A new method for manipulating the capsid of recombinant adeno-associated virus (AAV)

Abstract

The present disclosure provides a modified AAV capsid protein in which specificity and affinity for a target cell / tissue are regulated, an AAV capsid comprising such modified capsid protein, and an AAV vector comprising such AAV capsid. A method of using such AAV capsid is also provided.

Description

Technology Field

[0001] The present disclosure relates to the field of gene therapy, in particular to a new method for manipulating the capsid of a recombinant adeno-associated virus (AAV), a modified AAV capsid protein, and the use thereof. Background Technology

[0002] Recombinant adeno-associated viruses (AAVs) have been successfully utilized as leading vectors for the in vivo delivery of gene therapies for various clinical indications (Wang et al., 2019). While the clinical success of rAAV gene therapy is encouraging, limitations and challenges regarding this gene delivery method still exist (Ertl HCJ, 2022). In particular, existing recombinant AAV vectors currently in clinical development often exhibit low tissue specificity or insufficient transduction into target tissues. In gene therapy clinical trials, these issues lead to tissue toxicity caused by excessive accumulation in non-target organs such as the liver and kidneys (Hinderer et al., 2018; Chand et al., 2021) or reduced efficacy due to low accumulation in target organs.

[0003] Efficiently overcoming these problems has become a key challenge in the field of AAV gene therapy. Therefore, there is still a need for methods to modify AAV variants to efficiently control specificity and affinity for target cells / tissues.

[0004] The present disclosure provides a modified adeno-associated virus (AAV) capsid protein comprising at least one peptide insertion at one or more sites selected from the group consisting of positions 264, 452, 498, 550, and 586 according to the numbering of the wild-type AAV9 VP1 protein (SEQ No. 1) or any functionally equivalent site thereof.

[0005] In one aspect, the present disclosure provides a polynucleotide encoding a modified AAV capsid protein disclosed herein. In one aspect, the present disclosure provides an expression vector comprising the polynucleotide disclosed herein. In one aspect, the present disclosure provides a cell comprising the polynucleotide or expression vector disclosed herein.

[0006] In one aspect, the present disclosure provides an AAV capsid comprising the modified AAV capsid protein disclosed herein. In one aspect, the present disclosure provides an AAV virus vector comprising the AAV capsid disclosed herein.

[0007] In one aspect, the present disclosure provides a pharmaceutical composition comprising an AAV virus vector and a pharmaceutically acceptable carrier as disclosed herein.

[0008] In one aspect, the present disclosure provides a method for delivering a cargo nucleic acid to a cell, comprising the step of bringing the virus vector disclosed herein into contact with the cell.

[0009] In one aspect, the present disclosure provides a method for delivering a cargo nucleic acid to a subject, comprising the step of administering an effective amount of the virus vector or pharmaceutical composition disclosed herein to the subject.

[0010] In one aspect, the present disclosure provides a method for treating a subject in need of such treatment, comprising the step of administering a therapeutically effective amount of the AAV virus vector or pharmaceutical composition disclosed herein to the subject.

[0011] In a further aspect, the present disclosure provides a method for producing an AAV vector that does not substantially affect viral production, the method comprising: a) generating a library of modified AAV vectors by inserting short peptides at various positions of a VP1 protein; b) determining viral production; and c) identifying a modified AAV vector in which viral production is substantially maintained. As used herein, “substantially maintained viral production” means that the modified AAV vector has a viral production efficiency of 50% or more of the viral production efficiency of a corresponding AAV vector containing an unmodified or corresponding wild-type AAV capsid protein under equivalent analytical conditions.

[0012] The foregoing summary is merely illustrative and is not intended to be limiting in any way. In addition to the illustrative aspects, embodiments, and features described above, additional aspects, embodiments, and features will become apparent by referring to the drawings and the following detailed description. Brief explanation of the drawing

[0013] Figure 1 shows the viral yield of mutant AAVs. Viruses were produced in 15 cm plates using equal amounts of plasmid DNA. Viral titers were measured in vector genomes per culture dish (Vg). Relative viral yields were calculated using wild-type AAV9 as the reference (100%). Figures 2a and 2b show the binding activity of mutant AAVs to anti-Strep-tag antibodies or anti-c-Myc antibodies. P8 represents the wild-type AAV9 control. Left panel: Binding to anti-Strep-tag II antibody. Right panel: Binding activity of mutant AAVs to anti-c-Myc antibody. Figure 3 shows a pull-down analysis using Strep-Tactin magnetic beads. The unbound, washed, EB1, EB2, EB3, and beads represent the unbound virus, the virus collected in two washing steps, the eluent from the first elution step using 2.5 mM D-destiobiotin, the eluent from the second elution step using 2.5 mM D-destiobiotin, the eluent from the third elution step using 12.5 mM D-destiobiotin, and the eluent from the final step using 12.5 mM D-destiobiotin for an extended time, respectively. Figure 4 shows a pull-down analysis using anti-c-Myc magnetic beads. The unconjugated, washed, EB1, EB2, EB3, and beads represent the unconjugated virus, the virus collected in two washing steps, the eluent from the first elution step using 0.5 mg / ml c-Myc peptide, the eluent from the second elution step using 2.5 mg / ml c-Myc peptide, the eluent from the third elution step using 5 mg / ml c-Myc peptide, and the eluent from the final step using proteinase K treatment, respectively. Figure 5 shows the viral yield of mutant AAVs. Viruses were produced in 15 cm plates using equal amounts of plasmid DNA. Viral titers were measured in vector genomes per culture dish (Vg). Data were expressed as relative viral yields with wild-type AAV9 as the reference (100%). Figures 6a–6c show the binding activity of mutant AAV to anti-Strep tag antibodies, anti-c-Myc antibodies, or anti-HA tag antibodies. 6a: Binding kinetics of mutant AAV to anti-Strep tag antibody. 6b: Binding kinetics to anti-c-Myc antibody. 6c: Binding to anti-HA tag antibody. Specific details for implementing the invention

[0014] In the following detailed description, reference is made to the drawings presented above, which are presented together with the various embodiments provided herein and are intended to constitute part of the description of the embodiments. Unless the context indicates otherwise, similar symbols in the drawings generally represent similar components in the description.

[0015] All descriptions provided herein are merely illustrative of various embodiments of the invention provided herein and are not intended to be limiting. It will be apparent to those skilled in the art that various equivalents, modifications, and alterations may be made without departing from the scope of this disclosure, and such equivalent embodiments are understood to be incorporated herein.

[0016] For clarity, it should be understood that specific features of the present disclosure described in the context of separate embodiments may be provided in combination in a single embodiment. Conversely, for brevity, various features of the present disclosure described in the context of a single embodiment may be provided separately or in any suitable sub-combination. For example, if a specific embodiment disclosed herein includes components A, B, and C, it should be understood that the present disclosure also includes embodiments that include A, B, or C individually or in any combination of A, B, or C.

[0017] All references cited in this disclosure, including patent applications, registered patents, published papers, or other publications, are incorporated by reference in their entirety to provide a methodology that may be used in relation to the descriptions provided in this specification. If terms similar or identical to those explicitly defined in this disclosure are presented in one or more publications, the definitions of the terms explicitly provided in this disclosure shall prevail in all respects.

[0018] Unless otherwise explicitly defined, all technical and scientific terms used in this disclosure are generally considered to have the same meaning as commonly understood by a person skilled in the art to which this disclosure pertains.

[0019] I. definition

[0020] Before providing a detailed description of the invention in this disclosure, the following matters are recorded and defined.

[0021] As used herein, that is, throughout the entire disclosure, the articles “a,” “an,” and “the” are interpreted to mean “one or more” or “at least one” unless otherwise specified. For example, “a gene” may mean one gene or one or more genes.

[0022] As used herein, any numeric range described herein may include each numeric value and each sub-range within that range, unless otherwise explicitly indicated.

[0023] As used herein, the terms “about,” “approximately,” “approximately,” or similar terms mean a quantity, level, value, number, frequency, percentage, dimension, size, amount, weight, or length that varies by up to 30, 25, 20, 25, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1% with respect to a reference quantity, level, value, number, frequency, percentage, dimension, size, amount, weight, or length. In certain embodiments, when the terms “about” or “approximately” precede a number, they indicate a range of ±15%, 10%, 5%, or 1% from the value.

[0024] As used herein, the term “polypeptide” is used interchangeably with “peptide,” “protein,” or similar terms and is used to refer to a polymer of amino acid residues or an assembly of polymers of multiple amino acid residues. This term applies to both naturally occurring amino acid polymers and non-naturally occurring amino acid polymers, and is interpreted to include amino acid polymers in which one or more amino acid residues are artificial or synthetic chemical mimics of the corresponding naturally occurring amino acid. The term “protein” generally refers to a large polypeptide. The term “peptide” generally refers to a short polypeptide. A polypeptide sequence is generally described as having an amino terminus (N-terminus) at the left end of the polypeptide sequence and a carboxyl terminus (C-terminus) at the right end of the polypeptide sequence.

[0025] As used herein, the term “nucleic acid” refers to oligonucleotides or polynucleotides such as deoxyribonucleic acid (DNA) and ribonucleic acid (RNA), and is further interpreted to include equivalents, derivatives, variants, and analogs of RNA or DNA made from nucleotide analogs, as well as single (sense or antisense) and double-stranded polynucleotides. Since the term “nucleic acid” does not refer to or imply a specific length of polynucleotide chains, nucleotides, polynucleotides, and oligonucleotides are also included in the definition.

[0026] As used herein, "comprise," "comprising," "include," "including," "contain," "containing," "have," "having," and similar terms are synonyms and are used in an open and inclusive manner, and do not exclude additional elements, features, steps, actions, operations, etc.

[0027] As used herein, the term "or" is used in an inclusive sense (not an exclusive sense); therefore, for example, when used to link a list of elements, "or" means one, some, or all of the elements in the list.

[0028] As used herein, the phrase “at least one” means one or more, i.e., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more. A phrase referring to “at least one” in a list of items is interpreted to include any combination of such items, including individual items. For example, “at least one of A, B or C” is intended to include A, B, C, A and B, A and C, B and C, and A, B, C. Unless otherwise specified, conjunctions such as “at least one of X, Y and Z” are generally understood to convey that an item, term, etc., may be at least one of X, Y or Z. Accordingly, such conjunctions are generally not intended to imply that a particular embodiment must include at least one of X, at least one of Y, and at least one of Z, respectively.

[0029] The “sequence identity percentage (%)” for an amino acid sequence (or nucleic acid sequence) is defined as the percentage of amino acid (or nucleic acid) residues in a candidate sequence that are identical to the amino acid (or nucleic acid) residues in a reference sequence after aligning the sequences and, if necessary, introducing gaps to achieve maximum correspondence. Alignment to determine the percentage of amino acid (or nucleic acid) sequence identity can be performed using publicly available tools such as, for example, BLASTN, BLASTp (available on the National Center for Biotechnology Information (NCBI) website; see Altschul SF et al., J. Mol. Biol., 215:403-410 (1990); Stephen F. et al., Nucleic Acids Res., 25:3389-3402 (1997)), ClustalW2 (available on the European Bioinformatics Institute website; see Higgins DG et al., Methods in Enzymology, 266:383-402 (1996); see Larkin MA et al., Bioinformatics (Oxford, England), 23(21): 2947-8 (2007)), and ALIGN or Megalign (DNASTAR) software. A person skilled in the art may use the default parameters provided by the tool or customize parameters suitable for alignment, such as by selecting an appropriate algorithm. In certain embodiments, non-identical residue positions may differ due to conservative amino acid substitutions.

[0030] As used herein, “homologue sequence” and “homologous sequence” are used interchangeably and refer to a polynucleotide sequence (or its complementary strand) or amino acid sequence having at least 80% (e.g., at least 85%, 88%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%) sequence identity with respect to another sequence when optionally aligned.

[0031] "Conservative amino acid substitution" is the substitution of an amino acid residue with another amino acid residue having a side chain (R group) that has similar chemical properties (e.g., charge or hydrophobicity). Generally, conservative amino acid substitution does not substantially alter the functional properties of a protein. If two or more amino acid sequences differ due to conservative substitution, the percentage or degree of similarity may be upscaled to compensate for the conservative nature of the substitution. Means for such upscaled are well known to those skilled in the art. For example, see Pearson (1994) Methods Mol. Biol. 24: 307-331, incorporated by reference.

[0032] As used herein, references to “one embodiment,” “one embodiment,” “specific embodiment,” “related embodiment,” “specific embodiment,” “additional embodiment,” or “additional embodiment,” or any combination thereof, are understood to mean that a specific feature, structure, or characteristic described in connection with this specific embodiment is included in at least one embodiment of this disclosure. Accordingly, the appearance of the foregoing phrases in various places throughout this disclosure does not necessarily refer to all of the same embodiment. Furthermore, a specific feature, structure, or characteristic may be combined in any suitable manner in one or more embodiments.

[0033] Conditional language used herein, e.g., “may,” “may,” “may,” “may,” “e.g.,” etc., is generally intended to convey that certain embodiments include certain features, elements, and / or steps, while other embodiments do not, unless otherwise explicitly stated or understood in the context in which they are used. Accordingly, such conditional language is generally not intended to imply that features, elements, and / or steps are required in any way in one or more embodiments.

[0034] II. Modified adeno-associated virus (AAV) capsid protein

[0035] The present disclosure provides a modified AAV capsid protein having a modification that confers tropism toward a specific target cell of interest without substantially reducing replication or production efficiency.

[0036] Although AAV vectors are recognized for their potential in therapeutic gene delivery, their natural orientation often limits their utility in targeting specific cell types. Modifying orientation can be useful, for example, by fusing a heterologous peptide containing a recognition site for a receptor present on the target cell membrane. However, this method of genetically inserting a peptide motif into the AAV capsid often compromises the vector's packaging and infectivity.

[0037] The inventors have discovered that while specific regions of the AAV capsid protein are more resistant to the insertion of heterologous peptides, other regions can significantly reduce viral vector packaging and infection efficiency. This highlights the importance of site selection for AAV capsid modification.

[0038] The present disclosure provides specific insertion sites within an AAV capsid protein. These sites display a heterologous peptide on the surface of the AAV capsid and enable the redirection of AAV orientation toward specific target cells without substantially reducing or impairing the replication or production of the AAV vector.

[0039] In one aspect, the present disclosure provides a modified adeno-associated virus (AAV) capsid protein comprising at least one peptide insertion at one or more sites selected from the group consisting of positions 264, 452, 498, 550, and 586 according to the numbering of the wild-type AAV9 VP1 protein (SEQ No. 1).

[0040] a. AAV capsid protein

[0041] As used herein, the term “adeno-associated virus (AAV)” refers to a small virus that infects humans and some other primate species. AAV is a type of non-pathogenic single-stranded DNA virus commonly found in humans and other mammals. AAV belongs to the family Parvoviridae and the genus Dependoparvovirus.

[0042] As used herein, the term "capsid" refers to the protein shell of a virus that surrounds viral nucleic acid. Generally, a capsid consists of several oligomeric structural subunits (i.e., protomers).

[0043] The AAV capsid, useful for enclosing genetic material such as the viral genome, is a 20-sided hollow structure with a diameter of approximately 26 nm. It can be visualized as an icosahedron composed of 20 triangles, forming a pentagon every five triangles. There are 5-fold rotation axes between pairs of opposite pentagons, 3-fold rotation axes between pairs of opposite triangle centers, and 2-fold rotation axes between pairs of opposite corner centers. The AAV capsid consists of a total of 60 capsid proteins, VP1, VP2, and VP3, with the ratio of these three subunits in each capsid being 5:5:50. These subunits are encoded by overlapping sequences within the same decoding frame. Neutralizing antibodies recognize the antigenic epitope regions on the surface of the viral capsid and bind to the AAV.

[0044] As used herein, the term “capsid protein” refers to a structural protein of the viral capsid. The AAV capsid has three capsid proteins, Viral Protein 1 (VP1), VP2, and VP3, which assemble into an icosahedral capsid. In the AAV genome, VP1, VP2, and VP3 are all encoded by overlapping sequences within a single coding frame. The entire sequence of VP3 is contained within VP2, and the entirety of VP2 is contained within VP1, and VP1 has a unique N-terminal (VP1u) domain. Only the common VP3 region is observed in the capsid structures of all AAV serotypes identified to date by cryo-electron microscopy (cryo-EM) and image reconstruction or X-ray crystallography.

[0045] In certain embodiments, the modified AAV capsid protein provided herein comprises at least one peptide insertion in one or more sites. These sites display a heterogeneous peptide on the surface of the AAV capsid and enable the redirection of AAV orientation toward specific target cells without substantially reducing or impairing the replication or production of the AAV vector.

[0046] Insertion site

[0047] In certain embodiments, one or more sites are selected from the group consisting of positions 264, 452, 498, 550, and 586 according to the numbering of the wild-type AAV9 VP1 protein or any functionally equivalent sites thereof. In some embodiments, the AAV9 VP1 capsid protein comprises the amino acid sequence of SEQ ID NO. 1.

[0048] As used herein, the term “functionally equivalent site” refers to an amino acid position within a range of 10 amino acids adjacent to a relevant position in a variable region of a capsid protein, whereby an AAV virus having a modified AAV capsid protein having a modification at this position can achieve at least 50% of the viral production of a wild-type AAV virus. Optionally, at least 50% of the antigen-binding ability is also maintained compared to the wild-type AAV capsid protein.

[0049] As used herein, the "variable region" of a capsid protein refers to a region located on the surface loops of the capsid protein. These loops connect several conserved structural motifs, such as β-barrels and / or α-helices, which play a pivotal role in forming the unique topography of the capsid surface. This unique topography results in variations in cell orientation, tissue transduction efficiency, and antigenic properties.

[0050] In certain embodiments, the functionally equivalent site of position 452 includes positions 453, 454, 455, and 456 according to the numbering of the wild-type AAV9 VP1 protein. In certain embodiments, the functionally equivalent site of position 498 includes positions 492 and 493 according to the numbering of the wild-type AAV9 VP1 protein. In certain embodiments, the functionally equivalent site of position 586 includes positions 587, 588, and 589 according to the numbering of the wild-type AAV9 VP1 protein.

[0051] As used herein, the phrase “corresponds to” with respect to an AAV capsid protein reflects that an amino acid residue of a reference capsid protein corresponds to a numbered amino acid residue of a standard AAV capsid protein (e.g., wild-type AAV9 VP1 protein) having a specific homology. The reference capsid protein and the standard capsid protein may be different AAV serotypes, and such correspondence can be obtained, for example, by sequence alignment. Sequence alignment can be performed by aligning a selected AAV capsid sequence with a reference sequence, such as AAV9 or another AAV serotype, using any suitable computer program and technique such as Clustal W, CAP Sequence Assembly, MAP, MEME, and Vector NTI utilities.

[0052] High levels of conservation in capsid amino acid sequences between different AAV serotypes have been reported. In this sense, insertion into corresponding residues in AAV serotypes other than AAV9 can have similar modifying effects. Therefore, when listing the locations where insertions are introduced in this disclosure, only specific locations of a specific AAV9 VP1 protein (e.g., having the sequence of SEQ ID NO. 1) are used as references or examples, and there is no intention to specifically limit the mutation locations to the capsid protein of wild-type AAV9.

[0053] In other words, the amino acid positions into which peptide insertion is introduced according to the present disclosure (e.g., positions 264, 452, 498, 550, and 586 mentioned above, etc.) include not only specific positions of the AAV9 VP1 protein (having the amino acid sequence of SEQ ID NO. 1), but also conserved positions of AAV serotype capsid proteins other than AAV9 VP1 that can be obtained, for example, by sequence alignment. For example, position 264 of the AAV9 VP1 protein corresponds to position 262 of AAV2, position 263 of AAV6, and position 265 of AAV8.

[0054] In some embodiments, the wild-type AAV9 VP1 protein comprises or consists of the amino acid sequence presented in SEQ ID NO. 1.

[0055] Wild-type AAV9 VP1 protein (Sequence No. 1)

[0056]

[0057] The modified AAV capsid protein provided in this specification may be any suitable AAV serotype. In some embodiments, the modified AAV capsid proteins provided herein are AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV12, AAV843, AAVbb2, AAVcyS, AAVrh10, AAVrh20, AAVrh39, AAVrh43, AAVrh64, AAVhu37, AAV3B, AAVhu48, AAVhu43, AAVhu44, AAVhu46, AAVhu19, AAVhu20, AAVhu23, AAVhu22, AAVhu24, AAVhu21, AAVhu27, AAVhu28, AAVhu29, AAVhu63, AAVhu64, AAVhu13, AAVhu56, AAVhu57, AAVhu49, AAVhu58, AAVhu34, AAVhu45, AAVhu47, AAVhu51, AAVhu52, AAVhu T41, AAVhu S17, AAVhu T88, AAVhu T71, AAVhu T70, AAVhu T40, AAVhu T32, AAVhu T17, AAVhu LG15, AAVhu9, AAVhu10, AAVhu11, AAVhu53, AAVhu55, AAVhu54, AAVhu7, AAVhu18, AAVhu15, AAVhu16, AAVhu25, AAVhu60, AAVch5, AAVhu3, AAVhu1, AAVhu4, AAVhu2, AAVhu61, AAVrh62, AAVrh48, AAVrh54, AAVrh55, AAVcy2, AAVrh35, AAVrh37, AAVrh36, AAVcy6, AAVcy4, AAVcy3, AAVcy5, AAVrh13, AAVrh38, AAVhu66, AAVhu42, AAVhu67, AAVhu40, AAVhu41, AAVrh40, AAVrh2, AAVbb1, AAVhu17, AAVhu6, AAVrh25, AAVpi2, AAVpi3, AAVrh57, AAVrh50, AAVrh49, AAVhu39, AAVrh58,It is an AAV serotype selected from the group consisting of AAVrh61, AAVrh52, AAVrh53, AAVrh51, AAVhu14, AAVhu31, AAVhu32, AAVrh34, AAVrh33, AAVrh32, avian AAV ATCC VR-865, avian AAV strain DA-1, or bovine AAV.

[0058] Examples of AAV capsid gene sequences and protein sequences can be found in the GenBank database. See GenBank registry numbers: AF043303, AF028705, AF028704, J02275, J01901, J02275, X01457, AF288061, AH009962, AY028226, AY028223, NC 001358, NC 001540, AF513851, AF513852, AY530579, AY631965, AY631966; AF063497, AF085716, AF513852, AY530579, AAS99264.1, AY243022, AY243015, AY530560, AY530600, AY530611, AY530628, AY530553, AY530606, AY530583, AY530555, AY530607, AY530580, AY530569, NC 006263, NC 005889, NC 001862, AY530609, AY530581, AY530563, AY530591, AY530562, AY530584, AY530622, AY530601, AY530586, AY243021, AY530570, AY530589, AY530595, AY530572, AY530588, AY530575, AY530565, AY530590, AY530602, AY530566, AY530587, AY530585, AY530564, AY530592, AY530623, AY530574, AY530593, AY530560, AY530594, AY530573, AF513852, AY530624, AY530561, AY242997, AY530625, AY530567, AY530556, AY530578, AY530568, AY530618, AY243020, AY530579, AY530619, AY530596, AY530612, AY243000, AY530597, AY530620, AY242998, AY530598, AY242999, AY530599, AY243016, NC 001729,NC 001401, AY243018, NC 001863, AY530608, AY243019, NC 001829, AY530610, AY243017, AY243001, AY530613, AY243013, AY243002, AY530614, AY243003, AY695378, AY530558, AY530626, AY695376, AY695375, AY530605, AY695374, AY530603, AY530627, AY695373, AY695372, AY530604, AY695371, AY530600, AY695370, AY530559, AY695377, AY243007, AY243023, AY186198, AY629583, NC 004828, AY530629, AY530576, AY243015, AY388617, AY530577, AY530582, AY530615, AY530621, AY530617, AY530557, AY530616 or AY530554.,

[0059] In some embodiments, the capsid protein may be modified, chimeric, or synthetic. A chimeric capsid contains parts of two or more capsid sequences. A synthetic capsid contains a synthetic or artificially designed sequence. In some embodiments, the cap gene or capsid protein is derived from two or more AAV serotypes.

[0060] In some embodiments, the modified AAV capsid proteins provided herein are derived from wild-type or original capsid proteins of AAV suitable for therapeutic use, such as, but not limited to, AAV1, AAV2, AAV3, AAV3B, AAV5, AAV6, AAV8, AAV9, AAV10, AAVrh.74, AAVrh.10, and AAVhu.37. Exemplary amino acid sequences of the wild-type or original VP1 proteins of the aforementioned AAVs are provided in the table below.

[0061]

[0062]

[0063]

[0064]

[0065]

[0066] In some embodiments, the modified AAV capsid protein provided herein comprises a variant of an amino acid sequence selected from the group consisting of SEQ ID NOs. 1 and 5-16, wherein the variant comprises at least one peptide insert disclosed herein at a position presented herein.

[0067] In some embodiments, except for at least one peptide insertion at the position(s) presented herein, the modified AAV capsid protein provided herein has at least 90%, 95%, or 98% sequence identity with respect to SEQ ID NOs 1 and 5-16 outside the region of at least one peptide insertion.

[0068] In some embodiments, the modified AAV capsid proteins provided herein have at least 90%, 95%, or 98% sequence identity with respect to SEQ ID NOs 1 and 5-16.

[0069] Unless otherwise defined, the insertion site in a predetermined amino acid sequence is between the C-terminus of the residue at the defined mutation site and the N-terminus of the residue following the defined mutation site. For example, when an insertion mutation is defined at position 264 corresponding to the sequence of SEQ ID NO. 1, this means that the inserted amino acid(s) are inserted between positions 264 and 265 corresponding to SEQ ID NO. 1.

[0070] In some embodiments, a modified AAV capsid protein having peptide insertions in one or more sites provided herein does not substantially reduce the production of the AAV containing the modified AAV capsid protein compared to its non-modified counterpart. In some embodiments, the AAV containing the modified AAV capsid protein provided herein has a viral production efficiency equivalent to or similar to that of a relative AAV containing the non-modified or corresponding wild-type AAV capsid protein under equivalent analytical conditions. In some embodiments, an AAV comprising the modified AAV capsid protein provided herein has a viral production efficiency of 99% or more, 98% or more, 97% or more, 96% or more, 95% or more, 94% or more, 93% or more, 92% or more, 91% or more, 90% or more, 85% or more, 80% or more, 75% or more, 70% or more, 65% or more, 60% or more, 55% or more, or 50% or more of the relative AAV virus comprising the unmodified or corresponding wild-type AAV capsid protein under equivalent analytical conditions.

[0071] The production of AAVs with modified capsid proteins can be verified using any appropriate method. For example, the total yield of produced viral particles can be measured using quantitative analysis. This yield of the AAV vector with the modified capsid protein is compared to the yield of the vector with the unmodified capsid protein under equivalent production conditions. As another example, the replication efficiency of the AAV genome within host cells can be evaluated using molecular techniques such as quantitative polymerase chain reaction (qPCR). Efficient replication may be indicated by similar levels of the viral genome in cells producing both the modified and unmodified AAV vectors. As yet another example, capsid protein expression levels between the modified and unmodified AAV vectors can be compared using Western blot or ELISA (enzyme-linked immunosorbent assay). Similar expression levels suggest that the modification does not negatively affect capsid protein expression. As yet another example, the structural integrity of the produced viral particles can be evaluated using techniques such as electron microscopy. This ensures that capsid deformation does not result in deformed or unstable virus particles, which can be critical for maintaining production efficiency.

[0072] The production of AAVs with modified capsid proteins can be further evaluated by the infectivity of the produced AAV vector. Infectivity can be assessed to ensure that the modification does not impair the virus's ability to infect host cells for virus production. A comparable ratio of infectivity between the modified and unmodified vectors indicates that production efficiency is maintained.

[0073] Peptide insertion

[0074] As used herein, the term “peptide insertion” refers to the incorporation of a peptide into a predetermined amino acid sequence. In some embodiments, the peptide insertion disclosed herein comprises the insertion of about 3 to about 5 or even about tens of amino acid residues. The inserted residue(s) may be naturally occurring or non-naturally occurring. The inserted residues or residues may be “naturally occurring amino acid residues (i.e., coded by the genetic code)” and include alanine (Ala); arginine (Arg); asparagine (Asn); aspartic acid (Asp); cysteine ​​(Cys); glutamine (Gln); glutamic acid (Glu); glycine (Gly); histidine (His); isoleucine (Ile); leucine (Leu); lysine (Lys); methionine (Met); phenylalanine (Phe); proline (Pro); serine (Ser); threonine (Thr); tryptophan (Trp); It is selected from the group consisting of tyrosine (Tyr) and valine (Val). The insertion of one or more non-naturally occurring amino acid residues is also included in the definition of insertion herein. “Non-naturally occurring amino acid residue” refers to a residue other than the naturally occurring amino acid residues listed above that can covalently bond to adjacent amino acid residue(s) in the polypeptide chain. Examples of non-naturally occurring amino acid residues include norleucine, ornithine, norvaline, homoserine, and other amino acid residue analogs such as those described in Ellman et al. Meth. Enzym. 202:301-336 (1991). To generate these non-naturally occurring amino acid residues, the procedures of Noren et al. Science 244:182 (1989) and Ellman et al., supra may be used. Briefly, these procedures involve chemically activating repressor tRNA with non-naturally occurring amino acid residues, followed by in vitro transcription and translation of RNA.

[0075] In some embodiments, the peptide insertion comprises up to 15, 20, 25, 30, 35, 40, 45, or 50 amino acid residues. In some embodiments, the length of the peptide insertion is 2 to 40, 2 to 30, 2 to 20, 2 to 19, 2 to 18, 2 to 17, 2 to 16, 2 to 15, or 2 to 14 amino acid residues.

[0076] In some embodiments, peptide insertion alters the binding of the modified AAV capsid protein to a target compared to its non-modified counterpart. For example, the binding of the modified AAV capsid protein to a target may be substantially eliminated or enhanced.

[0077] In some embodiments, the target is a receptor expressed in the cell of interest. In some embodiments, the cell of interest is the natural host of the AAV. In some embodiments, the cell of interest is not the natural host of the AAV.

[0078] During the process of natural infection, AAV typically binds to primary receptors and / or co-receptors on the surface of natural host cells to induce infection. As a strategy to alter AAV orientation, one method involves inserting peptide fragments into specific regions of the capsid protein, such as the VP3 region. This modification aims to reduce or eliminate the natural binding of AAV to natural host cells and selectively reduce or eliminate infection of natural host cells. Alternatively, or additionally, the capsid protein can be modified to allow AAV to bind to receptors on the surface of non-natural host cells, thereby facilitating AAV binding and transduction through novel non-natural AAV receptors. Consequently, these modified capsid proteins enable the AAV vector to reorient or expand its orientation.

[0079] In some embodiments, peptide insertion reduces or substantially eliminates binding to a target or cell of interest compared to the unmodified counterpart. In some embodiments, the AAV containing the modified capsid protein has binding to the target at least about 30% less, at least about 40% less, at least about 50% less, at least about 70% less, at least about 80% less, or at least about 90% less than the unmodified or corresponding wild-type AAV capsid protein under equivalent analytical conditions. In some embodiments, the AAV containing the modified capsid protein has binding to the target 20% or less, 15% or less, 10% or less, 8% or less, 5% or less, 2% or less, or 1% or less compared to the unmodified or corresponding wild-type AAV capsid protein under equivalent analytical settings in an appropriate detection assay. In some embodiments, the AAV containing the modified capsid protein has at least about 30% less, at least about 40% less, at least about 50% less, at least about 70% less, at least about 80% less, or at least about 90% less than the unmodified or corresponding wild-type AAV capsid protein under equivalent analysis conditions. In some embodiments, the AAV containing the modified capsid protein has 20% or less, 15% or less, 10% or less, 8% or less, 5% or less, 2% or less, or 1% or less compared to the unmodified or corresponding wild-type AAV capsid protein under equivalent analysis settings in an appropriate detection assay.

[0080] In certain embodiments, the cell of interest is the natural host of the AAV. In certain embodiments, the target is the primary receptor and / or co-receptor on the surface of the natural host cell of the AAV. In some embodiments, the peptide insertion reduces or substantially eliminates binding to the target expressed in the natural host of the AAV compared to the unmodified AAV counterpart. For example, the peptide insertion may be designed to evade or reduce binding to the receptor present in the natural host. This may be achieved, for example, by inserting amino acid residues or peptide fragments into specific site(s) or regions exposed on the capsid surface associated with the AAV capsid binding to the natural host receptor. At least some of the insertion sites provided in this disclosure are believed to be involved in binding to these host receptors. Thus, peptide insertions may be introduced into these sites to reduce the binding or binding affinity of the natural host receptor of, for example, the modified AAV capsid protein (and consequently the AAV with such modified capsid protein). For example, peptide insertion can mask or modify the capsid region responsible for binding to natural host cell receptors by including a sequence that stereochemically interferes with the interaction with these natural host receptors. Such peptide insertion sequences can be obtained by methods known in the art, such as rational design and molecular evolution.

[0081] In some embodiments, the modified AAV capsid protein provided herein is endowed with or enhanced binding to a target compared to its unmodified counterpart. In some embodiments, the target is a receptor expressed in the cell of interest. In some embodiments, the target is a natural receptor for the AAV capsid protein. In certain embodiments, the cell of interest is not a natural host of the AAV. In some embodiments, the AAV comprising the modified AAV capsid protein provided herein has, under equivalent analytical conditions, at least about 30% more, at least about 40% more, at least about 50% more, at least about 70% more, at least about 80% more, at least about 90% more, at least about 2 times, at least about 2.1 times, at least about 2.2 times, at least about 2.3 times, at least about 2.4 times, at least about 2.5 times, at least about 2.6 times, at least about 2.7 times, at least about 2.8 times, at least about 2.9 times, at least about 3 times, at least about 3.5 times, at least about 4 times, at least about 5 times, at least about 6 times, at least about 7 times, at least about 8 times, at least about 9 times, or at least about 10 times more binding to the target or the cell of interest expressing the target. In some embodiments, the AAV comprising the modified AAV capsid protein provided herein has, under equivalent analytical conditions, at least about 30% more, at least about 40% more, at least about 50% more, at least about 70% more, at least about 80% more, at least about 90% more, at least about 2 times, at least about 2.1 times, at least about 2.2 times, at least about 2.3 times, at least about 2.4 times, at least about 2.5 times, at least about 2.6 times, at least about 2.7 times, at least about 2.8 times, at least about 2.9 times, at least about 3 times, at least about 3.5 times, at least about 4 times, at least about 5 times, at least about 6 times, at least about 7 times, at least about 8 times, at least about 9 times, or at least about 10 times more.

[0082] In some embodiments, the peptide insertion confers or enhances binding to a target or cell of interest compared to its non-modified counterpart. In some embodiments, the target may be a specific receptor or molecule expressed on the cell of interest. For example, the peptide insertion may be designed to bind specifically to a target on the cell of interest rather than a molecule on the natural host cell. This may be useful for reducing non-target infectivity.

[0083] Peptide sequences may be designed to enhance the binding of an AAV vector to a target expressed in cells of interest by specifically targeting, for example, a specific cell type or tissue. Such peptide sequences may be known in the art or may be obtained by reasonable design, molecular evolution, or random screening, etc. In some embodiments, cells of interest include various cancer cells such as, for example, ovarian cancer, breast cancer, prostate cancer, lung cancer (including non-small cell and small cell lung cancer), colorectal cancer, melanoma, leukemia (acute myeloid leukemia, chronic lymphocytic leukemia), lymphoma (Hodgkin and non-Hodgkin), pancreatic cancer, liver cancer cells (hepatocellular carcinoma), and glioblastoma. In some embodiments, cells of interest include, for example, muscle cells including skeletal muscle, cardiac muscle, and smooth muscle cells; vascular cells such as endothelial cells and vascular smooth muscle cells; lung cells such as alveolar and bronchial epithelial cells; and heart cells such as cardiomyocytes and cardiac fibroblasts. Neurons (sensory, motor), glial cells (astrocytes, oligodendrocytes, microglia), neural stem cells and neural progenitor cells, and diseased brain endothelial cells; retinal cells such as rods, cones, retinal ganglion cells and bipolar cells; stem cells such as pluripotent stem cells (induced pluripotent and embryonic), mesenchymal stem cells and hematopoietic stem cells; hepatocytes (hepatocytes, Kupffer cells), kidney cells (podocytes, mesangial cells, renal tubule cells), gastrointestinal cells (intestinal cells, goblet cells) and various immune cells (T cells, B cells, macrophages, dendritic cells, natural killer cells); skin cells such as keratinocytes, melanocytes and fibroblasts; bone cells including osteoblasts, osteoclasts and osteocytes; chondrocytes such as chondrocytes (cancer cells); and pancreatic cells (including alpha cells, beta cells, delta cells, gamma cells, epsilon cells, exocrine cells, and tubular epithelial cells).

[0084] Those skilled in the art can select specific targets in the cells of interest. For example, in the case of cancer cells such as breast, prostate, ovarian, lung, leukemia, and lymphoma cells, targeting often focuses on overexpressed receptors or antigens. For instance, breast cancer cells frequently overexpress the HER2 / neu receptor, and prostate cancer cells are known for the presence of prostate-specific membrane antigen (PSMA). Ovarian cancer cells can be targeted via folate receptors or CA-125, while lung cancer cells often express epidermal growth factor receptor (EGFR) abundance. In hematological malignancies such as leukemia and lymphoma, cell surface antigens such as CD19, CD20, or CD22 are used as potential targets.

[0085] For non-cancerous cell types, targeting strategies vary depending on the cell's function and location. Muscle cells, including skeletal and cardiac muscle cells, can be targeted via dystrophin-related proteins or integrins. In the vascular system, endothelial cells become unique targets by expressing specific markers such as VEGFR and integrins. Lung cells, including alveolar and bronchial epithelial cells, can be identified via markers such as EpCAM or surfactant proteins. Cardiomyocytes in the heart can be targeted via receptors such as β1-adrenergic or angiotensin II receptors. In the nervous system, neurons and glial cells exhibit unique markers such as neuronal cell adhesion molecules, synaptic receptors, or GFAP. Specialized cells in the retina, including photoreceptors and retinal ganglion cells, can be targeted via cell-specific proteins such as rhodopsin or opsin.

[0086] In addition, stem cells exhibit a unique set of markers, and pluripotent stem cells express stage-specific embryonic antigens (SSEA), TRA-1-60, and TRA-1-81, whereas mesenchymal stem cells and hematopoietic stem cells can be distinguished by markers such as CD105, CD73, CD90, and CD34, CD117 (c-Kit), respectively. Other cell types, such as hepatocytes (hepatocytes), kidney cells (podocytes, renal tubules), gastrointestinal cells (intestinal epithelial cells, pancreatic cells), immune cells (T cells, B cells, macrophages), skin cells (keratinocytes, melanocytes), bone cells (osteoblasts, osteoclasts), and chondrocytes (chondrocytes), also express specific markers that can be utilized for targeted AAV vector delivery.

[0087] In some embodiments, peptide insertion can disrupt epitope(s) recognized by neutralizing antibodies against the AAV capsid. This strategy can be used to evade existing neutralizing antibodies, thereby enhancing the efficacy of the gene therapy and / or improving its safety profile. For example, specific locations on the AAV capsid may form at least some of the epitopes recognized by neutralizing antibodies in host serum, and recognition by neutralizing antibodies may be reduced by inserting a peptide to disrupt these epitopes. Examples of such locations include, but are not limited to, locations 498, 588, and 589. For further details, see, for example, Giles, AR et al., J. Virol. (2018) 92(20): e01011-18.

[0088] In some embodiments, peptide inserts modify the immune response compared to their non-modified counterparts. For example, peptide inserts may be designed to reduce the innate immune response, T cell response, or humoral response to the capsid or transgene. This strategy may also help the AAV evade existing neutralizing antibodies. For example, peptide inserts may be introduced to disrupt Toll-like receptor signaling, thereby improving the early stages of host-vector interaction and reducing innate and adaptive immune responses. For details, see, for example, Bentler, M. et al., Mol Ther Methods Clin Dev. (2023) 30: 576-592.

[0089] Exemplary peptide insertion sequences conferring binding to specific targets or specific cells of interest are known in the art and have been extensively reviewed. For example, see Buning, H. et al., Mol Ther Methods Clin Dev. (2019) 12: 248-265; PCT publications WO2019178412A1, WO2020219656A1 and WO2022061378A2, the contents of which are incorporated by reference.

[0090] In some embodiments, peptide insertion facilitates the purification of the AAV capsid.

[0091] In some embodiments, the peptide insertion comprises a commonly used protein tag (e.g., a protein purification tag) having a length of 6 to 26 amino acid residues or less. In some embodiments, the protein tag is well-established and commercially available, enabling rapid identification of the produced mutant virus. In some embodiments, the protein tag has uniform polarity and charge characteristics.

[0092] In some embodiments, the insertion comprises the amino acid sequence of a Strep-II tag or a fragment thereof. In certain embodiments, the Strep-II tag comprises the amino acid sequence of WSHPQFEK (SEQ No. 2). In some embodiments, the insertion comprises the amino acid sequence of a Myc tag or a fragment thereof. In certain embodiments, the c-Myc tag comprises the amino acid sequence of EQKLISEEDL (SEQ No. 3). In some embodiments, the insertion comprises the amino acid sequence of an HA tag or a fragment thereof. In certain embodiments, the HA tag comprises the amino acid sequence of YPYDVPDYA (SEQ No. 4).

[0093] In some embodiments, the peptide insertion comprises the insertion of a Strep-II tag, for example, containing the amino acid sequence of SEQ ID NO. 2, at a position selected from the group consisting of positions 264, 452, 498, 550, and 586 of the wild-type AAV9 VP1 protein SEQ ID NO. 1. In some embodiments, the peptide insertion comprises the insertion of a c-Myc tag, for example, containing the amino acid sequence of SEQ ID NO. 3, at a position selected from the group consisting of positions 264, 452, 498, 550, and 586 of the wild-type AAV9 VP1 protein SEQ ID NO. 1. In some embodiments, the peptide insertion comprises the insertion of an HA tag, for example, containing the amino acid sequence of SEQ ID NO. 4, at a position selected from the group consisting of positions 264, 452, 498, 550, and 586 of the wild-type AAV9 VP1 protein SEQ ID NO. 1.

[0094] In a specific embodiment, the peptide insertion comprises a first insertion of a Strep-II tag comprising, for example, the amino acid sequence of SEQ ID NO. 2 at a position selected from the group consisting of positions 264, 452, 498, 550, and 586 of the wild-type AAV9 VP1 protein SEQ ID NO. 1, and a second insertion of a c-Myc tag comprising, for example, the amino acid sequence of SEQ ID NO. 3 at a position selected from the group consisting of positions 264, 452, 498, 550, and 586.

[0095] Part 1 and Part 2

[0096] In some embodiments, at least one peptide insertion in the modified AAV capsid protein provided herein comprises a first peptide insertion at a first site selected from the group consisting of positions 264, 452, 498, 550, and 586. In some embodiments, at least one peptide insertion further comprises a second peptide insertion at a second site, the second site being different from the first site.

[0097] In some embodiments, the first portion and the second portion are each selected from the group consisting of positions 264, 452, 498, 550, and 586. In some embodiments, the first portion is selected from the group consisting of positions 264, 452, 498, and 586. In some embodiments, the second portion is selected from the group consisting of positions 264, 452, and 498.

[0098] In some embodiments, the first and second portions are located in a pair of portions selected from the group consisting of: (a) positions 264 and 452; (b) positions 264 and 498; (c) positions 452 and 498; (d) positions 586 and 452; (e) positions 586 and 498; and (f) positions 586 and 264.

[0099] In some embodiments, at least one peptide insertion further comprises a third peptide insertion at a third site, the third site being different from the first and second sites. In some embodiments, the third site is selected from the group consisting of positions 264, 452, 498, 550, and 586. In some embodiments, the first site, the second site, and the third site are each selected from the group consisting of positions 264, 452, 498, 550, and 586. In some embodiments, the first site, the second site, and the third site are a group of sites selected from the group consisting of positions 264, 452, and 498, and positions 452, 498, and 586.

[0100] In some embodiments, the first peptide insertion and the second peptide insertion each comprise different peptide fragments. In some embodiments, the first peptide insertion or the second peptide insertion has at least one of the following characteristics: (a) reducing or substantially removing binding to a first target of the modified capsid protein; (b) conferring or enhancing binding to a second target of the modified capsid protein; (c) facilitating the purification of the AAV capsid or the AAV having the modified AAV capsid; d) destroying epitope(s) recognized by a neutralizing antibody against the AAV capsid; e) modifying the immune response compared to the unmodified counterpart; or any combination thereof. In certain embodiments, the first peptide insertion or the second peptide insertion reduces or substantially removes binding to a first target of the modified capsid protein and confers or enhances binding to a second target of the modified capsid protein.

[0101] In some embodiments, at least one peptide insertion further comprises a third peptide insertion at a third site, the third site being different from the first site and the second site.

[0102] In some embodiments, the first peptide insertion, the second peptide insertion, and the third peptide insertion each comprise a different peptide fragment.

[0103] b. Polynucleotides, expression vectors, cells, and viral vectors

[0104] In one aspect, the present disclosure provides a polynucleotide encoding a modified AAV capsid protein disclosed herein. Additionally, an expression vector comprising said polynucleotide and a cell (in vivo or cultured cell) comprising said polynucleotide and / or said expression vector of the present disclosure are provided.

[0105] In one aspect, the present disclosure provides an AAV capsid comprising a modified AAV capsid protein provided herein.

[0106] In one aspect, the present disclosure provides a viral vector comprising an AAV capsid provided herein. In a specific embodiment, the viral vector provided herein further comprises a nucleic acid comprising at least one terminal repeat sequence, said nucleic acid being encapsulated by the AAV capsid provided herein.

[0107] As used herein, "viral vector" refers to a nucleic acid vector comprising a nucleic acid having a 5' viral terminal repeat (TR) and / or a 3' viral terminal repeat sequence. A viral vector may comprise a pair of TRs or a single TR.

[0108] The terms “terminal repeat” or “TR” include any viral terminal repeat or synthetic sequence that forms a hairpin structure and mediates desired functions such as replication, viral packaging, integration, and / or proviral rescue. For example, 5’ viral terminal repeat and 3’ viral terminal repeat sequences may contain replication origins, allowing DNA synthesis initiation in one of the viral terminal repeats and proceeding to the other viral terminal repeat. Examples of viral terminal repeats include, but are not limited to, inversion terminal repeats (ITRs) (e.g., those found in adeno-associated viruses (AAVs)) and long terminal repeats (LTRs) (e.g., those found in retroviruses).

[0109] In certain embodiments, the viral vector of the present disclosure comprises at least one ITR of AAV. The ITR sequence of AAV can guide the replication and packaging of the viral vector genome. In certain embodiments, the viral vector comprises at least a portion of the AAV genome. In certain embodiments, the viral vector lacks the REP and CAP genes within the AAV genome.

[0110] AAV ITRs may be derived from any AAV, including but not limited to AAV serotype 1 (AAV 1), AAV 2, AAV 3, AAV 4, AAV 5, AAV 6, AAV 7, AAV 8, AAV 9, AAV 10, AAV 11, AAV 12, avian AAV, bovine AAV, canine AAV, equine AAV, sheep AAV, and any other AAV currently known or to be discovered later. For details, refer, for example, BERNARD NF et al., VIROLOGY, volume 2, chapter 69 (4th ed., Lippincott-Raven Publishers), and Gao et al., (2004) J. Virol. 78:6381-6388. The nucleotide sequences of the AAV ITR region are known. For example, Kotin, RM (1994) Human Gene Therapy 5:793-801; See Berns, KI "Parvoviridae and their Replication" in Fundamental Virology, 2nd Edition, (BN Fields and DM Knipe, eds.).

[0111] The AAV ITR may be a natural AAV ITR, or alternatively, it may be modified from a natural AAV ITR by, for example, mutation, deletion, or insertion, as long as the modified ITR can still mediate the desired biological function, such as replication, viral packaging, and integration. The 5' and 3' ITRs located on either side of the selected nucleotide sequence in the AAV vector do not necessarily have to be the same or derived from the same AAV serotype, as long as they function as intended, such as allowing the excision and rescue and integration of the sequence of interest from the recipient cell genome.

[0112] In some embodiments, the nucleic acid further comprises a cargo nucleic acid operably linked to at least one terminal repeat sequence. In certain embodiments, the viral vector may comprise one or more cargo nucleic acids heterogeneous to the viral genome at the 5' end of a TR or ITR, and / or at the 3' end of a TR or ITR, or between a TR or ITR. In certain embodiments, the cargo nucleic acid replaces the REP and CAP genes present in the original AAV genome.

[0113] In some embodiments, the cargo nucleic acid codes for a therapeutic protein or RNA intended to be delivered to a target or cell of interest.

[0114] The cargo nucleic acid sequence delivered in the viral vector of the present disclosure may be any heterogeneous nucleic acid sequence(s) of interest. The nucleic acid of interest includes nucleic acids encoding therapeutic (e.g., medical or veterinary use) or immunogenic (e.g., vaccine) polypeptides or functional RNAs.

[0115] Optionally, the cargo nucleic acid codes for a secretory polypeptide (e.g., a polypeptide secreted in its natural state or a polypeptide engineered to be secreted by an operable linkage with a secretory signal sequence known in the art, for example).

[0116] Alternatively, the cargo nucleic acids provided herein may code for other non-coding RNAs, such as antisense nucleic acids, ribozymes (e.g., ribozymes described in U.S. Patent No. 5,877,022), RNAs that induce splicosome-mediated splicing or Rahm-splicing, interfering RNAs (RNAi) including siRNA, shRNA, or miRNA that mediate gene silencing, and guide RNAs. Exemplary non-coding RNAs include RNAi for PCSK9 mRNA, RNAi for transthyretin mRNA, RNAi for multiple drug resistance (MDR) mRNA (e.g., cardiac administration for tumor treatment and / or prevention or to prevent damage caused by chemotherapy), RNAi for myostatin mRNA (e.g., Duchenne muscular dystrophy), RNAi for VEGF mRNA (e.g., tumor treatment and / or prevention), and RNAi for phospholamban mRNA (e.g., treatment of cardiovascular disease); There are phosphoramban inhibitory or dominant-negative molecules such as phosphoramban S16E (e.g., treatment of cardiovascular disease), RNAi against adenosine kinases (e.g., liver disease), and RNAi against pathogenic organisms and viruses (e.g., hepatitis B and / or C virus, human immunodeficiency virus, CMV, herpes simplex virus, human papillomavirus, etc.).

[0117] In some embodiments, the cargo nucleic acid provided herein may contain a nucleic acid sequence that directs gene editing. For example, the nucleic acid may code for a guide RNA. In some embodiments, the guide RNA is a single guide RNA (sgRNA) comprising a crRNA sequence and a tracrRNA sequence. In some embodiments, the cargo nucleic acid provided herein may code for a nuclease. In some embodiments, the nuclease is a zinc finger nuclease, a homing endonuclease, TALEN (transcriptional activator-like effector nuclease), NgAgo (argonaut endonuclease), SGN (structure-directed endonuclease), RGN (RNA-directed nuclease), or a variant or cleavage variant thereof. In some embodiments, the RNA-derived nuclease is Cas9 nuclease, Cas12(a) nuclease (Cpf1), Cas12b nuclease, Cas12c nuclease, TrpB-like nuclease, Cas13a nuclease (C2c2), Cas13b nuclease, or a modified or cleaved variant thereof. In some embodiments, the Cas9 nuclease is S. pyogenes ( S. pyogenes ) or Es. Aureus( S. aureus It is separated from or derived from ).

[0118] In some embodiments, the cargo nucleic acid provided herein may encode an immunogenic polypeptide useful, for example, for vaccination. The immunogenic polypeptide may be any polypeptide suitable for inducing an immune response and / or protecting a subject from infection and / or disease, said infection and / or disease includes, but is not limited to, microorganisms, bacteria, protozoa, parasites, fungi and / or viral infections and diseases. Alternatively, the immunogenic polypeptide may be any tumor or cancer cell antigen. Optionally, the tumor or cancer antigen is expressed on the surface of cancer cells. The nucleic acid may encode any immunogen of interest known in the art, including, but not limited to, immunogens from human immunodeficiency virus (HIV), HPV, primate immunodeficiency virus (SIV), influenza virus, HIV or SIV gag protein, tumor antigens, cancer antigens, bacterial antigens, viral antigens, etc.

[0119] AAV vectors can be constructed using methods known in the art. The general principles of constructing rAAV vectors are known in the art. For example, see Carter, 1992, Current Opinion in Biotechnology, 3:533-539; and Muzyczka, 1992, Curr. Top. Microbiol. Immunol., 158:97-129. For example, a Cargo nucleic acid can be inserted directly between the ITRs of an AAV genome in which the Rep gene and / or Cap gene have been deleted. Other parts of the AAV genome may also be deleted, provided that a sufficient portion of the ITR remains to allow for replication and packaging functions. Such constructs can be designed using techniques well known in the art. For example, U.S. Patents No. 5,173,414 and No. 5,139,941; International publication numbers WO 92 / 01070 (published January 23, 1992) and WO 93 / 03769 (published March 4, 1993); Lebkowski et al. (1988) Molec. Cell. Biol. 8:3988-3996; Vincent et al. (1990) Vaccines 90 (Cold Spring Harbor Laboratory Press); Carter, BJ (1992) Current Opinion in Biotechnology 3:533-539; Muzyczka, N. (1992) Current Topics in Microbiol. and Immunol. 158:97-129; Kotin, RM (1994) Human Gene Therapy 5:793-801; Shelling and Smith (1994) Gene Therapy 1:165-169; and Zhou et al. (1994) J. Exp. Med. See 179:1867-1875.Alternatively, the AAV ITR can be excised from the viral genome or from an AAV vector containing it and fused to the 5' and 3' of the cargo nucleic acid using standard ligation techniques.

[0120] In certain embodiments, the AAV viral vector of the present disclosure may also include AAV viral particles. As used herein, “viral particle” means a viral genome packaged within a viral capsid. The viral genome of the viral particle may be a viral genome that has been modified to lack some natural viral sequences or to include some sequences heterogeneous to the natural viral genome. AAV viral particles may be produced by introducing an AAV expression vector into a suitable host cell using known techniques, such as transfection, along with other necessary mechanisms, such as a plasmid encoding an AAV cap / rep gene and a helper gene provided by an adeno or herpes virus (see, e.g., MF Naso et al., BioDrugs, 31(4): 317-334 (2017), the entire contents of which are incorporated by reference). The AAV expression vector may be expressed in a host cell and packaged into a viral particle.

[0121] The cargo nucleic acid may further comprise one or more regulatory sequences operably linked to the nucleic acid encoding a therapeutic protein or RNA. As used herein, the term “operably linked” means that the coding sequence is directly or indirectly linked or associated with one or more regulatory sequences of the exogenous nucleic acid in such a way that the coding sequence allows the expression of the protein of interest from the coding sequence in the cell. The coding sequence associated with the regulatory sequence may be referred to herein as an expression cassette. In certain embodiments, the exogenous nucleic acid may be in the form of an expression vector. Examples of transcriptional regulatory elements include one or more promoters and / or enhancers, and optionally one or more introns inserted between the exons of the polyadenylation sequence and / or protein-coding sequence.

[0122] As used herein, the term “regulatory sequence” refers to any nucleotide sequence that is necessary or advantageous for the expression of a coding sequence. A regulatory sequence may include, but is not limited to, one or more promoters, enhancers, transcription termination sequences, polyadenylation sequences, internal ribosome entry sites, and / or one or more introns inserted between exons of a protein coding sequence.

[0123] c. Method for manufacturing a virus vector

[0124] The present disclosure further provides a method for manufacturing a virus vector as provided in the present specification.

[0125] In one embodiment, the present disclosure provides a method for preparing a viral vector, the method comprising the step of providing a cell with: (a) a nucleic acid comprising at least one TR sequence (e.g., an AAV TR sequence), and (b) an AAV sequence sufficient for replication of the nucleic acid template and encapsulation into the AAV capsid of the present disclosure (e.g., an AAV rep sequence and an AAV cap sequence encoding the AAV capsid of the present disclosure). Optionally, the nucleic acid further comprises at least one cargo nucleic acid. In a specific embodiment, the nucleic acid comprises two AAV ITR sequences, which are located at the 5' and 3' of the cargo nucleic acid (if present), but do not necessarily have to be directly adjacent thereto.

[0126] The nucleic acid and AAV rep and cap sequences are provided under conditions in which a viral vector containing nucleic acid packaged within an AAV capsid is produced in a cell. The method may further include the step of collecting the viral vector from the cell. The viral vector may be collected from a medium and / or by lysing the cell.

[0127] In one embodiment, the present disclosure provides a method for preparing a viral vector provided herein having a controlled binding affinity for a target or cell of interest, the method comprising: a) introducing at least one peptide insert provided herein into an AAV capsid protein at one or more sites disclosed herein; b) detecting the binding of the mutated AAV capsid protein to a target or cell of interest; and c) selecting a modified AAV capsid protein having a desired binding affinity for a target or cell of interest in comparison to a non-mutated corresponding AAV capsid protein.

[0128] In some embodiments, the method further comprises the steps of d) testing whether at least one peptide insertion is presented on the surface of the modified AAV capsid protein, and / or e) testing whether at least one peptide insertion on the modified AAV capsid can be recognized and captured by its binding partner (e.g., an antibody that specifically binds to the peptide, or a target receptor that specifically binds to the peptide).

[0129] In some embodiments, the method further comprises the step of f) testing the viral production of an AAV virus containing a modified AAV capsid protein.

[0130] This comprehensive approach presents a platform technology applicable to modifying arbitrary AAV capsids. The application of this platform technology generates AAV antigenic variants derived from the original AAV capsid template without loss of transduction efficiency.

[0131] III. Method for delivering cargo nucleic acids to cells and targets

[0132] The viral vector of the present disclosure is useful for delivering nucleic acids to target cells in vitro, in vitro, and in vivo. In particular, the viral vector can be advantageously used to deliver or transfer nucleic acids to animal cells, including mammalian cells. Accordingly, in some embodiments, the nucleic acid ("cargo nucleic acid") may be encapsulated by the modified capsid protein of the present disclosure.

[0133] Generally, the viral vector of the present disclosure may be used to deliver a cargo nucleic acid encoding a polypeptide or functional RNA to treat and / or prevent any disease condition where delivering the therapeutic polypeptide or functional RNA is beneficial. In some embodiments, the viral vector of the present disclosure may be used to deliver a cargo nucleic acid encoding a polypeptide or functional RNA to treat and / or prevent liver disease or disorder.

[0134] A viral vector according to the present disclosure provides a means for delivering a cargo nucleic acid to a wide range of target cells, including dividing and non-dividing cells. The viral vector may be used, for example, to produce a polypeptide in vitro or to deliver a nucleic acid of interest to cells in vitro for in vitro gene therapy. The viral vector is also useful in a method for delivering nucleic acids to a subject who requires them to express, for example, an immunogenic or therapeutic polypeptide or functional RNA. In this manner, the polypeptide or functional RNA may be produced in vivo in the subject. The subject may require the polypeptide because it has a polypeptide deficiency. Furthermore, the above method may be carried out because the production of the polypeptide or functional RNA in the subject may confer some beneficial effects.

[0135] As used in the broadest sense herein, the terms “administer,” “administering,” or “administer” refer to providing or distributing a pharmaceutically active substance to a subject in a pharmaceutically compatible manner. The term is intended to include “causing to be administered,” which means inducing, urging, encouraging, supporting, inducing, or directing another party, directly or indirectly, to administer the pharmaceutically active substance to a subject. In certain embodiments, the term may be used interchangeably with “delivery,” “delivery,” “delivering,” or similar terms.

[0136] Exemplary modes of administration include oral, rectal, transmucosal, intranasal, inhalation (e.g., via aerosol), oral (e.g., sublingual), vaginal, intrathecal, intraocular, percutaneous, intrauterine (or ovarian), parenteral (e.g., intravenous, subcutaneous, intradermal, intramuscular (including administration to skeletal muscle, diaphragm, and / or cardiac muscle), intradermal, intrapleural, intracerebral, and intra-articular), local (e.g., both skin and mucosal surfaces including airway surfaces, and transdermal administration), intralymphatic, etc., and direct tissue or tracheal injection (e.g., to the liver, skeletal muscle, cardiac muscle, diaphragm muscle, or brain). Administration may also be performed on tumors (e.g., within or near the tumor, or in lymph nodes). The most suitable route in a specific case depends on the nature and severity of the condition being treated and / or prevented, and the nature of the specific vector used.

[0137] The dose of viral vector and / or capsid to be administered to a subject depends on the mode of administration, the disease or condition to be treated and / or prevented, the individual subject's condition, the specific viral vector or capsid, the nucleic acid to be delivered, etc., and may be determined in a routine manner. An exemplary dose to achieve a therapeutic effect is at least about 10 5 , 10 6 , 10 7 , 10 8 , 10 9 , 10 10 , 10 11 , 10 12 , 10 13 , 10 14 , 10 15 It is the titer of the transduction unit, and optionally about 10 8 -10 13 It is the titer of the transduction unit.

[0138] In certain embodiments, two or more administrations (e.g., 2, 3, 4 or more administrations) may be used to achieve a desired level of gene expression over various intervals, e.g., daily, weekly, monthly, yearly, etc.).

[0139] As used herein, the term “subject” includes human and non-human animals. Non-human animals include all vertebrates, including mammals and non-mammals, such as non-human primates, mice, rats, cats, rabbits, sheep, dogs, cattle, chickens, amphibians, and reptiles. Unless otherwise noted, the terms “patient” and “subject” are used interchangeably herein. In certain embodiments, the subject is human. In some embodiments, the subject is a non-human primate.

[0140] IV. Pharmaceutical composition

[0141] In an additional aspect, a pharmaceutical composition comprising the virus vector and / or capsid and / or capsid protein of the present disclosure together with a pharmaceutically acceptable carrier and optionally other medicinal substances, pharmaceutical substances, stabilizers, buffers, carriers, adjuvants, diluents, etc. is provided.

[0142] As used in the broadest sense herein, the term “pharmaceutical composition” refers to a formulation comprising a therapeutically effective amount of a pharmaceutically active ingredient and, optionally, pharmaceutically acceptable excipients and / or carriers, etc. As used herein, the term “pharmaceutically acceptable” means suitable for normal pharmaceutical application, that is, not causing serious side effects such as adverse reactions in subjects. As used herein, the terms “therapeutically effective amount” or “effective amount” refer to a dose sufficient to make the treatment of a patient effective compared to no treatment. As used herein, “effective amount” refers to an amount that produces a desired effect, for example, an amount capable of treating or improving a disease or condition, or an amount capable of achieving an intended therapeutic effect (e.g., induction of immune tolerance).

[0143] A pharmaceutically active ingredient generally requires one or more pharmaceutically acceptable carriers or excipients to take on an appropriate form (i.e., pharmaceutical composition) and formulation for effective administration to a subject. As used herein, the term “pharmaceutically acceptable carrier” refers to a carrier or diluent that does not cause significant irritation to the organism and does not abolish the biological activity and properties of the administered pharmaceutically active substance. As used herein, the term “pharmaceutically acceptable excipient” refers to an inert substance added to a pharmaceutical composition to further facilitate the administration of the pharmaceutically active ingredient.

[0144] In this specification, pharmaceutical compositions suitable for use include sterile aqueous solutions or dispersions, and sterile powders for the immediate preparation of sterile injectable solutions or dispersions. In all cases, the composition must be sterile and stable under manufacturing and storage conditions and must be preserved from the action of contamination by microorganisms such as bacteria and fungi.

[0145] Pharmaceutically acceptable carriers may be solvents or dispersion media comprising, for example, water, ethanol, polyols (e.g., glycerol, propylene glycol, and liquid polyethylene glycol, etc.), and suitable mixtures thereof. For intravenous administration, suitable carriers may include, for example, physiological saline, bacteriostatic water, or phosphate-buffered saline (PBS). Suitable fluidity may be maintained by the use of a coating, for example, lecithin; in the case of dispersion, by maintaining the required particle size and by using surfactants. Prevention of microbial action may be achieved by various antimicrobial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, etc. In many cases, it is desirable to include isotonic agents in the composition, for example, sugars, polyhydric alcohols such as mannitol and sorbitol, and sodium chloride. Prolongation of absorption of the composition for in vivo administration may be achieved by including substances that delay absorption, for example, aluminum monostearate and gelatin, in the composition.

[0146] Pharmaceutical compositions may include, but are not limited to, solutions, emulsions, and liposome-containing formulations. Such compositions may be produced from various components including, but are not limited to, pre-formed liquids, self-emulsifying solids, and self-emulsifying semi-solids.

[0147] In some embodiments, the pharmaceutical compositions provided herein comprise a therapeutically effective amount of virion mixed with pharmaceutically acceptable carriers and / or excipients, e.g., saline solution, phosphate-buffered saline solution, phosphate, and amino acids, polymers, polyols, sugars, buffers, preservatives, and other proteins. Exemplary amino acids, polymers, and sugars, etc., include octylphenoxypolyethoxyethanol compounds, polyethylene glycol monostearate compounds, polyoxyethylene sorbitan fatty acid esters, sucrose, fructose, glucose, maltose, glucose, mannitol, dextran, sorbitol, inositol, galactitol, xylitol, lactose, trehalose, bovine or human serum albumin, citrate, acetate, Ringer's solution and Hanks' solution, cysteine, arginine, carnitine, alanine, glycine, lysine, valine, leucine, polyvinylpyrrolidone, polyethylene, and glycol. In certain embodiments, this formulation is stable for at least 6 months at 4°C.

[0148] In some cases, the unit dose of the pharmaceutical composition of the present disclosure may be measured in pfu (plaque-forming units). In some cases, the pfu of a unit dose of the pharmaceutical composition of the present disclosure containing modified AAV is 1 × 10⁻⁶ 8 1 to 10 14 It could be pfu.

[0149] The compositions provided herein include inorganic or organic buffers (e.g., sodium or potassium salts of phosphates, carbonates, acetates, or citrates) and pH regulators (e.g., hydrochloric acid, sodium or potassium hydroxide, salts of citrates or acetates, amino acids and salts thereof), antioxidants (e.g., ascorbic acid, alpha-tocopherol), surfactants (e.g., polysorbate 20, polysorbate 80, polyoxyethylene 9-10 nonylphenol, sodium deoxycholate), solution and / or freeze / freeze-drying stabilizers (e.g., sucrose, lactose, mannitol, trehalose), osmotic pressure regulators (e.g., salts or sugars), antimicrobial agents (e.g., benzoic acid, phenol, gentamicin), antifoaming agents (e.g., polydimethylsiloxane), preservatives (e.g., thimerosal, 2-phenoxyethanol, EDTA), polymer stabilizers and viscosity modifiers (e.g., polyvinylpyrrolidone, It may include poloxamer 488, carboxymethylcellulose, and a cosolvent (e.g., glycerol, polyethylene glycol, ethanol).

[0150] The composition according to the present invention may include pharmaceutically acceptable excipients. The composition may be prepared using conventional pharmaceutical manufacturing and dispensing techniques to obtain a useful formulation. Techniques suitable for use in the practice of the present invention can be found in *Handbook of Industrial Mixing: Science and Practice*, Edited by Edward L. Paul, Victor A. Atiemo-Obeng, and Suzanne M. Kresta, 2004, John Wiley & Sons, Inc.; and *Pharmaceutics: The Science of Dosage Form Design*, 2nd Ed., Edited by ME Auten, 2001, Churchill Livingstone. In one embodiment, the composition is in the form of an injectable sterile saline solution with a preservative.

[0151] In the following, one embodiment is provided as a specific embodiment of the method and kit provided in the present disclosure. It should be noted that this embodiment is provided for illustrative purposes only and does not limit the scope of the present disclosure.

[0152] Example 1. Plasmid Construction

[0153] Plasmid construction

[0154] Plasmids containing coding sequences for AAV2 ITR and AAV2 Rep proteins and AAV9 capsid VP1 protein were synthesized by Azenta (Azenta Life Sciences, Burlington, USA). DNA fragments coding for Strep-Tag II (TGGAGCCACCCCCAGTTCGAGAAG), c-Myc Tag (GCTGCTGAGCAGAAGCTGATCAGCGAAGAGGACCTGGCTGCT) and HA Tag (GCTGCCTACCCCTACGACGTGCCTGATTACGCC) were PCR amplified and inserted into different regions of the AAV9 VP1 protein (as presented in Table 1 below) using Golden Gate cloning.

[0155] Virus production and purification

[0156] Adherent HEK 293T cells were cultured in 15 cm plates using Dulbecco's Modified Eagle's Medium (Gibco, ThermoFisher Scientific) containing 10% fetal bovine serum (Cellmax, Beijing, China) supplemented with 2 mmol / l GlutaMAX (Gibco, ThermoFisher Scientific). AAV viruses were produced by triple transfection of polyethyleneimine Max (PEI Max)-mediated 293T cells.

[0157] At harvest, culture medium was collected and purified by deep filtration through a 0.04–0.6 micron Cobetter polypropylene membrane (Hangzhou Cobetter Filtration Equipment LLC, Hangzhou, China). Cell lysates were centrifuged to remove debris, treated with benzonase, loaded onto a G25 size exclusion chromatograph, and subsequently purified using a Cytiva Capto Core 400 column. Fractions containing AAV were pooled and concentrated using a Sartorius Vivaspin Turbo 15 centrifuge (Sartorius Stedim Biotech GmbH, Goettingen, Germany).

[0158] Viral titers were measured using qPCR with the Applied Biosystems QuantStudio 5 real-time PCR system or ddPCR with the Bio-Rad QX200 AutoDG droplet digital PCR system.

[0159] Measurement of intermolecular bond dynamics

[0160] Intermolecular binding kinetics were analyzed using the GatorPrime Biolayer Interferometer System (Gator Bio, Palo Alto, California, USA), a label-free analytical instrument based on biolayer interferometer technology. Antibodies were purchased from the following commercial suppliers: Sino Biological's anti-c-Myc monoclonal antibody (Cat# 100029-MM07), Biodragon's anti-HA tag antibody (Cat# B1003), and Novus Biologicals' anti-Strep-tag II antibody (Cat# NBP2-43719). The antibodies were loaded into the instrument via an anti-mouse IgG Fc probe (Gator Bio, Cat# 20-5046). Novel AAV samples were analyzed with a wild-type AAV9 control and / or a Q-buffered control containing only substances that reduce background signals of the crude samples and non-specific binding.

[0161] Pull-down analysis

[0162] For the pull-down analysis using Strep-Tag II, 1E9 Vg AAV virus was resuspended in 200 μl of binding buffer (10 mM Tris-HCl, 150 mM NaCl, 1 mM EDTA, 0.1% PF-68, pH 8.0) and mixed well with 20 μl of magnetic beads from the BeaverBeads Magrose Strep-Tactin KIT (Cat# 70808-K10, BEAVER biomedical, Suzhou, China). After washing the beads twice with 500 μl of binding buffer, the AAV bound to the beads was eluted twice with binding buffer supplemented with 2.5 mM D-Destiobiotin (MedChemExpress, Monmouth Junction, New Jersey, USA) and once with binding buffer supplemented with 12.5 mM D-Destiobiotin. In the final step, the beads were incubated with a binding buffer supplemented with 12.5 mM D-destiobiotin for 30 minutes to recover tightly bound AAV viruses.

[0163] For the pull-down analysis using the c-Myc tag, 1E9 Vg AAV virus was resuspended in 200 μl of binding buffer (10 mM Tris-HCl, 150 mM NaCl, 1 mM EDTA, 0.1% PF-68, pH 8.0) and thoroughly mixed with 10 μl of Pierce anti-c-Myc magnetic beads (Cat# 88842, Thermo Scientific). After washing the beads with 500 μl binding buffer, the AAV bound to the beads was eluted once with 100 μl binding buffer supplemented with 0.5 mg / ml c-Myc peptide (Cat# P9805-25 mg, Beyotime Biotechnology, Shanghai, China), once with 100 μl binding buffer supplemented with 2.5 mg / ml c-Myc peptide, and once with 100 μl binding buffer supplemented with 5 mg / ml c-Myc peptide. In the final step, the beads were treated with Proteinase K (Roche) to remove the protein, and the remaining AAV DNA was recovered.

[0164] result

[0165] Simultaneous peptide insertion at two different sites of the VP capsid protein was first tested using Strep-tag II and c-Myc tags with the following site combinations (Table 1):

[0166]

[0167] annotation: a Site numbers indicate amino acid positions according to the VP1 numbering of AAV9. Based on protein sequence alignment, sites 264, 452, 498, 550, and 586 of AAV9 VP1 correspond to sites 262, 450, 497, 549, and 585 of AAV2 VP1 numbering, respectively.

[0168] AAVs with modified capsids DM1, DM2, DM3, DM4, DM5, DM6, DM8, DM9, DM10, and DM11 were produced in parallel with wild-type AAV9 capsids using a triple plasmid transfection system. Viral levels were accurately measured by ddPCR. As shown in Figure 1, capsids DM3, DM5, DM6, or DM10 yielded less than 10% of normal AAV production compared to wild-type AAV9, indicating that the co-insertion of Strep-tag II and c-Myc tags in site combinations #3, #5, #6, or #10 may interfere with AAV9 production. On the other hand, in site combinations 1, 2, 4, 8, 9, and 11, the co-insertion of these two tags had a much milder effect on viral production, yielding more than 50% of normal AAV9 production.

[0169] Next, mutant AAVs with modified capsids DM1, DM2, DM4, DM8, DM9, and DM11 were purified, and their ability to bind to the corresponding antibodies for each tag was tested in a Gator system. All mutant AAVs could be loaded with anti-Strep-tag antibodies, suggesting that the Strep tags of these mutant AAVs were well presented on the surface of the viral particles. Next, the loaded AAVs were tested for binding activity to two anti-c-Myc antibodies. The results are summarized in Figures 2a and 2b. Compared to wild-type AAV9 (sample P8), all mutant AAVs exhibited strong binding activity to the anti-Myc-tag antibodies. These results indicate that both Strep-tag II and the c-Myc tag were well presented on the surface of the viral particles in all five selected mutant AAVs with double insertions.

[0170] These results were further confirmed by pull-down analysis using antibody-bound magnetic beads. As shown in Figure 3, all mutant AAVs were able to bind to Strep-Tactin magnetic beads, with the DM4 mutant exhibiting the strongest binding activity. Additionally, all mutant AAVs bound very well to anti-c-Myc magnetic beads (Figure 4). For comparison, in a control experiment using wild-type AAV9, no type of magnetic bead was able to bind to AAV9.

[0171] Example 2

[0172] To further explore the simultaneous insertion of three peptides, HA tags were introduced to two different site combinations as shown in the table below (Table 2).

[0173]

[0174] annotation: a Site numbers indicate amino acid positions according to the VP1 numbering of AAV9. Based on protein sequence alignment, sites 264, 452, 498, and 586 of AAV9 VP1 correspond to sites 262, 450, 497, and 585 of the AAV2 VP1 numbering, respectively.

[0175] Both mutant HA1 and HA2 AAVs were produced in parallel with wild-type AAV9. As shown in Figure 5, viral production was only slightly impaired by the simultaneous insertion of Strep-tag II, c-Myc, and HA tag at three different locations.

[0176] Finally, these two mutant AAVs with three peptide insertions were purified, and their binding kinetics to the corresponding antibodies for each tag were tested in the GatorPrime system. Both mutant AAVs were efficiently loaded via an anti-Strep-tag antibody, and subsequently, their ability to bind to an anti-c-Myc antibody or an anti-HA tag antibody was tested. As shown in Figures 6a, 6b, and 6c, wild-type AAV9 or mock controls in Q buffer alone hardly bound to any of the anti-Strep tag antibody, anti-c-Myc antibody, or anti-HA tag antibody. In contrast, both HA1 and HA2 mutant AAVs exhibited strong binding to the anti-Strep tag antibody (Figure 6a), anti-c-Myc antibody (Figure 6b), and anti-HA tag antibody (Figure 6c). These results indicate that these three tags are well presented on the surface of the virus particle and provide proof of concept that the sites used to introduce these tags can be simultaneously used for peptide insertion with minimal interference with peptide presentation and only a minor effect on virus production.

[0177] Sites 452, 498, and 586 are all located in one of the structurally flexible variable regions that allow for specific amino acid changes. Insertion at adjacent sites was tested to explore the possibility of achieving comparable or equivalent effects at these adjacent sites. Strep-II tags were inserted individually into these sites, production yields were measured by qPCR, and the binding activity of mutant AAVs to anti-Strep-tag antibodies was evaluated using the GatorPrime system in parallel with wild-type AAV9 as a control. The results are summarized in the following table (Table 3).

[0178]

[0179] annotation: a The site number indicates the amino acid position according to the VP1 numbering of AAV9.

[0180] b - indicates no bonding at all, and ++++, +++, ++ and + indicate very strong bonding, strong bonding, weak bonding, and very weak bonding, respectively.

[0181] Based on these results, it is proposed that the functionally equivalent region of region 586 includes regions 587, 588, and 589; the functionally equivalent region of region 452 includes regions 453, 454, 455, and 456; and the functionally equivalent region of region 498 includes regions 492 and 493.

Claims

Claim 1 A modified adeno-associated virus (AAV) capsid protein comprising at least one peptide insertion at one or more sites selected from the group consisting of sites 264, 452, 498, 550 and 586 or any functionally equivalent site thereof, wherein the numbering corresponds to the wild-type AAV9 VP1 protein (SEQ No. 1). Claim 2 The modified AAV capsid protein according to claim 1, wherein the peptide insertion comprises up to 15, 20, 25, 30, 35, 40, 45, or 50 amino acid residues. Claim 3 A modified AAV capsid protein according to claim 1 or 2, wherein the length of the peptide insertion is 2 to 40, 2 to 30, 2 to 20, 2 to 19, 2 to 18, 2 to 17, 2 to 16, 2 to 15, or 2 to 14 amino acid residues. Claim 4 A modified AAV capsid protein according to any one of claims 1 to 3, wherein the peptide insertion alters the binding of the modified AAV capsid protein to a target compared with the non-modified counterpart. Claim 5 In paragraph 4, the target is a modified AAV capsid protein, which is a receptor expressed in the cell of interest. Claim 6 In paragraph 5, the cell of interest is a modified AAV capsid protein that is the natural host of AAV. Claim 7 In paragraph 6, the modified AAV capsid protein, wherein the peptide insertion reduces or substantially eliminates the binding of the modified AAV capsid protein to a target compared to the non-modified counterpart. Claim 8 In paragraph 5, the cell of interest is a modified AAV capsid protein, not a natural host of AAV. Claim 9 In paragraph 8, the modified AAV capsid protein, wherein the peptide insertion confers or enhances binding of the modified AAV capsid protein to a target or cell of interest compared to the non-modified counterpart. Claim 10 A modified AAV capsid protein according to any one of claims 1 to 9, wherein the modified AAV capsid protein does not substantially reduce the production of AAV containing the modified AAV capsid protein compared to its non-modified counterpart. Claim 11 A modified AAV capsid protein according to any one of claims 1 to 10, wherein at least one peptide insertion comprises a first peptide insertion at a first site selected from the group consisting of positions 264, 452, 498, 550, and 586. Claim 12 In claim 11, at least one peptide insertion further comprises a second peptide insertion at a second site, wherein the second site is a modified AAV capsid protein different from the first site. Claim 13 In claim 12, the first site and the second site are a modified AAV capsid protein selected from the group consisting of positions 264, 452, 498, 550 and 586, respectively. Claim 14 A modified AAV capsid protein according to any one of claims 11 to 13, wherein the first site is selected from the group consisting of positions 264, 452, 498 and 586. Claim 15 A modified AAV capsid protein according to any one of claims 12 to 14, wherein the second site is selected from the group consisting of positions 264, 452, and 498. Claim 16 A modified AAV capsid protein, wherein the first site and the second site are located in a pair of sites selected from the group consisting of a) sites 264 and 452; b) sites 264 and 498; c) sites 452 and 498; d) sites 586 and 452; e) sites 586 and 498; and f) sites 586 and 264. Claim 17 In any one of claims 12 to 16, at least one peptide insertion further comprises a third peptide insertion at a third site, wherein the third site is different from the first site and the second site, a modified AAV capsid protein. Claim 18 In claim 17, the third site is a modified AAV capsid protein selected from the group consisting of positions 264, 452, 498, 550 and 586. Claim 19 A modified AAV capsid protein, wherein the first site, the second site, and the third site are each selected from the group consisting of positions 264, 452, 498, 550, and 586. Claim 20 A modified AAV capsid protein according to any one of claims 17 to 19, wherein the first site, the second site, and the third site are a group of sites selected from the group consisting of a) sites 264, 452, and 498, and b) sites 452, 498, and 586. Claim 21 A modified AAV capsid protein according to any one of claims 12 to 16, wherein the first peptide insertion and the second peptide insertion each comprise different peptide fragments, optionally the first peptide insertion reduces or substantially removes binding to a first target of the modified capsid protein, and the second peptide insertion confers or enhances binding to a second target of the modified capsid protein. Claim 22 A modified AAV capsid protein according to any one of claims 1 to 21, wherein the functionally equivalent region of position 452 comprises regions 453, 454, 455, and 456, the functionally equivalent region of position 498 comprises regions 492 and 493, and / or the functionally equivalent region of position 586 comprises regions 587, 588, and 589. Claim 23 A modified AAV capsid protein according to any one of claims 17 to 20, wherein the first peptide insertion, the second peptide insertion, and the third peptide insertion each comprise different peptide fragments. Claim 24 A modified AAV capsid protein according to any one of claims 1 to 23, wherein the peptide insertion comprises an amino acid sequence selected from the group consisting of SEQ ID NOs 2-4. Claim 25 A modified AAV capsid protein according to any one of claims 1 to 24, wherein the peptide acid insertion is inserted additionally to or in place of the wild-type protein. Claim 26 제1항 수제 제25학 중 자이 한 한로다다, AAV 구시드 레레은 AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV12, AAV843, AAVbb2, AAVcyS, AAVrh10, AAVrh20, AAVrh39, AAVrh43, AAVrh64, AAVhu37, AAV3B, AAVhu48, AAVhu43, AAVhu44, AAVhu46, AAVhu19, AAVhu20, AAVhu23, AAVhu22, AAVhu24, AAVhu21, AAVhu27, AAVhu28, AAVhu29, AAVhu63, AAVhu64, AAVhu13, AAVhu56, AAVhu57, AAVhu49, AAVhu58, AAVhu34, AAVhu45, AAVhu47, AAVhu51, AAVhu52, AAVhu T41, AAVhu S17, AAVhu T88, AAVhu T71, AAVhu T70, AAVhu T40, AAVhu T32, AAVhu T17, AAVhu LG15, AAVhu9, AAVhu10, AAVhu11, AAVhu53, AAVhu55, AAVhu54, AAVhu7, AAVhu18, AAVhu15, AAVhu16, AAVhu25, AAVhu60, AAVch5, AAVhu3, AAVhu1, AAVhu4, AAVhu2, AAVhu61, AAVrh62, AAVrh48, AAVrh54, AAVrh55, AAVcy2, AAVrh35, AAVrh37, AAVrh36, AAVcy6, AAVcy4, AAVcy3, AAVcy5, AAVrh13, AAVrh38, AAVhu66, AAVhu42, AAVhu67, AAVhu40, AAVhu41, AAVrh40, AAVrh2, AAVbb1, AAVhu17, AAVhu6, AAVrh25, AAVpi2, AAVpi3, AAVrh57, AAVrh50, AAVrh49, AAVhu39, AAVrh58, AAVrh61, AAVrh52, AAVrh53, AAVrh51, AAVhu14, AAVhu31,Modified AAV capsid protein of an AAV serotype selected from AAVhu32, AAVrh34, AAVrh33, AAVrh32, avian AAV ATCC VR-865, avian AAV strain DA-1, or bovine AAV. Claim 27 A modified AAV capsid protein according to any one of claims 1 to 26, wherein the AAV capsid protein comprises the amino acid sequence of SEQ ID NOs. 1 and 5-16, excluding at least one peptide insertion at one or more sites. Claim 28 A polynucleotide encoding a modified AAV capsid protein according to any one of claims 1 to 27. Claim 29 An expression vector comprising the polynucleotide of claim 28. Claim 30 A cell comprising the polynucleotide of claim 28 or the expression vector of claim 29. Claim 31 An AAV capsid comprising a modified AAV capsid protein of any one of claims 1 to 27. Claim 32 An AAV virus vector comprising the AAV capsid of claim 31. Claim 33 In paragraph 32, an AAV virus vector further comprising a nucleic acid comprising at least one terminal repeat sequence, wherein the nucleic acid is encapsulated by an AAV capsid. Claim 34 In paragraph 33, the nucleic acid further comprises a cargo nucleic acid operably linked to at least one terminal repeat sequence, an AAV virus vector. Claim 35 In paragraph 34, the cargo nucleic acid is an AAV virus vector encoding a therapeutic protein or RNA. Claim 36 A pharmaceutical composition comprising an AAV virus vector of any one of claims 32 to 35 and a pharmaceutically acceptable carrier. Claim 37 A method for delivering cargo nucleic acid to a cell, comprising the step of contacting the cell with the AAV virus vector of claim 34 or 35 under conditions. Claim 38 A method for delivering a cargo nucleic acid to a subject, comprising the step of administering an effective amount of the AAV virus vector of claim 34 or 35 or the pharmaceutical composition of claim 36 to the subject. Claim 39 A method for treating a subject in need of treatment, comprising the step of administering to the subject a therapeutically effective amount of the AAV virus vector of claim 34 or 35 or the pharmaceutical composition of claim 36. Claim 40 A method for producing an AAV vector that does not substantially affect viral production, comprising: a) generating a library of modified AAV vectors by inserting short peptides at various locations of the VP1 protein; b) determining viral production; and c) identifying a modified AAV vector in which viral production is substantially maintained.

Images