.) comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more nucleobases. As described in the present invention, in some embodiments, each nucleobase independently comprises a selectively substituted monocyclic, bicyclic, or polycyclic ring, the ring having one or more nitrogen ring atoms; in some embodiments, each nucleobase independently is a selectively substituted A, T, C, G, or U, or a substituted tautomer of A, T, C, G, or U. In some embodiments, the number is 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 for the wings. In some embodiments, each wing of the wing-core-wing structure has a length as described in the present invention independently. In some embodiments, the two wings are of the same length. In some embodiments, the two wings are of different lengths. In some embodiments, the number is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or more for the cores.

[0416] In some embodiments, the wing comprises one or more sugar modifications. In some embodiments, the two wings of the wing-core-wing structure comprise different sugar modifications (and the oligonucleotide has or comprises an "asymmetric" format). In some embodiments, the sugar modification provides improved stability and / or annealing properties compared to the absence of the sugar modification.

[0417] In some embodiments, a specific sugar modification, e.g., 2'-MOE, provides greater stability than another sugar modification, e.g., 2'-OMe, under certain conditions. In some embodiments, the wing comprises a 2'-MOE modification. In some embodiments, each nucleoside unit of the wing comprising a pyrimidine base (e.g., C, U, T, etc.) comprises a 2'-MOE modification. In some embodiments, each sugar unit of the wing comprises a 2'-MOE modification. In some embodiments, each nucleoside unit of the wing comprising a purine base (e.g., A, G, etc.) does not comprise a 2'-MOE modification (e.g., each of these nucleoside units comprises 2'-OMe, or does not comprise a 2'-modification, or etc.). In some embodiments, each nucleoside unit of the wing comprising a purine base comprises a 2'-OMe modification. In some embodiments, the link between each nucleotide at the 3'-position of the sugar unit containing the 2'-MOE modification is a natural phosphate link.

[0418] In some embodiments, the wing does not include a 2'-MOE modification. In some embodiments, the wing includes a 2'-OMe modification. In some embodiments, each nucleoside unit of the wing independently includes a 2'-OMe modification.

[0419] In some embodiments, the structure of an oligonucleotide, e.g., an HTT oligonucleotide, comprises a wing-core-wing structure, wherein one wing comprises a 2'-OMe sugar modification and the other wing comprises a bicyclic sugar and / or; one wing comprises 2'-OMe and the other wing comprises a bicyclic sugar, and the majority of sugars in the core are natural DNA sugars (without substitution at the 2'-position) and / or; the majority of sugars in one wing comprise 2'-OMe and the majority of sugars in the other wing are independently bicyclic sugars and / or; the majority of sugars in one wing comprise 2'-OMe and the majority of sugars in the other wing are independently bicyclic sugars, and the majority of sugars in the core are natural DNA sugars and / or; the majority of sugars in one wing comprise 2'-OMe, and in the other wing, at least one sugar is a bicyclic sugar and at least one sugar comprises 2'-OMe; The majority of sugars in one wing contain 2'-OMe, and in the other wing, at least one sugar is a bicyclic sugar and at least one sugar contains 2'-OMe, and the majority of sugars in the core are natural DNA sugars and / or; the majority of sugars in one wing are bicyclic sugars, and in the other wing, at least one sugar is a bicyclic sugar and at least one sugar contains 2'-OMe and / or; the majority of sugars in one wing are independently bicyclic sugars, and in the other wing, at least one sugar is a bicyclic sugar and at least one sugar contains 2'-OMe, and the majority of sugars in the core are natural DNA sugars and / or; each sugar in one wing contains 2'-OMe and each sugar in the other wing is independently a bicyclic sugar and / or; each sugar in one wing contains 2'-OMe and each sugar in the other wing is independently a bicyclic sugar, and the majority of sugars in the core are natural DNA sugars and / or;Each sugar in one wing is independently a bicyclic sugar, and each sugar in the other wing contains 2'-OMe, and each sugar in the core is a natural DNA sugar and / or; one wing contains a bicyclic sugar and the other wing contains 2'-MOE and / or; one wing contains a bicyclic sugar and the other wing contains 2'-MOE, and the majority of sugars in the core are natural DNA sugars and / or; the majority of sugars in one wing are independently a bicyclic sugar and the majority of sugars in the other wing contain 2'-MOE and / or; the majority of sugars in one wing are independently a bicyclic sugar and the majority of sugars in the other wing contain 2'-MOE, and the majority of sugars in the core are natural DNA sugars and / or; the majority of sugars in one wing are independently a bicyclic sugar, and in the other wing, at least one sugar contains 2'-MOE and at least one sugar is a bicyclic sugar and / or; The majority of sugars in one wing are independently bicyclic sugars, and in the other wing, at least one sugar contains a 2'-MOE and at least one sugar is a bicyclic sugar, and the majority of sugars in the core are natural DNA sugars and / or; the majority of sugars in one wing contain a 2'-MOE and in the other wing, at least one sugar contains a 2'-MOE and at least one sugar is a bicyclic sugar and / or; the majority of sugars in one wing contain a 2'-MOE and in the other wing, at least one sugar contains a 2'-MOE and at least one sugar is a bicyclic sugar, and the majority of sugars in the core are natural DNA sugars and / or; each sugar in one wing is independently a bicyclic sugar and each sugar in the other wing independently contains a 2'-MOE and / or; each sugar in one wing is independently a bicyclic sugar and each sugar in the other wing of the oligonucleotide contains a 2'-MOE, and the majority of sugars in the core are natural DNA sugars.;

[0420] In some embodiments, the structure of an oligonucleotide, e.g., an HTT oligonucleotide, comprises a wing-core-wing structure, wherein each sugar in one wing comprises a 2'-MOE, each sugar in the other wing is independently a bicyclic sugar, and each sugar in the core is a natural DNA sugar.

[0421] In some embodiments, the cyclic sugar is an LNA, cEt, or BNA sugar.

[0422] In some embodiments, the structure of the oligonucleotide, e.g., HTT oligonucleotide, comprises a wing-core-wing structure, wherein one wing comprises 2'-OMe and the other wing comprises 2'-F. In some embodiments, the structure of the oligonucleotide, e.g., HTT oligonucleotide, comprises a wing-core-wing structure, wherein one wing comprises 2'-OMe and the other wing comprises 2'-F, and the majority of the sugars in the core are natural DNA sugars.

[0423] In some embodiments, the structure of an oligonucleotide, e.g., an HTT oligonucleotide, comprises a wing-core-wing structure, wherein the majority of sugars in one wing comprise 2'-OMe and the majority of sugars in the other wing comprise 2'-F. In some embodiments, the structure of an oligonucleotide, e.g., an HTT oligonucleotide, comprises a wing-core-wing structure, wherein the majority of sugars in one wing comprise 2'-OMe and the majority of sugars in the other wing comprise 2'-F, and the majority of sugars in the core are natural DNA sugars.

[0424] In some embodiments, the structure of an oligonucleotide, e.g., an HTT oligonucleotide, comprises a wing-core-wing structure, wherein the majority of the sugars in one wing comprise 2'-OMe, and in the other wing, at least one sugar comprises 2'-F and at least one sugar comprises 2'-OMe. In some embodiments, the structure of an oligonucleotide, e.g., an HTT oligonucleotide, comprises a wing-core-wing structure, wherein the majority of the sugars in one wing comprise 2'-OMe, and in the other wing, at least one sugar comprises 2'-F and at least one sugar comprises 2'-OMe, and the majority of the sugars in the core are DNA sugars.

[0425] In some embodiments, the structure of an oligonucleotide, e.g., an HTT oligonucleotide, comprises a wing-core-wing structure, wherein the majority of sugars in one wing comprise 2'-F, and in the other wing, at least two sugars comprise 2'-F and at least two sugars comprise 2'-OMe. In some embodiments, the structure of an oligonucleotide, e.g., an HTT oligonucleotide, comprises a wing-core-wing structure, wherein the majority of sugars in one wing comprise 2'-F, and in the other wing, at least two sugars comprise 2'-F and at least two sugars comprise 2'-OMe, and the majority of sugars in the core are natural DNA sugars.

[0426] In some embodiments, the structure of an oligonucleotide, e.g., an HTT oligonucleotide, comprises a wing-core-wing structure, wherein each sugar in one wing of the oligonucleotide comprises 2'-OMe and each sugar in the other wing of the provided oligonucleotide comprises 2'-F. In some embodiments, the structure of an oligonucleotide, e.g., an HTT oligonucleotide, comprises a wing-core-wing structure, wherein each sugar in one wing of the oligonucleotide comprises 2'-OMe and each sugar in the other wing of the oligonucleotide comprises 2'-F, and the majority of the sugars in the core are natural DNA sugars.

[0427] In some embodiments, the structure of an oligonucleotide, e.g., an HTT oligonucleotide, comprises a wing-core-wing structure, wherein each sugar in one wing comprises 2'-F, each sugar in another wing comprises 2'-OMe, and each sugar in the core is a DNA sugar.

[0428] In some embodiments, the structure of an oligonucleotide, e.g., an HTT oligonucleotide, comprises a wing-core-wing structure, wherein one wing comprises 2'-F and the other wing comprises 2'-MOE. In some embodiments, the structure of an oligonucleotide, e.g., an HTT oligonucleotide, comprises a wing-core-wing structure, wherein one wing comprises 2'-F and the other wing comprises 2'-MOE, and the majority of the sugars in the core comprise 2'-deoxy.

[0429] In some embodiments, the structure of an oligonucleotide, e.g., an HTT oligonucleotide, comprises a wing-core-wing structure, wherein the majority sugar in one wing comprises 2'-F and the majority sugar in the other wing comprises 2'-MOE. In some embodiments, the structure of an oligonucleotide, e.g., an HTT oligonucleotide, comprises a wing-core-wing structure, wherein the majority sugar in one wing comprises 2'-F and the majority sugar in the other wing comprises 2'-MOE, and the majority sugar in the core is a natural DNA sugar.

[0430] In some embodiments, the structure of an oligonucleotide, e.g., an HTT oligonucleotide, comprises a wing-core-wing structure, wherein the majority of sugars in one wing comprise 2'-F, and in the other wing, at least one sugar comprises 2'-MOE and at least one sugar comprises 2'-F. In some embodiments, the structure of an oligonucleotide, e.g., an HTT oligonucleotide, comprises a wing-core-wing structure, wherein the majority of sugars in one wing comprise 2'-F, and in the other wing, at least one sugar comprises 2'-MOE and at least one sugar comprises 2'-F, and the majority of sugars in the core are natural DNA sugars.

[0431] In some embodiments, the structure of an oligonucleotide, e.g., an HTT oligonucleotide, comprises a wing-core-wing structure, wherein the majority of sugars in one wing comprise 2'-MOE, and in the other wing, at least one sugar comprises 2'-MOE and at least one sugar comprises 2'-F. In some embodiments, the structure of an oligonucleotide, e.g., an HTT oligonucleotide, comprises a wing-core-wing structure, wherein the majority of sugars in one wing comprise 2'-MOE and in the other wing, at least one sugar comprises 2'-MOE and at least one sugar comprises 2'-F, and the majority of sugars in the core are natural DNA sugars.

[0432] In some embodiments, the structure of an oligonucleotide, e.g., an HTT oligonucleotide, comprises a wing-core-wing structure, wherein each sugar in one wing of the oligonucleotide comprises 2'-MOE, each sugar in the other wing comprises 2'-F, and each sugar in the core is a natural DNA sugar.

[0433] In some embodiments, the oligonucleotide, e.g., HTT oligonucleotide, has a wing-core-wing structure. In some embodiments, the core comprises one or more natural DNA sugars. In some embodiments, the core comprises five or more consecutive natural DNA sugars. In some embodiments, the core comprises 5 to 10, 5 to 15, 5 to 20, 5 to 25, 5 to 30, or 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or more natural DNA sugars (which are optionally consecutive). In some embodiments, the core comprises five, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or more consecutive natural DNA sugars. In some embodiments, the core comprises 10 or more consecutive natural DNA sugars. In some embodiments, the core can hybridize to the target mRNA to form a duplex structure that can be recognized by RNaseH, so that RNaseH can cleave the mRNA.

[0434] In some embodiments, the oligonucleotide, e.g., HTT oligonucleotide, has a wing-core-wing structure and an asymmetric format.

[0435] In some embodiments, in an oligonucleotide having an asymmetric format, one wing has a sugar modification or a pattern thereof, or a backbone nucleotide linkage or a pattern thereof, or a backbone chiral center or a pattern thereof that is different from another. In some embodiments, an oligonucleotide, e.g., an HTT oligonucleotide, has an asymmetric format in that one wing contains a sugar modification different from that of another wing. In some embodiments, an oligonucleotide, e.g., an HTT oligonucleotide, has an asymmetric format in that one wing contains a sugar modification pattern different from that of another wing.

[0436] In some embodiments, the HTT oligonucleotide (or wing, core, block, or any part thereof) may comprise any variation, any variation pattern, any internucleotide linkage, any internucleotide linkage pattern, any chiral center pattern, or any format (including but not limited to asymmetric formats) as described in any of the following: WO2017015555; WO2017192664; W00201200366; WO2011 / 034072; WO2014 / 010718; WO2015 / 108046; WO2015 / 108047; WO2015 / 108048; WO 2011 / 005761; WO 2011 / 108682; WO 2012 / 039448; WO 2018 / 067973; WO2005 / 028494; WO2005 / 092909; WO2010 / 064146; WO2012 / 073857; WO2013 / 012758; WO2014 / 010250; WO2014 / 012081; WO2015 / 107425; WO2017 / 015555; WO2017 / 015575; WO2017 / 062862; WO2017 / 160741; WO2017 / 192664; WO2017 / 192679; WO2017 / 210647; WO2018 / 022473; or WO2018 / 098264 (each variant, any variant pattern, any internucleotide linkage, any internucleotide linkage pattern, or any format (including but not limited to asymmetric formats) described therein are incorporated for reference).

[0437] In some embodiments, the structure of an oligonucleotide, for example, an HTT oligonucleotide, comprises or is composed of an asymmetric format. In some embodiments, the structure of an oligonucleotide, for example, an HTT oligonucleotide, comprises or is composed of a symmetric format.

[0438] In some embodiments, the structure of an oligonucleotide, e.g., an HTT oligonucleotide, is in an asymmetric format or comprises the same, wherein the structure of the oligonucleotide is a wing-core-wing structure, and the format of the first wing is different from the format of the second wing. In some embodiments, the structure of an oligonucleotide, e.g., an HTT oligonucleotide, is in an asymmetric format or comprises the same, wherein the structure of the oligonucleotide is a wing-core-wing structure, and the first and second wings differ in sugar modification (or a combination or pattern thereof) and / or internucleotide linkage (or a combination or pattern thereof). In some embodiments, the structure of an oligonucleotide, e.g., an HTT oligonucleotide, is in an asymmetric format or comprises the same, wherein the structure of the oligonucleotide is a wing-core-wing structure, and the first and second wings differ in sugar modification (or a combination or pattern thereof).

[0439] In some embodiments, the core region comprises a sequence complementary to one allele of a distinct location, for example, an SNP location. In some embodiments, the core region comprises a sequence complementary to one allele of the SNP (for example, this is on the same strand / chromosome as a disease-associated or causative sequence (for example, an extended CAG repeat in the HTT gene)), but not complementary to the other allele of the SNP (for example, this is on the same strand / chromosome as a sequence less associated with the disease, or disease-unassociated or non-causative sequence (for example, a normal or shorter CAG repeat in the HTT gene)). In some embodiments, for the SNP, this sequence is a single nucleobase. In some embodiments, the core region comprises a nucleobase complementary to the allele of the SNP located on the same strand / chromosome as an extended CAG repeat in the HTT gene. In particular, the present invention demonstrates that the properties and / or activity of an oligonucleotide can be regulated through the location of such nucleobases. In some embodiments, the position of this nucleobase is position 4, 5, 6, 7, or 8 counting from the 5'-terminus of the core region (the first nucleoside of the core region from the 5'-terminus is position 1). In some embodiments, the position is position 4 from the 5'-terminus of the core region. In some embodiments, the position is position 5 from the 5'-terminus of the core region. In some embodiments, the position is position 6 from the 5'-terminus of the core region. In some embodiments, the position is position 7 from the 5'-terminus of the core region. In some embodiments, the position is position 8 from the 5'-terminus of the core region. In some embodiments, the position of this nucleobase is position 7, 8, 9, 10, 11, or 12 counting from the 5'-terminus of the oligonucleotide (the first nucleoside of the oligonucleotide from the 5'-terminus is position 1).In some embodiments, the position is at position 7 from the 5'-terminus of the oligonucleotide. In some embodiments, the position is at position 8 from the 5'-terminus of the oligonucleotide. In some embodiments, the position is at position 9 from the 5'-terminus of the oligonucleotide. In some embodiments, the position is at position 10 from the 5'-terminus of the oligonucleotide. In some embodiments, the oligonucleotide comprises a 5'-terminal wing containing five or fewer nucleosides. In some embodiments, each wing is 2'-modified. In some embodiments, each wing is 2'-OMe modified. In some embodiments, each core sugar does not independently include a 2'-OR modification, where R is as described in the present invention. In some embodiments, each core sugar is independently an unmodified DNA sugar.

[0440] In some embodiments, the oligonucleotide, e.g., HTT oligonucleotide, may comprise any first wing, core, and / or second wing described herein or known in the art.

[0441] In some embodiments, an oligonucleotide having a base sequence that is the HTT oligonucleotide sequence disclosed herein, or includes the same or a span thereof, may include a first wing, a core, and / or a second wing as described herein or known in the art.

[0442] RNAi agents

[0443] The oligonucleotides of the present invention may perform one or more functions through various biological mechanisms and / or pathways. In some embodiments, the present invention provides oligonucleotides capable of reducing the level, expression, and / or activity of a gene or its product in part, mainly, or wholly through RNA interference. As understood by those skilled in the art, these oligonucleotides may be single-stranded or double-stranded. In some embodiments, single-stranded or double-stranded oligonucleotides may reduce the level, expression, and / or activity of a target gene (e.g., HTT) or its gene product through a mechanism involving RNA interference.

[0444] In some embodiments, the present invention relates to an oligonucleotide, e.g., an HTT oligonucleotide, which has a base sequence comprising 15 or more junction bases (optionally including 1 to 3 mismatches) from the base sequence of the oligonucleotide in Table 1, or a base sequence comprising this or a span thereof, wherein the oligonucleotide can mediate RNA interference.

[0445] In some embodiments, the present invention relates to an HTT oligonucleotide having a base sequence comprising 15 or more junction bases (optionally including 1 to 3 mismatches) from the base sequence of an oligonucleotide in Table 1, or a base sequence comprising this or a span thereof, wherein the HTT oligonucleotide can mediate single-stranded RNA interference.

[0446] In some embodiments, the present invention relates to an HTT oligonucleotide having a base sequence comprising 15 or more junction bases (optionally including 1 to 3 mismatches) from the base sequence of an oligonucleotide in Table 1, or a base sequence comprising this or a span thereof, wherein the HTT oligonucleotide can mediate single-stranded RNA interference.

[0447] In some embodiments, the RNAi agent is an agent capable of mediating RNA interference (e.g., a nucleic acid comprising, but not limited to, a single-stranded or double-stranded nucleic acid). In some embodiments, the present invention provides an RNAi agent that targets HTT.

[0448] In some embodiments, the present invention relates to a single-stranded RNAi agent having a base sequence that is a span of 15 to 30 (e.g., at least 15, 16, 17, 18, 19, 20, or 21) junctional bases of HTT or its transcript, or a sequence that is complementary thereto, or a sequence comprising such a sequence. In some embodiments, the present invention relates to a single-stranded RNAi agent having a base sequence that is at least 15 junctional bases of any HTT oligonucleotide in Table 1, or comprises such a span thereof. In some embodiments, such a span of junctional bases is a characteristic of HTT, which is not identical to or complementary to any other sequence in the genome or transcriptome.

[0449] In some embodiments, the present invention relates to a double-stranded RNAi agent comprising a sense strand and an antisense strand, wherein the base sequence of the antisense strand is a span of 15 to 30 (e.g., at least 15, 16, 17, 18, 19, 20, or 21) junctional bases of HTT or its transcript, or a sequence complementary thereto, or comprises such a sequence. In some embodiments, the present invention relates to a double-stranded RNAi agent comprising a sense strand and an antisense strand, wherein the antisense strand has a base sequence comprising at least 15 junctional bases of any HTT oligonucleotide in Table 1, or comprises such bases, or comprises such a span thereof. In some embodiments, the present invention relates to a double-stranded RNAi agent comprising a sense strand and an antisense strand, wherein the antisense strand has a base sequence comprising at least 10 junctional bases of any HTT oligonucleotide in Table 1, or comprises such bases, or comprises such a span thereof. In some embodiments, the span of these junctional bases is a feature of HTT, which is not identical to or complementary to any other sequence in the genome or transcriptome.

[0450] In some embodiments, the RNAi agent, e.g., HTT RNAi agent, may be in the form of an RNAi agent described herein or known in the art, whether double-stranded or single-stranded. Various formats of double-stranded RNAi agents are described in the art and may be utilized according to the present invention (e.g., described in the following literature: [Elbashir et al. 2001 Gen. Dev. 15: 188]; [Elbashir et al. 2001 Nature 411: 494]; [Elbashir et al. 2001 EMBO J. 20: 6877-6888]; [Sun et al. Nat. Biotech. 26: 1379]; [Chiu et al. 2003 RNA 9: 1034-1048]; [Kim et al. (2005) Nat Biotech 23:222-226]; US 8084600; US 9175289; US 8329888; US 8090542; US 7507811; US ​​8828956; US 20130035368; US 20050255487; US 20080242851; WO 2015051366; and EP 3052464). Various formats of single-stranded RNAi agents are described in the art and may be used according to the present invention (e.g., described in the following literature: EP1520022, US 8729036, US 9476044, US 9243246, WO 2004 / 007718, etc.).

[0451] In some embodiments, the strand of a single-stranded RNAi agent or the antisense strand of a double-stranded RNAi agent comprises, in order from 5' to 3', a 5'-terminal region, a seed region, a post-seed region, and a 3' end. In some embodiments, in the strand, the seed region comprises a nucleotide at position about 2 to about 7 or about 8 counting from the 5' end. In some embodiments, the 5'-terminal region comprises a portion of the 5' strand relative to the seed region. In some embodiments, the 3'-terminal region comprises a terminal dinucleotide (e.g., TT or UU) at the 3' end, or a moiety (e.g., a 3'-terminal cap) that functionally replaces the terminal dinucleotide. A 3'-terminal cap is described, for example, in U.S. Patent No. 8,084,600 and WO 2015 / 051366. In some embodiments, the post-seed region includes a portion of the strand between the seed region and the 3' end region.

[0452] In some embodiments, the 5' terminal region comprises a phosphate group or an analog thereof. In some embodiments, for example, directly or indirectly conjugated to the 5' terminal region is an additional chemical moiety as described herein. In some embodiments, for example, directly or indirectly conjugated to the 5' terminal region is an additional chemical moiety that is GalNAc or a derivative thereof capable of binding to ASPGR.

[0453] In some embodiments, the seed region is particularly important for the recognition and complementarity of the target region. In some embodiments, the seed region is less suitable for mismatch to the target than the 5' terminal region or the post-seed region.

[0454] In some embodiments, a single-stranded RNAi agent, e.g., a single-stranded HTT RNAi reagent, comprises a chemical moiety at the 5' end containing phosphate. In some embodiments, the single-stranded RNAi agent has a group containing phosphate at its 5'-end. In some embodiments, the single-stranded RNAi agent has a phosphate group or an analog thereof at its 5'-end.

[0455] In some embodiments, the ASPGR ligand is bound to either or both strands of a single-stranded RNAi agent or a double-stranded RNAi agent. In some embodiments, the ASGPR ligand is GalNAc or a derivative thereof capable of binding to ASPGR.

[0456] 단일 가닥 RNAi 에이전트로 사용될 수 있는 올리고뉴클레오티드의 비제한적인 예는 다음을 Model: WV-5153, WV-5154, WV-5155, WV-5156, WV-5157, WV-5158, WV-5159, WV-5160, WV-5161, WV-5162, WV-5163, WV-5164, WV-5165, WV-5166, WV-5167, WV-5168, WV-5169, WV-5170, WV-5171, WV-5172, WV-5173, WV-5174, WV-5175, WV-5176, WV-5177, WV-5178, WV-5179, WV-5180, WV-5181, WV-5182, WV-5183, WV-5184, WV-5185, WV-5186, WV-5187, WV-5188, WV-5189, WV-5190, WV-5191, WV-5192, WV-5193, WV-5194, WV-5195, WV-5196 WV-5197, WV-5198, WV-5199, WV-5200, WV-5201, WV-5202, WV-5203, WV-5204, WV-5205, WV-5206, WV-5207, WV-5208, WV-5209, WV-5210, WV-5211, WV-5212, WV-5213, WV-5214, WV-5215, WV-5216, WV-5217, WV-5218, WV-5219, WV-5220, WV-5221, WV-5222, WV-5223, WV-5224, WV-5225, WV-5226 WV-5227, WV-5228, WV-5229, WV-5230, WV-5231, WV-5232, WV-5233, WV-5234, WV-5235, WV-5236, WV-5237, WV-5238, WV-5239, WV-5240, WV-5241, WV-5242, WV-5243, WV-5244, WV-5245, WV-5246, WV-5247, WV-5248, WV-5249, WV-5250, WV-5251, WV-5252, WV-5253, WV-5254, WV-5255, WV-5256 WV-5257,WV-5258, WV-5259, WV-5260, WV-5261, WV-5262, WV-5263, WV-5264, WV-5265, WV-5266, WV-5267, WV-5268, WV-5269, WV-5270, WV-5271, WV-5272, WV-5273, WV-5274, WV-5275, WV-5276, WV-5277, WV-5278, WV-5279, WV-5280, WV-5281, WV-5282, WV-5283, WV-5284, WV-5285, WV-5286, WV-10107, WV-10108, WV-10109, WV-10110, WV-10111, WV-10112, WV-10113, WV-10114, WV-10115, WV-10116, WV-10117, WV-10118, WV-10119, WV-10120, WV-10121, WV-10122, WV-10123, WV-10124, WV-10125, WV-10126, WV-10127, WV-10128, WV-10129, WV-10130, WV-10131, WV-10132, WV-10133, WV-10134, WV-10135, WV-10136, WV-10137, WV-10138, WV-10139, WV-10140, WV-10141, WV-10142, WV-10143, WV-10144, WV-10145, and WV-10146.,

[0457] In some embodiments, the present invention relates to a double-stranded RNAi agent comprising a strand of a single-stranded RNAi agent annealed to a second strand. In some embodiments, the present invention relates to a double-stranded HTT RNAi agent comprising a strand of the single-stranded HTT RNAi agent described herein annealed to a second strand.

[0458] In some embodiments, oligonucleotides such as double or single-stranded HTT RNAi agents comprise internucleotide linkages and / or patterns thereof, nucleobases and patterns thereof, sugars and patterns thereof, backbone chiral center patterns, and / or additional chemical moiety as described herein. In some embodiments, useful structural elements such as nucleobases, sugars, internucleotide linkages, linkage stereochemistry, 5'-terminal groups (e.g., phosphates and analogs / derivatives thereof), additional chemical moiety, linkers, etc., and useful patterns and / or combinations thereof are described in WO / 2018 / 223056 and incorporated herein by reference.

[0459] Links between nucleotides

[0460] In some embodiments, the HTT oligonucleotide comprises base modifications, sugar modifications, and / or internucleotide linkage modifications. Various internucleotide linkages may be utilized according to the present invention to link units comprising nucleobases, e.g., nucleosides. In some embodiments, the provided oligonucleotide comprises both one or more modified internucleotide linkages and one or more natural phosphate linkages. As is widely known to those skilled in the art, natural phosphate linkages are widely found in natural DNA and RNA molecules; said linkages have the structure -OP(O)(OH)O-, link sugars in nucleosides of DNA and RNA, and may exist in various salt forms (e.g., at physiological pH (about 7.4)); and natural phosphate linkages exist mainly in salt forms, wherein the anion is -OP(O)(OH). -It is )O-. Modified internucleotide linkages or non-natural phosphate linkages are internucleotide linkages that are not natural phosphate linkages or their salt forms. Modified internucleotide linkages may also exist in salt forms depending on the structure. For example, as understood by those skilled in the art, phosphorothioate internucleotide linkages having the structure -OP(O)(SH)O- may exist in various salt forms (e.g., at physiological pH (approx. 7.4)), where the anion is -OP(O)(S - )O-is.

[0461] In some embodiments, the HTT oligonucleotide comprises internucleotide linkages that are modified internucleotide linkages, e.g., phosphorothioate, phosphorodithioate, methylphosphonate, phosphoromidate, thiophosphate, 3'-thiophosphate, or 5'-thiophosphate.

[0462] In some embodiments, the modified internucleotide linkage is a chiral internucleotide linkage comprising a chiral linkage element. In some embodiments, the chiral internucleotide linkage is a phosphorothioate linkage. In some embodiments, the chiral internucleotide linkage is a phosphorothioate linkage of an Rp or Sp sequence (represented herein as *R or *S, respectively).

[0463] In some embodiments, the chiral internucleotide linkage is a non-negatively charged internucleotide linkage. In some embodiments, the chiral internucleotide linkage is a neutral internucleotide linkage. In some embodiments, the chiral internucleotide linkage is chirally controlled in relation to its chiral linkage factor. In some embodiments, the chiral internucleotide linkage is stereochemically pure in relation to its chiral linkage factor. In some embodiments, the chiral internucleotide linkage is not chirally controlled. In some embodiments, the backbone chiral center pattern is the position of the chirally controlled internucleotide linkage and the arrangement of the linkage factor ( R p orS It includes or consists of the location of a link between p) and non-chiral nucleotides (e.g., a natural phosphate link).

[0464] In some embodiments, the internucleotide linkage includes a P-modification, wherein the P-modification is a modification in the linkage nucleolus. In some embodiments, the modified internucleotide linkage does not include a nucleolus but is a moiety that serves to link two sugars or two moietys each containing a nucleobase independently, as in, for example, peptide nucleic acid (PNA).

[0465] In some embodiments, the oligonucleotide comprises those described herein and / or below having modified internucleotide linkages, e.g., of formulas I, Ia, Ib, or Ic: WO 2018 / 022473, WO 2018 / 098264, WO 2018 / 223056, WO 2018 / 223073, WO 2018 / 223081, WO 2018 / 237194, WO 2019 / 032607, WO 2019 / 055951, and / or WO 2019 / 075357 (each of these internucleotide linkages (e.g., those of formulas I, Ia, Ib, Ic, etc.) is independently incorporated herein by reference).

[0466] In some embodiments, the modified nucleotide linkage is a non-negatively charged nucleotide linkage. In some embodiments, the provided oligonucleotide comprises one or more non-negatively charged nucleotide linkages. In some embodiments, the non-negatively charged nucleotide linkage is a positively charged nucleotide linkage. In some embodiments, the non-negatively charged nucleotide linkage is a neutral nucleotide linkage. In some embodiments, the present invention provides an oligonucleotide comprising one or more neutral nucleotide linkages.In some embodiments, the non-negatively charged internucleotide linkages have a structure of the formulas In-1, In-2, In-3, In-4, II, II-a-1, II-a-2, II-b-1, II-b-2, II-c-1, II-c-2, II-d-1, II-d-2, etc., or a salt form thereof, which are incorporated herein and / or US 9394333, US 9744183, US 9605019, US 9982257, US 20170037399, US 20180216108, US 20180216107, US 9598458, WO 2017 / 062862, WO 2018 / 067973, WO 2017 / 160741, WO 2017 / 192679, WO 2017 / 210647, WO 2018 / 098264, WO 2018 / 022473, WO 2018 / 223056, WO 2018 / 223073, WO 2018 / 223081, WO 2018 / 237194, WO 2019 / 032607, WO2019 / 032612, WO 2019 / 055951, and / or WO 2019 / 075357 (each of which a negatively charged nucleotide linkage (e.g., formula In-1, In-2, In-3, In-4, II, II-a-1, II-a-2, II-b-1, II-b-2, II-c-1, II-c-2, II-d-1, II-d-2, etc., or suitable salt forms thereof) are as described in (independently incorporated herein by reference).

[0467] Non-limiting examples of oligonucleotides comprising negatively charged internucleotide linkages include: WV-19823, WV-19824, WV-19825, WV-19826, WV-19827, WV-19828, WV-19829, WV-19830, WV-19831, WV-19832, WV-19833, WV-19834, WV-19835, WV-19836, WV-19837, WV-19841, WV-19842, WV-19843, WV-19844, WV-19845, WV-19846, WV-19847, WV-19848, WV-19849, WV-19850, WV-19851, WV-19852, WV-19853, WV-19854, WV-16214, WV-16215, WV-16216, WV-19844, WV-19845, WV-19846, WV-19847, WV-19848, WV-19849, WV-19850, WV-19851, WV-19852, WV-19853, WV-19854, and WV-19855.

[0468] In some embodiments, negatively charged internucleotide linkages can improve the delivery and / or activity of HTT oligonucleotides (e.g., the ability to reduce the level, activity and / or expression of the HTT gene or its gene product).

[0469] In some embodiments, the modified internucleotide linkage (e.g., a non-negatively charged internucleotide linkage) comprises an optionally substituted triazolyl. In some embodiments, the modified internucleotide linkage (e.g., a non-negatively charged internucleotide linkage) comprises an optionally substituted alkynyl. In some embodiments, the modified internucleotide linkage comprises a triazole or alkyne moiety. In some embodiments, the triazole moiety, e.g., a triazolyl group, is optionally substituted. In some embodiments, the triazole moiety, e.g., a triazolyl group, is substituted. In some embodiments, the triazole moiety is unsubstituted. In some embodiments, the modified internucleotide linkage comprises an optionally substituted cyclic guanidine moiety. In some embodiments, the modified internucleotide linkage comprises an optionally substituted cyclic guanidine moiety and has the following structure: , , or (Here, W is O or S). In some embodiments, W is O. In some embodiments, W is S. In some embodiments, the linkage between negatively uncharged nucleotides is stereochemically controlled.

[0470] In some embodiments, the non-negatively charged internucleotide linkage or neutral internucleotide linkage is an internucleotide linkage comprising a triazole moiety. In some embodiments, the non-negatively charged internucleotide linkage or non-negatively charged internucleotide linkage comprises an optionally substituted triazolyl group. In some embodiments, the internucleotide linkage comprising a triazole moiety (e.g., an optionally substituted triazolyl group) has the following structure: In some embodiments, the internucleotide linkage comprising a triazole moiety has the following structure: . In some embodiments, internucleotide linkages, e.g., non-negatively charged internucleotide linkages, neutral internucleotide linkages, comprise a cyclic guanidine moiety. In some embodiments, internucleotide linkages comprising a cyclic guanidine moiety have the following structure: In some embodiments, non-negatively charged nucleotide linkages, or neutral nucleotide linkages, , It is a structure selected from or includes the same, where W is O or S.

[0471] In some embodiments, the linkage between nucleotides is a Tmg group ( Includes ). In some embodiments, the internucleotide linkage includes a Tmg group, and It has the structure of ("Tmg nucleotide linkage"). In some embodiments, the neutral nucleotide linkage includes the nucleotide linkage of PNA and PMO, and the Tmg nucleotide linkage.

[0472] In some embodiments, the negatively charged internucleotide linkage comprises an optionally substituted 3- to 20-membered heterocyclyl or heteroaryl group having 1 to 10 heteroatoms. In some embodiments, the negatively charged internucleotide linkage comprises an optionally substituted 3- to 20-membered heterocyclyl or heteroaryl group having 1 to 10 heteroatoms, wherein at least one heteroatom is nitrogen. In some embodiments, such a heterocyclyl or heteroaryl group is of a 5-membered ring. In some embodiments, such a heterocyclyl or heteroaryl group is of a 6-membered ring.

[0473] In some embodiments, the non-negatively charged internucleotide linkage comprises an optionally substituted 5- to 20-membered heteroaryl group having 1 to 10 heteroatoms. In some embodiments, the non-negatively charged internucleotide linkage comprises an optionally substituted 5- to 20-membered heteroaryl group having 1 to 10 heteroatoms, wherein at least one heteroatom is nitrogen. In some embodiments, the non-negatively charged internucleotide linkage comprises an optionally substituted 5- to 6-membered heteroaryl group having 1 to 4 heteroatoms, wherein at least one heteroatom is nitrogen. In some embodiments, the non-negatively charged internucleotide linkage comprises an optionally substituted 5-membered heteroaryl group having 1 to 4 heteroatoms, wherein at least one heteroatom is nitrogen. In some embodiments, the heteroaryl group is directly bonded to the linkage phosphorus. In some embodiments, the non-negatively charged internucleotide linkage comprises an optionally substituted triazolyl group. In some embodiments, the non-negatively charged internucleotide linkage comprises an unsubstituted triazolyl group, e.g., Includes. In some embodiments, the non-negatively charged internucleotide linkage is a substituted triazolyl group, e.g., Includes

[0474] In some embodiments, the non-negatively charged internucleotide linkage comprises an optionally substituted 5- to 20-membered heterocyclyl group having 1 to 10 heteroatoms. In some embodiments, the non-negatively charged internucleotide linkage comprises an optionally substituted 5- to 20-membered heterocyclyl group having 1 to 10 heteroatoms, wherein at least one heteroatom is nitrogen. In some embodiments, the non-negatively charged internucleotide linkage comprises an optionally substituted 5- to 6-membered heterocyclyl group having 1 to 4 heteroatoms, wherein at least one heteroatom is nitrogen. In some embodiments, the non-negatively charged internucleotide linkage comprises an optionally substituted 5-membered heterocyclyl group having 1 to 4 heteroatoms, wherein at least one heteroatom is nitrogen. In some embodiments, at least two heteroatoms are nitrogen. In some embodiments, the heterocyclyl group is directly bound to the linking phosphate. In some embodiments, the heterocyclyl group is bound to the linking phosphate through a linker, e.g., =N-, if it is part of a guanidine moiety directed to the linking phosphate through =N-. In some embodiments, the non-negatively charged internucleotide linkage is an optional substitution. It includes a group. In some embodiments, the non-negatively charged internucleotide linkages are substituted It includes a group. In some embodiments, the non-negatively charged internucleotide linkage is Includes the element. In some embodiments, each R 1 is an independently optional substitution C 1-6 It is an alkyl. In some embodiments, each R 1 is independently methyl.

[0475] In some embodiments, the modified nucleotide linkage, e.g., the negatively uncharged nucleotide linkage, comprises a triazole or alkyne moiety, each of which is optionally substituted. In some embodiments, the modified nucleotide linkage comprises a triazole moiety. In some embodiments, the modified nucleotide linkage comprises an unsubstituted triazole moiety. In some embodiments, the modified nucleotide linkage comprises a substituted triazole moiety. In some embodiments, the modified nucleotide linkage comprises an alkyl moiety. In some embodiments, the modified nucleotide linkage comprises an optionally substituted alkynyl group. In some embodiments, the modified nucleotide linkage comprises an unsubstituted alkynyl group. In some embodiments, the modified nucleotide linkage comprises a substituted alkynyl group. In some embodiments, the alkynyl group is directly bound to the linkage phosphorus.

[0476] In some embodiments, the HTT oligonucleotide comprises phosphate linkages between different types of nucleotides. In some embodiments, the chiral control oligonucleotide comprises at least one natural phosphate linkage and at least one modified (non-natural) nucleotide linkage. In some embodiments, the HTT oligonucleotide comprises at least one natural phosphate linkage and at least one phosphorothioate. In some embodiments, the HTT oligonucleotide comprises at least one negatively charged nucleotide linkage.

[0477] In some embodiments, the neutral or negatively charged internucleotide linkage has the structure of any neutral or negatively charged internucleotide linkage described in any of the following: US 9394333, US 9744183, US 9605019, US 9982257, US 20170037399, US 20180216108, US 20180216107, US 9598458, WO 2017 / 062862, WO 2018 / 067973, WO 2017 / 160741, WO 2017 / 192679, WO 2017 / 210647, WO 2018 / 098264, WO 2018 / 022473, WO 2018 / 223056, WO 2018 / 223073, WO 2018 / 223081, WO 2018 / 237194, WO 2019 / 032607, WO2019 / 032612, WO 2019 / 055951, and / or WO 2019 / 075357,2607, WO2019 / 032612, WO 2019 / 055951, and / or WO 2019 / 075357 (each of which a neutral or negatively uncharged internucleotide linkage is incorporated herein by reference).

[0478] In some embodiments, the linkage between neutral nucleotides is a chemical formula II-d-2 It has the structure of. In some embodiments, each R' is independently an optional substitution C 1-6 It is aliphatic. In some embodiments, each R' is independently an optional substitution C 1-6 It is an alkyl. In some embodiments, each R' is independently -CH3. In some embodiments, each R s is -H.

[0479] In some embodiments, the non-negatively charged internucleotide linkages have the following structure:

[0480]

[0481] . In some embodiments, W is O. In some embodiments, W is S. In some embodiments, the neutral nucleotide linkage is the negatively uncharged nucleotide linkage described above.

[0482] In some embodiments, the provided oligonucleotide comprises one or more negatively charged internucleotide linkages and / or one or more internucleotide linkages of formula I, Ia, Ib, Ic, In-1, In-2, In-3, In-4, II, II-a-1, II-a-2, II-b-1, II-b-2, II-c-1, II-c-2, II-d-1, or II-d-2.

[0483] In some embodiments, the HTT oligonucleotide comprises a linkage between neutral nucleotides and a linkage between chiral control nucleotides. In some embodiments, the HTT oligonucleotide comprises a linkage between neutral nucleotides and a linkage between chiral control nucleotides (which is not a linkage between neutral nucleotides). In some embodiments, the HTT oligonucleotide comprises a linkage between neutral nucleotides and a linkage between chiral control phosphorothioate nucleotides.

[0484] Without being bound by any particular theory, the present invention acknowledges that neutral nucleotide linkages may be more hydrophobic than phosphothioate nucleotide linkages (PS) (which may be more hydrophobic than natural phosphate linkages (PO). Typically, unlike PS or PO, neutral nucleotide linkages possess less charge. Without being bound by any particular theory, the present invention acknowledges that the inclusion of one or more neutral nucleotide linkages into an HTT oligonucleotide may increase the oligonucleotide's ability to be absorbed by the cell and / or escape from the endosome. Without being bound by any particular theory, the present invention acknowledges that the melting temperature of the duplex formed between the HTT oligonucleotide and its target nucleic acid can be adjusted by utilizing the inclusion of one or more neutral nucleotide linkages.

[0485] Without being bound by any particular theory, the present invention recognizes that the inclusion of one or more negatively charged nucleotide linkages, e.g., neutral nucleotide linkages, into an HTT oligonucleotide may be possible to increase the ability of the oligonucleotide to mediate functions such as gene knockdown. In some embodiments, an HTT oligonucleotide capable of mediating knockdown of the level of, e.g., nucleic acid or product encoded by it comprises one or more negatively charged nucleotide linkages. In some embodiments, an HTT oligonucleotide capable of mediating knockdown of the expression of, e.g., an HTT gene comprises one or more negatively charged nucleotide linkages.

[0486] In some embodiments, typical linkage, such as in natural DNA and RNA, is that the nucleotide linkage forms a bond with two sugars (which may be unmodified or modified as described herein). In many embodiments, as illustrated herein, the nucleotide linkage forms a bond with one optionally modified ribose or deoxyribose at its 5' carbon and a bond with another optionally modified ribose or deoxyribose at its 3' carbon through its oxygen atom. In some embodiments, each nucleoside unit linked by the nucleotide linkage independently comprises a nucleobase that is an optional substitution A, T, C, G, or U, or a substituted tautomeric isomer of A, T, C, G, or U.

[0487] In some embodiments, the HTT oligonucleotide comprises internucleotide linkages, wherein the negatively charged non-crosslinking oxygen of the regular phosphodiester linkage is replaced with a non-charged alkyl substituent, such as a methyl (Met) or ethyl (Et) group, as in P-alkyl phosphonate nucleic acids (phNA), such as P-methyl or P-ethyl phNA. For example, see [Micklefield et al. 2001 Curr. Med. Chem. 8, 1157-1179]; and [Arangundy-Franklin et al. 2019 Nat. Chem. 11, 533-542].

[0488] In some embodiments, the HTT oligonucleotide is a phosphonomethyl-threosyl nucleic acid (tPhoNA) and / or comprises a linkage between phosphonomethyl-threosyl nucleotides. [Liu et al. 2018 J. Am. Chem. Soc. 140, 6690-6699].

[0489] As understood by those skilled in the art, many different types of internucleotide linkages may be used according to the present invention (e.g., U.S. Patents No. 3,687,808; No. 4,469,863; No. 4,476,301; No. 5,177,195; No. 5,023,243; No. 5,034,506; No. 5,166,315; No. 5,185,444; No. 5,188,897; No. 5,214,134; No. 5,216,141; No. 5,235,033; No. 5,264,423; No. 5,264,564; No. 5,276,019; No. 5,278,302; No. 5,286,717; No. 5,321,131; No. 5,399,676; No. 5,405,938; No. 5,405,939; No. 5,434,257; No. 5,453,496; No. 5,455,233; No. 5,466,677; No. 5,466,677; No. 5,470,967; No. 5,476,925; No. 5,489,677; No. 5,519,126; No. 5,536,821; No. 5,541,307; No. 5,541,316; No. 5,550,111; No. 5,561,225; No. 5,563,253; No. 5,571,799; No. 5,587,361; No. 5,596,086; No. 5,602,240; No. 5,608,046; No. 5,610,289; No. 5,618,704; No. 5,623,070; No. 5,625,050; No. 5,633,360; No. 5,64,562; No. 5,663,312; No. 5,677,437; No. 5,677,439; No. 6,160,109; No. 6,239,265; No. 6,028,188; No. 6,124,445; No. 6,169,170; No. 6,172,209; No. 6,277,603; No. 6,326,199; No. 6,346,614; No. 6,444,423; No. 6,531,590; No. 6,534,639; No. 6,608,035; No. 6,683,167; No. 6,858,715; No. 6,867,294; No. 6,878,805; No. 7,015,315; No. 7,041,816; No. 7,273,933; No. 7,321,029;or as described in RE39464). In some embodiments, the modified internucleotide linkage is as described in US 9982257, US 20170037399, US 20180216108, WO 2017192664, WO 2017015575, WO 2017062862, WO 2018067973, WO 2017160741, WO 2017192679, WO 2017210647, WO 2018098264, PCT / US18 / 35687, PCT / US18 / 38835, or PCT / US18 / 51398, the respective nucleobases, sugars, internucleotide linkages, chiral co-agents / reagents, and oligonucleotide synthesis techniques (reagents, conditions, cycles, etc.) are independently incorporated herein by reference.;

[0490] In some embodiments, the linkage between each nucleotide in the HTT oligonucleotide is independently selected from natural phosphate linkages, phosphorothioate linkages, and negatively uncharged nucleotide linkages (e.g., n001). In some embodiments, the linkage between each nucleotide in the HTT oligonucleotide is independently selected from natural phosphate linkages, phosphorothioate linkages, and neutral nucleotide linkages (e.g., n001).

[0491] In some embodiments, the HTT oligonucleotide comprises one or more nucleotides that independently contain a phosphorus modification that is prone to "auto-releasing" under certain conditions. That is, under certain conditions, the specific phosphorus modification is designed to self-cleave from the oligonucleotide, for example, to provide a natural phosphate linkage. Specific examples of such phosphorus modification groups can be found in US 9982257. In some embodiments, the auto-releasing group comprises a morpholino group. In some embodiments, the auto-releasing group is characterized by the ability to deliver an agent to the phosphorus linker between nucleotides, said agent promoting further modification of the phosphorus atom, such as desulfurization, for example. In some embodiments, said agent is water and the further modification is hydrolysis to form a natural phosphate linkage.

[0492] In some embodiments, the HTT oligonucleotide comprises one or more internucleotide linkages that improve one or more of the pharmaceutical properties and / or activity of the oligonucleotide. It is well documented in the industry that certain oligonucleotides are rapidly degraded by nucleases and exhibit poor cellular uptake across the cytoplasmic membrane (References [Poijarvi-Virta et al., Curr. Med. Chem. (2006), 13(28);3441-65]; [Wagner et al., Med. Res. Rev. (2000), 20(6):417-51]; [Peyrottes et al., Mini Rev. Med. Chem. (2004), 4(4):395-408]; [Gosselin et al., (1996), 43(1):196-208]; [Bologna et al., (2002), Antisense & Nucleic Acid Drug Development 12:33-41]). Vives et al. (Nucleic Acids Research (1999), 27(20):4071-76) reported that tert-butyl sate pro-oligonucleotide exhibited significantly increased cell penetration compared to morpho-oligonucleotide under specific conditions.

[0493] In some embodiments, the present invention, at least in some cases, particularly, of a 5'-terminal and / or 3'-terminal S It is demonstrated that p-nucleotide linkages can improve oligonucleotide stability. In some embodiments, the present invention, in particular, natural phosphate linkages and / or R It is demonstrated that p-nucleotide linkages can improve the removal of oligonucleotides from the system. As understood by those skilled in the art, various analytical methods known in the art can be used to evaluate these properties according to the present invention.

[0494] To achieve desired oligonucleotide properties and / or activity, various types of nucleotide linkages may be used in combination with other structural elements, such as sugars. For example, the present invention routinely uses modified nucleotide linkages and modified sugars, optionally with natural phosphate linkages and natural sugars, in designing oligonucleotides. In some embodiments, the present invention provides an HTT oligonucleotide comprising one or more modified sugars.

[0495] In some embodiments, the present invention provides an HTT oligonucleotide comprising one or more modified sugars and one or more modified nucleotide linkages, one or more of which may be chiral controlled.

[0496] In some embodiments, in HTT oligonucleotides, chiral-controlled internucleotide linkages may appear in a specific pattern, which may affect one or more of the activities and / or properties of the oligonucleotides.

[0497] HTT Oligonucleotide Composition and Stereochemistry

[0498] In particular, the present invention provides various HTT oligonucleotide compositions. In some embodiments, the present invention provides oligonucleotide compositions of the oligonucleotides described herein. In some embodiments, an HTT oligonucleotide composition, for example, an HTT oligonucleotide composition, comprises a plurality of HTT oligonucleotides described in the present invention. In some embodiments, an HTT oligonucleotide composition, for example, an HTT oligonucleotide composition, is chiral controlled. In some embodiments, an HTT oligonucleotide composition, for example, an HTT oligonucleotide composition, is not chiral controlled (stereorandom).

[0499] The linking factor of natural phosphate linkages is achiral. The linking factor of many modified internucleotide linkages, for example, phosphorothioate internucleotide linkages, is chiral. In some embodiments, during the preparation of an oligonucleotide composition (e.g., in traditional phosphoramidite oligonucleotide synthesis), the arrangement of chiral linking factors is not intentionally designed or controlled, resulting in a chiral uncontrolled (stereorandom) oligonucleotide composition (substantially a racemic preparation) which is a complex random mixture of various stereoisomers (diastereoisomers) (in the case of an oligonucleotide having n chiral internucleotide linkages (where the linking factor is chiral), typically 2 n 2 stereoisomers (e.g., when n is 10) 10 =1,032; if n is 20, 2 20 = 1,048,576). These stereoisomers have the same composition but differ in the stereochemical pattern of the linking phosphorus.

[0500] In some embodiments, the stereorandom oligonucleotide composition has properties and / or activity sufficient for a specific purpose and / or application. In some embodiments, the stereorandom oligonucleotide composition may be cheaper and / or easier and simpler to produce than the chiral-controlled oligonucleotide composition.

[0501] However, in some embodiments, stereoisomers within the stereorandom composition may have different properties, activity, and / or toxicity, which may result in inconsistent therapeutic effects and / or unintended side effects caused by the stereorandom composition, particularly compared to a specific chiral-controlled oligonucleotide composition of the same composition.

[0502] In some embodiments, the present invention includes techniques for designing and manufacturing chiral-controlled HTT oligonucleotide compositions. In some embodiments, the present invention provides chiral-controlled oligonucleotide compositions of many oligonucleotides in Table 1 containing, for example, S and / or R in stereochemistry / linking. In some embodiments, the chiral-controlled oligonucleotide composition comprises a plurality of oligonucleotides at controlled / predetermined levels (not random as in stereorandom compositions), wherein the oligonucleotides share the same linkage stereochemistry in one or more chiral nucleotide-linkings (chiral-controlled nucleotide-linkings). In some embodiments, the oligonucleotides share the same backbone chiral center pattern (stereochemistry of linkage). In some embodiments, the backbone chiral center pattern is as described in the present invention. In some embodiments, the oligonucleotides are structurally identical.

[0503] In some embodiments, the level of diastereform purity of a plurality of oligonucleotides in the composition may be determined as the product of the diastereform purity of the linkage between each chiral control nucleotide in the oligonucleotide. In some embodiments, the diastereform purity of the linkage between two nucleosides in the HTT oligonucleotide (or nucleic acid) is expressed as the diastereform purity of the linkage between the nucleotides of the dimer linking the two nucleosides, wherein the dimer is prepared using comparable conditions, in some cases, the same synthesis cycle conditions.

[0504] In some embodiments, all chiral nucleotide linkages are chiral controlled, and the composition is a completely chiral controlled oligonucleotide composition. In some embodiments, not all chiral nucleotide linkages are chiral controlled nucleotide linkages, and the composition is a partially chiral controlled oligonucleotide composition.

[0505] Oligonucleotides may include or be composed of various backbone chiral center patterns (stereochemical patterns of chiral linkage nucleotides). Specific useful backbone chiral center patterns are described in the present invention. In some embodiments, a plurality of oligonucleotides share a common backbone chiral center pattern, which is or includes the pattern described in the present invention (e.g., as in “stereochemistry of linkage nucleotides and patterns thereof,” backbone chiral center patterns of chiral control oligonucleotides in Table 1).

[0506] In some embodiments, the chiral-controlled oligonucleotide composition is a chiral-pure (or stereo-pure, stereochemical-pure) oligonucleotide composition, wherein the oligonucleotide composition comprises a plurality of oligonucleotides, the oligonucleotides are identical [including each chiral element of the oligonucleotide containing each chiral linkage is independently defined (stereo-defined)], and the composition does not contain other stereoisomers. The chiral-pure (or stereo-pure, stereochemical-pure) oligonucleotide composition of HTT oligonucleotide stereoisomers does not contain other stereoisomers (as understood by those skilled in the art, one or more unintended stereoisomers may be present as impurities (exemplary purity is described in the present invention)).

[0507] Chiral-controlled oligonucleotide compositions can demonstrate numerous advantages over stereorandom oligonucleotide compositions. In particular, chiral-controlled oligonucleotide compositions are more uniform than corresponding stereorandom oligonucleotide compositions with respect to oligonucleotide structure. By controlling stereochemistry, compositions of individual stereoisomers can be prepared and evaluated, allowing for the development of chiral-controlled oligonucleotide compositions of stereoisomers with desired properties and / or activities. In some embodiments, chiral-controlled oligonucleotide compositions provide superior delivery, stability, elimination, activity, selectivity, and / or toxicity profiles compared, for example, with corresponding stereorandom oligonucleotide compositions. In some embodiments, chiral-controlled oligonucleotide compositions provide superior efficacy, fewer side effects, and / or a more convenient and effective administration regimen. In particular, backbone chiral center patterns as described herein can be used to provide controlled cleavage of oligonucleotide targets (e.g., transcripts, e.g., pre-mRNA, mature mRNA, etc.; including control of cleavage sites, the rate and / or extent of cleavage at the cleavage site, and / or the overall rate and extent of cleavage, etc.) and significantly increased HTT target selectivity.

[0508] In some embodiments, the HTT oligonucleotide composition comprises one or more stereocontrolled (chiral controlled; in some embodiments, stereopure) internucleotide linkages and one or more stereorandom internucleotide linkages.

[0509] In some embodiments, the HTT oligonucleotide composition comprises one or more stereocontrolled (chiral controlled; in some embodiments, stereopure) internucleotide linkages and one or more stereorandom internucleotide linkages.

[0510] In some embodiments, the HTT oligonucleotide composition comprises one or more stereocontrolled (e.g., chiral controlled or stereopure) internucleotide linkages and one or more stereorandom internucleotide linkages. These oligonucleotides may target various targets, may have various base sequences, and may be capable of operating through one or more of various modes (e.g., RNase H mechanism, steric hindrance, double or single-stranded RNA interference, exon skip regulation, CRISPR, aptamers, etc.).

[0511] Non-limiting examples of stereorandom oligonucleotide compositions, e.g., stereorandom HTT oligonucleotide compositions, are described herein and include, but are not limited to: WV-1027, WV-1028, WV-1029, WV-1030, WV-1031, WV-1032, WV-1033, WV-1034, WV-1035, WV-1036, WV-1037, WV-1038, WV-1039, WV-1040, WV-1041, WV-1042, WV-1043, WV-1044, WV-1045, WV-1046, WV-1047, WV-1048, WV-1049, WV-1050, WV-1051, WV-1052, WV-1053, WV-1054, WV-1055, WV-1056, WV-1057, WV-1058, WV-1059, WV-1060, WV-1061, WV-1062, WV-1063, WV-1064, WV-1065, WV-1066, WV-1067, WV-1068, WV-1069, WV-1070, WV-1071, WV-1072, WV-2023, WV-2024, WV-2025, WV-2026, WV-2027, WV-2028, WV-2029, WV-2030, WV-2031, WV-2032, WV-2033, WV-2034, WV-2035, WV-2036, WV-2037, WV-2038, WV-2039, WV-2040, WV-2041, WV-2042, WV-2043, WV-2044, WV-2045, WV-2046, WV-2047, WV-2048, WV-2049, WV-2050, WV-2051, WV-2052, WV-2053, WV-2054, WV-2055, WV-2056, WV-2057, WV-2058, WV-2059, WV-2060, WV-2061, WV-2062, WV-2063, WV-2064, WV-2065, WV-2066, WV-2067, WV-2068, WV-2069, WV-2070, WV-2071, WV-2072, WV-2073, WV-2074, WV-2075,WV-2076, WV-2077, WV-2078, WV-2079, WV-2080, WV-2081, WV-2082, WV-2083, WV-2084, WV-2085, WV-2086, WV-2087, WV-2088, WV-2089, WV-2090, WV-2605, WV-2606, WV-2607, WV-2608, WV-2609, WV-2610, WV-2611, WV-2612, WV-2613, WV-2614, WV-2615, WV-2616, WV-2617, WV-2618, WV-2619 WV-2620, WV-13625, WV-13626, WV-13627, WV-13628, WV-13629, WV-13630, WV-13631, WV-13632, WV-13633, WV-13634, WV-13635, WV-13646, WV-13647, WV-13648, WV-13649, WV-13650, WV-13651, WV-13652, WV-13653, WV-13654, WV-13655, WV-13656, and WV-13667.

[0512] Non-limiting examples of stereopurity (or chiral control) oligonucleotide compositions, e.g. stereopurity (or chiral control) HTT oligonucleotide compositions, are described herein and include, but are not limited to: WV-2269, WV-2270, WV-2271, WV-2272, WV-2374, WV-2375, WV-2380, WV-2416, WV-2417, WV-2418, WV-2419, WV-2431, WV-2589, WV-2590, WV-2591, WV-2592, WV-2593, WV-2594, WV-2595, WV-2596, WV-2597, WV-2598, WV-2599, WV-2600, WV-2601, WV-2602, WV-2603, WV-2604, WV-2659, WV-2671, WV-2672, WV-2673, WV-2674, WV-2675, WV-2676, WV-2682, WV-2683, WV-2684, WV-2685, WV-2686, WV-2687, WV-2688, WV-2689, WV-2690, WV-2691, WV-2692, WV-2732, WV-13952, WV-13953, WV-13954, WV-13955, WV-13956, WV-13957, WV-13958, WV-13959, WV-13960, WV-13961, WV-13962, WV-14059, WV-14060, WV-14061, WV-14062, WV-14063, WV-14064, WV-14065, WV-14066, WV-14067, WV-14068, WV-14069, WV-14070, WV-14071, WV-14072, WV-14073, WV-14074, WV-14075, WV-14076, WV-14077, WV-14078, WV-14079, WV-14080, WV-14081, WV-14082, WV-14083, WV-14084, WV-14085, WV-14086, WV-14092, WV-14093, WV-14094, WV-14095, WV-14096, WV-14097, WV-14098,WV-14099, WV-14100, WV-14101, WV-14133, WV-14134, WV-14135, WV-14136, WV-14137, WV-14138, WV-14139, and WV-14140.,

[0513] Non-limiting examples of oligonucleotide compositions comprising one or more stereocontrolled (e.g., chiral controlled or stereopure) internucleotide linkages and one or more stereorandom internucleotide linkages, e.g., HTT oligonucleotide compositions, include but are not limited to the following: WV-13636, WV-13637, WV-13638, WV-13639, WV-13640, WV-13641, WV-13642, WV-13643, WV-13644, WV-13645, WV-13657, WV-13658, WV-13659, WV-13660, WV-13661, WV-13662, WV-13663, WV-13664, WV-13665, WV-13666.

[0514] In some embodiments, the present invention provides a chiral-controlled oligonucleotide composition, for example, a chiral-controlled HTT oligonucleotide composition. In some embodiments, the provided chiral-controlled oligonucleotide composition comprises a plurality of HTT oligonucleotides of the same composition and has one or more internucleotide linkages. In some embodiments, for example, the plurality of oligonucleotides in the chiral-controlled oligonucleotide composition are a plurality of HTT oligonucleotides selected from Table 1, wherein the oligonucleotides have at least one chiral-controlled internucleotide linkage. R p or SIt includes p-linking elements. In some embodiments, for example, a plurality of oligonucleotides in a chiral-controlled oligonucleotide composition are a plurality of HTT oligonucleotides selected from Table 1, wherein the linkage between each phosphorothioate nucleotide in the oligonucleotide is independently chiral-controlled (the linkage between each phosphorothioate nucleotide is independently R p or S p). In some embodiments, the HTT oligonucleotide composition, e.g., the HTT oligonucleotide composition, is a substantially pure single oligonucleotide preparation in that the oligonucleotides in the composition, which are not single oligonucleotides, are, in some cases, impurities from the manufacturing process of single oligonucleotides after a specific purification procedure. In some embodiments, the single oligonucleotide is the HTT oligonucleotide of Table 1, wherein the linkage between each chiral nucleotide of the oligonucleotide is chiral controlled (e.g., indicated by S or R rather than X in "stereochemistry / linkage").

[0515] In some embodiments, the chiral-controlled oligonucleotide composition may have increased activity and / or stability, increased delivery, and / or reduced ability to induce adverse effects such as complement, TLR9 activation, compared to the corresponding stereorandom oligonucleotide composition. In some embodiments, the stereorandom (chiral-uncontrolled) oligonucleotide composition differs from the chiral-controlled oligonucleotide composition in that the corresponding plurality of oligonucleotides do not contain linkages between chiral-controlled nucleotides, but the stereorandom oligonucleotide composition is identical to the chiral-controlled oligonucleotide composition.

[0516] In some embodiments, the present invention relates to a chiral-controlled HTT oligonucleotide composition capable of reducing the level, activity, or expression of the HTT gene or its gene product.

[0517] In some embodiments, the present invention provides a chiral-controlling HTT oligonucleotide composition comprising a plurality of oligonucleotides sharing a common base sequence that is or includes a base sequence disclosed herein (e.g., in Table 1 (wherein each T may be independently replaced with U and vice versa)) or a span thereof (e.g., at least 10 or 15 junction bases) which can reduce the level, activity, or expression of the HTT gene or its gene product. In some embodiments, the present invention provides a chiral-controlling HTT oligonucleotide composition comprising a plurality of oligonucleotides sharing a common base sequence that is or includes a base sequence disclosed herein (e.g., in Table 1 (wherein each T may be independently replaced with U and vice versa)). In some embodiments, the present invention provides a chiral-controlled HTT oligonucleotide composition comprising a plurality of oligonucleotides sharing a common base sequence, which is the base sequence disclosed herein (e.g., in Table 1, wherein each T can be independently replaced with U and vice versa), which can reduce the level, activity, or expression of the HTT gene or its gene product.

[0518] In some embodiments, the provided chiral-controlled oligonucleotide composition is a chiral-controlled HTT oligonucleotide composition comprising a plurality of HTT oligonucleotides. In some embodiments, the chiral-controlled oligonucleotide composition is a chiral-pure (or "stereochemically-pure") oligonucleotide composition. In some embodiments, the present invention provides a chiral-pure oligonucleotide composition of the HTT oligonucleotides of Table 1, wherein the linkage between each chiral nucleotide of the oligonucleotide is independently chiral-controlled (e.g.,R p or S p may be determined from R or S rather than X in "stereochemistry / linking"). As will be understood by those skilled in the art, chemical selectivity rarely achieves completeness (absolute 100%). In some embodiments, the chiral pure oligonucleotide composition comprises a plurality of oligonucleotides, said plurality of oligonucleotides being structurally identical and all having the same structure (identical stereoisomer forms; typically, in the context of oligonucleotides, a diastereomer form identical to the typical multiple chiral center is present in the HTT oligonucleotide), and the chiral pure oligonucleotide composition does not contain any other stereoisomers (typically diastereomers because the multiple chiral center is typically present in the HTT oligonucleotide; for example, to the extent achievable by stereoselective preparation). As understood by those skilled in the art, stereorandom (or "racemic," "chiral uncontrolled") oligonucleotide compositions are random mixtures of many stereoisomers (e.g., 2 n 10 diastereomers (where n is the number of chiral linkages for an oligonucleotide in which other chiral centers (e.g., carbon chiral centers in the sugar) are chiral-controlled and exist independently as a single arrangement, and only the chiral linkage center is not chiral-controlled)).

[0519] Specific data indicating the characteristics and / or activity of chiral control oligonucleotide compositions, for example, chiral control HTT oligonucleotide compositions, in reducing the level, activity, and / or expression of the HTT gene or its gene product are exemplified, for example, in the Examples section of this document.

[0520] In some embodiments, the present invention provides an HTT oligonucleotide composition comprising an oligonucleotide comprising at least one chiral linking factor. In some embodiments, the present invention provides an HTT oligonucleotide composition comprising an HTT oligonucleotide comprising at least one chiral linking factor. In some embodiments, the present invention provides an HTT oligonucleotide composition in which the HTT oligonucleotide comprises a link between chiral-controlled phosphothioate nucleotides, wherein the linking factor R It has a p-arrangement. In some embodiments, the present invention provides an HTT oligonucleotide composition comprising a linkage between chiral-controlled phosphorothioate nucleotides, wherein the linkage is S It has a p array.

[0521] In some embodiments, the provided chiral-controlled oligonucleotide composition (e.g., chiral-controlled HTT oligonucleotide composition) is remarkably effective compared to a reference oligonucleotide composition. In some embodiments, the desired biological effect (e.g., as a reduction in the level is measured by a reduction in the level of the targeted mRNA, protein, etc.) may be enhanced by more than 5, 10, 15, 20, 25, 30, 40, 50, or 100 times (e.g., as measured by the residual level of the mRNA, protein, etc.). In some embodiments, the change is measured by a reduction in the unwanted mRNA level compared to the reference condition. In some embodiments, the change is measured by an increase in the desired mRNA level compared to the reference condition. In some embodiments, the change is measured by a reduction in the unwanted mRNA level compared to the reference condition. In some embodiments, the reference condition is, for example, the absence of treatment with the chiral-controlled oligonucleotide composition. In some embodiments, the reference condition is a corresponding stereorandom composition of oligonucleotides having the same composition.

[0522] In some embodiments, the present invention provides a chiral-controlled oligonucleotide composition, e.g., a chiral-controlled HTT oligonucleotide composition, wherein the linking agent of at least one chiral-controlled nucleotide linkage is S p. In some embodiments, the present invention provides a chiral-controlled oligonucleotide composition, e.g., a chiral-controlled HTT oligonucleotide composition, wherein the majority of the linking factors of the chiral-controlled internucleotide linkages are Sp. In some embodiments, about 50% to 100%, 55% to 100%, 60% to 100%, 65% to 100%, 70% to 100%, 75% to 100%, 80% to 100%, 85% to 100%, 90% to 100%, 55% to 95%, 60% to 95%, 65% to 95%, or about 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 99% or more of all chiral control nucleotide linkages (or all chiral nucleotide linkages, or all nucleotide linkages) are p. S p. In some embodiments, the present invention provides a chiral-controlled oligonucleotide composition, e.g., a chiral-controlled HTT oligonucleotide composition, wherein the linkage between the majority of chiral nucleotides is chiral-controlled and the linkage in S It is p.

[0523] In some embodiments, the present invention provides a chiral-controlled oligonucleotide composition, e.g., a chiral-controlled HTT oligonucleotide composition, wherein the linkage between each chiral nucleotide is chiral-controlled and each chiral linkage is S p. In some embodiments, the present invention provides a chiral-controlled oligonucleotide composition, e.g., a chiral-controlled HTT oligonucleotide composition, wherein at least one linkage between chiral-controlled nucleotides is R It has a p-linkage. In some embodiments, the present invention provides a chiral-controlled oligonucleotide composition, e.g., a chiral-controlled HTT oligonucleotide composition, wherein at least one chiral-controlled nucleotide linkage is R A linkage between at least one chiral control nucleotide containing a p linkage factor is S p includes the connection factor.

[0524] In some embodiments, the present invention provides a chiral-controlled oligonucleotide composition, wherein the linkage between at least two chiral-controlled nucleotides has a different linkage stereochemistry and / or a different P-modification with respect to each other, and the P-modification is a modification in the linkage. In some embodiments, the present invention provides a chiral-controlled oligonucleotide composition, wherein the linkage between at least two chiral-controlled nucleotides has a different stereochemistry with respect to each other, and the backbone chiral center pattern of the oligonucleotide is characterized by a repeating pattern of alternating stereochemistry.

[0525] In a specific embodiment, the present invention provides a chiral-controlled oligonucleotide composition comprising a plurality of oligonucleotides, wherein at least two individual nucleotide connections in each oligonucleotide have different P-modifications relative to each other. In a specific embodiment, the present invention provides a chiral-controlled oligonucleotide composition comprising a plurality of oligonucleotides, wherein at least two individual nucleotide connections in each oligonucleotide have different P-modifications relative to each other, and each oligonucleotide includes a natural phosphate linkage. In a specific embodiment, the present invention provides a chiral-controlled oligonucleotide composition comprising a plurality of oligonucleotides, wherein at least two individual nucleotide connections in each oligonucleotide have different P-modifications relative to each other, and each oligonucleotide includes a phosphorothioate nucleotide linkage.

[0526] In a specific embodiment, the present invention provides a chiral-controlled oligonucleotide composition comprising a plurality of oligonucleotides, wherein at least two individual nucleotide connections in each oligonucleotide have different P-modifications relative to each other, and each oligonucleotide comprises a natural phosphate linkage and a phosphorothioate nucleotide linkage. In a specific embodiment, the present invention provides a chiral-controlled oligonucleotide composition comprising a plurality of oligonucleotides, wherein at least two individual nucleotide connections in each oligonucleotide have different P-modifications relative to each other, and each oligonucleotide comprises a phosphorothioate tryst nucleotide linkage. In a specific embodiment, the present invention provides a chiral-controlled oligonucleotide composition comprising a plurality of oligonucleotides, wherein at least two individual nucleotide connections in each oligonucleotide have different P-modifications relative to each other, and each oligonucleotide comprises a natural phosphate linkage and a phosphorothioate tryst nucleotide linkage. In a specific embodiment, the present invention provides a chiral-controlled oligonucleotide composition comprising a plurality of oligonucleotides, wherein at least two individual nucleotide linkages in each oligonucleotide have different P-modifications relative to each other, and each oligonucleotide comprises a phosphorothioate nucleotide linkage and a phosphorothioate trystine nucleotide linkage.

[0527] In some embodiments, the present invention provides a chiral-controlled oligonucleotide composition, for example, a chiral-controlled HTT oligonucleotide composition (comprising a plurality of oligonucleotides sharing a common base sequence which is the base sequence of the HTT oligonucleotide disclosed herein), wherein at least one linkage between nucleotides is chiral-controlled.

[0528] Backbone chiral center patterns and stereochemistry

[0529] In contrast to natural phosphate linkages, the linking factor of chiral modified internucleotide linkages, e.g., phosphorothioate internucleotide linkages, is chiral. In particular, the present invention provides techniques (e.g., oligonucleotides, compositions, methods, etc.) comprising the control of the stereochemistry of the chiral linking factor in chiral internucleotide linkages. In some embodiments, as demonstrated herein, the control of stereochemistry may provide improved properties and / or activity, including desired stability, reduced toxicity, and improved reduction of HTT nucleic acids. In some embodiments, the present invention provides a backbone chiral center pattern useful for oligonucleotides and / or regions thereof, said pattern comprising each chiral linking factor of the chiral linking factor ( R p or S The combination of stereochemistry of p), the indication of each achiral linkage (if any, Op), etc. (from 5' to 3'). In some embodiments, the backbone chiral center pattern can control the cleavage pattern of the HTT nucleic acid when the HTT nucleic acid comes into contact with a provided oligonucleotide or a composition thereof in a cleavage system (e.g., in vitro assay, cell, tissue, organ, organism, subject, etc.).

[0530] In some embodiments, a backbone chiral center pattern improves the cleavage efficiency and / or selectivity of the HTT nucleic acid when the HTT nucleic acid comes into contact with a provided oligonucleotide or a composition thereof in a cleavage system.

[0531] In some embodiments, the HTT oligonucleotide (or its wing, core, block, or any part) may comprise any chiral center pattern described in any of the following: WO2017015555; WO2017192664; W00201200366; WO2011 / 034072; WO2014 / 010718; WO2015 / 108046; WO2015 / 108047; WO2015 / 108048; WO 2011 / 005761; WO 2011 / 108682; WO 2012 / 039448; WO 2018 / 067973; WO2005 / 028494; WO2005 / 092909; WO2010 / 064146; WO2012 / 073857; WO2013 / 012758; WO2014 / 010250; WO2014 / 012081; WO2015 / 107425; WO2017 / 015555; WO2017 / 015575; WO2017 / 062862; WO2017 / 160741; WO2017 / 192664; WO2017 / 192679; WO2017 / 210647; WO2018 / 022473; or WO2018 / 098264 (its chiral center pattern is included for reference).

[0532] In some embodiments, the oligonucleotides in the chiral-controlled oligonucleotide composition comprise at least two nucleotide linkages, each having different stereochemistry and / or different P-modifications relative to each other. In some embodiments, the at least two nucleotide linkages have different stereochemistry relative to each other, and the oligonucleotides comprise a backbone chiral center pattern comprising a stereochemistry that is an alternating linkage.

[0533] In some embodiments, the phosphorothioate triester linkage comprises a chiral cofactor, which is used to control the stereoselectivity of the coupling reaction, for example, in the HTT oligonucleotide synthesis cycle. In some embodiments, the phosphorothioate triester linkage does not comprise a chiral cofactor. In some embodiments, the phosphorothioate triester linkage is intentionally maintained until and / or during administration of the oligonucleotide composition to the subject.

[0534] In some embodiments, the oligonucleotide is linked to a solid support. In some embodiments, the solid support is a support for oligonucleotide synthesis. In some embodiments, the solid support comprises glass. In some embodiments, the solid support is CPG (controlled pore glass). In some embodiments, the solid support is a polymer. In some embodiments, the solid support is polystyrene. In some embodiments, the solid support is highly cross-linked polystyrene (HCP). In some embodiments, the solid support is a hybrid support of controlled pore glass (CPG) and highly cross-linked polystyrene (HCP). In some embodiments, the solid support is a metal foam. In some embodiments, the solid support is a resin. In some embodiments, the oligonucleotide is cleaved from the solid support.

[0535] In some embodiments, the purity, particularly stereochemical purity, and particularly diastereomer purity of many oligonucleotides and their composition (wherein all other chiral centers of the oligonucleotide except the chiral linking center are stereodefined) (e.g., carbon chiral centers in the sugar defined in the phosphoramidite for oligonucleotide synthesis) can be controlled by stereoselectivity at the chiral linking center during the coupling step when forming a link between chiral nucleotides (diastereselectivity in many cases of oligonucleotide synthesis as understood by those skilled in the art (wherein the oligonucleotide contains more than one chiral center)). In some embodiments, the coupling step has 60% stereoselectivity at the linking center (diastereselectivity when other chiral centers are present). After these coupling steps, the newly formed internucleotide linkages may be described as having a stereochemical purity of 60% (in the case of oligonucleotides, typically diastereomer purity considering the presence of other chiral centers). In some embodiments, each coupling step independently has a stereoselectivity of at least 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5%.

[0536] In some embodiments, each coupling step independently has virtually 100% stereoselectivity.

[0537] In some embodiments, the coupling step has virtually 100% stereoselectivity in that all detectable products from the coupling step analyzed by an analytical method (e.g., NMR, HPLC, etc.) have the intended stereoselectivity. In some embodiments, the chiral-controlled internucleotide linkage is typically formed with stereoselectivity of at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99.5%, or virtually 100% (at least 90% in some embodiments; at least 95% in some embodiments; at least 96% in some embodiments; at least 97% in some embodiments; at least 98% in some embodiments; at least 99% in some embodiments). In some embodiments, each chiral-controlled internucleotide linkage independently has a stereochemical purity of at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99.5% or virtually 100% (at least 90% in some embodiments; at least 95% in some embodiments; at least 96% in some embodiments; at least 97% in some embodiments; at least 98% in some embodiments; at least 99%) (typically diastereomer purity in the case of oligonucleotides having multiple chiral centers).

[0538] In some embodiments, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 couplings of the monomer (phosphoramidite for oligonucleotide synthesis in many embodiments as understood by those skilled in the art) independently have stereoselectivity of about 60%, 70%, 80%, 85%, or less than 90% [in the case of oligonucleotide synthesis, typically, distereoselectivity for the chiral center(s) that are the formed linkage].

[0539] In some embodiments, the stereochemical purity, for example, the purity of the diastereomer, is about 60% to 100%.

[0540] In some embodiments, the compounds of the present invention (e.g., oligonucleotides, chiral cofactors, etc.) comprise multiple chiral elements (e.g., multiple carbon and / or phosphorus (e.g., linking phosphorus of a link between chiral nucleotides) chiral centers). In some embodiments, at least 1, 2, 3, 4, 5, 6, 7, 8, 9 or more chiral elements of the provided compounds (e.g., HTT oligonucleotides) each independently have diastereomer purity as described herein.

[0541] As understood by those skilled in the art, in some embodiments, the diastereoselectivity of the coupling or the diastereoisomer purity of the center of the chiral linkage can be evaluated through the diastereoisomer purity of the dimer prepared under the same or comparable conditions or the diastereoselectivity of the dimer formation, wherein the dimer has the same 5'- and 3'-nucleoside and nucleotide-nucleotide linkages.

[0542] Various techniques may be used for the identification or confirmation of the stereochemistry of chiral elements (e.g., arrangement of chiral linking factors) and / or backbone chiral center patterns, and / or the evaluation of stereoselectivity (e.g., diastereoselectivity of the coupling step in oligonucleotide synthesis) and / or stereochemical purity (e.g., internucleotide linkage, purity of diastereoisomers of compounds (e.g., oligonucleotides), etc.). Exemplary techniques include NMR [e.g., 1D (one-dimensional) and / or 2D (two-dimensional) 1 H- 31This includes the cleavage of internucleotide links by PHETCORS (heteronuclear correlation spectroscopy), HPLC, RP-HPLC, mass spectrometry, LC-MS, and stereospecific nucleases (which may be used individually or in combination). Examples of useful nucleases include benzonases, micrococcus nucleases, and svPDEs (snake venom phosphodiesterases) (these are R Linkages between specific nucleotides having a p-linking factor (e.g., R specific to p-phosphorothioate linkage); and nuclease P1, mung bean nuclease and nuclease S1 (these are S A linkage between nucleotides having a p-link (e.g., S Includes p-phosphorothioate linkage) specific). Without being bound by any particular theory, the present invention acknowledges that in at least some cases, the cleavage of oligonucleotides by certain nucleases may be influenced by structural factors, e.g., chemical modifications (e.g., 2'-modification of the sugar), base sequence, or stereochemical context. For example, in some cases, R Benzonases and micrococcone nucleases specific to internucleotide linkages containing p-linking molecules S p Phosphorothioate internucleotide linkages are isolated on the side R It is observed that p phosphorothioate could not cleave the link between nucleotides.

[0543] In some embodiments, a plurality of HTT oligonucleotides share the same composition. In some embodiments, a plurality of HTT oligonucleotides are identical (identical stereoisomers). In some embodiments, a chiral-controlled oligonucleotide composition, e.g., a chiral-controlled HTT oligonucleotide composition, is a stereopure oligonucleotide composition in which a plurality of oligonucleotides are identical (identical stereoisomers) and the composition does not contain any other stereoisomers. Those skilled in the art will understand that one or more other stereoisomers may be present as impurities, as the process, selectivity, purification, etc., may not achieve completeness.

[0544] In some embodiments, the provided composition is characterized in that when it comes into contact with HTT nucleic acid [e.g., HTT transcripts [e.g., free-mRNA, mature mRNA, other types of RNA, etc. (hybridized with the oligonucleotides of the composition)], the level of HTT nucleic acid and / or the product encoded by it (e.g., protein) is reduced compared to that observed under reference conditions. In some embodiments, the reference conditions are selected from the group consisting of the absence of the composition, the presence of a reference composition, and combinations thereof. In some embodiments, the reference conditions are the absence of the composition. In some embodiments, the reference conditions are the presence of a reference composition. In some embodiments, the reference composition is a composition in which its oligonucleotides do not hybridize with HTT nucleic acid. In some embodiments, the reference composition is a composition in which its oligonucleotides do not contain a sequence in which they are sufficiently complementary to HTT nucleic acid. In some embodiments, the provided composition is a chiral-controlled oligonucleotide composition, and the reference composition is the same chiral-uncontrolled oligonucleotide composition except that it is not chiral-controlled (e.g., a racemic preparation of oligonucleotides having the same composition as the oligonucleotides in the chiral-controlled oligonucleotide composition (e.g., a plurality of those of a specific oligonucleotide type, etc.)).

[0545] As indicated above and understood in the art, in some embodiments, the base sequence of the HTT oligonucleotide may indicate the identity and / or modified state of the nucleoside residues in the oligonucleotide (e.g., sugar and / or base components) (compared to standard naturally occurring nucleotides, e.g., adenine, cytosine, guanosine, thymine, and uracil) and / or indicate the hybridization characteristics of these residues (i.e., the ability to hybridize with specific complementary residues).

[0546] As demonstrated herein, oligonucleotide structural elements (e.g., patterns such as sugar modifications, backbone linkages, backbone chiral centers, backbone phosphorus modifications, etc.) and combinations thereof can provide surprisingly improved properties and / or viability.

[0547] In some embodiments, the oligonucleotide composition may reduce the expression, level, and / or activity of the HTT gene or its gene product. In some embodiments, the oligonucleotide composition may reduce the expression, level, and / or activity of the HTT gene or its gene product by sterically blocking translation into HTT mRNA (e.g., free-mRNA or mature mRNA) by cleavage of said mRNA. In some embodiments, the provided HTT oligonucleotide composition may reduce the expression, level, and / or activity of the HTT gene or its gene product. In some embodiments, the provided HTT oligonucleotide composition may reduce the expression, level, and / or activity of the HTT gene or its gene product by sterically blocking translation into HTT mRNA by cleavage of HTT mRNA (free-mRNA or mature mRNA) and / or by altering or interfering with mRNA splicing.

[0548] In some embodiments, the HTT oligonucleotide composition, for example, the HTT oligonucleotide composition is a substantially pure single oligonucleotide stereoisomer preparation in that the oligonucleotides in the composition that are not oligonucleotide stereoisomers are, in some cases, impurities from the manufacturing process of said oligonucleotide stereoisomers after a specific purification procedure.

[0549] In some embodiments, the present invention provides chiral-controlled and stereopure oligonucleotides and oligonucleotide compositions. For example, in some embodiments, the provided composition comprises one or more individual oligonucleotide types at non-random or controlled levels. In some embodiments, oligonucleotides of the same oligonucleotide type are identical.

[0550] sugar

[0551] Various sugars, including modified sugars, may be used according to the present invention. In some embodiments, the present invention provides sugar modifications and patterns thereof that can provide improved properties and / or activity when incorporated into oligonucleotides (optionally combined with other structural elements (e.g., nucleotide-interlinking modifications and patterns thereof, backbone chiral center patterns thereof, etc.)).

[0552] The most common naturally occurring nucleosides include a ribose sugar (e.g., in RNA) or a deoxyribose sugar (e.g., in DNA) linked to a nucleobase adenosine (A), cytosine (C), guanine (G), thymine (T), or uracil (U). In some embodiments, the sugar, e.g., the various sugars in many of the oligonucleotides in Table 1 (unless otherwise noted), is It is a natural DNA sugar (in DNA nucleic acids or oligonucleotides) having the structure, wherein a nucleobase is attached to the 1' position and the 3' and 5' positions are connected to the internucleotide linkage (as understood by those skilled in the art, if at the 5'-terminus of an HTT oligonucleotide, the 5' position may be connected to a 5'-terminal group (e.g., -OH), and if at the 3'-terminus of an HTT oligonucleotide, the 3' position may be connected to a 3'-terminal group (e.g., -OH)). In some embodiments, the sugar is It is a natural RNA sugar (in RNA nucleic acid or oligonucleotide) having the structure, wherein the nucleobase is attached to the 1' position, and the 3' and 5' positions are connected to the nucleotide linkage (as understood by those skilled in the art, if at the 5'-terminus of an HTT oligonucleotide, the 5' position may be connected to a 5'-terminal group (e.g., -OH), and if at the 3'-terminus of an HTT oligonucleotide, the 3' position may be connected to a 3'-terminal group (e.g., -OH)). In some embodiments, the sugar is a modified sugar in that it is not a natural DNA sugar or a natural RNA sugar. In particular, the modified sugar may provide enhanced stability. In some embodiments, one or more hybridization properties may be altered and / or optimized using the modified sugar. In some embodiments, HTT nucleic acid recognition may be altered and / or optimized using the modified sugar. In some embodiments, Tm may be optimized using the modified sugar. In some embodiments, modified sugars can be used to enhance oligonucleotide activity.

[0553] Sugars can be attached to nucleotide linkages at various positions. As a non-limiting example, nucleotide linkages can be attached to the 2', 3', 4', or 5' positions of the sugar. In some embodiments, as is most commonly seen in natural nucleic acids, nucleotide linkages are attached to one sugar at the 5' position and to another sugar at the 3' position.

[0554] In some embodiments, the sugar is a selectively substituted natural DNA or RNA sugar. In some embodiments, the substituent, sugar, modified sugar and / or sugar modification is US 9394333, US 9744183, US 9605019, US 9982257, US 20170037399, US 20180216108, US 20180216107, US 9598458, WO 2017 / 062862, WO 2018 / 067973, WO 2017 / 160741, WO 2017 / 192679, WO 2017 / 210647, WO 2018 / 098264, WO 2018 / 022473, WO 2018 / 223056, WO 2018 / 223073, WO As described in WO 2018 / 223081, WO 2018 / 237194, WO 2019 / 032607, WO 2019 / 032612, WO 2019 / 055951, and / or WO 2019 / 075357, each of which substituents, sugar modifications, and modified sugars are independently incorporated herein by reference. Various such sugars are used in Table 1.

[0555] In some embodiments, the sugar is a bicyclic sugar. In some embodiments, the sugar is selected from LNA sugar, BNA sugar, cEt sugar, etc.

[0556] In some embodiments, the sugar is a 2'-OMe, 2'-MOE, 2'-F, LNA (locking nucleic acid), ENA (ethylene cross-linked nucleic acid), BNA (NMe) (methylamino cross-linked nucleic acid), 2'-F ANA (2'-F arabinose), alpha-DNA (alpha-D-ribose), 2' / 5' ODN (e.g., 2' / 5' linked oligonucleotide), Inv (invert sugar, e.g., invert deoxyribose), AmR (amino-ribose), ThioR (thio-ribose), HNA (hexos nucleic acid), CeNA (cyclohexene nucleic acid), or MOR (morpholino) sugar.

[0557] In some embodiments, the provided oligonucleotide comprises one or more modified sugars. In some embodiments, the provided oligonucleotide comprises one or more modified sugars and one or more natural sugars.

[0558] Examples of bicyclic sugars include alpha-L-methyleneoxy(4'-CH2-O-2') LNA, beta-D-methyleneoxy(4'-CH2-O-2') LNA, ethyleneoxy(4'-(CH2)2-O-2') LNA, aminooxy(4'-CH2-ON(R)-2') LNA, and oxyamino(4'-CH2-N(R)-O-2') LNA. In some embodiments, the bicyclic sugar, e.g., LNA or BNA sugar, is a sugar having at least one crosslink between two sugar carbons. In some embodiments, the bicyclic sugar of the nucleoside may have the stereochemical arrangement of alpha-L-ribofuranose or beta-D-ribofuranose. In some embodiments, the sugar is the sugar described in WO 1999014226. In some embodiments, the 4'-2' discyclic sugar or 4'→2' discyclic sugar is a discyclic sugar comprising a furanose ring comprising a crosslinker connecting the 2' carbon atom and the 4' carbon atom of the sugar ring. In some embodiments, the discyclic sugar, e.g., LNA or BNA sugar, comprises at least one crosslinker between two pentopuranosyl sugar carbons. In some embodiments, the LNA or BNA sugar comprises at least one crosslinker between two 4' and 2' pentopuranosyl sugar carbons.

[0559] In some embodiments, the dicyclic sugar may be further defined by an isomer arrangement.

[0560] Specific modified sugars (e.g., bicyclic sugars having 4'→2' crosslinking groups such as 4'-CH2-O-2' and 4'-CH2-S-2'), their preparation and / or use are described in the literature [Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222]; WO 1999014226, etc. 2'-amino-BNA, which can provide conformational restriction and high affinity in some cases, is described, for example, in the literature [Singh et al., J. Org. Chem., 1998, 63, 10035-10039]. Additionally, the thermal stability of 2'-amino- and 2'-methylamino-BNA sugars and their duplexes containing complementary RNA and DNA strands has been previously reported.

[0561] In some embodiments, the sugar is a bicyclic sugar having a hydrocarbon crosslinker, e.g., a 4'-(CH2)3-2' crosslinker, a 4'-CH=CH-CH2-2' crosslinker, etc. (e.g., Freier et al., Nucleic Acids Research, 1997, 25(22), 4429-4443; Albaek et al., J. Org. Chem., 2006, 71, 7731-7740), etc.). Exemplary preparations of such bicyclic sugars and nucleosides have been reported along with their oligomerization and biochemical studies (e.g., Srivastava et al., J. Am. Chem. Soc. 2007, 129(26), 8362-8379).

[0562] In some embodiments, the dicyclic sugar is alpha-L-methyleneoxy(4'-CH2-O-2') BNA, beta-D-methyleneoxy(4'-CH2-O-2') BNA, ethyleneoxy(4'-(CH2)2-O-2') BNA, aminooxy(4'-CH2-ON(R)-2') BNA, oxyamino(4'-CH2-N(R)-O-2') BNA, methyl(methyleneoxy)(4'-CH(CH3)-O-2') BNA (also referred to as limited ethyl or cEt), methylene-thio(4'-CH2-S-2') BNA, methylene-amino(4'-CH2-N(R)-2') BNA, methyl carboncyclic(4'-CH2-CH(CH3)-2') BNA, propylene carboncyclic(4'-(CH2)3-2') BNA, or It is a sugar of vinyl BNA.

[0563] In some embodiments, the sugar variant is a variant described in US 9006198. In some embodiments, the modified sugar is described in US 9006198. In some embodiments, the present invention relates to US 9394333, US 9744183, US 9605019, US 9982257, US 20170037399, US 20180216108, US 20180216107, US 9598458, WO 2017 / 062862, WO 2018 / 067973, WO 2017 / 160741, WO 2017 / 192679, WO 2017 / 210647, WO 2018 / 098264, WO 2018 / 022473, WO 2018 / 223056, WO 2018 / 223073, WO 2018 / 223081, WO Variants described in 2018 / 237194, WO 2019 / 032607, WO 2019 / 032612, WO 2019 / 055951, and / or WO 2019 / 075357, each of which sugar variations and modified sugars are independently incorporated herein by reference.

[0564] In some embodiments, the modified sugar is US 5658873, US 5118800, US 5393878, US 5514785, US 5627053, US 7034133;7084125, US 7399845, US 5319080, US 5591722, US 5597909, US 5466786, US 6268490, US 6525191, US 5519134, US 5576427, US 6794499, US 6998484, US 7053207, US 4981957, US 5359044, US 6770748, US 7427672, US It is described in 5446137, US 6670461, US 7569686, US 7741457, US 8022193, US 8030467, US 8278425, US 5610300, US 5646265, US 8278426, US 5567811, US 5700920, US 8278283, US 5639873, US 5670633, US 8314227, US 2008 / 0039618 or US 2009 / 0012281.

[0565] In some embodiments, the sugar modification is 2'-OMe, 2'-MOE, 2'-LNA, 2'-F, 5'-vinyl, or S-cEt. In some embodiments, the modified sugar is the sugar of FRNA, FANA, or morpholino. In some embodiments, the HTT oligonucleotide comprises a nucleic acid analog, e.g., GNA, LNA, PNA, TNA, F-HNA (F-THP or 3'-fluorotetrahydropyran), MNA (mannitol nucleic acid, e.g., see reference [Leumann 2002 Bioorg. Med. Chem. 10: 841-854]), ANA (anitol nucleic acid), or morpholino, or a part thereof. In some embodiments, the sugar modification replaces the natural sugar with another cyclic or acyclic moiety. Examples of such moiety are widely known in the art (e.g., used in morpholino, glycol nucleic acid, etc.) and can be used according to the present invention. As understood by those skilled in the art, when used with modified sugars, in some embodiments the linkage between nucleotides may be modified as in, for example, morpholino, PNA, etc.

[0566] In some embodiments, the sugar is a 6'-modified bicyclic sugar having (R) or (S)-chirality at the 6-position, e.g., as described in US 7399845. In some embodiments, the sugar is a 5'-modified bicyclic sugar having (R) or (S)-chirality at the 5-position, e.g., as described in US 20070287831.

[0567] In some embodiments, the modified sugar comprises one or more substituents at the 2' position (typically one substituent, and often at the axial position) independently selected from the following: -F; -CF3, -CN, -N3, -NO, -NO2, -OR', -SR', or -N(R')2 (wherein each R' is independently described in the present invention); -O-(C1-C 10 alkyl), -S-(C1-C 10 alkyl), -NH-(C1-C10 alkyl), or -N(C1-C 10 Alkyl)2; -O-(C2-C 10 alkenyl), -S-(C2-C 10 alkenyl), -NH-(C2-C 10 alkenyl), or -N(C2-C 10 Alkenyl)2; -O-(C2-C 10 alkynyl), -S-(C2-C 10 alkynyl), -NH-(C2-C 10 alkynyl), or -N(C2-C 10 alkynyl)2; or -O--(C1-C 10 Alkylene)-O--(C1-C 10 alkyl), -O-(C1-C 10 Alkylene)-NH-(C1-C 10 alkyl) or -O-(C1-C 10 Alkylene)-NH(C1-C 10 Alkyl)2, -NH-(C1-C 10 Alkylene)-O-(C1-C 10 alkyl), or -N(C1-C 10 Alkyl)-(C1-C 10 Alkylene)-O-(C1-C 10 Alkyl)(wherein each alkyl, alkylene, alkenyl, and alkynyl is independently and optionally substituted). In some embodiments, the substituent is -O(CH2) n OCH3, -O(CH2) nNH2, MOE, DMAOE, or DMAEOE, wherein n is 1 to about 10. In some embodiments, the modified sugar is that described in WO 2001 / 088198; and in the literature [Martin et al., Helv. Chim. Acta, 1995, 78, 486-504]. In some embodiments, the modified sugar comprises one or more groups selected from substituted silyl groups, RNA cleavage groups, reporter groups, fluorescent labels, intercalators, groups for improving the pharmacokinetic properties of nucleic acids, groups for improving the pharmacodynamic properties of nucleic acids, or other substituents having similar properties. In some embodiments, the modification is made at one or more of the 2', 3', 4', 5', or 5' positions, including the 3' position of the sugar on the 3'-terminal nucleoside or the 5' position of the 5'-terminal nucleoside.

[0568] In some embodiments, the 2'-OH of ribose is replaced with a group selected from: -H, -F; -CF3, -CN, -N3, -NO, -NO2, -OR', -SR', or -N(R')2 (wherein each R' is described independently in the invention); -O-(C1-C 10 alkyl), -S-(C1-C 10 alkyl), -NH-(C1-C 10 alkyl), or -N(C1-C 10 Alkyl)2; -O-(C2-C 10 alkenyl), -S-(C2-C 10 al...

Claims

Claim 1 All inventions described in the present specification.

Images