SMAD4 engineered cytotoxic lymphocytes for cell therapy

Abstract

Modified human cytotoxic lymphocytes are provided for adoptive immunotherapy containing an inactivation mutation in the SMAD4 gene, which makes it possible to make the cells resistant to the immunosuppressive effects of TGF-β and maintain their cytotoxicity. Additionally, cell populations and pharmaceutical compositions containing modified human cytotoxic lymphocytes are also provided, which are useful for cancer treatment. In particular, modified NK cells for off-the-shelf treatment are provided.

Description

Technology Field

[0001] The present invention relates to the field of modified cytotoxic lymphocytes useful for cell therapy for human health, particularly for cancer treatment. Background Technology

[0002] Allogeneic NK cell adoptive delivery has been utilized as an adjuvant therapy following hematopoietic stem cell transplantation and has demonstrated significant leukemia efficacy relative to the graft and a favorable safety profile. Currently, there are more than 65 ongoing clinical trials involving NK cell adoptive delivery, either as monotherapy or in combination with immunotherapy, chemotherapy, or targeted drugs, for the treatment of hematological malignancies and solid tumors. While the infusion of allogeneic NK or CAR-NK cells has demonstrated clear clinical benefits for certain hematological malignancies, its clinical efficacy for the treatment of solid tumors remains unclear due to the immunosuppressive tumor microenvironment (TME).

[0003] Immunosuppressive TMEs refer to cellular and molecular conditions present within and around tumors that collectively hinder the body's immune system from effectively recognizing and attacking cancer cells. Major limitations include i) enhancing the homing of intravenously injected NK cells into solid tumors / lesions and ii) enhancing NK cell cytotoxicity and persistence in immunosuppressive TMEs. TGF-β, a pleiotropic inhibitory cytokine produced by tumor cells and other regulatory cells (i.e., cancer-associated fibroblasts, T-regs, and myeloid-derived suppressor cells), is present in TMEs and has been shown to exert immunosuppressive effects, preventing immune cell infiltration and reducing immune cell cytotoxicity and proliferation. These immunosuppressive effects can prevent immune system agents, such as NK cells, from recognizing and attacking cancer cells in TMEs, as described in more detail below.

[0004] Tumor NK cell infiltration is an important parameter controlled by chemokines and adhesion molecules. The chemokine-chemokine receptor axes involved in NK cell homing to solid tumors include CCL5 / CCR5, CXCL9-CXCL10 / CXCR3, CX3CL1 / CXC3CR1, SDF-1 / CXCR4, and CXCL8 / CXCR1-2. However, most solid tumors are poorly invasive toward NK cells. TGF-β has been shown to inhibit immune cell infiltration.

[0005] Activated TGF-β binds to the TGF-β type 2 receptor dimer (TGF-βRII), which recruits and activates the type 1 receptor (TGF-βRI) to form a tetrameric receptor complex. Canonical signaling is initiated by the phosphorylation of SMAD2 and SMAD3 receptor-SMAD (R-SMAD), which heterotrimerizes with SMAD4, alternatively TIF-1γ (also known as TRIM33), and translocates into the nucleus to regulate the activity of cell type-specific transcription factors. Figure 17 illustrates the TGF-β pathway.

[0006] TGF-β limits NK cell IFN-γ production and cytotoxicity by inhibiting the transcription of T-bet and granzyme B through SMAD2 / SMAD3 / SMAD4 normalized signaling, while inducing the expression of tumor homing / tissue-residence characteristics such as Hobit, CD103, CD49a, and TRAIL in murine NK cells in a SMAD4-independent manner. In addition, TGF-β has been shown to reduce NK cell proliferation as well as the expression of NKp30 and NKG2D activating receptors, but the signaling mediators underlying these effects remain unclear.

[0007] To address the TGF-β inhibitory effect in cells for enlisted immunotherapy, many TGF-β pathway inhibitors have been studied in preclinical settings, some of which are in clinical development (small molecules inhibiting TGF-β receptor kinase activity, TGF-β neutralizing antibodies, TGF-β ligand traps). However, the effects of systemic TGF-β inhibitors are situation / tumor-dependent and require concomitant use with cytotoxic therapies (chemotherapy or immunotherapy), which exacerbates the severity of adverse events. Alternative strategies tested preclinically to avoid TGF-β inhibiting NK cell anti-tumor function include the knockout of TGF-βRII or the expression of dominant-negative TGF-βRII via genetic engineering.

[0008] International application WO 20074868 A1 discloses a dominant-negative SMAD protein (dnSMAD) and cells expressing a chimeric antigen receptor (CAR) or a transgenic T-cell receptor (TCR). The dominant-negative polypeptide involves the synthesis of a mutated form of the protein that interferes with the function of the wild-type protein. The disclosure relates to dnSMAD2, dnSMAD3, and dnSMAD4, but only dnSMAD2 and dnSMAD3 were experimentally tested (Example 1, FIG. 5), which demonstrate cytotoxicity to target cells in both the absence and presence of TGF-β.

[0009] International application WO 2019243817 A1 describes a protein binder that is a blocking intrabody for, for example, SHP2, FADD, or SMAD4, and a T cell expressing CAR. Molecular interactions were tested by immunoprecipitation of cell lysates for SMAD4, followed by Western blot of SMAD2 / 3, but results are not presented.

[0010] In the case of mouse NK cells, the TGFβ-dependent and independent roles of SMAD4 in the regulation of NK cell homeostasis and function are described in the literature [Wang Y et al., 2018]. A single gene in innate lymphocytes, including NK and ILC1 cells Smad4 Deletion of [the term] causes impaired NK cell maturation, homeostasis, and immune surveillance against melanoma metastasis and cytomegalovirus infection. Smad4 Deficient mNK cells also exhibited low cytotoxicity against b2m- / - splenocytes in in vivo rejection studies and in vitro cytotoxicity assays. Furthermore, Smad4 - Deficient NK cells exhibited reduced granzyme B levels at the transcriptome and protein levels and produced less IFN-γ in response to cytokines (IL-12 and IL-18) and target cells. Meanwhile, TGFβ-inhibition of IFN-γ production in IL-12 and IL-18-stimulated mNK cells, as well as IL-15-induced granzyme B and TRAIL upregulation, were partially dependent on SMAD4. Accordingly, these previous data in mice Smad4 This supports the idea that gene deletion has a negative effect on NK cell homeostasis, as well as antitumor and antiviral functions.

[0011] In this regard, finding a new approach to produce adoptive cell therapy cells that can bypass the TGF-β inhibitory effect present in TMEs and thereby enhance the efficacy of anticancer treatment is attracting significant interest.

[0012] TGF-β, a pleiotropic inhibitory cytokine produced by tumor cells and other regulatory cells present in the tumor microenvironment, has been shown to prevent immune cell infiltration, reduce immune cell cytotoxicity and immune cell proliferation, which collectively hinders the immune system from effectively recognizing and attacking cancer cells. These effects are referred to herein as the "immunosuppressive effects of TGF-β" or "inhibitory effects of TGF-β."

[0013] Therefore, one problem to be solved by the present invention is to provide cytotoxic lymphocytes that can preserve their antitumor function by avoiding the TGF-β inhibitory effect present in the tumor microenvironment.

[0014] The solution is based on the inhibition of SMAD4 biological activity (e.g., genetic inactivation) in cytotoxic lymphocytes as a novel strategy to bypass the TGF-β inhibitory effect on lymphocyte function and thereby exhibit cytotoxicity.

[0015] In particular, the inventors SMAD4 It was shown that cytotoxic lymphocytes containing inactivated mutations in their genes are resistant to the immunosuppressive effects of TGF-β (i.e., have low sensitivity), meaning they can withstand the tumor microenvironment. As a result, these cells can exert their biological functions, such as cytotoxicity, which is important for tumor cell killing.

[0016] Surprisingly, the inventors also [in] cytotoxic lymphocytes SMAD4 It was confirmed that inactivated mutations within genes also produce the following effects in the presence of TGF-β, which are beneficial for cell therapy and resolve major limitations known in the industry:

[0017] - Enhanced cytotoxicity important for tumor cell killing;

[0018] - Enhanced expression of cytotoxic effectors (granzymes and perforins) important for maintaining cytotoxicity along with a series of tumor cell killings;

[0019] - Increased secretion of pro-inflammatory cytokines such as IFN-γ and TNF-α, which are important for inducing the Thi1 anti-tumor microenvironment;

[0020] - Increased expression of activating receptors CD16A, NKG2D, NKp30, and NKG2C, which are important for the anti-tumor function of NK cells;

[0021] - Increased expression of activating signaling adapters (HCST, TYROBP) essential for NK cell activation upon target cell recognition;

[0022] - Increased expression of CCL5 and CCL3 chemokines important for immune cell mobilization;

[0023] - Increased expression of FLT3LG, XCL1, XCL2, and CSF1, which are important for the recruitment and activation of dendritic cells;

[0024] - Conserved expression of the IL15 / IL2 receptor chain, essential for NK cell proliferation in response to pro-proliferative cytokines;

[0025] - Increased expression of CD137 co-stimulatory receptor upon activation, which is important for NK cell survival and proliferation;

[0026] - Increased proliferation in response to IL-15 and CD137L, which are important for NK cell expansion in tumors, as well as activating receptor cross-linking;

[0027] - Enhanced expression of CD11a, CD18, and CD49d integrins, which are important for NK cell extravasation from blood vessels into tumors and necessary for tumor cell recognition and cytotoxic synapse formation;

[0028] - Maintenance of TGF-β-induced CD29, CD49a, and CD103 expression, which is important for tumor retention and invasion;

[0029] - Enhanced cytotoxicity against tumor globules compared to NK cells treated with TGFBRII inhibitors;

[0030] - Resistance to activin-A inhibition, which is important for simultaneously bypassing these inhibitory factors also found in the tumor microenvironment;

[0031] - Enhanced antitumor activity as monotherapy and in combination with tumor antigen-targeted monoclonal antibody therapy (anti-HER2 antibody) in preclinical in vivo models, which is important as a validation of concept; and

[0032] - Cytotoxic activity enhanced in the presence of TGF-β when cells contain additional mutations or alterations of a chimeric antigen receptor (CAR), such as CD19, which is important for enhancing the antitumor activity of CRA-NK cells in TGF-β-rich environments, such as solid tumors.

[0033] All the aforementioned effects are presented in the working examples of the present invention described below.

[0034] First, the inventors obtained CD16-activated NK from a healthy donor SMAD4 + / + Various cellular parameters from NK cells in patients with juvenile polyposis syndrome (JPS) SMAD4 By comparing with + / - in the presence or absence of TGF-β SMAD4 The role was studied (see Example 2). Surprisingly, the inventors NK SMAD4 + / - cells are NK SMAD4 It was found that it was not reduced in the presence of TGF-β compared to + / + cells. Furthermore, NK SMAD4 + / - cells exhibited less severe downregulation of NKG2D and granzyme B, maintenance of CD103, higher degranulation, and higher TNF-α secretion (Fig. 1). These SMAD4 It was confirmed that + / - cells had reduced expression of SMAD4 (Fig. 3). Therefore, these SMAD4 It was discovered that haploinsufficient NK cells exhibited cytotoxicity in the presence of TGF-β.

[0035] From 2 patients with JPS SMAD4 Based on preliminary observations showing partial resistance to TGF-β inhibition in diploid-insufficient NK cells, the inventors, as a novel strategy to overcome TGF-β inhibition while maintaining TGF-β-induced tissue retention traits SMAD4 The possibility of disproportionating TGF-β signaling by knocking out was further investigated. Examples 3 and 4 are SMAD4 KO This shows a method successfully produced in NK92 and primary NK cells, respectively, which not only demonstrates on-target efficiency and safety in the manipulation approach but also generates NK cells with reduced levels of SMAD4.

[0036] Unexpectedly, SMAD4 KO NK92 cells exhibited enhanced cytotoxicity against cancer cell line HCT116 upon TGF-β1 treatment, which surpassed its baseline cytotoxicity and the cytotoxic capacity of NK92 parent cells with and without TGF-β treatment (Example 3, Fig. 5(i, j)).

[0037] Furthermore, the results provided herein demonstrate the complex relationship between TGF-β and SMAD4 in the regulation of NK cell proliferation and function. As previously discussed, a previous study in the literature [Wang Y et al., 2018] Smad4 - / - It demonstrated that NK cells exhibited impaired homeostasis and maturation in an in vivo mouse model, leading to the conclusion that although SMAD4 is part of a transcription complex that positively regulates homeostatic granzyme B expression along with NK and T cell differentiation in the mouse model, it paradoxically contributes to the downregulation of granzyme B expression upon TGF-β exposure. In contrast to the views derived from the mouse model, the inventors unexpectedly [in] expanded human NK cells in vitro SMAD4We found that knockout of [it] did not affect the maturation status or functional profile, including granzyme B and perforin levels. Therefore, although SMAD4 would be necessary to ensure early NK cell differentiation and the acquisition of functional qualification, in fully mature human NK cells SMAD4 The knockout of had a negligible effect on its homeostasis (see Example 5, Figs. 8 and 9).

[0038] TGF-β is known to inhibit IL-2 / 15-dependent NK cell proliferation upon activation (literature [Cabo M et al., 2021]), that is, the process by which NK cell proliferation depends on the presence of IL-2 and IL-15. Surprisingly, SMAD4 KO NK cells showed conserved IL-2 and IL-15-dependent proliferation in the presence of TGF-β (Figs. 10 h to j).

[0039] surprisingly, SMAD4 KO Expanded human NK cells exhibited enhanced cytotoxicity against tumor cell lines (Example 6, Figs. 10(d to f)) and enhanced infiltration into tumor globules (Example 9) regardless of prior exposure to TGF-β. Meanwhile, the TGF-β-dependent downregulation of adhesion molecules (involved in cytotoxic synapse formation), activating receptors (necessary for tumor cell recognition), and cytotoxic effectors (e.g., granzyme B and perforin) SMAD4 KO It was partially prevented in NK cells. On the other hand, TGF-β-dependent induction of tissue-retention / storage molecules (CD103, CD29, and CD49a) and ligands (TRAIL and FasL) to the death receptor pathway (Example 8, Fig. 10(g)) was preserved, and SMAD4 KO NK cells contributed to enhanced cytotoxicity and globular infiltration.

[0040] It is known that cytokine and chemokine secretion by NK cells, outweighing NK cytotoxicity, contributes to the development of an efficient adaptive immune response against tumors. TGF-β normalized signaling also impairs T-Bet expression and IFN-γ production by human and mouse NK cells (Wang Y et al., 2018). Interestingly, the inventors discovered that a decrease in SMAD4 expression in expanded NK cells overcomes TGF-β inhibition, leading to enhanced IFN-γ, CCL5, and TNF-α production upon tumor cell recognition (see Example 7, Figs. 10(b, c), and Fig. 11).

[0041] Furthermore, the results provided herein highlight the effects of TGF-β on the expression of many adhesion molecules and chemokine receptors in NK cells (see Example 9, Fig. 12). TGF-β downregulated the expression of several integrin / adhesion molecules (e.g., LFA-1 (CD11a-CD18 or αLβ2), MAC1 (CD11b-CD18 or αMβ2), and ICAM1) involved in NK cell extravasation and cytotoxic synapse formation in a SMAD4-dependent manner, while inducing the expression of tissue-retention-associated integrins CD29 (β1), CD49a (α1), and CD103 (αE) in a SMAD4-independent manner. As with adhesion molecules, the induction of tumor-homing receptors such as CXCR3 or CXCR4 by TGF-β was SMAD4-independent. TGF-β-treated SMAD4 KO NK cells showed increased migration toward the SDF-1 gradient as well as increased infiltration into tumor globules when combined with CCL5 and CXCL9, which supports the benefit of reducing SMAD4 levels to simultaneously enhance NK cell tumor homing, tumor cell recognition, and killing.

[0042] Phosphorylated SMAD2 / 3 is also known to interact with transcription mediator factor 1 (TIF1γ or TRIM33), which has been suggested to be essential for leukocyte mobilization within tissues in response to inflammatory signals. The inventors have shown herein that TIF1γ is also expressed by NK cells and is not affected by TGF-β exposure (Fig. 6).

[0043] Due to the inhibitory role of TGF-β in the tumor microenvironment, many therapeutic strategies that inhibit the TGF-β pathway are in clinical development. Compared to previous strategies based on the complete inhibition of TGF-β signaling, SMAD4 KO NK cells will utilize these SMAD4-independent pathways regulated by TGF-β, such as the acquisition of tissue-residence characteristics, the expression of tumor-homing chemokine receptors, and enhanced cytotoxicity through death-receptor ligands. Indeed, SMAD4 KO NK cells exhibited enhanced cytotoxicity against tumor globules compared to control NK cells treated with the TGF-β-RI inhibitor SB-431542, which indirectly demonstrates the benefit of partial maintenance of SMAD4-independent TGF-β signaling on NK cell function (see Example 10, Figs. 14(a) to d)).

[0044] In addition to this, SMAD4 KO NK cells were also resistant to activin A, an inhibitory cytokine produced by tumor-associated fibroblasts that can redundantly inhibit NK cell effector function (see Example 11, Fig. 14(g)).

[0045] Notably, SMAD4 KO The antitumor function of NK cells was also tested in a humanized in vivo mouse model of HER2-positive breast cancer (see Example 12). SMAD4 KO Mice treated with NK cells demonstrated superior tumor growth control as monotherapy as well as in combination with anti-HER2 therapeutic antibodies such as trastuzumab and pertuzumab, which outperformed the antitumor efficacy of control NK cells combined with anti-HER2 antibodies in both scenarios (Fig. 18(b)). Therefore, SMAD4 KO NK cells exhibit significantly enhanced antitumor activity in both in vitro and in vivo, demonstrating that they surpass the efficacy of known treatments such as HER2 therapeutic antibodies.

[0046] Furthermore, Example 13 in CD19-CAR transduced NK cells SMAD4 It is demonstrated that the knockout of not only makes cells resistant to the inhibitory effect of TGF-β but also significantly enhances the cytotoxic activity of CAR-NK cells in the presence of TGF-β, highlighting the improvement of its antitumor efficacy (Fig. 19).

[0047] Overall, the results provided herein SMAD4 KO NK cells could be developed as an off-the-shelf platform for cancer immunotherapy resistant to TGF-β and activin A, having superior antitumor function compared to other NK cell products; this supports suitability for CAR armoring as well as combination strategies including tumor-antigen targeted antibodies, bispecific antibodies, or immune checkpoint blockers.

[0048] Accordingly, the first aspect of the present invention relates to isolated modified human cytotoxic lymphocytes for adoptive immunotherapy, wherein SMAD4 biological activity is inhibited and the cells are resistant to the immunosuppressive effect of TGF-β and exhibit cytotoxicity.

[0049] Another aspect relates to a method for producing modified human cytotoxic lymphocytes for adoptive immunotherapy, wherein the method comprises human cytotoxic lymphocytes SMAD4It includes the step of genetically inactivating a gene to generate modified cells that have inhibited SMAD4 expression and are resistant to the immunosuppressive effects of TGF-β, thereby exhibiting cytotoxicity.

[0050] Another aspect of the present invention is a cell as described herein. SMAD4 sgRNA that targets a gene (e.g., sgRNA comprising SEQ ID NOs 1 to 11), or (a) at least one targeted nuclease as described herein; and (b) a cell as described herein SMAD4 The invention relates to a kit comprising at least one sgRNA that targets a gene. Another aspect relates to modified human cytotoxic lymphocyte cells obtained by the method provided herein.

[0051] One aspect of the present invention also relates to a method for producing modified human cytotoxic lymphocyte cells for adoptive immunotherapy, wherein modified cells having inhibited SMAD4 expression and being resistant to the immunosuppressive effects of TGF-β and exhibiting cytotoxicity are produced, the method comprising: (a) expanding or proliferating cells from a sample of a subject requiring treatment or a healthy donor; (b) optionally, isolating or purifying human cytotoxic lymphocyte cells from the sample or cells obtained in (a); and (c) as defined herein SMAD4 The method comprises: (d) a step of genetically modifying human cytotoxic lymphocyte cells by inactivating (knockout) genes; (d) a step of optionally expanding or proliferating the cells obtained in (c); and (e) a step of optionally isolating or purifying the cells obtained in (c) or (d).

[0052] Furthermore, another aspect relates to a method for delivering adoptive cells, the method comprising: (a) obtaining a sample (e.g., blood) from a subject requiring treatment or a healthy donor; (b) producing modified human cytotoxic lymphocytes having inhibited SMAD4 expression according to a method for producing modified human cytotoxic lymphocytes as described above; (c) optionally administering a conditioning or preconditioning treatment to a subject requiring treatment; and (d) administering an effective amount of the cells obtained in (b) or (c) to a subject requiring treatment. This aspect may be formulated as a method for treating cancer in a subject requiring treatment, alternatively comprising steps as described above.

[0053] Alternatively, another embodiment relates to a method for delivering adoptive cells and a method for treating cancer in a subject requiring treatment, the method comprising: (a) thawing isolated modified SMAD4 human cytotoxic lymphocyte cells according to the present invention; (b) optionally administering a conditioning or preconditioning treatment to a subject requiring treatment; and (d) administering the cells obtained in (a) to a subject requiring treatment.

[0054] In one embodiment, the present invention relates to a cell population comprising modified human cytotoxic lymphocyte cells as defined in the first embodiment of the present invention, wherein the cell population comprises (a) 10% to 90% modified SMAD4 Allele frequency of genetic cytotoxic lymphocytes; (b) about 10% to 90% of SMAD4 - / - and / or SMAD4It is characterized by a genotype frequency of + / - cytotoxic lymphocyte cells; and / or (c) a detargeting rate of less than 1%. Another aspect of the present invention is a method for producing a cell population comprising modified cytotoxic lymphocyte cells by following the steps of a method for producing modified cytotoxic lymphocyte cells.

[0055] Another aspect relates to a pharmaceutical composition comprising modified cytotoxic lymphocyte cells as defined herein or a cell population as defined herein and pharmaceutically acceptable excipients.

[0056] Another aspect relates to modified cytotoxic lymphocyte cells, cell populations, or pharmaceutical compositions as defined in the present invention for use as a medicine, for use as an immunotherapeutic agent, or for use in the treatment of cancer (e.g., colorectal cancer). Alternatively, the present invention also comprises a method for treating cancer in a subject, the method comprising the step of administering a therapeutically effective amount of modified cytotoxic lymphocyte cells, cell populations, or pharmaceutical compositions as defined herein to a subject requiring treatment.

[0057] Throughout the specification and claims, the word “comprise” and its variations are not intended to exclude other technical features, additives, components, or steps. Additional objects, benefits, and features of the invention will become apparent to those skilled in the art upon examination of the detailed description or may be learned through the practice of the invention. Furthermore, the invention encompasses all possible combinations of the specific and preferred embodiments described herein. The following examples and drawings are provided herein for illustrative purposes only and are not intended to limit the invention. Brief explanation of the drawing

[0058] Fig. 1 TGFβ-normal signaling affecting NK cell phenotype and function and SMAD4It demonstrates the effect of gene dose. Purified human NK cells from three independent subjects were activated on anti-CD16-coated plates for 5 days in the presence or absence of TGF-β1 (10 ng / ml) prior to total RNA extraction and microarray analysis. a, b, c Volcano plot and heatmap showing total and selected differentially expressed genes (DEGs) among anti-CD16 activated NK cells in the presence or absence of TGF-β (|log-fold-change|> or <0.5; pval <0.05). d to h PBMCs from a healthy donor and two JPS patients were cultured on anti-CD16-coated plates for 6 days in the presence or absence of TGF-β (10 ng / ml). d to g As analyzed by multiparameter flow cytometry, on the 6th day, 2 JPS patients (PT, SMAD4+ / - ) and healthy control group (HD, SMAD4+ / + Number of NK cells from ) and expression of the indicated marker in NK cells. e to g ) Data normalized to NK cells cultured in the absence of TGF-β. h) Healthy donors, with or without treatment with TGF-β1, during 4-hour co-culture with K562 tumors ( SMAD4+ / + ) and JPS patients( SMAD4+ / - Degranulation (CD1071a+) and TNF-α production by NK cells from ) Fig. 2 This shows the results of purified human NK cells from three independent subjects activated on anti-CD16-coated plates for 5 days in the presence or absence of TGF-β1 (10 ng / ml) prior to total RNA extraction and microarray analysis. a, b) DEG (|log-fold change|> or <0.5; pval <0.05) in untreated activated NK cells compared to TGF-β1-treated cells was introduced separately into Metascape software for the analysis of biological pathways. Downregulated in TGF-β1-treated NK cells ( a) or upwardly adjusted( b A bar graph showing biological pathways. Fig. 3 silver SMAD4 This shows SMAD4 expression in PBMCs from diploid insufficiency patients and healthy individuals. a, b) SMAD4 and β-actin expression in fresh PBMCs from two patients with juvenile polyposis syndrome and two healthy donors (HD#1 and HD#2) by Western blot. Mutations for each JPS patient are indicated. Fig. 4 This shows the effects of TGF-β on NK92 cell cytotoxicity, phenotype, and proliferation. NK92 cells were treated with TGF-β (5 ng / ml) overnight (ON) or for 5 days. a) Western blot for TGFB-RII, SMAD4, pSMAD2, and β-actin under the indicated conditions. b NKG2D, GzmB, and CXCR3 expression in NK92 cells treated with or not treated with TGF-β (NT) for 5 days as analyzed by flow cytometry. c) NK92 cells treated with or not treated with TGF-β were co-cultured with HCT116 cells for 4 hours at the indicated effector:target (E:T) ratio. HCT116 cell death in each co-culture was monitored by the detection of activated caspase 3 (aC3) by multiparameter flow cytometry. d ) Change in NK92 cell counts after 5 days of treatment with TGF-β. Data from 3 to 5 independent experiments. Statistical significance by paired Student's t-test (*≤ 0.05,** ≤ 0.01, ***≤0.001). Fig. 5 ...the effect on the phenotype and function of NK92 cells SMAD4 It shows the effects of gene dosage and TGF-β. SMAD4- The engineered NK92 cell clones were obtained by CRISPR / Cas9 engineering, sorting of nucleofected cells, and subsequent cloning by restriction dilution as described in the methods. a to d ) Intracellular flow cytometry( a, b ) and Western blot( c, d As determined by ), 2 SMAD4 - Baseline SMAD4 levels in engineered clones NK92-G3 and NK92-F3, the parent NK92 cell line, and HT29 and HCT116 colorectal cancer cell lines as negative and positive controls, respectively. e to f) SMAD4 Cas9-targeted PAM sequences in exons 5 and 10 were amplified by PCR from G3 and F3, as well as maternal NK92 cells, and sequenced by Illumina. Exon 5 from the indicated cells (e ) and 10 (f Allele frequency of mutations introduced by CRISPR in ). g to h) NK92 mother cells and SMAD4 - Engineered NK92 cell clones were treated with TGF-β (5 ng / ml) or untreated for 5 days (NT). Changes in cell number fold for each NK92 cell clone under the indicated conditions ( g ) and Granzyme B levels ( h ). Data from 3 independent experiments. i to j ) Mothers treated with or not treated with TGF-β and SMAD4 - Engineered NK92 cells were co-cultured with HCT116 for 4 hours. Mean percentage of active caspase 3-positive HCT116 cells in the indicated effector:target ratio. Dashed and solid lines indicate cytotoxicity induced by TGF-β-treated and untreated NK92 cells, respectively. Data from three independent experiments. Fig. 6 silver SMAD4 Knockout SMAD4 KO It shows the TGF-β normal signaling mediator in ) and control human primary NK cells. a) CRISPR / Cas9 Manipulation of Primary NK Cells, Protocol Overview: PBMCs from healthy donors were co-cultured with 8866 irradiated feeder cells. On day 7, NK cells were isolated by negative selection, and SMAD4 Nuclei were infected with exon 5 gRNA or control (CTRL) gRNA-containing Cas9 RNP. After overnight culture, cells were divided into four conditions and extended for 7 days in the presence of IL-2 (200 U / ml) or IL-2 + TGF-β1 (10 ng / ml). b ) Controls cultured with or not cultured with TGF-β- and SMAD4 KO SMAD4 levels in NK cells by intracellular flow cytometry. c to d ) Control group by Western blot- and SMAD4 KO Regular signaling molecules within NK cells. c Representative Western blot for TGF-BRII, pSMAD2, SMAD4, TIF1γ, SMAD7, and β-actin. d Quantification of Western blot data from four independent manipulation experiments using cells from different donors. Fig. 7 It shows the Cas9 RNP nuclear infection efficiency and SMAD4 reduction in primary human expanded NK cells. a and b) NK cells were isolated on day 7 after expansion using 8866 and control gRNA complexed with Cas9 and ATTO550-labeled sgRNA or SMAD4 Nuclear infection was performed with gRNA. Nuclear infection efficiency was monitored and analyzed by flow cytometry after overnight incubation. a ) Dot plot showing the percentage of nuclear-infected cells (ATTO550+) in one representative nuclear infection. b ) Median nuclear infection efficiency in 13 independent experiments. CSMAD4 expression in NK cells after 7 days of culture in the presence or absence of TGF-β as analyzed by flow cytometry. Inset numbers indicate mean fluorescence intensity. Histograms corresponding to control staining with a secondary antibody (abII) for all conditions are shown. Fig. 8 It shows the TGFβ-dependent and TGFβ-independent effects of SMAD4 on human extended NK cell transcriptomes and phenotypes. a to f) Total RNA was extended control and in the presence / absence of TGF-β1 as previously described and SMAD4 KO It was extracted from NK cells and analyzed by RNAseq. The data correspond to the average change in gene expression from engineered NK cells from three different donors. a ) Number of differentially expressed genes (DEGs) among the four indicated conditions (pval<0,01). b ) with the control group (CTRL) in the absence or presence of TGF-β and SMAD4 KO Volcanic plot of DEG between NK cells. Red dots indicate DEG significantly. c to e) NK cell receptors and signaling adapters in specified cells ( c ), NK cell cytotoxic effector molecule ( d ) and available medium( e Heatmap showing the expression of selected genes associated with ). Asterisks indicate the control group treated with TGF-β- and SMAD4 - Labels genes that exhibit significant differential expression among engineered NK cells. f ) Hepatic and intestinal CD56dim NK / ILC1: GSE37448; TGF-β treated control group and for NES SMAD4 KO Gene set enrichment analysis (GSEA) of RNAseq data from NK cells: Normalized enrichment score. g to h) Control groups (CTRL) treated with or not treated with TGF-β as previously specified by flow cytometry and SMAD4 KO Expression of surface NKG2D, CD16, NKp30, and intracellular granzyme B (GzmB) and perforin in NK cells. g ) Histogram showing data from representative experiments. The inserted numbers represent the average fluorescence intensity of the analyzed markers under each indicated condition. h ) Mean SEM of each specified parameter across the four tested conditions. Each dot corresponds to data from independent experiments performed using NK cells from different individuals. Data from 3 to 6 independent experiments. Statistical significance by ANOVA test for multiple comparisons. i ) Control groups treated with or not treated with TGF-β1 (5 ng / ml) as analyzed by flow cytometry- and SMAD4 KO Expression of surface NKp46, KIR, NKG2A, NKG2C, CD57, and KLRG1 in NK cells. Heatmap showing the mean percentage of marker+ NK cells under each specified condition. Asterisks indicate a significantly different mean percentage of KLRG1+ NK cells compared to control NK cells in the absence of TGF-β (NT). Fig. 9 is in the absence or presence of TGF-β SMAD4 Shows the transcription profiles of engineered primary NK cells. Total RNA is extended control and in the presence / absence of TGF-β1 as previously described and SMAD4 KO Extracted from NK cells and analyzed by RNAseq. Data correspond to the mean change in gene expression from engineered NK cells from three different donors. a) Compared to control-engineered expanded NK cells in the absence of TGF-β according to Metascape unsupervised analysis SMAD4 KOBiological pathways significantly downregulated in. b) Compared to control-manipulated expanded NK cells by pre-ranked gene set enrichment assay (GSEA) on C5 data collection of the GO biological process ontology in the presence of TGF-β SMAD4 KO Biological pathways significantly upregulated in. Fig. 10 silver SMAD4 KO It shows that NK cells demonstrated enhanced antitumor function in the presence of TGF-β. a to c) Control groups treated with or untreated with TGF-β (5 ng / ml)- and SMAD4 KO NK cells were co-cultured with HCT116 colorectal cancer cells for 4 hours at the specified effector:target (E:T) ratio. a ) Percentage of HCT116 cells showing activated caspase 3 after co-culture as analyzed by intracellular flow cytometry. Spontaneous activated caspase 3 levels were subtracted. Data from four independent experiments using NK cells from different donors. Significant differences between all conditions and control NK cells treated with TGF-β by two-way ANOVA (**** p<0.0001). Control- and after 2 hours of co-culture with HCT116 cell lines as analyzed by ELISA. SMAD4 KO CCL5 in the cell-free culture supernatant of NK cells ( b ) and IFN-γ( c Amount of ). Statistical significance calculated by one-way ANOVA test (*** p<0.001; **p<0.01; *p<0.5). d to f ) HCT116-Luc+-GFP+ globules are PKH26-labeled controls that have been previously exposed to or have not been exposed to TGF-β- or SMAD4 KO It was co-cultured with NK cells. Images were taken with a microscope at 6, 24, and 30 hours, and green fluorescence was quantified using Image J. d Representative image of one spherical body in each co-culture at 24 hours. e ) GFP intensity over time in each co-culture. Data represent the average + / - SEM data of 5 spheres for each analyzed condition. f Luciferase activity of residual viable HCT116 cells after 30 hours of co-culture with NK cells. Statistical significance calculated by one-way ANOVA (*** p<0.001; **p<0.01; *p<0.5). g) Control groups treated with or untreated with TGF-β (5 ng / ml)- and SMAD4 KO NK cells were co-cultured with HCT116 colorectal cancer cells for 2 hours at an effector:target (E:T) ratio of 0.75:1 in the presence of Fas ligand (anti-FASL), blocking antibodies against TRAIL (anti-TRAIL), or control IgG2. Active caspase 3 was analyzed by intracellular staining in HCT116 cells at the end of co-culture. Bar graph showing caspase 3 in HCT116 cells. Data from one representative experiment. h) Control group and by bulk RNAseq SMAD4 KO Expression of IL2 and IL15 receptor transcripts in NK cells. i ) CFSE-labeled control group and SMAD4 KO NK cells were cultured with IL-2 (200 U / ml) for 6 days in the presence or absence of TGF-β (5 ng / ml) on anti-NKp46 coated plates. Proliferation was analyzed as CFSE dilution by flow cytometry. j) Control group and SMAD4 KO NK cells were expanded using K562-CD137L-IL-15tmb-IL-21tmb feeder cells in the presence or absence of TGF-β (5 ng / ml). NK cell expansion multiplier at Day 7 under each culture condition. k) Percentage of luciferase activity (RLU = Relative Luminous Unit) of residual viable HCT116 cells after 24 hours of co-culture with NK cells. Each dot represents the average cytotoxic activity of NK cells in four independent experiments using cells from different individuals. Statistical significance calculated by one-way ANOVA (*** p<0.0001; **p<0.01; *p<0.5). Fig. 11 ...control group treated with TGF-β or untreated and SMAD4 KO Illuminates TNF-α secretion by NK cells. As analyzed by ELISA, after 2 hours of co-culture with the HCT116 cell line, the control- and SMAD4 KO Amount of TNF-α in the supernatant of cell-free culture of NK cells. Statistical significance calculated by one-way ANOVA test (*** p<0.001; **p<0.01; *p<0.5). Fig. 12 is extended This shows the effects of SMAD4 and TGF-β on the integrin profile, tumor infiltration, and transmigration of NK cells. a Heatmap of the average transcript level of adhesion molecules by RNAseq analysis. b) Control groups treated with or not treated with TGF-β and SMAD4 KO LFA-1 (CD11a) by flow cytometry in NK cells ITGAL ) and CD18(ITGB2 )), VLA-4(CD49d( ITGA4 ), CD29( ITGB1 )) and CD103( ITGAESurface expression level of ). Each dot represents the result from an independent experiment involving engineered NK cells from different individuals. c to f ) HCT116 globules are PKH26-labeled controls that have been previously exposed to or have not been exposed to TGF-β- or SMAD4 KO They were co-cultured with NK cells. After 1 hour of co-culture, the spheroids and attached NK cells were fixed and processed for lightsheet imaging. HCT116 cells were labeled with anti-Epcam-FITC antibody. c ) PKH26-Cover SMAD4 KO Image of a representative HCT116 sphere (green surface) co-cultured with NK cells (red dot). e Number of NK cells counted in spheroids under the indicated conditions. f Quantification of the distance between the spherical surface and each infiltrating NK cell. Each dot represents a measurement of one infiltrating NK cell. g ) Control groups treated with or not treated with TGF-β1 and as analyzed by flow cytometry and SMAD4 KO Surface expression of CXCR3, CCR5, and CXCR4 in NK cells. Bar graph showing the mean + / - SEM of fluorescence intensity for each specified receptor. Data from 3 to 5 independent experiments. h) Based on RNAseq data from three independent donors, controls exposed to or not exposed to TGF-β—and SMAD4 KO Transcriptome expression levels of chemokine receptors in NK cells. i) Control group (gray bar) transfecting with CCL5 (50 ng / ml), CXCL9 (50 ng / ml), SDF-1 (100 ng / ml), or the specified chemokine combination, or SMAD4 KO(Empty bars) Percentage of NK cells. Each dot represents the result from an independent experiment containing engineered NK cells from different individuals. Data normalized by the number of cells migrating from the control condition (RPMI). For all tests, statistical significance calculated by one-way ANOVA (*** p<0.001; **p<0.01; *p<0.5). Fig. 13 It shows the effects of SMAD4 and TGF-β on the integrin profile, tumor infiltration, and migration of expanded NK cells. a) Control groups treated with or not treated with TGF-β and SMAD4 KO Surface expression levels of LFA-1 (CD11a and CD18), VLA-4 (CD49d and CD29), and CD103 (ITGAE) as analyzed by flow cytometry in NK cells. Representative histograms of each marker staining in NK cells from representative subjects. b ) HCT116 globules are PKH26-labeled controls that have been previously exposed to or have not been exposed to TGF-β- or SMAD4 KO Co-cultured with NK cells. After 1 hour of co-culture, the globules and attached NK cells were fixed and processed for light sheet imaging. HCT116 cells were labeled with anti-Epcam-FITC antibody. Representative images of HCT116 globules under the specified conditions. The inset numbers correspond to the number of NK cells counted in each globule. Fig. 14 Is SMAD4 KO NK cells exhibit superior cytotoxicity compared to control NK cells treated with a TGFBR-I inhibitor and show resistance to activin A inhibition. a to d ) SMAD4 KO and control NK cells were expanded for 7 days in the presence of TGF-β (5 ng / ml). Control NK cells were supplemented daily with the TGFBR-I inhibitor SB431542 (20 μmol). a and b) treated with SB431542 (SB inhibitor) SMAD4 KO SMAD4, pSMAD2, and β-actin levels in total cell extracts as determined by Western blot in control NK cells. a A representative Western blot containing NK cells from two independent donors. b ) Quantification of mean + / -SEM levels of SMAD4 / β-actin and pSMAD2 / β-actin in NK cells from 3 independent donors. Statistical significance by Student's T-test. c to d) SB431542 treated SMAD4 KO and control NK cells were co-cultured with HCT116-GFP+-Luc+ globules. Luciferase levels were analyzed after 24 hours of co-culture. c) Average + / -SEM data from one representative experiment performed using NK cells from one individual. Five spheroid-NK co-cultures were analyzed for each condition. d) Mean + / - SEM luciferase coefficients including data from three independent experiments using NK cells from different individuals. Statistical significance by the Mann Whitney U test. e Relative transcriptome expression (z-score) of the specified activin receptor gene in NK cells. Average expression in NK cells from three independent subjects as analyzed by RNAseq. f to g) SMAD4 KO and control NK cells were incubated with TGF-β (5 ng / ml) or Activin A (100 ng / ml) during the last 7 days of extension. f ) received the specified treatment analyzed by intracellular staining via flow cytometry SMAD4 KO Mean + / -SEM Granzyme B levels in control NK cells. Data from experiments using NK cells from two different subjects.g ) Previously incubated with TGF-β (5 ng / ml) or Activin A (100 ng / ml) for 7 days SMAD4 KO Control NK cells were co-cultured with HCT116 cells for 2 hours. Mean + / - SEM percentage of active caspase 3+ HCT116 cells under specified conditions. Data from experiments performed using NK cells from two different subjects. Fig. 15 Is SMAD4 KO NK cells exhibit superior cytotoxicity compared to control NK cells treated with a TGF-BRI inhibitor and show resistance to activin A-mediated inhibition. a ) SMAD4 KO and control NK cells were expanded for 7 days in the presence of TGF-β (5 ng / ml). Control NK cells were supplemented daily with the TGFBR-I inhibitor SB431542 (20 μmol). On the 7th day, the expression of Granzyme B (GzmB), NKG2D, and CD103 was analyzed by flow cytometry. Representative histograms of the specified markers under each tested condition. b ) SMAD4 KO and control NK cells were incubated with TGF-β (5 ng / ml) or Activin A (100 ng / ml) during the last 7 days of extension. On day 7, the expression of Granzyme B (GzmB) and Perforin was analyzed by flow cytometry. Representative histograms of the specified markers under each tested condition. Fig. 16 CRISPR / Cas9 RNP nuclear infection in in vitro expanded NK cells SMAD4 It demonstrates the efficiency of a knockout. SMAD4 Cas9-targeted PAM sequences within exon 5 were amplified by PCR from engineered NK cells in three independent experiments and sequenced by Illumina. The obtained sequence was analyzed against the reference sequence.a ) Allele frequencies of indel outframe (OUT) and inframe (IN) introduced by Cas9 in exon 5 within engineered NK cells from three independent individuals expanded in the presence or absence of TGF-β pressure. b) Estimated by the Hardy-Weinberg principle in engineered NK cells from three independent individuals expanded in the presence or absence of TGF-β pressure SMAD4 Genotype frequency. c) Three dominant types found in NK cells from all three analyzed individuals SMAD4 Allele frequency of the mutated allele. d ) SMAD4 Schematic diagram of the three most common mutations found in exon 5. Fig. 17 TGF-β signaling is illustrated: Activated TGF-β binds to the TGF-β type 2 receptor dimer (TGF-βRII), which recruits and activates the type 1 receptor (TGF-βRI) to form a tetrameric receptor complex, initiating a complex signaling cascade involving normal and non-normal signaling pathways. Normal signaling is initiated by the phosphorylation of SMAD2 and SMAD3 receptor-SMAD (R-SMAD), which heterotrimericly combines with SMAD4, alternatively TIF-1γ (also known as TRIM33), or IkKα, and translocates into the nucleus to regulate the activity of cell type-specific transcription factors. Non-normal TGF-β signaling involves various intracellular signaling pathways activated by TGF-β independently of SMAD2 / 3. These pathways involve the activation of PI3K, ERK, and MAPK kinases. Fig. 18 is evaluated in a humanized in vivo mouse model of HER2-positive breast cancer SMAD4 KO NK cells demonstrate anti-tumor function. a and b ) HCC1954 cells(4x10 5) was subcutaneously implanted into NOD / Scid / γc- / -(NSG) mice. The tumor was 100 mm 3 When reached, mice were given i) trastuzumab (Tz) / pertuzumab (Pt) (1 mg / kg each, intraperitoneally); ii) control NK cells (2 x 10⁶ 5 , intratumor); iii) SMAD4 KO NK cells (2 x 10 5 , intratumor); iv) control NK cells (1 x 10 5 Intratumoral) and trastuzumab / pertuzumab (1 mg / kg each, intraperitoneal); or v) SMAD4 KO NK cells (1 x 10 5 Mice were treated with intratumoral and trastuzumab / pertuzumab (1 mg / kg, each, intraperitoneally). Mice were sacrificed at the end of treatment. a ) Treatment schedule. eNK: Engineered NK cells. + / -Tz+Pt: Addition of trastuzumab (Tz) / pertuzumab (Pt). b ) Tumor volume in each treatment group (n=5 mice / group). Statistical significance by two-way ANOVA test (* p<0.05; ** p<0.01; *** p=0.0001). Fig. 19 Is SMAD4 This shows that knockout enhanced the cytotoxicity of CAR19-NK cells in the presence of TGF-β. Nalm6-Luc-GFP cells were co-cultured with CAR19-transgenic control or SMAD4-KO NK cells for 4 hours. Mean ± SEM luciferase counts at the end of co-culture under the indicated conditions. Statistical significance by Student's T-test is indicated. Specific details for implementing the invention

[0059] definition

[0060] To facilitate easier understanding of this detailed description, specific terms are defined first. Additional definitions are provided throughout the detailed description.

[0061] SMAD4 These terms, also known as Mothers Against Decapentaplegic Homolog 4 (MADH4), DPC4, JIP, or MYHRS, refer to proteins that play a crucial role in the Transforming Growth Factor-Beta (TGF-β) signaling pathway. This pathway is a fundamental signaling cascade involved in various cellular processes, including cell growth, differentiation, proliferation, and embryonic development. Upon activation of the TGF-β receptor by ligand binding, specific receptor-activated SMADs (R-SMADs), such as SMAD2 and SMAD3, are phosphorylated. Subsequently, these R-SMADs form a complex with SMAD4 in the cytoplasm. The R-SMAD / SMAD4 complex is translocated into the cell nucleus, where it acts as a transcription factor. Within the nucleus, these SMAD complexes bind to specific DNA sequences known as SMAD-binding elements (SBEs) or TGF-β-responsive elements (TREs) within the promoter region of target genes. These bindings activate or inhibit the transcription of these target genes depending on the situation. Therefore, the primary function of SMAD4 is to act as a signaler or transcription factor in the TGF-β signaling pathway. In humans, transcription factor SMAD4 The gene is registered in GenBank under accession number 4089 (date: October 22, 2023), corresponding to Ensemble accession number ENSG00000141646. In mammals, SMAD4 is encoded by a gene located on chromosome 18. The SMAD4 transcript is registered in Ensemble under accession number ENST00000342988.8 (publication 110, date: July 2023). The protein SMAD4 has a length of 552 amino acids (Uniprot: Q13485). The term SMAD4 also includes polymorphic variants and natural variants.

[0062] biological activity As used herein, the terms "biological activity" and "biological function" are used interchangeably and refer to the ability of an agent (e.g., SMAD4 protein) to influence (e.g., stimulate or inhibit) one or more biological processes in a living organism. Examples of biological processes include biochemical pathways, physiological processes contributing to the internal homeostasis of a living organism, developmental processes contributing to the normal physical development of a living organism, and acute or chronic diseases.

[0063] The biological activity of SMAD4 is primarily associated with its role as a mediator in the TGF-β signaling pathway. Specifically, SMAD4 acts as a transcription factor that plays a role in transmitting signals from the TGF-β family of ligands to regulate gene expression. Transcriptional regulation of target genes by SMAD4-containing complexes influences various biological processes, including the control of cell growth, differentiation, and tissue development. The role of SMAD4 in the TGF-β pathway is associated with proper embryonic development, tissue repair, immune responses, and the maintenance of tissue homeostasis.

[0064] Inhibition of SMAD4 biological activity The terms "inhibition of SMAD4 biological activity / function," "SMAD4 biological activity / function is inhibited," and their grammatical variations refer to the total inhibition (i.e., blockade) or partial inhibition (i.e., reduction) of the biological activity of the SMAD4 protein. Accordingly, in the context of the present invention and for brevity of description, the term "inhibition" also includes "reduction" of SMAD4 biological activity.

[0065] In some embodiments, the biological activity of SMAD4 is inhibited by at least about: 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% compared to the endogenous biological activity of SMAD4 that is not inhibited.

[0066] The biological activity of SMAD4 may be inhibited by gene editing (e.g., CRISPR-Cas9), RNA interference (RNAi) that specifically targets the mRNA of SMAD4, small molecule inhibitors specific to SMAD4, dominant-negative mutations that interfere with the normal function of endogenous SMAD4 protein, antibodies designed to specifically bind to SMAD4 protein, proteolytic techniques (e.g., PROTAC and degron systems), phosphorylation and post-translational modification, competitive inhibition, protein expression knockdown (e.g., antisense oligonucleotides or ribozymes that reduce expression at the mRNA level), or protein blockade. In one embodiment, the biological activity of SMAD4 is inhibited by gene editing, i.e., SMAD4 By modifying the DNA sequence of a gene or regulatory sequence, it causes the loss of function or altered function of the protein encoded by the targeted gene, thereby inhibiting it.

[0067] expression As used herein, the term "expression" refers to the generation of, for example, mRNA or other RNA transcripts (e.g., non-coding, e.g., structural or scaffolding RNA) through the transcription of a polynucleotide from a DNA template. The term additionally refers to the process in which the transcribed mRNA is translated into a peptide, polypeptide, or protein. Transcripts and encoded polypeptides may be collectively referred to as "gene products." Expression may involve splicing mRNA in eukaryotic cells where the polynucleotide is derived from genomic DNA.

[0068] Inhibition of SMAD4 expression: The terms "inhibition of SMAD4 expression," "SMAD4 expression is inhibited," and their grammatical variations refer to the total inhibition (i.e., blocking) or partial inhibition (i.e., reduction) of the expression (e.g., transcription and / or translation) of the SMAD4 protein. Accordingly, in the context of the present invention and for brevity of description, the term "inhibition" also includes "reduction" of SMAD4 expression.

[0069] In one embodiment, SMAD4 expression is inhibited by gene editing, that is, by modifying the DNA sequence of the SMAD4 gene or regulatory sequence, thereby causing loss of function or altered function of the protein encoded by the targeted gene. In one embodiment, SMAD4 expression is inhibited by gene knockout (KO). Gene knockout is used to completely block protein expression. SMAD4 This can be done by introducing mutations or deletions into both alleles of a gene, or by introducing mutations into only one of the two alleles to produce a heterozygous knockout that results in partial inhibition of SMAD4 expression.

[0070] Inhibition of SMAD4 expression in cells can be determined by various assays available in the art. In some embodiments, inhibition of SMAD4 expression is determined by flow cytometry.

[0071] Inactivation mutation in the SMAD4 gene : Term " SMAD4 Inactivation mutation in genes", "knockout mutation", or " SMAD4 "Knockout in genes" and its grammatical variations are SMAD4It refers to a type of genetic mutation that disrupts or impairs the normal function of a gene (or regulatory sequence), typically resulting in the loss or reduction of the gene's protein product or its activity. Inactivation mutations can cause the inactivation or loss of function of the SMAD4 protein, which may play a significant role in various cellular processes. These mutations can occur through various mechanisms, including point mutations, insertions, deletions, or large-scale genetic rearrangements. Inactivation mutations can be homozygous or heterozygous.

[0072] gene : As used herein, this term refers to a polynucleotide sequence comprising exon(s) and associated regulatory sequences. The gene may further comprise intron(s) and / or non-translating region(s) (UTR(s)).

[0073] regulatory sequence : As used herein, the terms “regulatory sequence,” “regulatory element,” and “control element” are used interchangeably and refer to a polynucleotide sequence located upstream (5’ non-coding sequence), within, or downstream (3’ non-translation sequence) of a polynucleotide sequence to be expressed. The regulatory sequence influences, for example, the transcription timing of the related structural nucleotide sequence, the amount or level of transcription, RNA processing or stability, and / or translation. The regulatory sequence may include an activator binding sequence, an enhancer, an intron, such as a polyadenylation recognition sequence from bovine growth hormone (BGH) or Simian virus 40 (SV40), a promoter, a repressor binding sequence, a stem-loop structure, a translation initiation sequence, a translation lead sequence, a transcription termination sequence, a translation termination sequence, a primer binding site, etc.

[0074] lymphocytes As used herein, this term refers to leukocytes (white blood cells), which are part of the vertebrate immune system. The term “lymphocyte” also includes hematopoietic stem cells that generate lymphoid cells. Lymphocytes include T cells for cell-mediated, cytotoxic adaptive immunity, e.g., CD4+ and / or CD8+ cytotoxic T cells; alpha / beta T cells and gamma / delta T cells; regulatory T cells, e.g., Treg cells; natural killer (NK) cells that function in cell-mediated, cytotoxic innate immunity; and B cells for humoral, antibody-driven adaptive immunity. Lymphocytes may be mammalian cells, e.g., human cells. The term “lymphocyte” also includes genetically modified T cells that are modified to produce chimeric antigen receptors (CARs) (CAR-T cells) on the surface of T cells. These CAR-T cells recognize specific antigens on the surface of target cells, such as tumor cells. A CAR comprises an extracellular ligand binding domain, a hinge region, a transmembrane region, and an intracellular signaling region. Additionally, the term "lymphocyte" as used herein includes T cell receptor engineered T cells (TCRs) that are genetically engineered to express specific naturally occurring or engineered T-cell receptors capable of recognizing protein or (glyco)lipid antigens of target cells. Small fragments of these antigens, such as peptides or fatty acids, are shuttled to the surface of target cells and presented to T cell receptors as part of an MHC complex. Binding of the T cell receptor to the antigen-loaded MHC complex activates the lymphocyte. Tumor-infiltrating lymphocytes (TILs) are also included in the term "lymphocyte" as used herein. TILs are immune cells that have infiltrated the tumor and the surrounding environment (“tumor microenvironment”). TILs are typically isolated from tumor cells and the tumor microenvironment and selected for their high reactivity to tumor antigens in vitro.TILs are grown in vitro under conditions that overcome in vivo tolerance effects and then introduced into subjects for treatment. CARs can also be incorporated into TILs, NK cells, or TCRs to generate CAR TILs, CAR-NK cells, or TCR-engineered CAR-T cells.

[0075] Lymphocyte activation occurs when lymphocytes are triggered by antigen-specific receptors on their cell surface. This causes the cells to proliferate and differentiate into specialized effector lymphocytes. These "activated" lymphocytes are typically characterized by a set of receptors on their surface. Surface markers for activated T cells include CD3, CD4, CD8, PD1, IL2R, and others. Activated cytotoxic lymphocytes can kill target cells (e.g., cancer cells) after binding to their corresponding receptors on the surface of target cells.

[0076] cytotoxicity As used herein, the terms "cytotoxicity" or "cytotoxic activity" refer to an immune response mediated by cytotoxic immune cells, such as natural killer (NK) cells and cytotoxic T cells (CTLs), in which these cells recognize specific target cells—typically abnormal cells, including those infected with pathogens or cancer cells—and neutralize them primarily by inducing apoptosis (programmed cell death) in the target cells. Cytotoxicity plays a crucial role in the immune system's defense mechanisms against infection and cancer. This immune response is initiated by the recognition of surface markers or antigens on target cells indicating infection, stress, or abnormality. Upon recognition, cytotoxic immune cells are activated, triggering the release of cytotoxic molecules such as perforin and granzyme, which create pores in the target cell membrane and trigger the apoptotic pathway. Additionally, cytotoxic lymphocytes can induce apoptosis in target cells using Fas ligand (FasL)-Fas interactions or other death receptor signaling mechanisms. As a result of these interactions, target cells undergo programmed cell death characterized by nuclear fragmentation and other cellular changes. Ultimately, the goal of the immune system is to prevent the spread of pathogens or the growth of cancer cells and maintain overall health and immunity by neutralizing these apoptotic target cells, often through phagocytosis by macrophages.

[0077] Cytotoxicity can be determined by various assays available in the art. In some embodiments, cytotoxicity is determined by the analysis of cytotoxic cell degranulation (e.g., by monitoring CD107a mobilization by flow cytometry); by the analysis of activated caspase 3 in target cells by intracellular staining; by measuring luciferase activity remaining in live Luc-transfected tumor cells upon co-culture with NK cells; by chromium release assay; by calcein release assay; by LDH cytotoxicity assay; or by Annexin V and propidium iodide uptake.

[0078] cytotoxic lymphocytes The term "cytotoxic lymphocyte" as used herein refers to a lymphocyte capable of exerting cytotoxicity. Examples of cytotoxic lymphocytes are cytotoxic T lymphocytes (CTLs) and NK cells.

[0079] isolated As used herein, the term "isolated" may refer to nucleic acids or polypeptides that exist separated from their original environment by human hands and are therefore not natural products. "Isolated" implies substantial purity. Isolated nucleic acids or polypeptides may exist in a purified form and / or may exist in an environment other than their original one, such as, for example, recombinant cells.

[0080] deformed As used herein, the terms "manipulated," "genetically engineered," "recombined," "modified," and "non-naturally occurring" are interchangeable and refer to intentional human manipulation.

[0081] Allele frequency As used herein, these terms refer to the frequency or proportion of a specific allele (gene variant) within a cell population. For example, within a cell population SMAD4 Gene knockout generates different alleles within the cell, for example SMAD4 Cells having a specific deletion in a gene, SMAD4 Cells having a specific insertion in a gene and cells remaining unchanged can be obtained. Thus, for example, a cell population may have the following allele frequencies: 30% of cells with deletion A, 20% of cells with deletion B, 30% of cells with insertion C, and 20% of wild-type cells. In the context of the present invention, allele frequency represents the percentage of mutated cells having out-of-frame mutations (e.g., insertions or deletions) that do not produce a functional protein.

[0082] genotype frequency As used herein, these terms refer to the frequency or proportion of a specific genotype (combination of alleles) within a population. Considering a single gene having two alleles, A and B, a genotype frequency of 10% AA, 40% AB, and 50% BB within a cell population of 1,000 cells means that 100 cells are AA, 400 cells are AB, and 500 cells are BB. In the case of the present invention, the cell population is 60% of SMAD4 - / - cells, 35% of SMAD4 + / - cells and 5% of SMAD4 + / + cells (unchanged) can have genotype frequencies.

[0083] Estimated allele frequency and genotype frequency may be calculated by evaluating the edited results at the target site or locus of interest, and then the mean or mean value may be calculated. This may involve techniques known in the art, such as DNA sequencing, PCR, or other molecular assays. Frequency is often expressed as a percentage, which represents the proportion of the edited allele or target within a cell population. In some embodiments, the estimated allele frequency or genotype frequency is calculated by PCR using at least one of the primers having SEQ NOs 13 to 16 and 23 to 24 (listed in Tables 4 and 5 of this Appendix).

[0084] Target drop rate This term refers to the frequency or rate of unintended genetic modifications occurring in genomic regions other than the intended target sites when using genome-editing technologies such as CRISPR / Cas9. These unintended genetic alterations can potentially cause undesirable effects or mutations in non-target genes or genomic regions. The detargeting rate is typically expressed as a percentage or ratio and quantifies the proportion of edited cells or organisms exhibiting genetic modifications at detargeting sites relative to the total number of edited cells or organisms.

[0085] The detarget indel rate may be determined by, for example, DNA sequencing (e.g., high-throughput sequencing), PCR assay, or other molecular methods. In certain embodiments, the detarget rate is determined by PCR using at least one of the primers having SEQ ID NOs 17 to 22 (listed in Table 4 of this Appendix).

[0086] therapy: The terms "treat," "therapy," and "therapy" as used herein refer to clinical interventions intended to prevent (e.g., suppress or inhibit) a disease or pathological condition; to cure a disease or pathological condition (e.g., cancer); to delay the onset of a disease or pathological condition; to reduce the severity or severity of a disease or pathological condition (e.g., cancer); to alleviate or neutralize one or more symptoms or sequelae associated with a disease or pathological condition; or to provide beneficial effects to a subject having a disease or pathological condition without necessarily treating the disease or pathological condition.

[0087] In some embodiments, these terms refer to clinical interventions for improving one or more symptoms compared to what would be expected in the absence of treatment using the cells of the present invention, for example; improving one or more sequelae; preventing one or more symptoms (e.g., suppression, inhibition, or delay); preventing one or more sequelae (e.g., suppression, inhibition, or delay); delaying one or more symptoms; delaying one or more sequelae; alleviating one or more symptoms; alleviating one or more sequelae; shortening the duration of one or more symptoms; shortening the duration of one or more sequelae; reducing the frequency of one or more symptoms; reducing the frequency of one or more sequelae; reducing the severity of one or more symptoms; reducing the severity of one or more sequelae; improving quality of life; increasing survival rate; preventing (e.g., suppression, inhibition, or delay) the recurrence of a disease or condition; delaying the recurrence of a disease or condition; reducing the severity of a disease; or any combination thereof.

[0088] The term "treatment" also includes prophylactic therapy or prevention (e.g., inhibition, suppression, or delay) of a disease or condition, its symptoms, or its sequelae. Prophylactic therapy refers to a therapeutic agent or a route of action used to prevent, inhibit, suppress, reduce the risk of, reduce the incidence of, or delay the onset of a disease or condition, or to prevent, inhibit, suppress, or delay symptoms associated with the disease or condition.

[0089] Effective amount: As used herein, the term “effective amount” of a formulation of the present invention, e.g., a cell, a cell population, or a pharmaceutical composition, is an amount sufficient to produce a beneficial or desired result, e.g., a clinical result, and as such, the “effective amount” depends on the context in which it is applied. For example, in a situation where a formulation is administered to treat cancer or to alleviate or prevent cancer-related sequelae and / or symptoms, the effective amount of the formulation is an amount sufficient to produce, for example, a reduction or shrinkage of tumor size, inhibition of tumor growth, induction of tumor regression, alleviation of cancer-related symptoms, or any combination thereof in a subject compared to the response obtained without the administration of the formulation. The term “effective amount” may be used interchangeably with “effective dose,” “therapeutic effective amount,” or “therapeutic effective dose.”

[0090] approximately: The term “about” is used herein to mean approximately, roughly, about, or a range thereof. When the term “about” is used with a numerical range, it modifies the range by extending the boundaries of the specified numerical value over and under. Generally, the term “about” may modify the numerical value over and under the specified value by, for example, a 10% variation, to be higher or lower (over or under). When the term “about” or “at least about” as used herein is applied to a series of values ​​or ranges, it applies equally to all members of the list. Accordingly, “at least about 1, 2, 3, 4” will be interchangeable with “at least about 1, at least about 2, at least about 3, at least about 4”.

[0091] Modified cytotoxic lymphocytes

[0092] The present invention relates to cytotoxic lymphocytes having inhibited SMAD4 function for adoptive immunotherapy. The working examples of the present invention demonstrate that such modified cells can bypass the immunosuppressive effects of TGF-β present in the tumor microenvironment, thereby enabling them to exhibit cytotoxicity and antitumor function.

[0093] Accordingly, one aspect of the present invention relates to isolated modified human cytotoxic lymphocytes for adoptive immunotherapy, wherein SMAD4 biological activity is inhibited and the cells are resistant to the immunosuppressive effects of TGF-β (i.e., in the TGF-β microenvironment) and exhibit cytotoxicity.

[0094] In some embodiments, the biological activity of SMAD4 is inhibited by gene editing (e.g., CRISPR-Cas9), RNA interference (RNAi) that specifically targets SMAD4 mRNA, small molecule inhibitors specific to SMAD4, dominant-negative mutations that interfere with the normal function of endogenous SMAD4 protein, antibodies designed to specifically bind to SMAD4 protein, proteolytic techniques (e.g., PROTAC and Degron systems), phosphorylation and post-translational modification, competitive inhibition, protein expression knockdown (e.g., antisense oligonucleotides or ribozymes that reduce expression at the mRNA level), protein blockade, or any other methodology.

[0095] In one embodiment, the biological activity of SMAD4 is achieved through gene editing, i.e., SMAD4 By modifying the DNA sequence of a gene or regulatory sequence, it causes the loss of function or altered function of the protein encoded by the targeted gene, thereby inhibiting it.

[0096] Accordingly, in some embodiments, the present invention SMAD4The present invention relates to isolated modified human cytotoxic lymphocytes for adoptive immunotherapy containing inactivated mutations in a gene, wherein the cells have inhibited SMAD4 expression and are resistant to the immunosuppressive effects of TGF-β, thereby exhibiting cytotoxicity.

[0097] In the context of the present invention, the term "inhibited SMAD4 expression" also includes "reduction" of SMAD4 expression.

[0098] In one embodiment, the modified cytotoxic lymphocyte cells are SMAD4 Homozygous inactivation mutation in the gene (i.e., SMAD4 - / -) includes. In another embodiment, the modified cytotoxic lymphocyte cells SMAD4 heterozygous inactivation mutation in the gene (i.e., SMAD4 Includes + / -).

[0099] In another embodiment, the modified cytotoxic lymphocyte cells are SMAD4 It contains an inactivated mutation in the gene and expresses a truncated form of the SMAD4 protein.

[0100] In some embodiments, the modified cytotoxic lymphocyte is a natural killer (NK) cell or a T-cell. In one embodiment, the T-cell is selected from the group consisting of CD4+ T-cells, CD8+ T-cells, regulatory T-cells, and helper T-cells. In one embodiment, the modified cytotoxic lymphocyte is a tumor-infiltrating lymphocyte (TIL). In certain embodiments, the modified cytotoxic lymphocyte is an NK cell. In certain embodiments, the modified cytotoxic lymphocyte is a T cell having a modified T-cell receptor (TCR).

[0101] Cytotoxic lymphocytes can be allogeneic (or "off-the-shelf") or autologous. Allogeneic cytotoxic lymphocytes originate from a donor source, are typically isolated from a healthy donor, and are cells that can be used for therapeutic purposes, such as cancer immunotherapy. Autologous cytotoxic lymphocytes are the patient's own cells that are isolated, manipulated (e.g., expanded or engineered), and then re-injected into the same individual. This approach is used in specific immunotherapy strategies.

[0102] In another embodiment, the modified cytotoxic lymphocyte cells are differentiated cells derived from pluripotent stem cells or induced pluripotent stem cells (iPSCs), said differentiated cells having an NK or T cell phenotype (i.e., iPSC-NK or iPSC-T cells). Commercial iPSC lines are available and can be used to generate the iPSC-NK or iPSC-T cells described herein.

[0103] In some embodiments, the modified cytotoxic lymphocytes provided herein include additional mutations or modifications. Non-limiting mutations or modifications that enhance the antitumor activity of cytotoxic lymphocytes may be chimeric antigen receptors (CARs), such as CAR-T or CAR-NK cells; T-cells redirected for B-cell maturation antigen (BCMA) targeting, CD19 targeting, CD20 targeting, CD30 targeting, HER2 targeting, EGFR targeting, IL-13Rα2 targeting, checkpoint inhibitors (e.g., PD-1 knockout), or universal cytokine killing (TRUCK); or combinations thereof (e.g., CAR-T-19, which is a CAR-T cell targeting CD19). Thus, the CAR may be incorporated into a TIL, NK cell, or TCR to generate CAR TILs, CAR-NK cells, or TCR-engineered CAR-T cells. Example 13 is SMAD4KO This demonstrates the efficient incorporation of a CAR into NK cells (CAR19-SMAD4-KO NK cells) and the enhanced antitumor efficacy thereof. In certain embodiments, the modified cytotoxic lymphocyte cells contain a CAR. Such CAR constructs may include, but are not limited to, receptors targeting CD19, CD20, CD22, BCMA (B-cell maturation antigen), CD319 (SLAMF7), CD38, CD138, NY-ESO-1, CEA, PSMA, MUC1, CD276 (B7-H3), GD2, FAP, VEGFR-2, mesothelin, EGFRvIII, CD30, HER2, GPRC5D, CD33, IL-13Rα2, and EGFR. In certain embodiments, the CAR is a CD19-CAR (CAR19).

[0104] In some embodiments, modified cytotoxic lymphocyte cells exhibit a higher apoptotic capacity than non-modified cells. The apoptotic capacity can be determined by incubating modified cells (and non-modified control cells) with target cells and measuring the apoptosis of the target cells, for example, using a fluorescent marker.

[0105] In one embodiment, provided herein SMAD4 Modified cytotoxic lymphocyte cells containing inactivated mutations in genes are SMAD4 It kills target cells with an efficiency approximately 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% higher than cells that do not contain inactivated mutations in their genes. In another embodiment, SMAD4 Modified cytotoxic lymphocyte cells containing inactivated mutations in genes are SMAD4 It kills target cells with approximately 2, 3, 4, 5, 6, 7, 8, 9, or 10 times higher efficiency than cells that do not contain inactivated mutations in their genes.

[0106] In some embodiments, the modified cytotoxic lymphocyte cell produces at least one result (i.e., effect) selected from, but not limited to, the group consisting of:

[0107] - Resistance to TGF-β inhibitory effects present in the tumor microenvironment;

[0108] - Preservation of anti-tumor function;

[0109] - Enhanced cytotoxicity important for tumor cell killing;

[0110] - Enhanced expression of cytotoxic effectors (e.g., granzyme and perforin) important for maintaining cytotoxicity along with a series of tumor cell killings;

[0111] - Increased secretion of pro-inflammatory cytokines such as IFN-γ and TNF-α, which are important for inducing the Thi1 anti-tumor microenvironment;

[0112] - Increased cellular expression of activating receptors CD16A, NKG2D, NKp30, and NKG2C, which are important for NK cell anti-tumor function;

[0113] - Increased expression of activating signaling adapters (HCST, TYROBP) essential for NK cell activation upon target cell recognition;

[0114] - Increased expression of CCL5 and CCL3 chemokines important for immune cell mobilization;

[0115] - Increased expression of FLT3LG, XCL1, XCL2, and CSF1, which are important for the recruitment and activation of dendritic cells;

[0116] - Conserved expression of the IL15 / IL2 receptor chain, which is essential for NK cell proliferation in response to proliferation-promoting cytokines;

[0117] - Increased expression of CD137 co-stimulatory receptor upon activation, which is important for NK cell survival and proliferation;

[0118] - Increased proliferation in response to IL-15 and CD137L, which are important for NK cell expansion in tumors, as well as activating receptor cross-linking;

[0119] - Enhanced expression of CD11a, CD18, and CD49d integrins, which are important for NK cell extravasation from blood vessels into tumors and necessary for tumor cell recognition and cytotoxic synapse formation;

[0120] - Maintenance of TGF-β-induced CD29, CD49a, and CD103 expression, which is important for tumor retention and invasion;

[0121] - Enhanced cytotoxicity against tumor globules compared to NK cells treated with TGFBRII inhibitors;

[0122] - Resistance to activin-A inhibition, which is important for simultaneously bypassing these inhibitory factors also found in the tumor microenvironment;

[0123] - Enhanced antitumor activity as monotherapy and in combination with tumor antigen-targeted monoclonal antibody therapy (anti-HER2 antibody) in preclinical in vivo models, which is important as a validation of concept; and

[0124] - Cytotoxic activity enhanced in the presence of TGF-β when cells contain additional mutations or alterations of a chimeric antigen receptor (CAR), such as CD19, which is important for enhancing the antitumor activity of CRA-NK cells in TGF-β-rich environments, such as solid tumors.

[0125] Method to produce modified cytotoxic lymphocytes

[0126] The cytotoxic lymphocytes of the present invention SMAD4Genes may be modified by genetic engineering to make them non-functional or damaged. Such genetic engineering may be achieved through various methods and techniques known in the art, such as CRISPR-Cas9, homologous recombination, RNAi, zinc finger nucleases (ZFN), or TAL effector nucleases (TALEN). An exemplary method is described in Example 4.

[0127] Accordingly, another aspect of the present invention relates to a method for producing modified human cytotoxic lymphocyte cells for adoptive immunotherapy, wherein the method comprises human cytotoxic lymphocyte cells SMAD4 It includes the step of genetically inactivating a gene to generate modified cells that have inhibited SMAD4 expression and are resistant to the immunosuppressive effects of TGF-β, thereby exhibiting cytotoxicity.

[0128] In the context of the present invention, the term " SMAD4 "Genes" SMAD4 Genes (e.g., SMAD4 genetic coding region, or SMAD4 Exons, introns, or non-translating regions - UTRs) and related regulatory sequences (e.g., SMAD4 Promoter, SMAD4 Enhancer, SMAD4 It includes a regulator. The regulatory sequence is SMAD4 It may be an upstream polynucleotide sequence (5' non-coding sequence) or downstream (3' non-translation sequence) activator binding sequence, enhancer, intron, polyadenylation recognition sequence, promoter, repressor binding sequence, stem-loop structure, translation initiation sequence, translation lead sequence, transcription termination sequence, translation termination sequence, primer binding site, etc. within the gene.

[0129] Therefore, in one embodiment, SMAD4 Genetic inactivation of genes is SMAD4 Coding area, SMAD4 Intron, SMAD4 UTR, SMAD4 regulatory sequence, SMAD4 Promoter, SMAD4 enhancer or SMAD4 It is in the regulator. In certain embodiments, genetic inactivation is SMAD4 It is in the realm of coding. More specifically, SMAD4 The coding area is in exon 5 or exon 10, more specifically in exon 5.

[0130] In some embodiments, genetic inactivation is performed by DNA cleavage. In one embodiment, DNA cleavage is performed using at least one targeted nuclease.

[0131] In some embodiments, DNA cutting is performed by introducing at least the following into the cell:

[0132] i) targeted nucleases; and

[0133] ii) of the cell SMAD4 Single-guided ribonucleic acid (sgRNA) that targets genes.

[0134] Alternatively, genetic inactivation can be performed by introducing at least the following into the cell by introducing a knock-in into a suitable location within the SMAD4 amino acid sequence:

[0135] i) Targeted nucleases;

[0136] ii) of the cell SMAD4 Single-guided ribonucleic acid (sgRNA) that targets a gene; and

[0137] iii) Donor DNA sequence.

[0138] Genetic inactivation can be achieved through knock-in by adding, for example, a sequence that induces a decoding frameshift in the gene or a sequence having a stop codon. Thus, in certain embodiments, the donor DNA sequence encodes a stop codon. In particular, genetic inactivation is performed by homology-directed repair (HDR).

[0139] Genetic inactivation can also be achieved, for example, through prime editing (PE) using Cas9 and reverse transcriptase, or base editing (BE) using a base editor.

[0140] In one embodiment, the targeted nuclease is selected from the group consisting of a CRISPR / Cas nuclease system, a TAL-effector domain nuclease (TALEN), a zinc finger nuclease (ZFN), a meganuclease, or a variant thereof. In a specific embodiment, the targeted nuclease is a CRISPR / Cas nuclease system.

[0141] CRISPR-Cas systems have been used for genome editing in prokaryotic and eukaryotic cells. In these existing CRISPR-Cas systems, an expression vector or a combination of vectors containing a single guide RNA (sgRNA) and a CRISPR-associated (Cas) protein (e.g., Cas9) or a gene encoding the protein or a DNA fragment encoding the protein is introduced into a host cell. The single guide RNA (sgRNA) functions to enable targeted genome editing by guiding the Cas protein to a specific genomic location. As used herein, the term "CRISPR-Cas system" refers to any various CRISPR-Cas classes, types, and subtypes.

[0142] In one embodiment, the targeted nuclease is a CRISPR-associated protein. The targeted nuclease may be its natural form (e.g., spCas9) or a form modified through genetic engineering (e.g., xCas9, enCas12, SpC, SpRY). In a specific embodiment, the targeted nuclease is a Cas protein.

[0143] As used herein, “Cas protein” or “Cas enzyme” refers to a Cas protein derived from bacteria of any species, subspecies, or strain encoding the Cas protein of interest, as well as variants and kinets of the corresponding specific Cas protein. The Cas protein and its cognate crRNA or tracrRNA may be directly isolated and purified from bacteria, produced synthetically or recombinantly, or delivered using a construct encoding the protein.

[0144] In one embodiment, the targeted nuclease may be selected from the group consisting of Cas9, spCas9, Cas12, Cas12a, Cas13, Cas14, CasX, C2c6, Cas3, Cas8, Cas6, Cas7, Cas5, Cas11, and Csm / Cmr. In a specific embodiment, the targeted nuclease is selected from the group consisting of Cas9, spCas9, and Cas12a.

[0145] As used herein, the term "Cas9 protein" refers to wild-type proteins derived from the Type II CRISPR-Cas9 system, modifications of Cas9 proteins, variants of Cas9 proteins, Cas9 orthologs, and combinations thereof. Cas9 proteins refer to such proteins, for example, Streptococcus pyogenes called "SpyCas9" ( Streptococcus pyogenes It may be derived from any various bacterial species having a genome encoding the Cas9 protein. In certain embodiments, the targeted nuclease is Cas9. The Cas9 gene may be from Streptococcus pyogenes or other organisms. In certain embodiments, Cas9 comprises SEQ ID NO. 12.

[0146] For example, in the CRISPR-Cas system, sgRNA guides the Cas enzyme to a target site within DNA. sgRNA is a synthetic RNA molecule engineered to have a sequence complementary to a target DNA region, which is known as a "protospacer." The part of sgRNA that aligns with the protospacer is called the "spacer." sgRNA is primarily composed of two sequences: crRNA (CRISPR RNA) and tracrRNA (trans-activated CRISPR RNA). crRNA provides target recognition because it contains the spacer sequence, while tracrRNA facilitates processing and functional binding using the Cas enzyme. Therefore, when sgRNA is introduced into the cell along with Cas, it guides the Cas protein to a specific protospacer site within the DNA. At that site, the Cas enzyme induces a double-strand break, initiating DNA repair that can lead to genetic modification. sgRNA sequences can be optimized to reduce the risk of off-target mutations.

[0147] Accordingly, in one embodiment, the protospacer sequence (target DNA region) is SMAD4 Includes a coding area. In certain embodiments, SMAD4 The coding region comprises a sequence from exon 5, exon 6, exon 7, exon 9, exon 10, or exon 12. In more specific embodiments, SMAD4 The coding region includes a sequence from exon 5 or exon 10, more particularly exon 5.

[0148] In another embodiment, the protospacer sequence comprises a sequence corresponding to the DNA binding domain of the SMAD4 protein. In another embodiment, the protospacer sequence comprises a SMAD4 sequence corresponding to the SMAD2 / 3 binding domain of the SMAD4 protein.

[0149] In one embodiment, the cell SMAD4sgRNA that targets genes targets SMAD4 Complementary to the gene (i.e., SMAD4 It may be part of a gene or regulatory sequence and includes a sequence (i.e., a spacer or crRNA) that is complementary to the protospacer. In certain embodiments, the cell's SMAD4 sgRN that targets genes is SMAD4 Coding sequence, SMAD4 enhancer area, or SMAD4 One selected from the promoter area SMAD4 It is configured to target genes. In certain embodiments, the cell's SMAD4 The sgRNA targeting the gene is approximately 20 nucleotides long, and based on the total length of the sgRNA sequence SMAD4 It can be selected to have at least 80% sequence identity with the gene. In certain embodiments, the cell's SMAD4 sgRNA that targets genes targets SMAD4 It is configured to provide a cleavage event selected from double-strand breaks and single-strand breaks within 500, 400, 300, 200, 100, 50, 25, or 10 nucleotides of the gene.

[0150] In certain embodiments, the cell SMAD4 sgRNAs that target genes include crRNAs comprising sequences selected from sequences 1 to 10, particularly sequence 1. SMAD4 Exemplary crRNAs that can be used for the inactivation of genes are presented in Table 1. Accordingly, in one embodiment, the cell SMAD4 The sgRNA targeting the gene comprises SEQ ID NOs. 1 to 10, or a sequence having at least 80% sequence identity with any one of SEQ ID NOs. 1 to 10. In a specific embodiment, the cell's SMAD4 sgRNAs that target genes include SEQ ID NO. 1 or SEQ ID NO. 2, more particularly SEQ ID NO. 1.

[0151]

[0152] In one embodiment, the cell SMAD4 The sgRNA targeting the gene comprises a tracrRNA containing a sequence complementary to the targeted nuclease (e.g., Cas9 enzyme). In a specific embodiment, the tracrRNA sequence is SEQ ID NO. 11. Thus, in one embodiment, the cell's SMAD4 The sgRNA targeting the gene comprises SEQ ID NO. 11, or a sequence having at least 80% sequence identity with the sequence of SEQ ID NO. 11. In certain embodiments, the cell's SMAD4 sgRNAs that target genes include sequence number 11.

[0153] cell SMAD4 The sgRNA targeting the gene may have crRNA and tracrRNA, which are two distinct sequences that hybridize within the cell to form a functional sgRNA, or alternatively, may have a single fused sgRNA sequence capable of incorporating both crRNA and tracrRNA. Thus, in certain embodiments, the cell's SMAD4 The sgRNA targeting the gene comprises crRNA and tracrRNA in two distinct sequences. In certain embodiments, the crRNA comprises a sequence complementary to a portion of the tracrRNA sequence. Alternatively, in another specific embodiment, the cell's SMAD4 The sgRNA that targets the gene contains a single sequence that includes both the crRNA sequence and the tracrRNA sequence.

[0154] In some embodiments, the cell SMAD4 sgRNAs that target genes comprise crRNA and tracrRNA sequences as described herein (e.g., SEQ ID NOs 1 to 11). In particular, the cell's SMAD4 The sgRNA that targets a gene includes sequences of SEQ ID NOs 1 to 11, or sequences having at least 80% sequence identity with any one of SEQ ID NOs 1 to 11.

[0155] In one embodiment, the targeted nuclease is by DNA cleavage SMAD4 By exerting single-strand breaks and / or double-strand breaks (DBS) within the gene SMAD4 It can selectively inactivate SMAD4 by causing at least one permanent deletion or insertion of the gene, thereby reducing or inhibiting its expression.

[0156] Accordingly, a specific embodiment relates to a method for producing modified human cytotoxic lymphocyte cells for adoptive immunotherapy, wherein the method comprises human cytotoxic lymphocyte cells SMAD4 Genetically inactivating genes by DNA cutting, at least into the cell

[0157] i) targeted nucleases; and

[0158] ii) of the cell SMAD4 Single guide ribonucleic acid that targets genes

[0159] It is performed by introducing, and the targeted nuclease by DNA cleavage SMAD4 By exerting single-strand breaks and / or double-strand breaks within the gene SMAD4 It results in at least one permanent deletion or insertion of a gene, thereby selectively inactivating SMAD4 by reducing or inhibiting its expression, and the cells have inhibited SMAD4 expression and are resistant to the immunosuppressive effects of TGF-β, thereby resulting in modified cells that exhibit cytotoxicity.

[0160] Various components for use in the method are synthesized or, for example, targeted nucleases and / or cells. SMAD4It can be produced using an expression cassette encoding sgRNA that targets a gene. Various components can be produced recombinantly in host cells. These components may be present on a single cassette or multiple cassettes in the same or different constructs. A suitable replication vector will contain control sequences and replicons derived from species compatible with the intended expression host cell. In some embodiments, polynucleotides encoding one or more of the various components are operably linked to an inductive promoter, a repressive promoter, or a constitutive promoter. Transformed host cells are cells transformed or transfected with a vector constructed using recombinant DNA technology. General methods for constructing expression vectors are known in the art.

[0161] In one embodiment, a targeted nuclease (e.g., Cas9) is introduced into the cell as a polynucleotide (i.e., DNA or mRNA) or as a protein, particularly as a protein. In another embodiment, the cell's SMAD4 sgRNA targeting a gene is introduced into the cell as a plasmid (i.e., DNA) or as RNA, particularly as RNA. In another embodiment, the targeted nuclease and the cell SMAD4 sgRNA that targets genes is introduced into the cell as a ribonucleoprotein (RNP) complex.

[0162] In certain embodiments, the ribonucleoprotein complex is a targeted nuclease as a protein (e.g., Cas9) and a cell SMAD4 The prepared sgRNA targeting a gene is prepared by combining it in a 1:3 molar ratio at room temperature for about 20 minutes. In a specific embodiment, the ribonucleoprotein complex comprises at least one crRNA selected from the group consisting of SEQ ID NOs 1 to 10, a tracrRNA comprising SEQ ID NO. 11, and a Cas9 comprising SEQ ID NO. 12.

[0163] Methods for introducing polynucleotides (e.g., expression vectors) or ribonucleoprotein particles into host cells are known in the art and are typically selected based on the type of host cell. These methods include, for example, viral or bacteriophage infection, transfection, conjugation, electroporation, calcium phosphate precipitation, polyethyleneimine-mediated transfection, DEAE-dextran-mediated transfection, protoplasmic fusion, lipofection, liposome-mediated transfection, particle gun technology, direct microinjection, and nanoparticle-mediated delivery.

[0164] In one embodiment, the targeted nuclease and the cell SMAD4 sgRNAs that target genes are introduced by transfection (e.g., nuclear infection or electroporation), microinjection, or viral vectors (e.g., lentiviruses), particularly by nuclear infection. Viral vectors can be selected from the group consisting of lentiviruses, retroviruses, plasmids, and adeno-associated viruses (AAVs).

[0165] In some embodiments, the method for producing modified cytotoxic lymphocyte cells as defined above further includes a step of cell isolation or purification. Cell purification may occur before or after cell modification, depending on the specific therapy. If purification is performed before cell modification, the purpose is to isolate the desired cell type from the mixed population to ensure highly concentrated starting cells. On the other hand, if purification is performed after cell modification, it enables the selection of cells having the desired traits after the cells have been processed (e.g., through genetic engineering). The choice between these approaches depends on the specific therapeutic strategy and clinical requirements, where each method is tailored to the specific goals of the therapy.

[0166] Cell separation or purification may be performed using different techniques known in the art, such as immunomagnetic separation, flow cytometry sorting, density gradient centrifugation, or positive and negative selection. In one embodiment, cell separation is performed by immunomagnetic negative selection. In a specific embodiment, cytotoxic lymphocyte cells (e.g., NK cells) are purified by negative selection, for example, using an NK-cell isolation kit.

[0167] In a specific embodiment, the obtained cells are substantially purified for T cell content by selecting the cells for the expression of a marker selected from the group consisting of a) CD3; b) CD4; c) CD8; and d) CD90. In a more specific embodiment, the T cells are selected based on the expression of the CD3 marker and optionally the expression of the CD8 and CD4 markers.

[0168] In a specific embodiment, the obtained cells are substantially purified for NK cell content by selecting the cells for the expression of a marker selected from the group consisting of a) CD56; b) CD57; c) KIR; and d) CD16. In a more specific embodiment, NK cells are selected based on the expression of the CD56 marker and the lack of expression of the CD3 marker.

[0169] In some cases, the cell separation or purification process involves the use of two distinct methods to ensure the isolation of desired cells. These approaches are adapted to enhance the purity and concentration of selected cells within a population. For example, negative selection may be used to isolate a desired cell type, which can then be extended to subsequently increase its number and prominence within the population. A second step may involve positive selection, such as the use of a specific antibody to isolate the desired cell type with high purity. Accordingly, in one embodiment, the cell separation or purification involves the use of two separation methods.

[0170] In some embodiments, the method for producing modified cytotoxic lymphocyte cells as defined above includes isolation or purification of cells after cell modification. Cell isolation or purification may be performed using different techniques known in the art, in particular, cells are isolated by selective pressure. Selective pressure, such as isolation techniques after cell modification, involves the step of subjecting the modified cells to an environment favorable for the survival and growth of cells having specific traits or genetic modifications. By exposing cells to conditions that selectively benefit from desired characteristics, such as resistance to drugs or the ability to target specific antigens, it becomes possible to isolate and expand cells possessing the intended characteristics. Example 4 and FIG. 6 show that from day 7 to day 14, the cells SMAD4 KO It is shown that NK cells were cultured with TGF-β1 as a selective pressure to concentrate the cells while reducing the proliferation of non-manipulated cells. Thus, in certain embodiments, the separation step involves the use of TGF-β as a selective pressure. In certain embodiments, the cells can be concentrated by culture in the presence of TGF-β.

[0171] In some embodiments, the method for producing modified cytotoxic lymphocyte cells as defined above further comprises the step of expanding or proliferating the cells. Cell expansion may be applied at different stages, e.g., to expand immune cells obtained from a patient or donor after collection, before modification, during modification, or before patient infusion. Cells of the present invention may be proliferated in an in vitro culture system supported by growth factors IL-2, IL-15, feeder cells, genetically modified feeder cells containing IL-15 transmembrane, CD137 ligand, or a combination thereof. In one embodiment, the cells are about 10 4 It can be expanded during the fold.

[0172] Accordingly, one embodiment of the present invention relates to a method for producing modified human cytotoxic lymphocyte cells for adoptive immunotherapy, wherein the method comprises human cytotoxic lymphocyte cells SMAD4 The method includes the step of genetically inactivating a gene to generate modified cells that have inhibited SMAD4 expression and are resistant to the immunosuppressive effects of TGF-β, thereby exhibiting cytotoxicity.

[0173] a) SMAD4 A step of expanding or proliferating cells from a sample of a subject requiring treatment or a healthy donor before genetically inactivating the gene;

[0174] b) SMAD4 A step of isolating or purifying human cytotoxic lymphocyte cells from a sample or cell obtained in (a) before genetically inactivating the gene;

[0175] c) SMAD4 A step of expanding or proliferating cells obtained after genetically inactivating genes; and / or

[0176] d) SMAD4 It further includes the step of isolating or purifying (e.g., using TGF-β1 as a selective pressure) the cells obtained after genetically inactivating the gene or obtained in (c).

[0177] The method of producing modified cytotoxic lymphocytes does not involve a step that alters human germline genetic identity, and this is not a method of treating the human or animal body through therapy.

[0178] Another aspect of the present invention is a cell as described herein. SMAD4 The invention relates to sgRNAs that target genes (e.g., sgRNAs comprising SEQ ID NOs. 1 to 11). In particular, a cell SMAD4The sgRNA that targets a gene includes sequences of SEQ ID NOs 1 to 11, or sequences having at least 80% sequence identity with any one of SEQ ID NOs 1 to 11.

[0179] Another aspect of the present invention is

[0180] a) at least a targeted nuclease as described herein (e.g., Cas9 nuclease, or a polynucleotide encoding Cas9 nuclease); and

[0181] b) cells as defined herein SMAD4 The present invention relates to a kit comprising at least sgRNA that targets a gene (e.g., sgRNA including SEQ ID NOs 1 to 11).

[0182] Another aspect of the present invention relates to modified human cytotoxic lymphocyte cells obtained by the method provided herein.

[0183] In some embodiments, cytotoxic lymphocytes are modified by the method described herein. In particular, cytotoxic cells are modified by introducing the following into the cell SMAD4 Modified by genetic inactivation of genes:

[0184] i) at least one targeted nuclease; and

[0185] ii) of the cell SMAD4 At least one sgRNA that targets a gene.

[0186] In a specific embodiment, by introducing a Cas9 ribonucleoprotein complex as described herein into the cell, cytotoxic lymphocytes SMAD4 It is modified by the genetic inactivation of genes.

[0187] Method of adoptive cell therapy

[0188] Adoptive cell delivery is a therapeutic approach in immunotherapy that involves the steps of isolating, manipulating, and subsequently injecting the patient's own immune cells or engineered immune cells into the patient's body to treat a disease, typically cancer. Adoptive cell delivery can be autologous or allogeneic (e.g., "off-the-shelf").

[0189] In autoadoptive cell delivery, immune cells are collected from the patient's own body, typically from their blood or tumor tissue. These collected immune cells are modified, activated, and expanded outside the patient's body, and then reintroduced into the patient.

[0190] On the other hand, allogeneic adoptive cell delivery involves the use of immune cells that are not derived from the patient's own body. Instead, these immune cells are typically obtained from a healthy donor and can be modified and expanded to enhance their effectiveness in targeting the patient's disease. The modified cells can be stored by freezing them and preserving their viability until use in the patient; this is known as a "ready-to-use" therapy and offers potential advantages in terms of accessibility to treatment and reduced time required.

[0191] In particular, NK cell therapy is a field of adoptive cell delivery where the "off-the-shelf" approach is particularly attractive because NK cells, unlike T cells (i.e., TCRs), are part of the innate immune system that lacks antigen-specific receptors, has limited expression of HLA molecules, and has a more general and immediate response to abnormal cells, thus possessing unique characteristics that make them relatively well-suited for allogeneic or "off-the-shelf" use.

[0192] In some embodiments, the method for producing modified cytotoxic lymphocyte cells as defined above further comprises the step of obtaining a sample (e.g., blood) from a subject requiring treatment or a healthy donor. In certain embodiments, the sample is obtained via peripheral blood (e.g., standard venous blood collection), leukocyte apheresis (collection of a large volume of leukocytes), umbilical cord blood (collection of hematopoietic stem cells and other immune cells), bone marrow aspiration (collection of hematopoietic stem cells and other immune cells), or induced pluripotent stem cell reprogramming. In certain embodiments, the sample is obtained via leukocyte apheresis.

[0193] In certain embodiments, the sample is from a subject requiring treatment (i.e., auto-treatment). In another specific embodiment, the sample is from a healthy donor (i.e., allogeneic treatment or "pre-made"). In particular, the sample is histologically compatible with the subject requiring treatment (e.g., cells from a donor having a human leukocyte antigen (HLA) that is acceptable to the patient). In certain embodiments, the sample is selected from the group consisting of blood, peripheral blood, lymphatic organs, lymph fluid, organs, tissues (e.g., tumor-infiltrating NK cells), tumors, or combinations thereof.

[0194] Another aspect relates to a method for transferring adoptive cells, and the method

[0195] a) a step of obtaining a sample (e.g., blood) from a subject requiring treatment or a healthy donor;

[0196] b) a step of producing modified human cytotoxic lymphocyte cells having inhibited SMAD4 expression according to the method of producing modified human cytotoxic lymphocyte cells as described above;

[0197] c) optionally, a step of administering a conditioning or preconditioning treatment to a subject requiring treatment (e.g., IL-2 treatment); and

[0198] d) includes the step of administering an effective amount of cells obtained in (b) to a subject requiring treatment.

[0199] This embodiment may alternatively be formulated as a method for treating cancer in a subject requiring treatment, comprising steps as described above.

[0200] In the case of "off-the-shelf" therapy, the process can be simplified to primarily involve the thawing of stored modified cells and subsequent cell administration. Initially, immune cells are collected from healthy donors and modified, then cryopreserved to ensure long-term storage and accessibility for future therapeutic use. When a patient requires treatment, the frozen cells are thawed and administered directly, typically via intravenous infusion or a suitable delivery method. An expansion step may not be essential in "off-the-shelf" therapy because donor-derived cells are already available in sufficient quantities, simplifying the process and eliminating the complexities associated with extensive cell expansion and modification procedures.

[0201] Accordingly, another aspect relates to a method for delivering adoptive cells and a method for treating cancer in a subject requiring treatment, and the method

[0202] a) a step of thawing isolated modified SMAD4 human cytotoxic lymphocyte cells according to the present invention;

[0203] b) optionally, a step of administering a conditioning or preconditioning treatment to a subject requiring treatment (e.g., IL-2 treatment); and

[0204] c) includes the step of administering the cells obtained in (a) to a subject requiring treatment.

[0205] Cells produced in any of the aforementioned processes may be preserved (e.g., cryopreserved) for future use in the event of cancer recurrence in the subject.

[0206] In some embodiments, the adoptive cell delivery or cancer treatment method defined above includes the step of administering a conditioning or preconditioning treatment to a subject to prepare the subject to receive the engineered cells. The conditioning or preconditioning treatment may be administered to the subject before, during, and / or after the administration of the modified or expanded immune cells. Such treatment aims to establish a more favorable internal environment within the patient's body, create space within the patient's immune system, and also enhance the efficacy of the therapeutic cells. Non-limiting examples of preconditioning or conditioning treatment include lymphocyte depletion, whole-body irradiation, cytokine therapy (e.g., IL-2 which helps activate and expand NK cells or T cells), targeted antibodies (e.g., rituximab), or tumor microenvironment modulators (e.g., checkpoint inhibitors). In certain embodiments, the conditioning treatment is cytokine therapy. In particular, the cytokine therapy consists of the administration of IL-2.

[0207] In some embodiments, the adoptive cell delivery or cancer treatment method as defined above comprises the step of administering an effective amount of the obtained cells (which may be in the form of a pharmaceutical composition) to a subject in need thereof. In certain embodiments, the effective amount of cells is about 1 x 10⁶ per kg of human subject. 5 to about 1x10 7 It is a cell. Administration may take various forms as described above, such as intravenous infusion, intratumoral injection, or intraperitoneal injection, depending on the specific therapy and the desired site of action. In one embodiment, the cell is administered to the subject by intravenous infusion. In another embodiment, the cell is injected directly into the tumor or injected into a specific tissue or area surrounding the tumor of the subject. A combination of injection and infusion may be useful for treating one location in the subject, such as the original tumor at the primary site and one or more metastatic tumors at different locations.

[0208] cell population

[0209] In cell therapy, a subject is administered a cell population comprising both modified cells as described herein and unmodified cells. For example, in the context of gene knockout, it is possible to have a cell population having a significant proportion (e.g., 70%) of cells exhibiting a knockout phenotype, while some (e.g., 30%) of the cells may remain unchanged. The resulting cell population may exhibit enhanced therapeutic effects by utilizing the synergistic interactions and functions of the entire cell population. Accordingly, the method for producing modified cytotoxic lymphocyte cells described in the present invention comprises a significant proportion of cells SMAD4 It is possible to generate a population of cells containing inactivated mutations in genes.

[0210] The method for producing modified human cytotoxic lymphocyte cells described herein has been defined as modifying cells, but it is understood to be applicable to modifying a set of cells derived from a sample. In the same way, the product obtained from the method described above is defined as modified cell(s) or as a cell population comprising modified cells and non-modified cells. Accordingly, another aspect of the invention is a method for producing a cell population comprising modified cytotoxic lymphocyte cells by following the steps of the method described above.

[0211] Accordingly, another aspect of the present invention is a cell population comprising modified human cytotoxic lymphocyte cells as defined in the first aspect of the present invention, wherein the cell population is

[0212] a) Approximately 10% to 90% modified SMAD4 Allele frequency of genetic cytotoxic lymphocytes;

[0213] b) About 10% to 90% of SMAD4 - / - and / or SMAD4+ / - genotype frequency of cytotoxic lymphocytes; and / or

[0214] c) Characterized by a target drop rate of less than 1%.

[0215] Example 4 of the present invention and FIG. 16 are in human NK cells performed by CRISPR / Cas9 nuclear infection SMAD4 The allele and genotype frequencies and safety evaluation of the knockout are shown, and the obtained allele and genotype frequencies are described in detail.

[0216] In particular, the inventors concluded that the allelic frequencies of the edited sequence in exon 5 were 71%, 57%, and 74% in the absence of TGF-β treatment, and increased to 79%, 72%, and 79%, respectively, when TGF-β was included with the expansion of nuclear-infected NK cells. Allelic frequency represents the percentage of mutated cells having outframe (OUT) mutations (e.g., insertions or deletions) that do not induce a functional protein.

[0217] Accordingly, in some embodiments, the cell population is about: 10% to 90%, or 20% to 90%, or 30% to 90%, or 40% to 90%, or 50% to 90%, or 60% to 90%, or 70% to 90%, or 80% to 90%, or 40% to 80%, or 50% to 80%, or 70% to 80% of modified SMAD4 It is characterized by the allele frequencies of genetic cytotoxic lymphocytes.

[0218] In some embodiments, the cell population is about: 10%, 20%, 30%, 35%, 40%, 45%, 50%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100%, SMAD4 It includes cytotoxic lymphocytes containing inactivated mutations in genes.

[0219] Regarding genotype frequency, the inventors found that 67%, 43% to 72% of the obtained NK cells SMAD4 - / - and; 30%, 46% to 26% of NK cells SMAD4 It was + / -, and only 3%, 10% to 2% of NK cells were manipulated SMAD4 It was concluded that it remained at + / +. Notably, the addition of TGF-β along with NK cell expansion SMAD4 While reducing + / + NK cells to a level where they barely survive, SMAD4 - / - increased the ratio of NK cells.

[0220] Accordingly, in one embodiment, the cell population is at least about: 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 100% of SMAD4 - / - Characterized by the genotype frequency of cytotoxic lymphocytes. In another embodiment, the cell population is at least about: 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 100% of SMAD4 Characterized by a genotype frequency of + / - cytotoxic lymphocytes. In another embodiment, the cell population is at least about: 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% of SMAD4 It is characterized by the genotype frequency of + / + cytotoxic lymphocytes.

[0221] In one embodiment, the cell population is at least about: 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 100% of SMAD4 - / - Cytotoxic lymphocytes; at least about: 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 100% of SMAD4+ / - cytotoxic lymphocytes; and at least about: 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% of SMAD4 It is characterized by the genotype frequency of + / + cytotoxic lymphocytes.

[0222] In one embodiment, the cell population is about: 10% to 90% SMAD4 - / -, 10% to 90% of SMAD4 + / -, and 1% to 90% of SMAD4 + / + cytotoxic lymphocytes; or 20% to 80% of SMAD4 - / -, 20% to 80% of SMAD4 + / -, and 1% to 50% of SMAD4 + / + cytotoxic lymphocytes; or 40% to 75% of SMAD4 - / -, 25% to 50% of SMAD4 + / -, and 1% to 15% of SMAD4 + / + cytotoxic lymphocytes; or 43% to 72% of SMAD4 - / -, 26% to 46% of SMAD4 + / -, and 2% to 10% of SMAD4 It is characterized by the genotype frequency of + / + cytotoxic lymphocytes.

[0223] In certain embodiments, the cell population is about: 10% to 90%, or 20% to 90%, or 30% to 90%, or 40% to 90%, or 50% or 90%, or 40% to 70% of SMAD4 - / - and / or SMAD4 It is characterized by a genotype frequency of + / - cytotoxic lymphocytes. In certain embodiments, the cell population is about 10% to 90% of SMAD4 - / -, and about 1% to 90% of SMAD4 It is characterized by the genotype frequency of + / + cytotoxic lymphocytes. In another specific embodiment, the cell population consists of about 10% to 90% of SMAD4+ / -, and about 1% to 90% of SMAD4 It is characterized by the genotype frequency of + / + cytotoxic lymphocytes.

[0224] In a specific embodiment, the cell population is at least about 30% of SMAD4 - / -, at least about 20% of SMAD4 + / - and up to about 10% SMAD4 It is characterized by the genotype frequency of + / + cytotoxic lymphocytes. In another specific embodiment, the cell population is at least about 40% SMAD4 - / -, and at least about 30% of SMAD4 It is characterized by the genotype frequency of + / - cytotoxic lymphocytes.

[0225] In some embodiments, the cell population is characterized by a detargeting rate of less than 1%. In one embodiment, the detargeting event CREBBP, DCTN5 and NUFIP2 It exists in genes.

[0226] In certain embodiments, the cell population

[0227] a) About 10% to 90% of SMAD4 - / - and / or SMAD4 + / - genotype frequency of cytotoxic lymphocytes; and

[0228] b) Characterized by a target drop rate of less than 1%.

[0229] In certain embodiments, the cell population

[0230] a) About 20% to 70% of SMAD4 - / - and / or SMAD4 + / - genotype frequency of cytotoxic lymphocytes; and

[0231] b) Characterized by a target drop rate of less than 1%.

[0232] Pharmaceutical composition

[0233] Cell populations are typically administered to subjects via intravenous infusion or intratumoral injection. During this process, the cell population is mixed with pharmaceutically acceptable excipients to ensure safe and effective delivery. Furthermore, these excipients help maintain cell viability during storage, handling, and delivery; additionally, in the context of ready-made treatments, excipients such as cryoprotectants are used to preserve the cells, enabling freezing and long-term storage to preserve their viability until the cells are needed for the subject's treatment.

[0234] Accordingly, another aspect relates to a pharmaceutical composition comprising modified cytotoxic lymphocyte cells or a cell population as defined herein and a pharmaceutically acceptable excipient.

[0235] The term "pharmaceuticalally acceptable" includes excipients, compounds, substances, compositions, carriers, vehicles, and / or dosage forms that are recognized in the art and, within the scope of sound medical judgment, suitable for use in contact with the handling of the subject without excessive toxicity, irritation, allergic reaction, or other problems or complications, in accordance with a reasonable benefit / risk ratio. Each carrier, excipient, etc., must also be "acceptable" in the sense of compatibility with other components of the formulation. Suitable carriers, excipients, etc., may be found in standard pharmaceutical books.

[0236] Non-limiting examples of pharmaceutically acceptable excipients that may be included in a solution containing the cell population of the present invention include: buffers for maintaining pH, such as phosphate-buffered saline (PBS) or 4-(2-hydroxyethyl)-1-piperazine ethanesulfonic acid (HEPES); isotonic saline solutions, such as physiological saline (0.9% sodium chloride solution) or Ringer's solution; cryoprotectants for freezing and thawing, such as dimethyl sulfoxide (DMSO) or glycerol; anticoagulants for preventing coagulation, such as heparin or citrate-phosphate-dextrose (CPD); shelf-life preservatives, such as gentamicin or thimerosal; stabilizers for maintaining cell integrity, such as human serum albumin (HSA) or polyvinylpyrrolidone (PVP); diluents for concentration adjustment, such as cell culture media or sterile water for injection; and carrier proteins that contribute to the delivery of therapeutic factors. and co-solvents for improving solubility, such as ethanol or polyethylene glycol (PEG).

[0237] In certain embodiments, a pharmaceutically acceptable excipient is a cryoprotectant selected from DMSO or glycerol. In another specific embodiment, a pharmaceutically acceptable excipient is serum.

[0238] In some embodiments, the pharmaceutical composition is cryopreserved. It may be cryopreserved for approximately: 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 12 months, 13 months, 14 months, 15 months, 16 months, 17 months, 18 months, 2 years, or more than 3 years before thawing and use.

[0239] In this embodiment, where the cell population is cryopreserved and thawed before use, the viability of the cells is at least: 30%, 40%, 50%, 60%, or 70%, as determined by a suitable assay known in the art. Viability can be determined, for example, using trypan blue exclusion.

[0240] The pharmaceutical composition may be administered by any suitable route of administration, such as by injection, such as subcutaneous, intradermal, intravenous, arterial, intramuscular, intraperitoneal, intramedullary, intratumoral, or intranodal injection, or by infusion. In certain embodiments, the pharmaceutical composition is administered intravenously.

[0241] In another embodiment, the pharmaceutical composition is injected directly into the tumor or injected into a specific tissue or area surrounding the tumor of the subject. A combination of injection and infusion may be useful for treating one location in the subject, such as the original tumor at the primary site and one or more metastatic tumors at different locations.

[0242] In some embodiments, the pharmaceutical composition is administered by intravenous infusion for about: 15 minutes, 30 minutes, 45 minutes, 60 minutes, 90 minutes, 2 hours, 3 hours, 4 hours, or 5 hours. The infusion rate may vary depending on the number of cells being injected into the subject.

[0243] The pharmaceutical composition may be in the form of a liquid solution or suspension. Alternatively, the pharmaceutical composition may also be in the form of a powder or lyophilized material that can be reconstituted with a solvent before use, as well as a solution or suspension ready for injection, a dry insoluble composition for combination with a vehicle before use, and an emulsion and liquid concentrate for dilution before administration. Examples of suitable diluents for reconstituted solid compositions before injection include bacteriostatic water for injection, 5% dextrose in water, phosphate-buffered saline, Ringer's solution, saline solution, sterile water, deionized water, and combinations thereof.

[0244] Solutions or suspensions used for intravenous injection may contain the following components: sterile diluents such as water for injection, physiological saline, fixative oil, polyethylene glycol, glycerin, propylene glycol, or other synthetic solvents; antimicrobial agents such as benzoyl alcohol or methyl paraben; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid (EDTA); buffers such as acetate, citrate, or phosphate; and tonicity adjusters such as sodium chloride or glucose. pH may be adjusted with an acid or base such as hydrochloric acid or sodium hydroxide. The preparation may be sealed in ampoules, single-use syringes, or multi-use vials made of glass or plastic.

[0245] The dose to be administered will vary depending on the subject's age, weight, and general condition, as well as the severity of the condition being treated, the judgment of a medical professional, and the specific lymphocytes being administered. The therapeutically effective dose may be determined by a person skilled in the art and will be adjusted to the specific requirements of each specific case. In some embodiments, the pharmaceutical composition comprises an effective amount of the obtained cell population.

[0246] Generally, the therapeutically effective dose of a cell population is approximately 1 x 10 total per kg of the subject. 4 Up to 1x10 10 , or 1x10 5 Up to 1x10 10 , or 1x10 5 Up to 1x10 7 , or 1x10 6 Up to 1x10 10 , or 1x10 7 Up to 1x10 9 , or 5x10 7 Up to 5x10 8 It will be a range of cells or any amount within these ranges. In certain embodiments, the effective amount is about: 1 x 10⁻⁶ per kg of the object. 4 , 1x10 5 , 1x106 , 1x10 7 , 1x10 8 , 1x10 9 , or 1x10 10 It is a cell.

[0247] The total number of cells may be administered as a single bolus dose or as two or more doses, for example, at intervals of one day or more. The amount of compound administered will depend on the efficacy of the specific cell composition, the disease being administered, and the route of administration.

[0248] In some embodiments, one or more doses of the pharmaceutical composition are administered. If two or more doses of the pharmaceutical composition are administered, the duration between administrations must be sufficient time to enable cell proliferation in the individual. In certain embodiments, the duration between doses is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 weeks or more.

[0249] In certain embodiments, the modified cytotoxic lymphocyte cells, cell populations, or pharmaceutical compositions of the present invention are immunotherapeutic agents. In particular, the immunotherapeutic agents are used in adoptive cell therapy.

[0250] Medical use

[0251] As previously discussed, examples of the present invention provide evidence of the antitumor activity of the modified cytotoxic lymphocyte cells and cell populations described herein. Additionally, these cells or populations have been demonstrated to be effective against a wide range of cancer types, including solid tumors and hematological cancers such as colorectal cancer, breast cancer, and leukemia, particularly TGF-beta-rich cancers.

[0252] Accordingly, another aspect relates to modified cytotoxic lymphocyte cells, cell populations, or pharmaceutical compositions as defined herein for use as medicine.

[0253] Another aspect relates to modified cytotoxic lymphocyte cells, cell populations, or pharmaceutical compositions as defined herein for use as immunotherapeutic agents.

[0254] One aspect of the present invention also relates to modified cytotoxic lymphocyte cells, cell populations, or pharmaceutical compositions as defined herein for use in cancer treatment.

[0255] Alternatively, the present invention also comprises a method for treating cancer (e.g., colorectal cancer, breast cancer, or leukemia) in a subject, the method comprising the step of administering a therapeutically effective amount of modified cytotoxic lymphocyte cells, a cell population, or a pharmaceutical composition as defined herein to a subject requiring treatment.

[0256] In some embodiments, the cancer is a TGF-beta-rich cancer. In some embodiments, the cancer may be, but is not limited to, breast cancer, lung cancer, colorectal cancer, colon cancer, rectal cancer, prostate cancer, ovarian cancer, uterine cancer, cervical cancer, pancreatic cancer, liver cancer, kidney cancer, bladder cancer, stomach cancer, esophageal cancer, thyroid cancer, brain tumor, skin cancer (melanoma, squamous cell carcinoma, basal cell carcinoma), sarcoma, osteosarcoma, testicular cancer, adrenal tumor, neuroendocrine tumor, head and neck cancer, gastrointestinal stromal tumor, mesothelioma, thymoma, Wilms tumor, retinoblastoma, rhabdomyosarcoma, teratoma, multiple myeloma, leukemia, lymphoma, multiple myeloma, myelodysplastic syndrome, myeloproliferative neoplasm, erythroleukemia, pure red blood cell aplasia, or hemophagocytic lymphohistiocytosis.

[0257] In one embodiment, the cancer is a solid tumor. In some embodiments, the solid tumor includes, but is not limited to, breast cancer, lung cancer, colorectal cancer, colon cancer, rectal cancer, prostate cancer, ovarian cancer, uterine cancer, cervical cancer, pancreatic cancer, liver cancer, kidney cancer, bladder cancer, stomach cancer, esophageal cancer, thyroid cancer, brain tumor, skin cancer (melanoma, squamous cell carcinoma, basal cell carcinoma), sarcoma, osteosarcoma, testicular cancer, adrenal tumor, neuroendocrine tumor, head and neck cancer, gastrointestinal stromal tumor, mesothelioma, thymoma, Wilms tumor, retinoblastoma, rhabdomyosarcoma, teratoma, and multiple myeloma.

[0258] In one embodiment, the cancer is a blood cancer. In some embodiments, the blood cancer includes, but is not limited to, leukemia, lymphoma, multiple myeloma, myelodysplastic syndrome, myeloproliferative neoplasm, erythroleukemia, pure red blood cell aplasia, and hemophagocytic lymphohistiocytosis. In certain embodiments, the cancer is a lymphoma (e.g., Hodgkin lymphoma or non-Hodgkin lymphoma). In another specific embodiment, the cancer is a leukemia. In particular, the leukemia is selected from the group consisting of acute lymphoblastic leukemia, acute myeloid leukemia, chronic lymphoblastic leukemia, and chronic myeloid leukemia. In a more specific embodiment, the leukemia is acute lymphoblastic leukemia.

[0259] In one embodiment, the cancer is selected from the group consisting of colorectal cancer, colon cancer, rectal cancer, breast cancer, pancreatic cancer, liver cancer, lung cancer, primary melanoma, glioma, leukemia, and lymphoma. In one embodiment, the cancer is selected from the group consisting of colorectal cancer, colon cancer, rectal cancer, breast cancer, and leukemia. In a specific embodiment, the cancer is colorectal cancer. In a specific embodiment, the cancer is colon cancer.

[0260] In certain embodiments, the cancer is breast cancer. In some embodiments, the breast cancer is selected from the group consisting of ductal carcinoma in situ (DCIS), invasive ductal carcinoma (IDC), invasive lobular carcinoma (ILC), inflammatory breast cancer (IBC), hormone receptor-positive breast cancer (HR+) (e.g., estrogen receptor (ER)+ / progesterone receptor (PR)+, ER+ / PR-, ER- / PR+), HER2-positive breast cancer (HER2+ or ERBB2+) (e.g., ER+ / PR+ / HER2+, ER- / PR- / HER2+), triple-negative breast cancer (TNBC) (i.e., ER- / PR- / HER2-), Paget's disease of the breast, angiosarcoma, phyllodes tumor, and metastatic breast cancer. In particular, the breast cancer is HER2-positive breast cancer.

[0261] Various types of cancer can express large amounts of TGF-β, which may play a role in promoting tumor growth and suppressing the immune system's ability to target cancer cells. Some cancers known to express high levels of TGF-β include, but are not limited to, pancreatic cancer, lung cancer, breast cancer, colorectal cancer, glioma, ovarian cancer, prostate cancer, liver cancer (e.g., hepatocellular carcinoma), kidney cancer (e.g., renal cell carcinoma), and skin cancer (e.g., melanoma).

[0262] In certain embodiments, the cancer is metastatic or advanced cancer.

[0263] Accordingly, in one embodiment, the cancer is characterized by high levels of TGF-β expression. In another embodiment, the cancer is characterized by the presence of a tumor microenvironment with high abundance of NK cells. In another embodiment, the cancer is selected from the group consisting of pancreatic cancer, lung cancer, breast cancer, colorectal cancer, glioma, ovarian cancer, prostate cancer, liver cancer (e.g., hepatocellular carcinoma), kidney cancer (e.g., renal cell carcinoma), and skin cancer (e.g., melanoma). In a specific embodiment, the cancer is selected from the group consisting of pancreatic cancer, breast cancer, colorectal cancer, glioma, ovarian cancer, prostate cancer, liver cancer, and kidney cancer. In a more specific embodiment, the cancer is selected from the group consisting of breast cancer, colorectal cancer, glioma, ovarian cancer, and liver cancer. In particular, the cancer is selected from the group consisting of breast cancer, colorectal cancer, glioma, ovarian cancer, liver cancer, and leukemia (e.g., acute lymphoblastic leukemia).

[0264] In some embodiments, the treatment of cancer is characterized by the administration of a modified cytotoxic lymphocyte cell, cell population, or pharmaceutical composition of the present invention that preserves antitumor function by being resistant to the TGF-β inhibitory effect present in the tumor microenvironment.

[0265] In another embodiment, the administration of modified cytotoxic lymphocyte cells, cell populations, or pharmaceutical compositions of the present invention is

[0266] - Enhanced cytotoxicity;

[0267] - Reduction in tumor size;

[0268] - Immune activation;

[0269] - Tumor infiltration;

[0270] - Cytokine release;

[0271] - Antitumor memory response;

[0272] - Reduction in tumor vascularization;

[0273] - Tumor apoptosis;

[0274] - Inhibition of tumor growth signaling; and

[0275] - Produces at least one outcome (i.e., effect) selected from, but not limited to, a group consisting of reduced transfer potential.

[0276] In another embodiment, the administration of modified cytotoxic lymphocyte cells, cell populations, or pharmaceutical compositions of the present invention is

[0277] - Tumor regression;

[0278] - Extended survival rate;

[0279] - Enhanced immune response;

[0280] - Reduction in metastasis;

[0281] - Improved response to other treatments;

[0282] - Fewer side effects; and

[0283] - Produces at least one outcome (i.e., effect) selected from a group consisting of improved quality of life, but not limited thereto.

[0284] Although the present invention focuses on human application, the subject may also be different mammalian subjects for veterinary purposes, such as pets (e.g., dogs, cats, etc.), livestock (e.g., cattle, sheep, pigs, horses, etc.), and laboratory animals (e.g., monkeys, rats, mice, rabbits, guinea pigs, etc.). Thus, in one embodiment, the subject is a human. In another embodiment, the subject is a mammal. In certain embodiments, the mammal is a pet, livestock, or laboratory animal.

[0285] Combination use with other treatments

[0286] The modified cytotoxic lymphocyte cells, cell populations, and pharmaceutical compositions described herein may be administered in combination with one or more other therapeutic or biological agents or treatments (e.g., chemotherapy, anticancer drugs, checkpoint inhibitors, NK cell engagers, cytotoxic agents, cytokines, or radiotherapy). It is understood that combination administration may be formulated for separate, sequential, or simultaneous administration, or as a mixture in a single pharmaceutical composition. Examples 12 and 13 are SMAD4 KO It is demonstrated that the combination of NK cells and other therapeutic agents, such as anti-HER2 antibodies and CAR cells, respectively, exhibits an enhanced anti-tumor effect.

[0287] Accordingly, in some embodiments, the modified cytotoxic lymphocyte cells, cell populations, or pharmaceutical compositions of the present invention are used in combination with one or more therapeutic agents or treatments. Specific embodiments of the therapeutic agents are described below.

[0288] Another aspect relates to a combination of the modified cytotoxic lymphocyte cells, cell populations, or pharmaceutical composition of the present invention and one or more therapeutic agents or treatments for separate, sequential, or simultaneous use, or as a mixture in a single pharmaceutical composition. In one embodiment, the combination is intended for use as a medicine, particularly for use in the treatment of cancer.

[0289] In certain embodiments, other therapeutic agents or treatments are antitumor agents, e.g., chemotherapy agents, targeted therapies (e.g., monoclonal antibodies, e.g., trastuzumab or bevacizumab), immunotherapies (e.g., anti-PD1, anti-PDL1, anti-CTLA4 checkpoint inhibitors), tumor antigen-specific therapeutic antibodies, antibody-drug conjugates, cytotoxic agents, NK engagers, cytokine therapy, radiation therapy, bone marrow transplantation, gene therapy, surgery, or combinations thereof.

[0290] In certain embodiments, the antitumor agent is a targeted therapeutic agent. In certain embodiments, the targeted therapeutic agent is a monoclonal antibody. Non-limiting examples of monoclonal antibodies are trastuzumab, pertuzumab, rituximab, cetuximab, bevacizumab, nivolumab, pembrolizumab, ipilimumab, daratumumab, elotuzumab, atezolizumab, tocitumomab, conatumumab, tafacitamab, and magetuximab. In particular, the monoclonal antibody is trastuzumab, pertuzumab, or a combination thereof.

[0291] In certain embodiments, another therapeutic agent is an NK cell engager (NKCE). NKCEs, such as BiKE (bispecific killer cell engager) or TriKE (trispecific killer cell engager), are a class of antibody-based therapeutic agents. By bridging NK cells with tumor cells, NKCEs activate NK cells and induce tumor cell lysis. Non-limiting examples of NKCEs target CD16a, NKG2D, Nkp30, Nkp46, Nkp80, NKG2C / CD94, KIR2DS / KIR3DS, CD160, DNAM-1, 2B4, IL-2 / IL-15, PD-1, NKG2A, TIGIT, TIM-3, KIR2DL / KIR3DL, or CD96. In particular, the NKCE is an NKp46 NK cell engager.

[0292] Non-limiting examples of chemotherapy agents include diactive alkylating agents (e.g., cyclophosphamide, mechlorethamine, chlorambucil, or melphalan); monoactive alkylating agents (e.g., dacarbazine (DTIC), nitrosourea, or temozolomide); anthracyclines (e.g., daunorubicin, doxorubicin, epirubicin, idarubicin, mitoxantrone, or valubicin); taxanes (e.g., paclitaxel, docetaxel, nab-paclitaxel, or taxotere); epotillones (e.g., patupylon, sagopylon, or ixabepylon); deacetylase inhibitors (e.g., vorinostat or romidepsin); and topoisomerase I inhibitors (e.g., irinotecan or topotecan). Inhibitors of topoisomerase II (e.g., etoposide, tenifoside, or taflufoside); kinase inhibitors (e.g., bortezomib, erlotinib, gefitinib, imatinib, vemurafenib, or busmodegib); nucleotide analogs and / or precursor analogs (e.g., azacitidine, azathioprine, capecitabine, cytarabine, doxifluridine, fluorouracil, gemcitabine, hydroxyurea, mercaptopurine, methotrexate, or thioguanine); peptide antibiotics (e.g., bleomycin or actinomycin); platinum-based agents (e.g., carboplatin, cisplatin, or oxaliplatin); retinoids (e.g., tretinoin, alitretinoin, or bexarotene); and vinca alkaloids and derivatives (e.g., vinblastine, vincristine, vindecin, or vinorelbine).

[0293] Suitable checkpoint inhibitors may include anti-PD1 antibodies (e.g., pembrolizumab, nivolumab, avelumab, durvalumab, atezolizumab), anti-PD-L1 antibodies, anti-CTLA-4 (cytotoxic T lymphocyte-associated antigen, also known as CD152) antibodies, anti-LAG3 (lymphocyte activation gene-3) antibodies, anti-TIM-3 (T cell immunoglobulin and mucin domain-3) antibodies, or combinations thereof.

[0294] Suitable therapeutic agents may include anti-CD19 antibodies, anti-CD20 antibodies such as tocitumomab, cytokines such as interleukin, interferon-α 2a (INF-α 2a), interferon-α (INF-α), granulocyte colony-stimulating factor (G-CSF) (also known as filgrastim), T cell receptors (TCR), chimeric antigen receptors or chimeric antigen T cell receptors (CAR-T), chimeric antigen NK cell receptors (CAR-NK), or combinations thereof. In one embodiment, the therapeutic agent is a chimeric antigen NK cell receptor (CAR-NK), particularly a CAR19-NK cell.

[0295] Examples

[0296] Example 1. Materials and Method

[0297] 1.1 Human Blood Sample

[0298] Peripheral blood mononuclear cells (PBMCs) were obtained from healthy adult volunteers and patients by Ficoll-Hypaque gradient (Lymphoprep) and maintained overnight in full RPMI 1640 GlutaMAX (Gibco) supplemented with recombinant IL-2 (200 U / ml, Proleukin) [i.e., penicillin / streptomycin (100 U / ml and 100 μg / ml, Invitrogen, respectively), sodium pyruvate (1 mM, Gibco), 10% FBS (Gibco)]. NK cells were purified by negative selection using the NK-Cell Isolation Kit (Miltenyi) according to the manufacturer's instructions. Heparinized blood samples obtained from two patients with Juvenile Polyposis Syndrome (JPS) were processed as previously described. Details regarding the JPS patients are included below.

[0299] Patient #1 is SMAD4Patient #2 was diagnosed with a c.1349_1376(p.Ala460Glyfs*43) duplication in heterozygosity inducing an early stop codon in the gene. Patient #2 was diagnosed with c.403C>T(p.Arg135*)(rs377767326) in heterozygosity inducing an early stop codon, which is predicted to accelerate mRNA decay. SMAD4 Possessed a mutation.

[0300] All healthy volunteers and patients signed the informed consent form. The clinical trial was conducted in accordance with the guidelines of the Declaration of Helsinki. The clinical trial protocol was approved by the Clinical Ethics Committee of Parc de Salut Mar (No. 2018 / 787 / I) for healthy volunteers and by the Clinical Ethics Committee of Barcelona Clinic Hospital (No. 2020 / 0290) for JPS patients.

[0301] 1.2 Cell line

[0302] The following cell lines were used:

[0303] - Human colorectal cancer cell line HCT116 (CCL-247): This cell line is wt SMAD4 Encodes genes.

[0304] - Human colorectal cancer cell line HCT116-GFP + - Luciferase + , provided by Professor Julián Pardo Jimeno of the Aragon Institute of Health in Zaragoza, Spain.

[0305] - Human colorectal cancer cell line HT-29 (HTB-38): This cell line is mutated SMAD4 Encodes genes.

[0306] - B lymphoblastic cell line, 8866.

[0307] - HLA class I-negative human erythroleukemia cell line, K562 (CCL-243).

[0308] - NK92 cell line (PTA-6967): A model for NK cell-based immunotherapy currently in clinical development.

[0309] Human colorectal cancer cell lines HCT116 and HCT116-GFP + - Luciferase + Stable transformants and HT-29 were maintained in full DMEM medium (Sigma-Aldrich) supplemented with penicillin / streptomycin (100 U / mL and 100 μg / mL, respectively, Invitrogen), sodium pyruvate (1 mM, Gibco), and 10% FBS (Gibco). B lymphoblastic cell line, 8866, and HLA class I-negative human erythroleukemia cell line, K562, were cultured in full RPMI 1640 GlutaMAX. NK92 cell lines were cultured in alpha-MEM (Sigma) supplemented with 10% fetal bovine serum (Gibco), 10% horse serum (Sigma), glutamine (2 mM, Gibco), sodium pyruvate (1 mM, Gibco), 1× non-essential amino acid (Gibco), penicillin / streptomycin (100 U / mL and 100 μg / mL, respectively, Invitrogen), IL-2 (200 U / ml, Proleukin), 0.2 mM myo-inositol, 0.002 mM folic acid, and 0.1 mM beta-mercaptoethanol.

[0310] 1.3 SMAD4 of CRISPR / Cas9 gene editing

[0311] SMAD4 KO was performed on both NK92 and primary NK cells using ribonucleoprotein (RNP) complexes. To evaluate KO efficiency, intracellular staining, Western blot, and NGS combined polymerase chain reaction (PCR) were used. Details of the protocol are included below.

[0312] 1.3.1 sgRNA Design and Cas9 / sgRNA Nucleoprotein Preparation

[0313] SMAD4Protospacer sequences targeting genes were identified using the CRISPRscan algorithm and synthesized by IDT. SMAD4 Two gRNAs targeting exons 5 and 10 were used, respectively: crRNA1-exon 5: GTCGATGCACGATTACTTGG (SEQ No. 1), and crRNA2-exon 10: AACTCTGTACAAAGACCGCG (SEQ No. 2). Cas9 ribonucleoprotein (RNP) complexes were prepared according to the manufacturer's instructions. Briefly, sgRNAs were ensembled by incubating the specific crRNA and the fluorescently labeled tracrRNA-ATTO550: 5'-ATTO-AGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUU 3' (SEQ No. 11), (IDT) in a 1:1 molar ratio at 95°C for 5 minutes. Prior to each nuclear infection, Cas9-gRNA RNPs were prepared by combining Cas9 enzyme (IDT) (Uniprot accession no. Q99ZW2, SEQ No. 12) and the prepared sgRNA in a 1:3 molar ratio at room temperature for 20 minutes. For primary NK cell manipulation, SMAD4 sgRNA targeting exon 5 was used. In the case of manipulation of the NK92 cell line, SMAD4 A mixture of sgRNAs targeting exons 5 and 10 was used to produce RNPs.

[0314] 1.3.2 Generation of SMAD4-Engineered NK92 Cell Clones

[0315] NK92 cell manipulation was performed by nuclear infection and subsequent cloning. One million NK92 cells per cuvette were Neon ®Electroporation was performed according to the nuclear infection system (Invitrogen) protocol (pulse voltage: 1250 V, 10 ms, 3 pulses, including enhancer (IDT)). After 24 hours of incubation in antibiotic-free medium, ATTO550-positive cells (corresponding to sgRNA) were sorted using a FACSAria III cell sorter (BD biosciences), cloned into 2 cells / well in 96-well plates, and maintained in complete culture medium. SMAD4 reduction in selected clones was evaluated by flow cytometry and Western blot.

[0316] 1.3.3 CRISPR Gene Editing of Primary NK Cells

[0317] PBMCs from healthy donors were co-cultured at a 3:1 ratio with 8866 cell lines (40 Gy) irradiated in full RPMI 1640 GlutaMAX (Gibco). On day 7, NK cells were isolated by negative selection, and Neon ® Electroporation was performed using a transfection system kit at 1900 V, 20 ms, and one pulse. Electroporated NK cells were left at room temperature for 1 hour and cultured for 7 days in full RPMI 1640 GlutaMAX (Gibco) supplemented with IL-2 (200 U / ml) or a combination of IL-2 and TGF-β1 (5 ng / ml). Nuclear infection efficiency (ATTO550-positive cells) was checked after 24 hours using a Fortessa flow cytometer (BD Bioscience).

[0318] 1.4 NK Cell Immunophenotyping Analysis by Multiparameter Flow Cytometry

[0319] Phenotypic analysis was performed according to standard flow cytometry protocols. Cells were pretreated with agglutinated human IgG (10 μg / ml), incubated with hybridoma supernatant (i.e., KIRmix) (Table 3), washed, subsequently incubated with the corresponding secondary antibody, and then incubated with a combination of antibodies directly labeled for extracellular markers. For intracellular staining, cells were fixed, permeated (fixation / permeation kit, BD Bioscience), and stained for intracellular antigens. All incubations were performed on ice for 20 minutes. For unfixed samples, DAPI (1 μg / ml, Sigma-Aldrich) was added as a viability dye prior to data acquisition. Data were acquired on a FACS-Fortessa or FACS-LSRII flow cytometer (BD Bioscience) and analyzed using FlowJo X software (FlowJo LLC). The antibodies used for flow cytometry are listed in Table 2.

[0320]

[0321]

[0322] 1.5 Evaluate SMAD4 levels by flow cytometry

[0323] To evaluate SMAD4 levels, expanded NK cells were stained with extracellular markers, then fixed and permeated using the Invitrogen™ eBioscience™ Foxp3 / Transcription Factor Staining Buffer Set (Thermo Fisher). Cells were subsequently incubated with label-free anti-SMAD4 antibody (Cell Signaling) at room temperature for 1 hour, followed by polyclonal donkey anti-rabbit IgG Alexa Fluor ® Incubated with 488. Flow cytometry data were acquired from a FACS-Fortessa flow cytometer (BD Bioscience) and analyzed with FlowJo X software (FlowJo LLC).

[0324] 1.6 NK Cell Functionality Test

[0325] NK cell activation, cytokine production, degranulation, and cytotoxicity by the activated caspase 3 assay were used as described below.

[0326] 1.6.1 NK cell activation on anti-CD16-coated plates

[0327] Purified NK cells were cultured in flat-bottom 96-well plates pre-coated with purified anti-CD16 mAb (5 μg / ml, clone KD1). TGF-β1 (10 ng / ml, Peprotech) was added 8 hours after activation. NK cells were maintained in the culture for 5 to 6 days. In some experiments, the TGF-β-RI inhibitor SB-431542 (20 μM, Sigma-Aldrich) was added prior to activation and maintained in the culture.

[0328] 1.6.2 NK Cell Degranulation and Cytotoxicity Test

[0329] NK cells were cultured at the specified E:T ratio in the presence of target cells (i.e., K562). NK cell degranulation was analyzed by monitoring CD107a recruitment by flow cytometry after 4 hours of co-culture with anti-CD107a-FITC (clone H4A3, BD Bioscience) and monensin (5 μg / ml, Sigma-Aldrich). Where specified, TNF-α (infliximab-CF Blue) was also analyzed by intracellular staining at the end of co-culture. For cytotoxicity testing, NK92 cells or primary expanded NK cells were cultured with HCT116 cells (at the specified target: effector ratio) for 2 or 4 hours. Activated caspase 3 in HCT116 was analyzed by intracellular staining. HCT116 cells were gated by CD45 exclusion based on forward and size scatter (FSC / SSC). The baseline level of active caspase 3 was reduced under each different condition.

[0330] 1.6.3 Detection of CCL5, INF-γ, and TNF-α by Enzyme-Linked Immunoassay (ELISA)

[0331] The production of CCL5, IFN-γ, and TNF-α was measured using DY278, DY210 (R&D Systems) and #88-7316-88, Invitrogen according to the manufacturer's instructions.

[0332] 1.7 NK cell activity against 3D tumor spheres

[0333] To induce globule formation, HCT116 GFP-Luc cells were plate-cultured in ultra-low adhesion 96-well plates (Costar), centrifuged (1000g x 10 min), and cultured for 72 hours. Controls treated with or untreated with TGF-β1—and SMAD4 - Engineered NK cells were labeled with PKH26 dye (Sigma-Aldrich) according to the manufacturer's instructions. NK cells (100,000 cells) were co-cultured with spheroids. Images of the green (HCT116, GFP), red (NK; PKH26), and transmitted light channels were acquired at 6 and 24 hours using a Zeiss Cell Observer HS microscope, Z-slice 13.5 μm, and total magnification 5x. Each condition was evaluated in five duplicates. Quantification of GFP intensity density was performed using Image J. Residual luciferase activity after 24 hours was proportional to Luc+ viable cells and was measured by incubating with a luciferin substrate (10 μg / ml, Sigma) for 5 minutes. Luminescence was measured using an FB12 tube luminometer (Berthold Technologies).

[0334] 1.8 Analysis of Spherical Penetration by Blaze using Ultralight Sheet Microscope

[0335] Control group- and SMAD4 - Engineered NK cells were co-cultured with HCT116 globules for 1 hour. Globule processing was performed according to the Miltenyi manufacturer's instructions for "Immunostaining and Clearing of Stem Cell-Derived Brain Organoids for 3D Imaging Analysis." The fixed globules were subjected to anti-CD45-Vio® R667 (10 μg / mL, Miltenyi Biotec), anti-Epcam-AlexaFluor ® The specimens were stained with 488 (5 µg / mL, abcam) and propidium iodide (PI, 0.2 µg / mL, Miltenyi Biotec). The specimens were cleared using a tissue clearing kit and imaging solution (Miltenyi Biotec) and scanned using UltraMicroscope Blaze (Miltenyi Biotec). The specimens were scanned using a 12x objective lens, 150 ms exposure, and a 2 μm step size in cross-section. 3D spheroid reconstruction was performed using ImageJ software, and the distance between the spheroid surface and each NK cell was Imaris ® The analysis was performed using software.

[0336] 1.9 Western Blot

[0337] PBMC, NK cell, NK92, HCT116, or HT29 cell pellets were lysed on ice for 20 minutes in RIPA buffer supplemented with protease and phosphatase inhibitors [10 mM β-glycerol-phosphate, 2 mM Na3VO4, 5 mM NaF, and 1 mM protease inhibitor cocktail Sigma (P8340, Sigma-Aldrich)]. Protein extracts were separated on a 10% polyacliamide gel (SDS-PAGE) and transferred to a PVDF membrane (Immobilon, Millipore). The membrane was blocked for 1 hour with 5% milk or 10% bovine serum albumin in tris-buffered saline + 0.05% Tween 20 (TBST), followed by overnight incubation with the primary antibody at 4°C. The specific antibodies used were anti-Smad4 (46535, Cell Signaling, 1:1000), anti-Smad7 (MAB2029, R&D Systems, 1:1000), anti-phospho-Smad2 (Ser465 / 467, 138D4, Cell Signaling, 1:1000), anti-TGFβ-RII (sc-17791, Santa Cruz Biotechnology, 1:100), anti-TIF1 gamma (A301-060A, 1:1000, Bethyl Laboratories, Inc), and anti-β-actin (A5441, Sigma-Aldrich). The membrane was washed in TBST and incubated at RT for 1 hour with secondary antibodies labeled with mustard bean peroxidase (HRP) anti-rabbit or anti-mouse antibodies (GE Healthcare, 1:2500, except for β-actin, 1:20000). The membrane was chromatographed using an ECL substrate (SuperSignal West Pico or Femto Chemiluminescent Substrate, Thermofisher), and the signal was quantified using ImageJ software.

[0338] 1.10 Microarray Data Processing and Analysis

[0339] The effects of TGF-β treatment on CD16-activated NK cell transcripts were analyzed by microarray analysis. Details regarding microarray data and analysis were previously disclosed in the literature [Cabo M et al., 2021] and are publicly available on the GSE156200 SuperSeries. Genes differentially expressed between α-CD16+TGF-β1 and untreated or α-CD16-activated NK cells, with |log-fold change| > 0.5 and p-value < 0.05, were loaded into Metascape (gene annotation and analysis software) to analyze the biological functions, pathways, and networks regulated by TGF-β in activated NK cells.

[0340] 1.11 By RNA-Seq SMAD4 Transcriptome Characterization of Manipulated Primary NK Cells

[0341] RNA-Seq sample processing and analysis were performed by the Genome Core Facility at Pompeu Fabra University in Barcelona, ​​Spain. Gene set enrichment analysis (GSEA) was performed by the Mar Genomics Facility at IMIM in Barcelona, ​​Spain.

[0342] 1.11.1 RNA-Seq Sample Processing

[0343] Controls treated with or untreated with TGF-β1 (5 ng / ml) from 3 independent donors—and SMAD4 - Engineered NK cells were generated as previously described. Total RNA was isolated (RNeasy ®The quality of total RNA extraction was verified using the Agilent RNA Nano chip and Bioanalyzer (Agilent Technologies) and the Micro Kit (Qiagen). NGS libraries were prepared using the NebNext Ultra II Directional RNA Library Prep Kit for Illumina (New England BioLabs) utilizing PolyA capture with 500 ng of each sample. Quality and concentration were verified using the TapeStation D1000 (Agilent Technologies). Samples were pooled equimolarly, amplified by qPCR using specific primers, and sequenced in NextSeq high-throughput 2x75 cycles (Illumina).

[0344] 1.11.2 RNA-Seq Analysis

[0345] Reads were mapped to the human reference of Ensembl (version GRCh38) using STAR (version 2.5.2b), and counts were obtained using HTSeq (version 0.9.1). MultiQC (version 1.9) was used for quality control evaluation. Differential gene expression analysis (DEA) was performed using various R packages (version 4.0.0). Genes with a p-value < 0.05 and |log-fold change| > 4 were considered significantly different between conditions. TGF-β1 treated control-operation and SMAD4 Genes differentially expressed among engineered NK cells were loaded into Metascape software to analyze the biological functions, pathways, and networks regulated by SMAD4. GSEA was performed against the Molecular Signature Database (MSigDB) collection "C7" version 7.5.1 using the R package "clusterProfiler" version 4.0.0. The CRISPRroots tool was used for detargeting evaluation in CRISPR-Cas9 edited cells.

[0346] 1.12 Illumina Sequencing and Analysis of SMAD4 Allele Variants and Putative Detargets

[0347] DNA was isolated using the QIAquick gel extraction kit (Qiagen). 2-step PCR was performed on TGF-β1 treated or untreated control- and SMAD4 - It was performed on engineered NK cells.

[0348] In the first PCR, a specific amplifier for each gene was prepared using KAPA polymerase (KAPA HiFi HotStart Ready Mix, Roche) and SMAD4 Exxon 5, SMAD4 Specific primer for exon 10, CREBBP , DCTN5 , and NUFIP2 Amplification was performed using primers. The sequences of the overhangs matching the NEB universal primers and the sequences of the specific primers for the edited loci—bold—are identified in Table 4. CREBBP , DCTN5 , and NUFIP2 The gene was predicted as a possible detarget. Protocol: Initial denaturation at 95°C for 3 minutes, followed by 25 cycles of 20 seconds at 98°C, 15 seconds at 60°C, and 20 seconds at 72°C, and final extension for 1 minute at 72°C. Afterward, the size of the PCR product was verified on a 3% agarose gel.

[0349]

[0350] A second PCR to introduce the barcode was performed using generic primers encoding the barcode, NEB P / N E7335S (Table 5). Protocol: Initial denaturation at 95°C for 3 minutes, followed by 8 cycles of 20 seconds at 98°C, 15 seconds at 60°C, and 20 seconds at 72°C, and final extension at 72°C for 1 minute. The PCR product was purified using the QIAquick PCR Purification Kit (Qiagen).

[0351]

[0352] The final PCR products were analyzed by miSeq Illumina, and the readouts were mapped onto the human genome (hg38). Analysis of the results was performed using the CRISPR-Analytics platform (Sanvicente-García M et al., 2023).

[0353] 1.13 In vivo xenograft model

[0354] All animal experiments were performed according to protocols approved by the Barcelona Biomedical Research Park (PRBB) Animal Facility and the Commission on Animal Care and Use of the Autonomous Government of Catalonia (EARA-20-0045). Eight-week-old NOD / Scid / γc- / -(NSG) mice were obtained from Jackson Laboratories (005557). Human HCC1954 cells (4x10⁶) embedded in Matrigel 5 A tumor was induced by subcutaneously injecting ) into the right flank. The tumor size was calculated using the formula (width 2 × length x π) / 6. The tumor was 100 mm 3 When the size was reached, mice were randomized and treated as follows (n=5 mice / condition): i) anti-HER2 antibodies [trastuzumab and pertuzumab (1 mg / kg, respectively)]; ii) control NK cells (0.2*10 6 Cell); iii) SMAD4 KO NK cells (0.2*10 6 cells); iv) Control group NK cells (0.1*10 6 Cells) and trastuzumab / pertuzumab combination; and v) SMAD4 KO NK cells (0.1*10 6 NK cells) and trastuzumab / pertuzumab combination. All antibodies were administered intraperitoneally every 3 to 4 days. NK cells were injected intratumorally once a week with recombinant human IL-2 (rhIL-2, 200 IU / mouse) for 3 weeks, and sustained by intraperitoneal rhIL-2 (20,000 IU / mouse) every 3 to 4 days (Fig. 18(a)).

[0355] 1.14 CD19 CAR-NK Cell Generation and Cytotoxicity Assessment

[0356] CD19-CAR NK cell generation was performed at the Department of Immunotherapy, Hospital Clínic-IDIBAPS, Barcelona, ​​Spain (Reference [Herrera L et al., 2019]). ScFv of the anti-CD19 A3B1 antibody was cloned into a pCCL lentiviral vector with the same frame as the 4-1BB and CD3z signaling domains (Reference [Castella M et al., 2018]). The lentiviral supernatant was generated by transient transfection of HEK293T cells as previously described (Reference [Herrera L et al., 2019]). Control group and SMAD4 KO NK cells were restimulated by co-culture at a 1:1 ratio with the irradiated (40 Gy) K562-CD137L-IL-15tmb-IL21tmb cell line (Reference [Oberoi P et al., 2020]). On day 7, NK cells were transduced with lentivirus supernatant in the presence of 6 μg / ml polybrene and an MOI of 20. Cells were centrifuged at 37°C and 2000 rpm for 1 hour. After 24 hours, cells were cultured with 200 U / ml IL-2 for 6 days in the presence or absence of TGF-β (100 ng / ml). CAR19-control or CAR19-SMAD4-KO NK cells were co-cultured with Nalm6-Luc-GFP at a 4:1 E:T ratio for 3 hours. Nalm6 cells are a B-cell precursor leukemia cell line derived from the peripheral blood of patients with acute lymphoblastic leukemia. Residual luciferase activity is proportional to Luc+ viable cells and was measured by incubating with a luciferin substrate (10 μg / ml, Sigma) for 5 minutes. Luminescence was measured using an FB12 tube luminescence meter (Berthold Technologies).

[0357] result

[0358] The following examples describe experiments using the technology described in Example 1 and specific exemplified materials and equipment.

[0359] Example 2. NK cells from a healthy donor (NK) in the presence or absence of TGF-β SMAD4+ / + NK cells) and NK cells from patients with Juvenile Polyposis Syndrome (JPS). SMAD4 Diploid insufficient cells (NK) SMAD4+ / - Analysis of the role of SMAD4 in cells.

[0360] One major mechanism by which tumors evade NK cell infiltration and function is the secretion of transforming growth factor beta (TGF-β). Reanalysis of microarray data of CD16-activated NK cells for 5 days in the presence or absence of TGF-β1 (reference [Cabo M et al., 2021]) showed that these cytokines exerted extensive effects on their transcriptome environment, promoting the upregulation or downregulation of 1,275 and 604 genes, respectively (Fig. 1(a)). Several biological pathways associated with cytokine signaling, cell migration, cytokinesis, and cell activation were downregulated in TGF-β1-treated NK cells, whereas TGF-β1 upregulated transcripts were grouped in biological pathways associated with cell adhesion, chemotaxis, and leukocyte differentiation (Fig. 2). Among these, NK cell-related transcription factors ( EOMES, PRDM1, TBX21 ) and effector molecules ( GZMB, PRF1, IFNG, TNFA The transcript of ) was significantly downregulated (Fig. 1(b)), while tumor homing ( CXCR3, CXCR4 ) and tissue-retaining lymphocytes ( ZNF683, ITGAE Transcripts associated with ) were increased in TGF-β1-treated NK cells (Fig. 1(c)).

[0361] Activated TGF-β binds to TGF-βRII in NK cells to initiate a complex signaling cascade involving both normal and non-normal signaling pathways. Downstream of normal TGFβ-RI, SMAD4-dependent, and SMAD4-independent (e.g., involving TIF-1γ or IkKa) transcriptional programs are described. The inventors investigated the effects of TGF-β treatment on NK cells from two SMAD4 diploid-insufficient patients with juvenile polyposis syndrome (JPS). Decreased expression of SMAD4 in their PBMC samples was confirmed by Western blot analysis (Fig. 3). Both patients exhibited normal NK cell ratios and CD56bright / dim subgroup distributions. Expression of major NK cell receptors (CD16, NKG2D, NKG2A, KIR) and Granzyme B levels were comparable to those of healthy controls (Fig. 1(d)). Notably, the expansion of HCMV-induced adaptive NKG2C+ NK cells is also one SMAD4 It was observed in the hemizygous sample (Fig. 1(d)). From the control subjects SMAD4+ / + In contrast to NK cells, recovered on day 6 after CD16-activation SMAD4+ / - The number of NK cells was not reduced by treatment with TGF-β1 (Fig. 1(e)). In addition, the TGFβ-induced downregulation of NKG2D and Granzyme B was less severe, while the acquisition of CD103 was SMAD4+ / + CD16-activated compared to NK cells SMAD4+ / - It was maintained (Fig. 1(f, g)). Notably, after TGF-β1 treatment, CD16-activated NK cells from JPS patients when co-cultured with HLA-I-negative erythroleukemia cell line K562 SMAD4+ / + It showed higher degranulation and TNF-α secretion than NK cells (Fig. 1(h)).

[0362] Taken together, these results indicate that TGF-β-normal signaling negatively regulates NK cell effector function while positively regulating the expression of molecules involved in tissue retention. Data from NK cells in JPS patients suggested that SMAD4 acts as a molecular switch branching both pathways. Thus, SMAD4 acts as a molecular switch separating TGF-β inhibition of NK cell anti-tumor function from TGF-β-induced gain of the tissue retention program.

[0363] Example 3. TGF-β: For colorectal cancer cell line HCT116 in the presence of SMAD4 SMAD4 -Manipulated ( SMAD4 eng ) The cytotoxicity of NK92 cells modulates NK92 cytotoxicity in a dose- and situation-dependent manner.

[0364] The inventors evaluated whether a gene that reduces SMAD4 levels in NK92, a model of NK cell-based cell immunotherapy currently in clinical development, could enhance resistance to TGF-β-inhibition.

[0365] Initial experiments demonstrated that while TGF-β normalized signaling was conserved in the NK92 cell line (Fig. 4(a)), TGF-β exposure only partially reproduced the effects on primary NK cells. As described for primary NK cells, TGF-β1 treatment reduced granzyme B levels in NK92 cells, thereby lowering cytotoxicity against the colorectal cancer cell line HCT116 (Fig. 4(b, c)); as well as enhancing the expression of the tumor homing receptor CXCR3 (Fig. 4(b)). However, TGF-β1 did not induce CD103 in NK92 cells nor inhibit cell proliferation (Fig. 4(d)), which was consistent with the leukemic origin of this cell line.

[0366] NK92 cell clones with reduced SMAD4 expression were generated by CRISPR / Cas9 ribonucleoprotein (RNP) transfection, sorting of RNP (ATTO550)-positive cells, and sequential cloning by restriction dilution. SMAD4Two different gRNAs targeting exons 5 and 10 were used simultaneously. Clones NK92-F3 and NK93-G3 were selected for further clinical studies based on their reduced SMAD4 levels, as determined by intracellular staining (Fig. 5(a, b)) and Western blot (Fig. 5(c, d)). wt and mutant SMAD4 Colorectal cancer cell lines HCT116 and HT29 encoding the gene (reference [Woodford-Richens, KL et al., 2001]) were used as positive and negative controls, respectively, for SMAD4 expression. The NK92 cell line has a tetraploid karyotype with multiple chromosomal rearrangements, one of which [der(10)t(10;18)] is SMAD4 It affects chromosome 18 (18 q21.2) where it is located, causing 4 potential SMAD4 Generates a locus.

[0367] To analyze the changes introduced by CRISPR / Cas9, the inventors' gRNA targeted SMAD4 Two amplifiers covering the exon 5 and exon 10 regions were PCR-amplified and sequenced. In NK92-F3 cells, 20% of SMAD4 The exon 5 sequence showed a deletion of 39 nucleotides, while no mutations were detected in exon 10 (Fig. 5(e to f)). In NK92-G3 cells, 20% of SMAD4 The exon 5 sequence showed a deletion of one thymidine (position 117), and 20% of the sequence showed a deletion of 19 nucleotides (position 111). In this clone SMAD4 Sequencing of exon 10 revealed two additional deletions of 30 and 23 nucleotides, respectively, in 21% of the sequences (Fig. 5(e to f)). All identified indels generated freeframe mutations. Therefore, based on the NK92 karyotype, the NK92-F3 clone has four in exon 5 SMAD4Presenting a mutation in one of the copies, the NK92-G3 clone has 4 in each analyzed exon SMAD4 Mutations were presented in two of the loci.

[0368] The low levels of SMAD4 protein detected in the NK92-G3 clone by Western blot (Fig. 5(c)) are complementary SMAD4 By supporting the location of exon 5 and 10 mutations within the locus, 4 SMAD4 Two or three mutated loci were produced, and very low SMAD4 protein levels were generated.

[0369] In the case of the NK92, SMAD4 -operation( SMAD4 eng Both NK92 clones showed comparable proliferation in the presence of TGF-β1 (Fig. 5(g)). At baseline, the level of granzyme B was SMAD4 eng In NK92 cell clones (Fig. 5(h)), it decreased proportionally to the decrease in SMAD4 (Fig. 5(b, d)), which was consistent with the described role of SMAD4 as a positive regulator of granzyme B transcription in mouse NK cells (Wang Y et al., 2018). However, 5 days of TGF-β1 treatment SMAD4 eng Granzyme B was not further reduced in NK92 cells, which was in contrast to the reduction induced in NK92 progenitor cells (Fig. 5(h)).

[0370] To analyze the effect of SMAD4 dose on NK cell cytotoxicity, NK92 cells were treated with TGF-β1 for 5 days and subsequently co-cultured with the colorectal cancer cell line HCT116 for 4 hours. Unexpectedly, SMAD4 eng Both NK92 clones exhibited enhanced cytotoxicity against HCT116 cells upon TGF-β1 treatment, which surpassed their baseline cytotoxicity and the cytotoxic capacity of NK92 parent cells with and without TGF-β treatment (Fig. 5(i, j)).

[0371] In summary, the effect of SMAD4 on NK92 cell cytotoxicity was situation-dependent. Under homeostatic conditions, reduced SMAD4 expression correlated with granzyme B levels and the cytotoxic dose to tumor cells. However, the decrease in SMAD4 in NK92 cells associated with enhanced cytotoxicity upon TGF-β treatment indicates the acquisition of an alternative cytotoxic mechanism.

[0372] Example 4. In human NK cells expanded in vitro by CRISPR / Cas9 nucleobases SMAD4 Knockout SMAD4 KO Evaluation of the efficacy and safety of ).

[0373] The objective of this clinical trial was to generate primary human NK cells with reduced SMAD4 levels.

[0374] primary SMAD4 KO The experimental strategy for NK cell generation is illustrated in Fig. 6(a), comprising i) initial NK cell expansion using irradiated 8866 lymphoblast cell lines, ii) Cas9 / trRNA-ATTO550 (control) or Cas9 / trRNA-ATTO550 / SMAD4 Isolation and nuclear infection of NK cells using exon 5 gRNA, iii) in the second expansion phase (from day 7 to day 14) SMAD4 KO This involves the use of TGF-β1 as a selective pressure to enrich NK cells while reducing non-manipulated proliferation. The average Cas9 / gRNA RNP nuclear infection efficiency was 86% at 24 hours post-nuclear infection by flow cytometry (Fig. 7(a, b)), which induced a uniform reduction of 40% to 70% in expanded NK cells as determined by flow cytometry and Western blot, respectively (Fig. 6(b to d)). While SMAD4 levels detected in control NK cells were not significantly affected by the addition of TGF-β during the second expansion phase, SMAD4 KO There was a tendency for it to decrease in NK cells (Figs. 6(b to d), Fig. 7(c)). Western blot analysis of key molecules involved in TGF-β normal signaling was SMAD4 KO It was shown that control-manipulated NK cells exhibited comparable levels of TGF-βRII, TIF1Ɣ, and SMAD7. In fact, despite reduced SMAD4 expression, TGF-β-induced phosphorylation of SMAD2 / 3 was maintained in the engineered NK cells (Fig. 6(c) to d)), which indicated the functionality of proximal TGF-β signaling.

[0375] SMAD4 To evaluate exon 5 CRSIPR efficiency, amplifiers containing gRNA-targeted regions were sequenced in engineered NK cells from three subjects (D132, D193, D204).

[0376] The allelic frequencies of the edited sequences were 71%, 57%, and 74% in the absence of TGF-β treatment, and increased to 79%, 72%, and 79%, respectively, when TGF-β was included with the expansion of nuclear-infected NK cells (Fig. 16(a)). Most edited sequences exhibited insertions and deletions that generate out-frame (OUT) transcripts, which do not induce functional proteins. In-frame (IN) mutations were not included in the calculation of the allelic frequencies of the edited sequences. Considering bulk NK cells as a population, the estimation of genotype frequencies showed that 67%, 43%, and 72% of NK cells at the time of manipulation SMAD4 - / - and; 30%, 46%, and 26% of NK cells SMAD4 It was + / -, and only 3%, 10%, and 2% of NK cells SMAD4 It indicated that it remained at + / +. Notably, the addition of TGF-β along with NK cell expansion SMAD4 While reducing + / + NK cells to a level where they barely survive, SMAD4 - / - increased the proportion of NK cells (Fig. 16(b)). In all three individuals analyzed, there were three common and dominant mutations causing unframe sequences: a deletion of a single thymidine at position 117, an insertion of a single thymidine at position 118, and a larger deletion of 19 nucleotides at position 104 (Fig. 16(c)). The small indel was likely caused by the NHEJ DNA repair process, whereas the larger deletion was due to the MMEJ repair mechanism (Fig. 16(d)).

[0377] Using RNA-Seq data and the CRISPR-roots tool, the inventors investigated possible off-target editing events mediated by the CRISPR-Cas9 RNP complex in engineered NK cells. Although no off-target events were found considering differentially expressed genes, three putative off-target events were identified considering genomic variants in genes containing the normalized PAM sequence 5′-NGG-3′. The inventors from three individuals SMAD4 KO NK cells containing a regular PAM sequence CREBBP, DCTN5 and NUFIP2 Three genomic regions of the gene were amplified and sequenced. No mutations were detected in any presumptive detargeting (data not presented).

[0378] These data demonstrate the target-selective efficiency and safety of the engineering approach, as well as the specificity of the data obtained regarding the reduction of SMAD4 levels in NK cells.

[0379] Example 5. SMAD4 KO Transcriptome Profile of Human NK Cells: In Expanded Human NK Cells in In Vitro SMAD4 Knockout of does not affect its maturation status or functional profile, but partially prevents TGF-β inhibition.

[0380] SMAD4 KO To obtain a broad perspective on TGF-β-dependent and TGF-β-independent changes in NK cells, the inventors performed bulk RNAseq analysis using engineered NK cells from three independent donors. In the absence of TGF-β, the control and SMAD4 KO The overall transcriptome profile of NK cells was remarkably similar, with only 53 DEGs present (Fig. 8(a)). SMAD4 KO NK cells are at a lower level SMAD4 , CD160 and CD226 (DNAM-1) transcript and higher levels IL9R and ZNF683(Hobit) was presented (Fig. 8(b)). SMAD4 KO Thirty-nine genes downregulated in NK cells were clustered into two biological networks associated with the transcriptional activity of the SMAD2 / 3 / 4 heterodimer and the initiation of eukaryotic translation (Fig. 9(a)). Exposure to TGF-β affected the expression of 3,787 genes in control NK cells, whereas the effect of this cytokine was SMAD4 KO In NK cells, up to 1091 transcripts, including both upregulated and downregulated transcripts, were significantly reduced (Fig. 8(a)). However, upon TGF-β treatment, the control and SMAD4 KO A rigorous comparison of NK cell transcripts demonstrated 634 DEGs between the two conditions. TGF-β-induced downregulation of various granzymes, activating receptors, signaling adapters, integrins, chemokines, and interleukin receptor transcripts in control NK cells SMAD4 KO It was significantly attenuated in NK cells (Figs. 8(b)). TGF-β-treated compared to TGF-β-treated control NK cells. SMAD4 KO Pre-ranked gene set enrichment analysis (GSEA) on the C5 data collection of the GO biological process ontology using DEGs investigated NK cell cytotoxicity, myeloid leukocyte activation, leukocyte migration, cytokine-mediated signaling, leukocyte proliferation, and inflammatory responses. SMAD4 KO It was identified as an upregulated biological pathway in NK cells (Fig. 9(b)). Despite TGF-β treatment, SMAD4 KO The transcriptome profile of NK cells was more similar to that of activated NK cells, while TGF-β-treated control NK cells were similar to ILC1 (Fig. 8(f)). SMAD4 In addition, treated with TGF-β SMAD4 KO Some examples of genes with higher expression in the control group compared to NK cells are VEGFA and CD9 was (Fig. 8(b)).

[0381] Initial phenotypic clinical trials by flow cytometry were conducted in the absence of TGF-β, in the control group- and SMAD4 KO It was confirmed that NK cells exhibited comparable levels of granzyme B, perforin, and various activating receptors (CD16, NKG2D, NKp30) involved in tumor cell recognition (Fig. 8(g, h)). Notably, SMAD4 reduction partially blocked the TGF-β-induced downregulation of NKG2D, CD16, NKp30, granzyme B, and perforin in control NK cells (Fig. 8(g, h)). On the other hand, SMAD4 - The manipulation did not significantly affect the expression and distribution of HLA-I specific inhibitory receptors (KIR, NKG2A) and maturation markers (NKG2C, CD57, and KLRG1) in primary expanded NK cells (Fig. 8(i)).

[0382] To summarize, the mouse SMAD4 In contrast to the results reported in - / - NK cells, in expanded human NK cells SMAD4 The knockout of did not affect its baseline Granzyme B levels, its maturity status, or its transcriptome profile, and this SMAD4 It was consistent with the characteristics of NK cells from patients with + / - JPS. Interestingly, a decrease in SMAD4 levels partially prevented the downregulation of TGF-β-induced activating receptors and cytotoxic effectors in NK cells.

[0383] Example 6. In the presence of TGF-β SMAD4 KO Evaluation of antitumor function and serial apoptosis in NK cells.

[0384] The purpose of this clinical trial is to [indicate] in the in vitro cytotoxicity assay against the colorectal cancer cell line HCT116 SMAD4 KO The goal was to evaluate the anti-tumor activity of expanded NK cells.

[0385] In the absence of TGF-β, the control group- and SMAD4 KO NK cells demonstrated cytotoxicity comparable to that of HCT116 cells. However, control NK cells exhibited reduced cytotoxicity upon TGF-β1 treatment, while, SMAD4 KO NK cells maintained their ability to kill (Fig. 10(a)).

[0386] Subsequently, serial NK cell apoptosis was evaluated by co-culturing PKH26-labeled NK cells with HCT116-GFP+Luc+ globules. Control NK cells treated with TGF-β1 accumulated around the globules and exhibited reduced globule growth control. In contrast, TGF-β1-treated SMAD4 KO NK cells exhibited enhanced globular apoptosis, reaching levels similar to those of TGF-β-untreated cells, as demonstrated by GFP and luciferase analysis (Fig. 10 (d to f, k)).

[0387] Another adverse effect of TGF-β on NK cell function is the inhibition of proliferation upon activation. Analysis of RNAseq data is IL15RA , IL2RG and IL2RA The expression of compared to control NK cells exposed to TGF-β SMAD4 KO It showed that it was higher at (Fig. 10(h)). In fact, SMAD4 KO NK cells showed enhanced proliferation in response to the concomitant administration of IL-2 and TGF-β upon NKp46-redirected activation (Fig. 10(i)). Similarly, using the K562-CD137L-IL15tm-IL-21tm feeder SMAD4 KO The expansion of NK cells was maintained in the presence of TGF-β, while it was significantly reduced in control NK cells (Fig. 10(j)).

[0388] Therefore, in human extended NK cells SMAD4 Knockout of prevented TGF-β inhibition of cytotoxic granule-dependent apoptosis and showed an enhanced series of apoptosis in a 3D tumor model.

[0389] Example 7. SMAD4 KO Cytokine analysis of NK cells.

[0390] Notably, the secretion of CCL5, IFN-γ, and TNF-α was despite TGF-β1 exposure SMAD4 KO It was preserved in NK cells (Fig. 10(b, c) and Fig. 11), while it was significantly reduced in control NK cells.

[0391] Therefore, in human extended NK cells SMAD4 The knockout of preserved TGF-β inhibition of cytokine production and preserved the ability to secrete CCL5, IFN-γ, and TNF-α. In addition, based on RNAseq analysis, SMAD4 KO NK cells will also acquire the ability to simultaneously produce CSF1, XCL1, and FLT3L cytokines involved in dendritic cell recruitment and activation.

[0392] Example 8. SMAD4 KO TRAIL and FasL activity of NK cells.

[0393] Granzyme B and perforin levels were treated with TGF-β SMAD4 KO Because it was not fully conserved in NK cells (Fig. 8 (g to h)), the estimated contribution of the death receptor pathway to HCT116 apoptosis was evaluated by adding specific blocking antibodies along with cytotoxicity assays.

[0394] In the absence of TGF-β, FasL blockade was the control and SMAD4 KO It had a negligible effect on the cytotoxicity of NK cells, while TRAIL blockade somewhat reduced the cytotoxicity of both effector cells. However, both ligands for the death receptor pathway exposed to TGF-β1 SMAD4 KO It contributed significantly to the cytotoxicity of NK cells, accounting for nearly 50% of their apoptotic capacity, which was in contrast to TGF-β-exposed control NK cells that showed minimal cytotoxicity (Fig. 10(g)).

[0395] thus, SMAD4 KO NK cells acquired TGF-β-induced TRAIL and FasL expression, enabling the possibility of apoptosis via these death receptor pathways, which represent an alternative mechanism to granzyme.

[0396] Example 9. Exposed to TGF-β SMAD4 KO NK cells exhibit enhanced globular infiltration and tumor-homing potential.

[0397] The regulation of cell adhesion and chemotaxis was two biological pathways preferentially upregulated by TGF-β in NK cells (Fig. 2).

[0398] actually, SMAD4 KO NK cells have numerous adhesion molecules [ ITGA2 (CD49b), ITGB2 (CD18), ITGAL (CD11a), ITGAM (CD11b), ICAM1 (CD54), ICAM2 (CD102), PECAM1It was partially resistant to the inhibitory effect of TGF-β on the expression of [(CD31)] (Fig. 12(a)), while preserving sensitivity to the TGF-β-dependent upregulation of transcripts for tumor retention-associated integrins [ITGB1(CD29), ITGA1(CD49a), ITGAE(CD103)] (Fig. 12(a)). Consistent with the mRNA data, SMAD4 KO NK cells were partially resistant to the downregulation of CD11a, CD18, and CD49d expression induced by TGF-β1, while acquiring or maintaining the expression of CD103 and CD29 (Fig. 12(b to c)).

[0399] To analyze whether enhanced expression of adhesion molecules could affect tumor infiltration ability, PKH26-labeled NK cells were co-cultured with HCT116 globules for 1 hour, and cell localization was subsequently analyzed by light sheet microscopy (Figs. 12(d) and 13). Within the globules, the control- and SMAD4 KO The number of NK cells was counted similarly (n=51 and 63, respectively), but SMAD4 KO NK cells were located deeper from the surface of the globule (Fig. 12(d to f)). Surprisingly, TGF-β treatment SMAD4 KO It significantly enhanced NK cell binding (n=109) and infiltration into tumor cell globules, while severely damaging control NK cells (n=21) (Fig. 12(d to f)). In addition to adhesion molecules, chemokine receptor expression was also regulated by TGF-β. As presented at both transcriptome and protein levels, TGF-β was found to be regulated by the control- and SMAD4 KOIt reduced CCR5 expression in both NK cells, while inducing CXCR4 expression (Fig. 12(g, h)). TGF-β1 treatment reduced CXCR3 transcripts in control NK cells, but these changes were not detected at the protein level (Fig. 12(g, h)). The transition assay was extended in the presence of TGF-β SMAD4 KO It was performed using NK cells and controls. The transition to CCL5, CXCL9, and the CCL5+CXCL9 combination was moderate in both control NK cells and engineered NK cells. However, TGF-β1 treated SMAD4 KO NK cells showed enhanced migration to SDF-1 and all combinations of SDF-1 with CCL5 and CXCL9 chemokines compared to TGF-β1-treated control NK cells (Fig. 12(i)).

[0400] Therefore, exposed to TGF-β SMAD4 KO NK cells exhibited enhanced globular infiltration and tumor-homing potential.

[0401] Example 10. SMAD4 KO Comparison of cytotoxicity between NK cells and NK cells treated with TGF-β inhibitors: SMAD4 KO NK cells exhibit excellent cytotoxicity.

[0402] Due to the inhibitory role of TGF-β in the tumor microenvironment, various strategies to target TGF-β (e.g., neutralizing antibodies, blocking antibodies against TGF-β receptor chain 2 (TGFBR2), TGF-β inhibitors, as well as genetically engineered NK / T cells using dominant-negative TGF-β receptor II) have been extensively studied in preclinical and early clinical trials.

[0403] SMAD4 KOTo compare the effects of NK cells and TGF-β inhibitors, control NK cells were treated with SB-431542, a specific inhibitor of TGF-β-RI kinase activity, for the last 6 days of extension in the presence of TGF-β. Adding SB-431542 to the culture completely blocked the detection of pSMAD2 by Western blot and did not affect SMAD4 expression in TGF-β-treated control NK cells, whereas, as expected, phosphorylation of SMAD2 and significantly reduced SMAD4 expression were observed in TGF-β-treated cells. SMAD4 KO It was detected in NK cells (Fig. 14(a, b)). SB-431542 activity was also demonstrated by the lack of granzyme B and NKG2D downregulation, as well as the lack of CD103 acquisition in TGF-β-treated control cells (Fig. 15(a)). Notably, TGF-β-treated SMAD4 KO NK cells showed superior cytotoxicity against HCT116-Luc+GFP+ globules compared to control NK cells treated with the combination of SB-431542 and TGF-β (Fig. 14(c) to d)).

[0404] Example 11. In the presence of Activin A SMAD4 KO Analysis of NK cells: Resistance to activin A inhibition.

[0405] SMAD4 is a signaling hub that also participates in transcriptional changes induced by other members of the TGF-β family. Among these, activin A is also produced in the tumor microenvironment and contributes to the attenuation of NK cell effector function. Although activin A shares the regular SMAD2 / 3 pathway with TGFβ, signaling is initiated by specific Type II receptors (ActRIIA, ActRIIB), which randomly bind to different Type I receptors (primarily ActRIB, but also include ActRIA and ActRIC). Consequently, activin A may contribute to NK cell inhibition even under the blockade of TGF-β or TGFβ-RII.

[0406] Analysis of RNAseq data showed the expression of activin type AI and type II receptors in NK cells. Control and SMAD4 KO Both NK cells under basal conditions ACVR2A and ACVR1 It expressed, meanwhile, upon exposure to TGF-β ACVR2B and ACVR1B It was converted to (Fig. 14(e)). The reduction in GzmB and perforin levels induced by Activin A treatment was compared to the control and SMAD4 KO It was less pronounced in both NK cells than that induced by TGF-β (Fig. 14(f) and Fig. 15(b)). Regardless of the effect of Activin A on granule-associated cytotoxic effectors, Activin A-treated SMAD4 KO NK cells showed comparable cytotoxicity to untreated NK cells and HCT116 globules, in contrast to the slight decrease in cytotoxicity detected in control NK cells treated with Activin A (Fig. 14(g)).

[0407] Example 12. In a humanized in vivo mouse model of HER2-positive breast cancer SMAD4 KO Evaluation of NK cell antitumor function.

[0408] The purpose of this clinical trial is to investigate in a humanized in vivo mouse model of HER2-positive breast cancer SMAD4 KO The goal was to evaluate the anti-tumor function of NK cells.

[0409] HCC1954 xenografts were subcutaneously transplanted into NOD / Scid / γc- / -(NSG) mice. The tumor was 100 mm 3 When [the target] was reached, mice were treated as follows: a control group or to evaluate tumor growth control affecting direct NK cell recognition. SMAD4 KO NK cells (0.2 x 10 6To evaluate tumor growth control affecting cells), or antibody-dependent NK cell-mediated cytotoxicity, a control group or SMAD4 KO NK cells (0.1 x 10 6 Combination of NK cells) and anti-HER2 antibodies (trastuzumab and pertuzumab). As a control group, a mouse group was treated with anti-HER2 antibodies. NK cells were injected intratumorally once a week along with IL-2 to promote in vivo NK cell survival, and anti-HER2 antibodies were administered intraperitoneally every 3 to 4 days (Fig. 18(a)). Control NK cells (0.2 x 10⁶ 6 Mice treated with ) and mice treated with the anti-HER2 antibody showed comparable tumor growth rates (Fig. 18(b)). Tumor growth was significantly reduced in mice treated with control NK cells and the therapeutic anti-HER2 antibody, demonstrating the synergistic potential of combination therapy despite receiving half the dose of NK cells (Fig. 18(b)). Notably, SMAD4 KO Mice treated with NK cells demonstrated superior tumor growth control as monotherapy as well as in combination with an anti-HER2 therapeutic antibody, which outperformed the antitumor efficacy of control NK cells combined with an anti-HER2 antibody in both cases (Fig. 18(b)).

[0410] Therefore, removing SMAD4 from NK cells proliferated in humans prevents NK cell cytotoxicity and cytokine production inhibition by TGF-β, resulting in excellent antitumor function in vitro and in vivo.

[0411] Example 13. CD19-CAR SMAD4 KO NK cells exhibit sensitivity to the inhibitory effect of TGF-β and enhance the cytotoxic activity of CAR-NK cells in leukemia cell lines in the presence of TGF-β.

[0412] Subsequent experiments evaluated the effects of SMAD4 knockout on CD19-CAR transduced NK cells. As illustrated in Figure 19, CD19-CAR NK cells exhibited sensitivity to the inhibitory effects of TGF-β despite activation through the CD137 and CD28 signaling domains of the CAR construct. Notably, SMAD4 knockout preserved the cytotoxic function of CD19-CAR NK cells against the B-cell leukemia cell line Nalm6 even in the presence of TGF-β. These results provide evidence demonstrating the feasibility of SMAD4 knockout as a strategy to enhance the cytotoxic activity of CAR-NK cells in the presence of TGF-β, a universal immunosuppressive factor in the tumor microenvironment. This supports the potential of this strategy to improve the therapeutic efficacy of CAR-NK cells in treating various malignancies.

[0413] References

[0414] WO20074868A1

[0415] WO2019243817A1

[0416] Wang Y, Chu J, Yi P, Dong W, Saultz J, Wang Y, Wang H, Scoville S, Zhang J, Wu LC, Deng Y, He J Clin Invest. 2018 Nov 1;128(11):5123-5136.

[0417] Cabo M, Santana-Hernandez S, Costa-Garcia M, Rea A. "CD137 Costimulation Counteracts TGFβ Inhibition of NK-cell Antitumor Function". Cancer Immunol Res. 2021 Dec;9(12):1476-1490.

[0418] Sanvicente-García M, García-Valiente A, Jouide S, Jaraba-Wallace J, Bautista E, Escobosa M, Sánchez-Mejías A, Güell M. "CRISPR-Analytics (CRISPR-A): A platform for precise analytics and simulations for gene editing". PLoS Comput Biol. 2023 19(5): e1011137.

[0419] Herrera L, Santos S, Vesga MA, Anguita J, Martin-Ruiz I, Carrascosa T, Juan M, Eguizabal C. "Adult peripheral blood and umbilical cord blood NK cells are good sources for effective CAR therapy against CD19 positive leukemic cells". Sci Rep. 2019 Dec 10;9(1):18729.

[0420] Castella M, Boronat A, Martín-Ibañez R, Rodríguez V, Suñé G, Caballero M, Marzal B, Pérez-Amill L, Martín-Antonio B, Castaño J, Bueno C, Balagué O, González-Navarro EA, Serra-Pages C, Engel P, Riba Riba, Benite D, Ortiz-Maldonado V, Cid J, Tabera J, Canals JM, Lozano M, Baumann T, Vilarrodona A, Trias E, Campo E, Menendez P, Urbano-Ispizua á, Yagüe J, Pérez-Galán P, Rives S, Delgado J, Juan M. Paradigm for an Affordable CAR T Cell Production at Academic Institutions”. Mol Ther Methods Clin Dev. 2018 Dec 6;12:134-144.

[0421] Oberoi P, Kamenjarin K, Ossa JFV, Uherek B, Bönig H, Welsh WS. "Directed Differentiation of Mobilized Hematopoietic Stem and Progenitor Cells into Functional NK cells with Enhanced Antitumor Activity". Cells. 2020 Mar 27;9(4):811.

[0422] Woodford-Richens KL, Rowan AJ, Gorman P, Halford S, Bicknell DC, Wasan HS, Roylance RR, Bodmer WF, Tomlinson IP. "SMAD4 mutations in colorectal cancer probably occur before chromosomal instability, but after divergence of the microsatellite instability pathway". Proc Natl Acad Sci U S A. 2001 Aug 14;98(17):9719-23.

Claims

Claim 1 SMAD4 Isolated modified human cytotoxic lymphocytes for adoptive immunotherapy containing inactivated mutations in a gene, isolated modified human cytotoxic lymphocytes having inhibited SMAD4 expression and being resistant to the immunosuppressive effects of TGF-β, thereby exhibiting cytotoxicity. Claim 2 In paragraph 1, SMAD4 Isolated modified human cytotoxic lymphocyte cells containing homozygous inactivation mutations in the gene. Claim 3 In paragraph 1, SMAD4 Isolated modified human cytotoxic lymphocyte cells containing heterozygous inactivation mutations in the gene. Claim 4 In any one of paragraphs 1 to 3, isolated modified human cytotoxic lymphocyte cells that are natural killer cells or T-cells. Claim 5 An isolated modified human cytotoxic lymphocyte cell comprising an additional mutation or modification that is a chimeric antigen receptor (CAR) in any one of claims 1 to 4. Claim 6 In paragraph 5, CAR is an isolated modified human cytotoxic lymphocyte cell that is a CD19-CAR. Claim 7 A cell population comprising modified human cytotoxic lymphocyte cells as defined in any one of claims 1 to 6, comprising: a) about 10% to 90% SMAD4 - / - and / or SMAD4 + / - genotype frequency of cytotoxic lymphocytes; and b) a cell population characterized by a detargeting rate of less than 1%. Claim 8 A pharmaceutical composition comprising isolated modified cytotoxic lymphocyte cells as defined in any one of claims 1 to 6 or a cell population as defined in claim 7, and a pharmaceutically acceptable excipient comprising a cryoprotective agent. Claim 9 Isolated modified cytotoxic lymphocyte cells as defined in any one of claims 1 to 6 for use as a medicine, a cell population as defined in claim 7, or a pharmaceutical composition as defined in claim 8. Claim 10 Isolated modified cytotoxic lymphocyte cells as defined in any one of claims 1 to 6 for use in cancer treatment, a cell population as defined in claim 7, or a pharmaceutical composition as defined in claim 8. Claim 11 In paragraph 10, cancer is isolated modified cytotoxic lymphocyte cells for use, a cell population for use, or a pharmaceutical composition for use, selected from the group consisting of breast cancer, colorectal cancer, glioma, ovarian cancer, liver cancer, and leukemia. Claim 12 An isolated modified cytotoxic lymphocyte cell, cell population, or pharmaceutical composition used in combination with one or more therapeutic agents or treatments in any one of claims 1 to 6, in claim 7, or in claim 8. Claim 13 In paragraph 12, the therapeutic agent is an isolated modified cytotoxic lymphocyte cell, cell population, or pharmaceutical composition that is an antitumor monoclonal antibody. Claim 14 In paragraph 13, the monoclonal antibody is an isolated modified cytotoxic lymphocyte cell, cell population, or pharmaceutical composition that is trastuzumab, pertuzumab, or a combination thereof. Claim 15 As a method for producing modified human cytotoxic lymphocytes for adoptive immunotherapy, human cytotoxic lymphocytes SMAD4 A method comprising the step of genetically inactivating a gene to generate modified cells that have inhibited SMAD4 expression and are resistant to the immunosuppressive effects of TGF-β, thereby exhibiting cytotoxicity. Claim 16 In paragraph 15, the genetic inactivation is performed by DNA cleavage by introducing at least the following into the cell: i) a targeted nuclease, a CRISPR-associated protein selected from the group consisting of Cas9, spCas9, and Cas12a; and ii) the cell's SMAD4 A single-guide ribonucleic acid comprising a sequence selected from SEQ ID NOs 1 to 11, which targets a gene, or a sequence having at least 80% sequence identity with any one of SEQ ID NOs 1 to 11. Claim 17 In paragraph 16, targeted nucleases and cells SMAD4 A method in which a single-guide ribonucleic acid targeting a gene is introduced into a cell as a ribonucleoprotein complex. Claim 18 In any one of paragraphs 15 through 17, a) SMAD4 a) a step of expanding or proliferating cells from a sample of a subject requiring treatment or a healthy donor before genetically inactivating the gene; b) SMAD4 Step of isolating or purifying human cytotoxic lymphocyte cells from the sample or cells obtained in (a) before genetically inactivating the gene; c) SMAD4 A step of expanding or proliferating cells obtained after genetically inactivating genes; and / or d) SMAD4 A method further comprising the step of isolating or purifying cells obtained after genetically inactivating genes or obtained in (c). Claim 19 A single-guide ribonucleic acid comprising a sequence selected from SEQ ID NOs 1 to 11, or a sequence having at least 80% sequence identity with any one of SEQ ID NOs 1 to 11.

Images