Allele-specific knockdown of gene expression

Abstract

A method for suppressing a mutation-containing allele in a cell (e.g., a method for treating a subject using a mutation-containing allele) is described herein. The method comprises the step of delivering to the cell an antisense oligonucleotide that targets a variant allele that is cis-related to the mutation (e.g., the mutation is a gain-of-function mutation or a dominant-negative mutation), wherein the cell or subject is heterozygous with respect to the target variant, and the antisense molecule is effective in knocking down the expression of the target variant allele (e.g., effective in preventing, treating, or alleviating at least one symptom associated with the mutation). Additionally, a method for analyzing the haploid type of the antisense oligonucleotide targeting the cell or subject, and the mutant superoxide dismutase 1 (SOD1) and other genes is described herein.

Description

Technology Field

[0001] Cross-reference regarding related applications

[0002] This application claims priority to U.S. Provisional Patent Application No. 63 / 618,571, filed January 8, 2024, titled ALLELE-SPECIFIC KNOCKDOWN OF GENE EXPRESSION, the entirety of which is incorporated herein by reference for all purposes.

[0003] Integration by reference

[0004] The present application comprises a sequence listing submitted electronically in XML format, the entire contents of which are incorporated herein by reference. Pursuant to 37 CFR 1.52(e), the entire contents of the sequence information contained in the electronic file named "UM30009PCT Sequence Listing.xml", created on January 7, 2025 and having a size of 152,076 bytes, are incorporated herein by reference.

[0005] U.S. Provisional Patent Application No. 63 / 396,545 filed on August 9, 2022, and International Patent Application PCT / US2023 / 071895 filed on August 9, 2023 are incorporated herein by reference in their entirety for all purposes.

[0006] Statements regarding federal government-sponsored research or development

[0007] This invention was made possible with government support under Project R21NS139270 awarded by the National Institutes of Health. The government holds certain rights to this invention. Background Technology

[0008] In the case of dominant hereditary diseases, there are three major pathogenic mechanisms of gene mutations: (1) Toxic Gain of Function (GoF), in which a gene mutation confers new harmful properties, such as protein aggregation, mislocalization, or RNA foci, on the resulting protein or ribonucleic acid (RNA); (2) Dominant Negative (DN), in which the mutant protein acts to inactivate the remaining wild-type allele (often observed for homomerizing proteins); and (3) Loss of Function (LoF) / Haploinsufficiency, in which the mutation reduces the total active protein to half a level insufficient to maintain corresponding cellular function.

[0009] For the successful development of gene-based therapies, it is essential to elucidate the mechanisms by which gene mutations contribute to pathogenesis. For example, in the case of haploid insufficiency, therapies focus on increasing gene expression, if possible, through viral gene delivery. The development of gene-based therapies for dominant disorders based on gain-of-function or dominant-negative mechanisms is more complex. In the case of gain-of-function mutations, existing research has primarily focused on knocking down gene expression through the use of RNA interference (RNAi), such as small interfering RNA (siRNA) and antisense oligonucleotides (ASO). Currently, almost all studies utilize RNAi targeting both mutant and wild-type alleles. However, in many cases, reducing a single wild-type allele can lead to adverse consequences. In the case of dominant-negative disorders, knocking down both mutant and wild-type alleles does not lead to successful outcomes because it fails to alter the mutant-to-wild-type protein ratio.

[0010] One way to overcome these limitations is to develop RNAi specific to particular mutations. However, developing RNAi capable of distinguishing single base pairs is technically very difficult. This is partly due to the ability of oligonucleotides to form "bubbles" across single base pair mismatches. Furthermore, this necessitates unique mutant-specific RNAi for every causative mutation observed within a gene. For example, more than 69 distinct mutations have been identified in the TAR DNA-binding protein (TARDBP) gene, and based on current methodologies, unique RNAi would need to be developed for each of these 69 distinct mutations. Additionally, repeat expansions may not be suitable for direct targeting due to their extensive secondary structures and complex sequences.

[0011] Accordingly, there is a need to develop mutant-specific RNAi for the therapeutic treatment of diseases caused by dominant mutations possessing gain-of-function or dominant-negative pathogenicity mechanisms.

[0012] One aspect of the present disclosure provides a method for suppressing an allele containing a mutation in a cell, the method comprising: delivering to the cell an antisense oligonucleotide (ASO) (e.g., an allele-specific antisense oligonucleotide (asASO)) that targets a target variant allele (e.g., an allele of a variant or common variant, and / or an indel such as an insertion or deletion of one or more bases) that is cis-related to the mutation (e.g., the mutation is a gain-of-function mutation or a dominant-negative mutation), wherein the cell (e.g., a target) is heterozygous for the target variant allele, and the antisense oligonucleotide is effective for suppressing or knocking down the allele (e.g., a reduction in the expression of the allele).

[0013] In any mode or embodiment described herein, the cell is an in vitro cell.

[0014] In any mode or embodiment described herein, the cell is a cell within the object.

[0015] In any mode or embodiment described herein, the cell is a human cell (e.g., a cell of the human central nervous system).

[0016] In any aspect or embodiment described herein, the mutation is present in superoxide dismutase 1 (SOD1) or chromosome 9 open decoding frame 72 (C9Orf72), and the cell is derived from (i) a subject having at least one of at least one of amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), or a combination thereof, or (ii) a subject having or suspected of having at least one of amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), or a combination thereof.

[0017] In any aspect or embodiment described herein, the mutation is present in superoxide dismutase 1 (SOD1) or chromosome 9 open decoding frame 72 (C9Orf72), and the method is a method for inhibiting the expression of the superoxide dismutase 1 (SOD1) gene mutation or the chromosome 9 open decoding frame 72 (C9Orf72) gene mutation.

[0018] In any aspect or embodiment described herein, the mutation is present in superoxide dismutase 1 (SOD1), and the method is a method for inhibiting the expression of the superoxide dismutase 1 (SOD1) gene mutation.

[0019] In any mode or embodiment described herein, the mutation is present in chromosome 9 open decoding frame 72 (C9Orf72), and the method is a method for suppressing the expression of the chromosome 9 open decoding frame 72 (C9Orf72) gene mutation.

[0020] In any mode or embodiment described herein, the mutation is present in kinesin family member 5A (KIF5A), and the cell is derived from (i) a subject having at least one of at least one of the symptoms of amyotrophic lateral sclerosis, neonatal intractable myoclonus (NEIMY), hereditary spastic paraplegia 10 (SPG10), or a combination thereof, or (ii) a subject having or suspected of having at least one of amyotrophic lateral sclerosis, neonatal intractable myoclonus (NEIMY), hereditary spastic paraplegia 10 (SPG10), or a combination thereof.

[0021] In any mode or embodiment described herein, the mutation is present in kinesin family member 5A (KIF5A), and the method is a method for suppressing the expression of the kinesin family member 5A (KIF5A) gene mutation.

[0022] In any aspect or embodiment described herein, the mutation is present in the titanium protein (TTN), and the cell is derived from (i) a subject having at least one of the symptoms of dilated cardiomyopathy-1G (CMD1G), familial hypertrophic cardiomyopathy-9 (CMH9), myofibular myopathy-9 with early respiratory failure (MFM9), tibial muscular dystrophy (TMD), or a combination thereof, or (ii) a subject having or suspected of having at least one of dilated cardiomyopathy-1G (CMD1G), familial hypertrophic cardiomyopathy-9 (CMH9), myofibular myopathy-9 with early respiratory failure (MFM9), tibial muscular dystrophy (TMD), or a combination thereof.

[0023] In any mode or embodiment described herein, the mutation is present in the titanium protein (TTN), and the method is a method for suppressing the expression of the titanium protein (TTN) gene mutation.

[0024] In any aspect or embodiment described herein, the mutation is present in mitofusin-2 (MFN2), and the cell is derived from (i) a subject having at least one of the symptoms of Charcot-Marie-Tooth (CMT) disease type 2A2A (CMT2A2A), Charcot-Marie-Tooth disease type 6A (CMT6A), or a combination thereof, or (ii) a subject having or suspected of having at least one of Charcot-Marie-Tooth (CMT) disease type 2A2A (CMT2A2A), Charcot-Marie-Tooth disease type 6A (CMT6A), or a combination thereof.

[0025] In any aspect or embodiment described herein, the mutation is present in mitofusin-2 (MFN2), and the method is a method for suppressing the expression of the mitofusin-2 (MFN2) gene mutation.

[0026] In any mode or embodiment described herein, the mutation is present in the β-myosin heavy chain (MYH7), and the cell is derived from (i) a subject having at least one of at least one of dilated cardiomyopathy-1S (CMD1S), hypertrophic cardiomyopathy-1 (CMH1), autosomal dominant myosin-accumulating congenital myopathy-7A (CMYP7A), Laing distal myopathy, dilated cardiomyopathy-1S (CMD1S), or a combination thereof, or (ii) a subject having or suspected of having at least one of dilated cardiomyopathy-1S (CMD1S), hypertrophic cardiomyopathy-1 (CMH1), autosomal dominant myosin-accumulating congenital myopathy-7A (CMYP7A), Laing distal myopathy, dilated cardiomyopathy-1S (CMD1S), or a combination thereof.

[0027] In any mode or embodiment described herein, the mutation is present in the β-myosin heavy chain (MYH7), and the method is a method for suppressing the expression of the β-myosin heavy chain (MYH7) gene mutation.

[0028] In any mode or embodiment described herein, the mutation is present in lamin A / C (LMNA), and the cell is (i) a subject having at least one of at least one of dilated cardiomyopathy-1A (CMD1A), autosomal dominant Emery-Dreifuss muscular dystrophy 2 (EDMD2), Slovenian heart-hand syndrome, Hutchinson-Gilford progeria syndrome (HGPS), familial partial lipodystrophy type 2 (FPLD2), Malouf syndrome, congenital muscular dystrophy (MDC), or a combination thereof, or (ii) dilated cardiomyopathy-1A (CMD1A), autosomal dominant Emery-Dreifuss muscular dystrophy 2 (EDMD2), Slovenian heart-hand syndrome, Hutchinson-Gilford progeria syndrome (HGPS), It originates from a subject who has or is suspected of having at least one of familial partial lipodystrophy type 2 (FPLD2), Mallouf syndrome, congenital muscular dystrophy (MDC), or a combination thereof.

[0029] In any mode or embodiment described herein, the mutation is present in lamin A / C (LMNA), and the method is a method for suppressing the expression of the lamin A / C (LMNA) gene mutation.

[0030] In any aspect or embodiment described herein, the mutation is present in transactive responsive deoxyribonucleic acid (DNA) binding protein 43 (TARDBP), and the cell is derived from (i) a subject having at least one of the symptoms of amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), Alzheimer's disease (AD), limbic-dominant age-related TDP-43 encephalopathy (LATE), or a combination thereof, or (ii) a subject having or suspected of having at least one of amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), Alzheimer's disease (AD), limbic-dominant age-related TDP-43 encephalopathy (LATE), or a combination thereof.

[0031] In any aspect or embodiment described herein, the mutation is present in transcription-reactive deoxyribonucleic acid (DNA) binding protein 43 (TARDBP), and the method is a method for suppressing the expression of the transcription-reactive deoxyribonucleic acid (DNA) binding protein 43 (TARDBP) gene mutation.

[0032] In any aspect or embodiment described herein, (i) the antisense oligonucleotide targets an intron region of a gene; or (ii) the antisense oligonucleotide sequence and / or the target variant allele sequence has a guanine-cytosine (GC) content of 20% to 80% (e.g., 35% to 65% or 40% to 60%); (iii) Antisense oligonucleotides are SEQ ID NOs 1, 2, 64–76, 79, 84, 85, 88, 89, 92, 93, 96, 97, 100, 101, 123, 124, or 125, rs11307260 (SEQ ID NO 79), rs142843265 (SEQ ID NO 64), rs3835416 (SEQ ID NO 125), rs34620383 (SEQ ID NO 65), rs2453565 (SEQ ID NO 66), rs700828 (SEQ ID NO 67), rs774356 (SEQ ID NO 68), rs774357 (SEQ ID NO 69), rs774359 (SEQ ID NO 70), An oligonucleotide of length 10 to 25 nucleotides that is complementary to at least 8 consecutive nucleotides of any one of rs2453554 (SEQ No. 71), rs2484319 (SEQ No. 72), rs2453555 (SEQ No. 73), rs2492816 (SEQ No. 74), rs3849945 (SEQ No. 75), or rs10757668 (SEQ No. 76); (iv) the antisense oligonucleotide is an oligonucleotide having the sequences of SEQ NOs 80–83, 86, 87, 90, 91, 94, 95, 98, 99, 102, 103–122, or 126–152, or the antisense oligonucleotide comprises, is essentially composed of, or is composed of any antisense oligonucleotide described herein; (v) the mutation is an A5V mutation in superoxide dismutase 1 (SOD1); and (vi) the mutation is an E134 deletion mutation in superoxide dismutase 1 (SOD1);(vii) the mutation is a repeat extension within intron 1 of chromosome 9 open read frame 72 (C9Orf72); (viii) the mutation is a Q331 mutation (e.g., Q331K) in transcription-reactive deoxyribonucleic acid (DNA) binding protein 43 (TARDBP); (ix) the mutation is an M337 mutation (e.g., M337V) in transcription-reactive deoxyribonucleic acid (DNA) binding protein 43 (TARDBP); or (x) a combination thereof.;

[0033] In any aspect or embodiment described herein, the subject has a target variant allele and a mutation, and the method comprises the step of administering an antisense oligonucleotide to said subject.

[0034] Another aspect of the present disclosure provides a method for treating a subject having an allele containing a mutation, the method comprising: administering to the subject an antisense oligonucleotide (ASO) (e.g., an allele-specific antisense oligonucleotide (asASO)) that targets a target variant allele (e.g., an allele of the variant or common variant, and / or an indel such as an insertion or deletion of one or more bases) that is cis-related to the mutation (e.g., a gain-of-function mutation or a dominant-negative mutation), wherein (i) the subject is heterozygous for the target variant allele; and (ii) the antisense oligonucleotide is effective for the prevention, treatment, or alleviation of at least one symptom associated with the mutation.

[0035] In any mode or embodiment described herein, the mutation is present in superoxide dismutase 1 (SOD1) or chromosome 9 open decoding frame 72 (C9Orf72), and the subject has (i) one or more symptoms of amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), or both amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD), or (ii) has or is suspected of having amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), or both amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD).

[0036] In any mode or embodiment described herein, the mutation is present in kinesin family member 5A (KIF5A), and the subject has at least one of (i) amyotrophic lateral sclerosis, neonatal intractable myoclonus (NEIMY), hereditary spastic paraplegia 10 (SPG10), or a combination thereof, or (ii) has or is suspected of having at least one of amyotrophic lateral sclerosis, neonatal intractable myoclonus (NEIMY), hereditary spastic paraplegia 10 (SPG10), or a combination thereof.

[0037] In any aspect or embodiment described herein, the mutation is present in the titanium protein (TTN), and the subject has at least one of (i) dilated cardiomyopathy-1G (CMD1G), familial hypertrophic cardiomyopathy-9 (CMH9), myofibular myopathy-9 (MFM9), tibial muscular dystrophy (TMD), or a combination thereof, or (ii) has or is suspected of having at least one of dilated cardiomyopathy-1G (CMD1G), familial hypertrophic cardiomyopathy-9 (CMH9), myofibular myopathy-9 (MFM9), tibial muscular dystrophy (TMD), or a combination thereof.

[0038] In any aspect or embodiment described herein, the mutation is present in mitofusin-2 (MFN2), and the subject has at least one of the symptoms of (i) Charcot-Marie-Tooth (CMT) disease type 2A2A (CMT2A2A), Charcot-Marie-Tooth disease type 6A (CMT6A), or a combination thereof, or (ii) Charcot-Marie-Tooth (CMT) disease type 2A2A (CMT2A2A), Charcot-Marie-Tooth disease type 6A (CMT6A), or a combination thereof, or is suspected of having.

[0039] In any mode or embodiment described herein, the mutation is present in the β-myosin heavy chain (MYH7), and the subject has at least one of the following symptoms: (i) dilated cardiomyopathy-1S (CMD1S), hypertrophic cardiomyopathy-1 (CMH1), autosomal dominant myosin-accumulating congenital myopathy-7A (CMYP7A), Laing distal myopathy, dilated cardiomyopathy-1S (CMD1S), or a combination thereof; or (ii) dilated cardiomyopathy-1S (CMD1S), hypertrophic cardiomyopathy-1 (CMH1), autosomal dominant myosin-accumulating congenital myopathy-7A (CMYP7A), Laing distal myopathy, dilated cardiomyopathy-1S (CMD1S), or a combination thereof.

[0040] In any mode or embodiment described herein, the mutation is present in lamin A / C (LMNA), and the cell has at least one of the following symptoms: (i) dilated cardiomyopathy-1A (CMD1A), autosomal dominant Emery-Dreyfus muscular dystrophy 2 (EDMD2), Slovenian heart-hand syndrome, Hutchinson-Gilford progeria syndrome (HGPS), familial partial lipodystrophy type 2 (FPLD2), Mallouf syndrome, congenital muscular dystrophy (MDC), or a combination thereof; or (ii) dilated cardiomyopathy-1A (CMD1A), autosomal dominant Emery-Dreyfus muscular dystrophy 2 (EDMD2), Slovenian heart-hand syndrome, Hutchinson-Gilford progeria syndrome (HGPS), familial partial lipodystrophy type 2 (FPLD2), Mallouf syndrome, congenital muscular dystrophy Having or suspected of having dystrophy (MDC), or a combination thereof.

[0041] In any mode or embodiment described herein, the mutation is present in transcription-reactive deoxyribonucleic acid (DNA) binding protein 43 (TARDBP), and the subject has (i) at least one of the symptoms of amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), Alzheimer's disease (AD), limbic-dominant age-related TDP-43 encephalopathy (LATE), or a combination thereof, or (ii) has or is suspected of having at least one of amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), Alzheimer's disease (AD), limbic-dominant age-related TDP-43 encephalopathy (LATE), or a combination thereof.

[0042] In any mode or embodiment described herein, the method is a method for treating (i) a subject having one or more symptoms of amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), or both amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD), or (ii) a subject having or suspected of having amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), or both amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD).

[0043] In any mode or embodiment described herein, the method is a method for treating (i) a subject having at least one of the symptoms of amyotrophic lateral sclerosis, neonatal intractable myoclonus (NEIMY), hereditary spastic paraplegia 10 (SPG10), or a combination thereof, or (ii) a subject having or suspected of having at least one of amyotrophic lateral sclerosis, neonatal intractable myoclonus (NEIMY), hereditary spastic paraplegia 10 (SPG10), or a combination thereof.

[0044] In any aspect or embodiment described herein, the method is a method for treating (i) a subject having at least one of the symptoms of dilated cardiomyopathy-1G (CMD1G), familial hypertrophic cardiomyopathy-9 (CMH9), myofibular myopathy-9 (MFM9) with early respiratory failure, tibial muscular dystrophy (TMD), or a combination thereof, or (ii) a subject having or suspected of having at least one of dilated cardiomyopathy-1G (CMD1G), familial hypertrophic cardiomyopathy-9 (CMH9), myofibular myopathy-9 (MFM9) with early respiratory failure, tibial muscular dystrophy (TMD), or a combination thereof.

[0045] In any aspect or embodiment described herein, the method is a method for treating (i) a subject having at least one of the symptoms of Charcot-Marie-Tooth (CMT) disease type 2A2A (CMT2A2A), Charcot-Marie-Tooth disease type 6A (CMT6A), or a combination thereof, or (ii) a subject having or suspected of having at least one of Charcot-Marie-Tooth (CMT) disease type 2A2A (CMT2A2A), Charcot-Marie-Tooth disease type 6A (CMT6A), or a combination thereof.

[0046] In any mode or embodiment described herein, the method is a method for treating (i) a subject having at least one of at least one of dilated cardiomyopathy-1S (CMD1S), hypertrophic cardiomyopathy-1 (CMH1), autosomal dominant myosin accumulation congenital myopathy-7A (CMYP7A), Laing distal myopathy, dilated cardiomyopathy-1S (CMD1S), or a combination thereof, or (ii) a subject having or suspected of having at least one of dilated cardiomyopathy-1S (CMD1S), hypertrophic cardiomyopathy-1 (CMH1), autosomal dominant myosin accumulation congenital myopathy-7A (CMYP7A), Laing distal myopathy, dilated cardiomyopathy-1S (CMD1S), or a combination thereof.

[0047] In any aspect or embodiment described herein, the method comprises: (i) a subject having at least one of at least one of dilated cardiomyopathy-1A (CMD1A), autosomal dominant Emery-Dreyfus muscular dystrophy 2 (EDMD2), Slovenian heart-hand syndrome, Hutchinson-Gilford progeria syndrome (HGPS), familial partial lipodystrophy type 2 (FPLD2), Mallouf syndrome, congenital muscular dystrophy (MDC), or a combination thereof; or (ii) having at least one of dilated cardiomyopathy-1A (CMD1A), autosomal dominant Emery-Dreyfus muscular dystrophy 2 (EDMD2), Slovenian heart-hand syndrome, Hutchinson-Gilford progeria syndrome (HGPS), familial partial lipodystrophy type 2 (FPLD2), Mallouf syndrome, congenital muscular dystrophy (MDC), or a combination thereof. It is a method of treating the subject suspected of having it.

[0048] In any aspect or embodiment described herein, (i) the antisense oligonucleotide targets an intron region of a gene; or (ii) the antisense oligonucleotide sequence and / or the target variant allele sequence has a guanine-cytosine (GC) content of 20% to 80% (e.g., 35% to 65% or 40% to 60%); (iii) Antisense oligonucleotides are SEQ ID NOs 1, 2, 64–76, 79, 84, 85, 88, 89, 92, 93, 96, 97, 100, 101, 123, 124, or 125, rs11307260 (SEQ ID NO 79), rs142843265 (SEQ ID NO 64), rs3835416 (SEQ ID NO 125), rs34620383 (SEQ ID NO 65), rs2453565 (SEQ ID NO 66), rs700828 (SEQ ID NO 67), rs774356 (SEQ ID NO 68), rs774357 (SEQ ID NO 69), rs774359 (SEQ ID NO 70), An oligonucleotide of length 10 to 25 nucleotides that is complementary to at least 8 consecutive nucleotides of any one of rs2453554 (SEQ No. 71), rs2484319 (SEQ No. 72), rs2453555 (SEQ No. 73), rs2492816 (SEQ No. 74), rs3849945 (SEQ No. 75), or rs10757668 (SEQ No. 76); (iv) the antisense oligonucleotide is an oligonucleotide having the sequences of SEQ NOs 80–83, 86, 87, 90, 91, 94, 95, 98, 99, 102, 103–122, or 126–152, or the antisense oligonucleotide comprises, is essentially composed of, or is composed of any antisense oligonucleotide described herein; (v) the mutation is an A5V mutation in superoxide dismutase 1 (SOD1); and (vi) the mutation is an E134 deletion mutation in superoxide dismutase 1 (SOD1);(vii) the mutation is a repeat extension within intron 1 of chromosome 9 open read frame 72 (C9Orf72); (viii) the mutation is a Q331 mutation (e.g., Q331K) in transcription-reactive deoxyribonucleic acid (DNA) binding protein 43 (TARDBP); (ix) the mutation is an M337 mutation (e.g., M337V) in transcription-reactive deoxyribonucleic acid (DNA) binding protein 43 (TARDBP); or (x) a combination thereof.;

[0049] In any mode or embodiment described herein, (i) the cell or target is heterozygous for the mutation; (ii) the target variant allele is a common variant; (iii) the target variant allele is an indel (e.g., insertion or deletion); (iv) the mutation comprises a repeat extension, a single base pair point mutation, a structural variant, a copy number variant, an indel, or a combination thereof; or (v) a combination thereof.

[0050] In any mode or embodiment described herein, the method further comprises: (i) determining or identifying the genotype of a target variant allele of a gene (e.g., through a sequence and / or haploid type analysis method described herein); (ii) determining or identifying whether the target variant allele is cis-related to a mutation (e.g., through a sequence and / or haploid type analysis method described herein); or (iii) a combination thereof.

[0051] A further aspect of the present disclosure provides a method for determining the haploid type of two variants of a gene (e.g., a first or target variant and a second variant or mutation) in a cell, the method comprising: providing one or more (e.g., at least one, at least two, one, two, three, four, five, six, seven, eight, or more) antisense oligonucleotides (ASO), wherein each of the one or more antisense oligonucleotides targets a different allele of the first or target variant allele of the gene (e.g., a common variant; an indel; and / or, if an indel, the first antisense oligonucleotide targets an insertion of the first or target variant allele and the second antisense oligonucleotide targets a deletion of the first or target variant allele); and administering each of the one or more antisense oligonucleotides (ASO) individually to the cell. and includes the step of measuring the level of expression (e.g., allele-specific expression) of one or more (e.g., at least one, one, at least two, or two) alleles for a second variant allele (e.g., mutant allele) in each cell administered with the antisense oligonucleotide (ASO) of the one or more antisense oligonucleotides (ASO).

[0052] In any mode or embodiment described herein, a decrease in expression of the allele of the second variant allele indicates that the cell has the second variant allele (e.g., mutant allele) and the first variant allele targeted by the antisense oligonucleotide.

[0053] In any mode or embodiment described herein, (a) a reduction in expression indicates that the second variant allele (e.g., mutant or mutant allele) is in a cis relationship with the first variant allele targeted by the antisense oligonucleotide; (b) a reduction in expression for only one allele of the second variant allele indicates that the cell is not heterozygous with respect to the allele of the second variant allele with reduced expression; (c) a reduction in expression for two alleles of the second variant allele indicates that the cell is heterozygous with respect to the two alleles of the second variant allele with reduced expression and homozygous with respect to the first variant allele targeted by the antisense oligonucleotide; or (d) a combination thereof.

[0054] In any mode or embodiment described herein, (a) the expression reduction indicates that the allele of the second variant allele (e.g., mutant or mutant allele) is in a cis relationship with the first variant allele targeted by the antisense oligonucleotide; (b) the expression reduction for two alleles of the second variant allele indicates that the cell is heterozygous for the two alleles of the second variant allele with reduced expression and homozygous for the first variant allele targeted by the antisense oligonucleotide; or (c) a combination thereof.

[0055] In any mode or embodiment described herein, (i) the first variant allele is a common variant; (ii) the first variant allele is an indel (e.g., an insertion or deletion); (iii) the second variant allele is a mutation comprising a repeat extension, a single base pair point mutation, a structural variant, a copy number variant, an indel, or a combination thereof; or (v) a combination thereof.

[0056] In any aspect or embodiment described herein, (i) the antisense oligonucleotide targets an intron region of a gene; (ii) the antisense oligonucleotide sequence and / or the target variant allele sequence has a guanine-cytosine (GC) content of 20% to 80% (e.g., 35% to 65% or 40% to 60%); (iii) the antisense oligonucleotide is an oligonucleotide of 10 to 25 nucleotides in length; (iv) the antisense oligonucleotide comprises at least one modified nucleotide; (v) the antisense oligonucleotide comprises a phosphorothioate modified bond; (vi) the antisense oligonucleotide is a morpholino; and (vii) the antisense oligonucleotide comprises lock nucleic acid (LNA) and ribonucleic acid (RNA) (e.g., alternating lock nucleic acid (LNA) and ribonucleic acid (RNA) nucleotides); (viii) the antisense oligonucleotide comprises lock nucleic acid (LNA) and deoxyribonucleic acid (DNA) (e.g., alternating lock nucleic acid (LNA) and deoxyribonucleic acid (DNA) nucleotides); (ix) the antisense oligonucleotide comprises ribonucleic acid (RNA) and deoxyribonucleic acid (DNA) (e.g., alternating ribonucleic acid (RNA) and deoxyribonucleic acid (DNA) nucleotides); (x) the antisense oligonucleotide is a gapmer; or (xi) a combination thereof.

[0057] In any aspect or embodiment described herein, at least one modified nucleotide is a 2'-modified nucleotide. In any aspect or embodiment described herein, each 2'-modified nucleotide comprises a 2'-deoxy-modified nucleotide, a 2'-fluoro-modified nucleotide, a 2'-O-methyl-modified nucleotide, a 2'-O-methoxyethyl-modified nucleotide, a 2'-amino-modified nucleotide, or a 2'-aminoalkoxy-modified nucleotide, or is independently one of these.

[0058] In any aspect or embodiment described herein, the variant is present in at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, or at least 75% of one or more gene mutations.

[0059] A further aspect of the present disclosure provides an antisense oligonucleotide (ASO) having a length of 10 to 25 nucleotides, SEQ ID NOs 1, 2, 64–76, 79, 84, 85, 88, 89, 92, 93, 96, 97, 100, 101, 123, 124, or 125, rs11307260 (SEQ ID NO. 79), rs142843265 (SEQ ID NO. 64), rs3835416 (SEQ ID NO. 125), rs34620383 (SEQ ID NO. 65), rs2453565 (SEQ ID NO. 66), rs700828 (SEQ ID NO. 67), rs774356 (SEQ ID NO. 68), It includes a complementary region that is complementary to at least eight consecutive nucleotides of any one of the sequences rs774357 (sequence number 69), rs774359 (sequence number 70), rs2453554 (sequence number 71), rs2484319 (sequence number 72), rs2453555 (sequence number 73), rs2492816 (sequence number 74), rs3849945 (sequence number 75), or rs10757668 (sequence number 76).

[0060] In any aspect or embodiment described herein, the antisense oligonucleotide comprises any one of the nucleic acid sequences SEQ ID NOs 80–83, 86, 87, 90, 91, 94, 95, 98, 99, 102, 103–122, or 126–152. In any aspect or embodiment described herein, the antisense oligonucleotide comprises, is essentially composed of, or is composed of any antisense oligonucleotide described herein.

[0061] In any aspect or embodiment described herein, (i) the antisense oligonucleotide comprises at least one modified nucleotide; (ii) the antisense oligonucleotide comprises at least one modified nucleotide which is a 2'-modified nucleotide (e.g., each 2'-modified nucleotide comprises a 2'-deoxy-modified nucleotide, a 2'-fluoro-modified nucleotide, a 2'-O-methyl-modified nucleotide, a 2'-O-methoxyethyl-modified nucleotide, a 2'-amino-modified nucleotide, or a 2'-aminoalkoxy-modified nucleotide, or is independently one of these); (iii) the antisense oligonucleotide comprises a phosphorothioate modified bond; (iv) the antisense oligonucleotide is a morpholino; and (v) the antisense oligonucleotide comprises a lock nucleic acid (LNA) and ribonucleic acid (RNA) (e.g., alternating lock nucleic acid (LNA) and ribonucleic acid (RNA) nucleotides); (vi) the antisense oligonucleotide comprises lock nucleic acid (LNA) and deoxyribonucleic acid (DNA) (e.g., alternating lock nucleic acid (LNA) and deoxyribonucleic acid (DNA) nucleotides); (v) the antisense oligonucleotide comprises ribonucleic acid (RNA) and deoxyribonucleic acid (DNA) (e.g., alternating ribonucleic acid (RNA) and deoxyribonucleic acid (DNA) nucleotides); (vi) the antisense oligonucleotide is a gapmer; or (vii) a combination thereof.

[0062] A further aspect of the present disclosure provides a pharmaceutical composition comprising an antisense oligonucleotide of the present disclosure and a pharmaceutically acceptable carrier. Brief explanation of the drawing

[0063] The attached drawings, which are incorporated into and form part of this specification, illustrate various embodiments of the present disclosure and serve to explain the principles of the present disclosure together with the specific description of the invention. The drawings are merely for illustrating embodiments of the present disclosure and should not be construed as limiting the present disclosure. Figure 1 shows a comparison with the wild-type sequence, C9Orf72 A schematic diagram showing the sequences of repeat expansions and non-equilibrium 2-base pair deletions (C9-deletions, C9-dels) is provided (see Sequence No. 1 (WT or normal C9) and Sequence No. 2 (C9-deletion or C9-mutant)). Below, a representative ASO designed by 1-base pair tiling across the C9-deletion site is provided. FIG. 2 shows normal fibroblasts (C9-del / C9-del; homozygous mutant genotype, also referred to herein as "sensitive") that are homozygous for the target 2-base pair deletion compared to cells homozygous for the target wild-type allele (WT / WT; homozygous normal genotype, also referred to herein as "resistant"). C9Orf72 Provides a graph showing the ability of a methoxyethyl (MOE) capper ASO to target a 2-base pair deletion site that inhibits the expression of Figure 3a provides a schematic diagram of a double luciferase assay used to test the effects of potential ASOs. Figure 3b provides a schematic diagram of the vector used for the double luciferase assay. Each variant of the target SNP region is cloned separately within the vector to test the effect of the potential ASO. Figures 4a, 4b, and 4c show exogenously expressed in HEK cells C9Orf72We provide a graph illustrating the ability of MOE capmer ASOs to inhibit the expression of target regions. ASOs were tested on cells expressing only a luciferase assay vector (no target region expressed), a luciferase vector carrying the wild-type sequence of an indel resistant to ASO (normal (WT) C9orf72 target sequence, SEQ NO. 1), and a luciferase vector carrying the C9-deleted sequence sensitive to ASO (mutant (C9-del) C9orf72 target sequence, SEQ NO. 2). The target ASO must inhibit the expression of the C9-deleted target sequence and have little to no effect on the WT target sequence or the vector alone. This refers to a non-selective ASO (Non-Discriminate; Lagier-Tourenne, C et al. ["Targeted degradation of sense and antisense"]) that reduces the total levels of both targets but does not reduce the levels of the vector alone construct. C9orf72 We compare RNA foci as therapy for ALS and frontotemporal degeneration". PNAS 2013 Nov 19;110(47):E4530-9]) with scrambled control ASOs (Scram 1 and 2) that do not target either of the said constructs. Figure 4a shows a screen of tiled MOE capper ASOs, while the data in Figure 4b corroborates the screen data for specific ASOs, and Figure 4c shows the dose curve of selective ASO #8 versus scrambled (untargeted) control ASOs. Figure 5 shows an allele-specific manner in fibroblasts C9Orf72We provide a graph showing the ability of MOE capmer ASO to suppress the expression of [specific component]. Two wild-type control fibroblast cell lines that are homozygous against the C9-deleted target (C9-del / C9-del; homozygous mutant genotype, also referred to herein as "sensitive") or wild-type variant (WT / WT; homozygous normal genotype, also referred to herein as "resistant") were used. C9Orf72 Treatment with MOE Gapmer #8 in homozygous mutant cell lines C9Orf72 It reduced expression, but not in homozygous normal genotype cell lines. Figures 6a, 6b, and 6c show exogenously expressed in HEK cells C9Orf72 We provide a graph illustrating the ability of LNA-gaffer ASOs to inhibit the expression of target regions. ASOs were tested on cells expressing only a luciferase assay vector (no target region expressed), a luciferase vector carrying the wild-type sequence of an indel resistant to ASO (normal (WT) C9orf72 target sequence, SEQ NO. 1), or a luciferase vector carrying the C9-deleted sequence sensitive to ASO (mutant (C9-del) C9orf72 target sequence, SEQ NO. 2). The target ASO must inhibit the expression of the C9-deleted target sequence and have little to no effect on the WT target sequence or the vector alone. This is a non-selective ASO (Non-Discriminate; Lagier-Tourenne, C et al. ["Targeted degradation of sense and antisense"]) that reduces the total levels of both targets C9orf72Compares RNA foci as therapy for ALS and frontotemporal degeneration". PNAS 2013 Nov 19;110(47):E4530-9]) or scrambled control ASOs (LNA Scram 1 and 2; scrambled) that do not target either of the said constructs. Fig. 6a shows a screen of tiled LNA ASOs, while the data in Fig. 6b corroborates the screen data for specific ASOs, and Fig. 6c shows the dose curves for selective ASOs #9 and #10. Figure 7 shows an allele-specific manner in fibroblasts C9Orf72 We provide a graph showing the ability of LNA capmer ASO to suppress the expression of [specific component]. Two control fibroblast cell lines that are homozygous against the C9-deleted target (C9-del / C9-del; homozygous mutant genotype, also referred to herein as "sensitive") or wild-type variant (WT / WT; homozygous normal genotype, also referred to herein as "resistant") were used. C9Orf72 Treatment with LNA Gammer #9 in homozygous mutant cell lines C9Orf72 It reduced expression, but not in homozygous normal genotype cell lines. This is a non-selective ASO that reduces the total levels of both targets (Non-Discriminate; Lagier-Tourenne, C et al. literature ["Targeted degradation of sense and antisense"). C9Orf72 Compare RNA foci as therapy for ALS and frontotemporal degeneration". PNAS 2013 Nov 19;110(47):E4530-9]) with a non-targeted control ASO (scrambled) that does not affect the levels of any of the corresponding targets. Figure 8 can be used to determine the location of C9 deletion variants (targets) and specific transcription frequencies in samples. C9Orf72The location of the second variant (ASP SNP) located within the transcription region is illustrated. Figures 9a, 9b, and 9c show heterozygous patients treated with allele-specific LNA capmer ASO #9. C9Orf72 in fibroblasts C9Orf72 We provide graphs showing partial relief (i.e., reduction) of RNA lesion formation. The graph in Fig. 9a indicates that treatment with ASO#9 reduces the number of cells with RNA lesions in the entire population, while Fig. 9b shows a downward shift in the distribution of cells with a specific number of lesions per cell. The latter is summarized in Fig. 9c, which shows a reduction in the average number of RNA lesions per cell upon ASO#9 treatment. FIGS. 10a and 10b are schematic diagrams of the allele-specific knockdown strategy of the present disclosure using antisense oligonucleotide(s) targeting variants, such as common variants and / or indels. Expression levels from each allele generated from treatment with insertion ("long") targeting antisense oligonucleotide or deletion ("short") targeting antisense oligonucleotide are evaluated via RNA sequencing (RNAseq) and / or allele-specific droplet digital polymerase chain reaction (ddPCR). Based on the schematic diagram in FIG. 10a, treatment with a long targeting ASO will reduce expression from the WT allele, allowing for higher expression from the mutant allele, while treatment with a short targeting ASO will have the opposite effect. Figure 11a shows mutants determined by digital droplet PCR in heterozygous A5V fibroblast cell line 120151 (patient-derived cell line) after 72 hours of treatment with 200 nM of the tiling series of short SOD1 MOE cappers (SOD1 short-1 to SOD1 short-11) and the tiling series of long SOD1 MOE cappers (SOD1 long-1 to SOD1 long-10) in a single experiment. SOD1 A graph showing the percentage of expression is provided. The experiment determined that the A5V mutation is cis-relation to the deletion form of the ASO-targeting indel, and that SOD1 short-5 is most effective in knocking down expression from the corresponding allele. SOD1 long-5, which exhibits the highest expression of SOD1 in mutants containing the allele, was proven to be the most effective ASO for knocking down expression from the allele containing the insertion form of the ASO-targeting indel. For the most effective SOD1 short-5 and SOD1 long-5, short SOD1 MOE cappers and long SOD1 MOE cappers were further investigated as shown in Figures 11c, 12c, 13b, 14b, and 15a and 15b. For comparison, LNA versions of the superior SOD1 MOE capper ASOs were prepared and tested, and the corresponding data are also provided herein. Figures 11b and 11c show the total relative values ​​observed when determined by the Taqman assay in heterozygous A5V fibroblast cell line 220022 (patient-derived cell line) after 72 hours of treatment with 100 nM of short SOD1 LNA and long SOD1 LNA (2 experiments) in Figure 11b and 200 nM of short SOD1 MOE capmer and long SOD1 MOE capmer (1 experiment) in Figure 11c. SOD1 Provides a graph showing the levels. All investigated antisense oligonucleotides were effective in knocking down total SOD1 expression. Figures 12a, 12b, and 12c provide graphs showing the percentage of wild-type SOD1 expression present after allele-specific targeting with antisense oligonucleotides in heterozygous A5V fibroblast cell line 220022 (patient-derived). The percentage of WT SOD1 allele expression observed after 72 hours of treatment with 100 nM (2 experiments) of short SOD1 LNA and long SOD1 LNA is determined by droplet digital polymerase chain reaction (ddPCR) in Figure 12a and by bulk RNA sequencing in Figure 12b. The RNA sequencing (RNAseq) allele-specific knockdown coefficients are consistent with the droplet digital polymerase chain reaction (ddPCR) data for the first and second experiments. The percentage of WT SOD1 allele expression observed after 72 hours of treatment with 200 nM (single experiment) of short SOD1 MOE capmer and long SOD1 MOE capmer is determined by droplet digital polymerase chain reaction (ddPCR) in Fig. 12c. The irradiated antisense oligonucleotides demonstrated allele-specific effects, where the short antisense oligonucleotide is responsible for knockdown of mutant alleles in the corresponding irradiated cell lines. Figures 13a and 13b provide graphs showing the total relative SOD1 levels observed when determined by Taqman assay in heterozygous A5V fibroblast cell line 210151 (patient-derived cell line) after 72 hours of treatment with 100 nM of short SOD1 LNA and long SOD1 LNA (2 experiments) in Figure 13a and 200 nM of short SOD1 MOE capperm and long SOD1 MOE capperm (1 experiment) in Figure 13b. Thus, SOD1 knockdown via the irradiated antisense oligonucleotides was confirmed in multiple SOD1 patient fibroblast cell lines. Figures 14a and 14b provide graphs showing the percentage of wild-type SOD1 expression determined by droplet digital polymerase chain reaction (ddPCR) observed in heterozygous A5V fibroblast cell line 210151 (patient-derived) after 72 hours of treatment with 100 nM of short SOD1 LNA and long SOD1 LNA (double experiment) in Figure 14a and 200 nM of short SOD1 MOE capperm and long SOD1 MOE capperm (single experiment) in Figure 14b. The investigated antisense oligonucleotides demonstrated allele-specific effects observed in A5V fibroblast cell line 220022, where the short antisense oligonucleotide is responsible for knockdown of the mutant allele in the investigated cell line. Figures 15a and 15b provide graphs indicating that treatment (two experiments) using the same SOD1 MOE capmer and LNA antisense oligonucleotides that successfully reduced SOD1 levels in two different heterozygous A5V patient fibroblasts can also target other mutations. Similar to the knockdown study described in the 220022 and 210151 heterozygous A5V patient fibroblast cell lines, as determined by the Taqman assay in Figure 15a and allele-specific droplet digital polymerase chain reaction (ddPCR) in Figure 15b, 200 nM of short and long SOD1 MOE capmers and 100 nM of short and long SOD1 LNAs can reduce total SOD1 levels in heterozygous Glu134del patient fibroblast cell lines. In the cell line, the patient mutation is cis-related to the insertion form of the ASO-targeting indel, which is supported by increased wild-type allele expression when treated with the long form of the ASO. FIGS. 16a, FIGS. 16b, and FIGS. 16c are short C9Orf72 LNA Gapmer (LNA #9), short C9Orf72 MOE Gapmer (MOE #8), non-selective C9Orf72 ASO (PNAS 2013; Lagier-Tourenne, C et al. ["Targeted degradation of sense and antisense C9orf72 RNA foci as therapy for ALS and frontotemporal degeneration". PNAS 2013 Nov 19;110(47):E4530-9]), and previously reported allele-specific C9Orf72 We provide a graph showing the treatment results of a heterozygous C9Orf72 mutant fibroblast cell line (C9-36) derived from a patient with C9ORF72 repeat expansion using a targeted ASO (NATMED 22; Tran et al. [Suppression of mutant C9Orf72 expression by a potent mixed backbone antisense oligonucleotide. Nature Medicine Nat Med. 2022 Jan; 28(1) 117-124]). Total C9Orf72 As shown by the Taqman test in Fig. 16a, the level decreases to below the level observed with similar treatment using NATMED 22 ASO after 72 hours of treatment with 100 nM LNA #9. The percentage of WT allele expression increases above the level observed with similar treatment using NATMED 22 ASO after 72 hours of treatment with 100 nM LNA #9, as shown by RNA sequencing (RNAseq) analysis in Fig. 16b. Total C9Orf72 As determined by the Taqman test in Figure 16c, the level decreased similarly to treatment with LNA #9 after 72 hours of treatment with 100 nM MOE Gapmer #8. Both MOE Gapmer #8 and LNA #9 treatments show a greater reduction in C9 levels compared to similar treatment with NATMED 22 ASO. Fig. 17 shows a short of 100 nM. C9Orf72LNA(LNA #9) short C9Orf72 MOE Gapmer (MOE #8), non-selective C9Orf72 ASO (PNAS 2013; Lagier-Tourenne, C et al. ["Targeted degradation of sense and antisense C9orf72 RNA foci as therapy for ALS and frontotemporal degeneration". PNAS 2013 Nov 19;110(47):E4530-9]), and NATMED 22 C9Orf72 Observed upon determination by Taqman assay in heterozygous C9-41 fibroblast cell lines (patient-derived cell lines) after 72 hours of treatment with an allele-specific ASO (Tran et al. [Suppression of mutant C9Orf72 expression by a potent mixed backbone antisense oligonucleotide. Nature Medicine Nat Med. 2022 Jan; 28(1) 117-124]) C9Orf72 It provides a graph showing the levels. These results are consistent with those from the C9-36 cell line and indicate that a single ASO can target multiple cell lines. Figure 18 provides a graph of total C9 levels determined by Taqman test present after DIV7 gymnotic treatment of C9Orf72 patient IPSC-derived cortical neurons using 5 uM of MOE capper #8 (MOE8) and LNA capper #C9 (LNA9). This compares an untreated control group (NT), a non-selective ASO that reduces the total levels of both targets (PNAS 2013; Lagier-Tourenne, C et al. ["Targeted degradation of sense and antisense C9Orf72 RNA foci as therapy for ALS and frontotemporal degeneration". PNAS 2013 Nov 19;110(47):E4530-9]), and a non-targeted control ASO (MSC) that does not affect the levels of either of the targets. Figure 19 provides a graph showing the ability of LNA capper ASO to suppress the expression of target regions from different genes using the dual luciferase assay method described herein. ASO was tested in cells expressing only the luciferase assay vector (no target region expressed), the luciferase vector carrying the wild-type sequence of an indel resistant to ASO (see below for each gene), or the luciferase vector carrying a mutant variant of an indel sensitive to ASO (see below for each gene). By achieving allele-specific knockdown for each of the kinesin family member 5A (KIF5A), titan protein (TTN), mitofusin-2 (MFN2), β-myosin heavy chain (MYH7), and lamin A / C (LMNA), the ability to perform potent allele-specific knockdown in multiple disease / genetic situations was further confirmed. These results were achieved through the minimum optimization of a single pair of antisense oligonucleotides for each investigated target. Figure 20 shows mutants determined by digital droplet PCR in heterozygous Q331K-induced cortical neuron cell lines after DIV7 gymnotic treatment with 5 μM of the short TARDBP MOE capmer (TARDBP short-1 to TARDBP short-11) tiling series and the long TDP43 MOE capmer (TARDBP long-1 to TARDBP long-10) tiling series in a single experiment. TARDBP A graph showing the expression percentage is provided. The experiment determined that the Q331K mutation is cis-relation to the insertion form of the ASO-targeting indel, and that TARDBP length-7 and length-8 are most effective in knocking down expression from the corresponding allele. From mutants containing the allele TARDBP TARDBP short-7 and short-8, which exhibit the highest expression, were proven to be the most effective ASOs for knocking down expression from alleles containing the deletion form of the ASO-targeting indel. Figure 21 shows mutants determined by digital droplet PCR in heterozygous M337V-induced cortical neuron cell lines after DIV7 gymnotic treatment using 5 μM of the top 5 performing TARDBP MOE cappers (TARDBP short-5 to TARDBP short-9 and TARDBP long-5 to TARDBP long-9) screened in Figure 20 in a single experiment. TARDBPA graph showing the expression percentage is provided. The experiment determined that the M337V mutation is cis-relation to the deletion form of the ASO-targeting indel and confirmed that TARDBP ASO 7 and 8 (TARDBP short-7 and TARDBP short-8 in the corresponding cell line) are most effective in knocking down expression from the corresponding allele. Consequently, TARDBP long-7 and long-8, which exhibit the highest expression of TDP43 in mutants containing the allele, were proven to be the most effective ASOs for knocking down expression from the allele containing the insert form of the ASO-targeting indel. Figure 22 shows mutants determined by digital droplet PCR in heterozygous Q331K and M337V IPSC-derived cortical neuron cell lines after DIV7 gymnotic treatment with 5 uM ASO. TARDBP Epigenetic knockdown at the level of allele-specific knockdown TARDBP We provide a graph showing the effect of ASO backbone modification on MOE #7. The corresponding treatment was also compared with untreated mutant TARDBP samples (TDP43 UT) and untreated WT parent cell lines (KOLF UT). Figure 22 shows the same ASO with modified backbone binding at 2 (2M), 3 (3M), or 4 (4M) positions of the ASO wing. TARDBP Compare the efficacy of knockdown of MOE #7(M). The experiment determined that ASO backbone modification at two or three positions of the wing increased allele-specific knockdown of mutant alleles in M337V and Q331K cell lines, respectively. Specific details for implementing the invention

[0064] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as generally understood by those skilled in the art to which this disclosure applies. The terms used herein are merely for describing specific embodiments and are not intended to limit this disclosure.

[0065] In the present disclosure, where a range of values ​​is provided (e.g., in the case of a group containing a plurality of carbon atoms, the number of each carbon atom within that range is provided), unless the context clearly indicates otherwise, it should be understood that the upper and lower limits of that range and all intermediate values ​​within the range up to one-tenth of the lower limit unit between any other mentioned or interposed value within the mentioned range are included. The upper and lower limits of such smaller ranges may independently be included in the smaller ranges and are also included in the present disclosure unless any specifically excluded limits are present in the mentioned ranges. Where the mentioned ranges include one or both of the limits, the range excluding either or both of the included limits is also included in the present disclosure.

[0066] In addition, it should be understood that in a particular method or process described herein comprising two or more steps or acts, the order of the steps or acts of the method is not necessarily limited to the order in which the steps or acts of the method are cited, unless the context otherwise specifies.

[0067] The following terms are used to describe the present disclosure. Where a term is not specifically defined herein, it is given the meaning recognized in the art by those skilled in the art to apply it in the context of its use in describing the present disclosure.

[0068] As used herein and in the appended claims, the singular forms (“a” and “an”) are used herein to refer to one or more (i.e., at least one) of the grammatical objects of the Article, unless the context otherwise clearly indicates. For example, “one element” means one or more elements unless otherwise specified.

[0069] In this specification and claims, as used herein, the phrase “and / or” should be understood to mean “either one or both” of the elements combined therethrough, that is, elements that exist combined in some cases and separately in others. Multiple elements enumerated by “and / or” should be interpreted in the same way, that is, “one or more” of the elements combined therethrough, regardless of whether they relate to the elements specifically identified by the phrase “and / or.” Any other elements other than the specifically identified elements may exist. Thus, as a non-limiting example, when the expression “A and / or B” is used with open language such as “comprising,” it may refer to: in one embodiment, A alone (optional, including elements other than B); in another embodiment, B alone (optional, including elements other than A); in yet another embodiment, both A and B (optional, including other elements); etc.

[0070] In this specification and claims, as used herein, “or” should be understood to have the same meaning as “and / or” as defined above. For example, when items are separated into a list, “or” or “and / or” should be interpreted in a comprehensive sense; that is, it includes not only cases where at least one of the items is included, but also cases where two or more items are included, and optionally cases where additional items not specified in the list are included. Conversely, only clearly specified terms, such as, for example, “only one” or “exactly one,” or “consisting of” as used in the claims, refer to the inclusion of exactly only one element of the items of the element. In general, the term “or” as used herein should be interpreted only as indicating an exclusive choice (i.e., “one or the other, but not both”) when preceded by an exclusive term, such as “either”, “one of”, “only one”, or “exactly one”.

[0071] In the specification and claims herein, as used herein, the phrase “at least one” relating to a list of one or more elements means at least one element selected from any one or more of the elements within the list of elements, but it should be understood that it does not necessarily include at least one of each and all of the elements specifically enumerated within the list of elements, nor exclude any combination of the elements within the list of elements. This definition also allows for the optional presence of elements other than the specifically identified elements within the list of elements referred to by the phrase “at least one,” regardless of whether they relate to the specifically identified elements. Accordingly, as a non-limiting example, “at least one of A and B” (or equivalently, “at least one of A or B”, or equivalently “at least one of A and / or B”) comprises, in one embodiment, at least one, optionally two or more A in the absence of B (and optionally including elements other than B); in another embodiment, at least one, optionally two or more B in the absence of A (and optionally including elements other than A); In another embodiment, it may refer to at least one, optionally two or more A and at least one, optionally two or more B (and optionally other elements); etc.

[0072] In the claims of this application as well as in the foregoing specification, all transition phrases such as “comprising,” “including,” “carrying,” “having,” “containing,” “involving,” “holding,” “composed of,” etc. shall be understood as open (i.e., meaning that they include but are not limited thereto). Any embodiment and claim referring to one of the open transition phrases is expressly considered to be capable of being described in any other transition phrase that may be more restrictive, unless explicitly excluded by the context or description. As specified in the United States Patent Office Manual of Patent Examining Procedures, Section 2111.03, only the transition phrases “composed of” and “essentially composed of” shall be interpreted as closed or semi-closed transition phrases, respectively.

[0073] As used herein, the terms “administration of” and “step of administering” refer to providing, supplying, applying, or spraying a compound of the present disclosure through any suitable route, for example. In the present disclosure, suitable routes of administration include oral, intravenous, intramuscular, subcutaneous, inhalation, oral, transmucosal, and nasal administration. In the context of administering a compound in the form of a combination, such as a combination of the compound of the present disclosure and other active agent compounds, the amount of each compound when administered in combination may differ from that of a compound administered alone.

[0074] Throughout this specification, the terms “patient” or “subject” are used to describe an animal, preferably a human or livestock, to which treatment using a composition according to the present disclosure is provided, including prophylactic treatment. In the case of treatment of a disease, condition, or symptom specific to a specific animal, e.g., a human patient, the term “patient” refers to a specific animal, including livestock such as dogs or cats, or farm animals such as horses, cattle, sheep, etc. Generally, in this disclosure, the terms “patient” and “subject” refer to a human patient unless otherwise stated or implied in the context of the use of such terms.

[0075] The terms “effective,” “therapeutically effective,” “effective dose / effective dosage,” “pharmaceutical effective dose / effective dosage,” “pharmaceutical effective dose / effective dosage,” or “therapeutic effective dose / effective dosage” are used to describe the amount / dosage of a compound or composition that, when used in the context of its intended use, affects an intended outcome, such as improvement or prevention of a disease, disorder, or condition, or alleviation (e.g., some degree of partial relief, preferably complete relief) or reduction of one or more symptoms associated with the disease, disorder, or condition, either as a single dose or, more preferably, after multiple administrations in the context of a therapeutic regimen. The terms “effective” and “therapeutically effective” encompass all other terms related to “effective dose” or “effective concentration” as otherwise described or used in this application. The effective dose depends on the type of disease, the composition used, the route of administration, the type of mammal being treated, the physical characteristics of the specific mammal under consideration, concomitant drugs, and other factors that may be recognized by those skilled in the art.

[0076] The term "independently" is used to indicate that independently applied variables vary independently of each other for each application.

[0077] As used herein, the terms “optional” or “optional” indicate that the event or situation described subsequently may or may not occur, and that such description includes cases where such event or situation occurs and cases where it does not occur.

[0078] Aspects of the present disclosure relate to allele-specific inhibition of gene or protein expression in a cell or subject, particularly of gene or protein expression of an allele comprising an acquiring mutation or a dominant-negative mutation. In any aspect or embodiment described herein, compared to the wild-type allele (e.g., , Mutation-specific knockdown / inhibition technology designed to preferentially reduce the expression (e.g., gene and / or protein expression) of a gain-of-function mutation or a dominant-negative mutation (in cells or subjects heterozygous to the mutation, such as cells or subjects having both the mutant allele and the wild-type allele). The technology of the present disclosure described herein, instead of targeting both the mutant and wild-type alleles, directly targets the mutant allele containing the gene mutation, which is significant because it implies that the technology described herein does not significantly affect the expression of the wild-type allele in cells or subjects having the gain-of-function mutation or the dominant-negative mutation (e.g., cells or subjects heterozygous to the mutation). It has been found that the reduction in the expression of the wild-type allele can be harmful to cells and subjects. As an example of an approach in the art, other technologies indirectly target the cis mutant variant (e.g., instead of directly targeting the gene mutation), which is often successful in targeting repeat expansions.

[0079] The present disclosure additionally provides antisense oligonucleotides, compositions, and methods for inhibiting gene or protein expression, comprising, for example, mutant superoxide dismutase 1 (SOD1), mutant chromosome 9 open-translate frame 72 (C9Orf72), mutant kinesin family member 5A (KIF5A), mutant titan protein (TTN), mutant mitofusin-2 (MFN2), mutant β-myosin heavy chain (MYH7), mutant lamin A / C (LMNA), and / or mutant transcription-reactive deoxyribonucleic acid (DNA)-binding protein 43 (TARDBP). In any aspect or embodiment described herein, abnormal expression of superoxide dismutase 1 (SOD1) or chromosome 9 open-translate frame 72 is associated with amyotrophic lateral sclerosis (ALS) and / or frontotemporal dementia (FTD). In any aspect or embodiment described herein, abnormal kinesin family member 5A (KIF5A) expression is associated with amyotrophic lateral sclerosis, neonatal intractable myoclonus (NEIMY), and / or hereditary spastic paraplegia 10 (SPG10). In any aspect or embodiment described herein, abnormal titanium protein (TTN) expression is associated with dilated cardiomyopathy-1G (CMD1G), familial hypertrophic cardiomyopathy-9 (CMH9), myofibular myopathy-9 (MFM9), and / or tibial muscular dystrophy (TMD). In any aspect or embodiment described herein, abnormal mitofusin-2 (MFN2) expression is associated with Charcot-Marie-Tooth (CMT) disease type 2A2A (CMT2A2A) and / or Charcot-Marie-Tooth disease type 6A (CMT6A). In any aspect or embodiment described herein, abnormal β-myosin heavy chain (MYH7) expression is associated with dilated cardiomyopathy-1S (CMD1S), hypertrophic cardiomyopathy-1 (CMH1), autosomal dominant myosin accumulation congenital myopathy-7A (CMYP7A), Laing distal myopathy, and / or dilated cardiomyopathy-1S (CMD1S).In any aspect or embodiment described herein, dysregulated lamin A / C (LMNA) expression is associated with dilated cardiomyopathy-1A (CMD1A), autosomal dominant Emery-Dreyfus muscular dystrophy 2 (EDMD2), Slovenian heart-hand syndrome, Hutchinson-Gilford progeria syndrome (HGPS), familial partial lipodystrophy type 2 (FPLD2), Mallouf syndrome, and / or congenital muscular dystrophy (MDC). In any aspect or embodiment described herein, dysregulated transcription-reactive deoxyribonucleic acid (DNA) binding protein 43 (TARDBP) expression is associated with amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), Alzheimer's disease (AD), and / or limbic-dominant age-related TDP-43 encephalopathy (LATE).

[0080] An aspect of the present disclosure is an allele-specific antisense oligonucleotide of the present disclosure (e.g., a superoxide dismutase 1 (SOD1) mutant allele, C9Orf72 The present invention relates to an improved gene therapy composition and a related method for treating diseases associated with gain-of-function mutations or dominant-negative mutations (e.g., those associated with ALS or FTD) using an allele-specific antisense oligonucleotide of the present disclosure that targets mutant alleles, kinesin family member 5A (KIF5A) mutant alleles, titan protein (TTN) mutant alleles, mitofusin-2 (MFN2) mutant alleles, β-myosin heavy chain (MYH7) mutant alleles, lamin A / C (LMNA) mutant alleles, or transcription-reactive deoxyribonucleic acid (DNA)-binding protein 43 (TARDBP) mutant alleles.

[0081] The inventors of the present disclosure have discovered that directly targeting variants such as common variants (including indels (gene insertions or deletions)) can be used to achieve allelic differentiation, and that this can be used to target gain-of-function mutations or dominant-negative mutations without knocking down other alleles (e.g., normal or wild-type alleles) by eliminating the need to directly target repeat expansions or single-point mutations / variants.

[0082] As an example, C9-deletion polymorphism indels C9Orf72 It is located within the transcribed region of the gene. In some embodiments, alleles from indel variants are often (e.g., in non-equilibrium linkages having G4C2 repeats) C9Orf72 The repeat expansions are located on the same haploid form. In addition, the variant sequences of each indel are often C9Orf72 It exists in a heterozygous state within the patient. As such, one allele of the indel variant represents a target for allele-specific ASOs or similar knockdown technologies. Additionally, because indels increase the difference between the targeted allele and the non-targeted allele, they are advantageous for the generation of allele-specific ASOs.

[0083] In addition to a 2-base pair C9 deletion, the present invention contains an allele commonly found in the same haploid type as repeat expansion. C9ORF72Ten single nucleotide polymorphisms (SNPs) were identified within the gene region. These SNPs are located at the following rs positions: rs2453565 (SEQ No. 66), rs700828 (SEQ No. 67), rs774356 (SEQ No. 68), rs774357 (SEQ No. 69), rs774359 (SEQ No. 70), rs2453554 (SEQ No. 71), rs2484319 (SEQ No. 72), rs2453555 (SEQ No. 73), rs2492816 (SEQ No. 74), and rs3849945 (SEQ No. 75). An example of a targeted 2-base pair C9 deletion as described herein is named rs142843265 (SEQ No. 64). The RS position naming convention is based on the literature by Smith, BN, et al. [The C9ORF72 Expansion mutation is a common cause of ALS + / - FTD in Europe and has a single founder. As described in the European Journal of Human Genetics (2013) 21, 102-108.

[0084] Method of use, inhibition, treatment, and haploid analysis

[0085] One aspect of the present disclosure provides a method for suppressing a mutant allele in a cell, said method comprising: delivering to the cell an antisense oligonucleotide (ASO) (e.g., allele-specific antisense oligonucleotide (asASO)) that targets an allele of a target mutant allele that is cis-related to the mutation (e.g., the mutation is a gain-of-function mutation or a dominant-negative mutation), said cell (e.g., target) is heterozygous for the target mutant allele, and said antisense oligonucleotide is effective for suppressing or knocking down the mutant allele (e.g., reducing the expression of the mutant allele). In any aspect or embodiment described herein, the target mutant allele is a common variant, an indel (e.g., a gene insertion or deletion), or a combination thereof. In any aspect or embodiment described herein, the method reduces the expression of the mutant allele in the cell. Accordingly, an additional aspect of the present disclosure provides a method for suppressing a mutant allele in a cell, said method comprising: delivering to the cell an antisense oligonucleotide (ASO) (e.g., allele-specific antisense oligonucleotide (asASO)) that targets an allele of a target mutant allele that is cis-related to the mutation (e.g., the mutation is a gain-of-function mutation or a dominant-negative mutation), said cell (e.g., target) is heterozygous for the target mutant allele, and said antisense oligonucleotide is effective for suppressing or knocking down the mutant allele (e.g., reducing the expression of the mutant allele). In any aspect or embodiment described herein, the target mutant allele is a common variant, an indel (e.g., a gene insertion or deletion), or a combination thereof.In any mode or embodiment described herein, the method reduces the expression of an allele or an allele containing a mutation in a cell.

[0086] In any mode or embodiment described herein, the cell is an in vitro cell. In any mode or embodiment described herein, the cell is a human cell (e.g., a cell of the human central nervous system).

[0087] In any embodiment or aspect described herein, the cell is a cell within a subject. In any embodiment or aspect described herein, the subject possesses a mutation, and the method comprises the step of administering an antisense oligonucleotide to said subject. For example, one embodiment of the present disclosure provides a method for suppressing a mutant allele in a subject, said method comprising: delivering to said subject an antisense oligonucleotide (ASO) (e.g., allele-specific antisense oligonucleotide (asASO)) that targets an allele of a target mutant allele that is cis-related to said mutation (e.g., said mutation is a gain-of-function mutation or a dominant-negative mutation), said subject is heterozygous for said target mutant allele, and said antisense oligonucleotide is effective for suppressing or knocking down the expression of said mutant allele (i.e., reducing the expression of said mutant allele). In any embodiment or aspect described herein, the method reduces the expression of the mutant allele in said subject. Accordingly, an additional aspect of the present disclosure provides a method for suppressing a mutant allele in a subject, said method comprising: delivering to the subject an antisense oligonucleotide (ASO) (e.g., allele-specific antisense oligonucleotide (asASO)) that targets an allele of a target mutant allele that is cis-related to the mutation (e.g., the mutation is a gain-of-function mutation or a dominant-negative mutation), said subject being heterozygous for the target mutant allele, and said antisense oligonucleotide being effective for suppressing or knocking down the mutant allele (e.g., reducing the expression of the mutant allele). In any aspect or embodiment described herein, the method reduces the expression of the mutant allele in the subject.

[0088] In any aspect or embodiment described herein, the mutation is present in superoxide dismutase 1 (SOD1), chromosome 9 open transliteration frame 72 (C9Orf72), kinesin family member 5A (KIF5A), titanium protein (TTN), mitofusin-2 (MFN2), β-myosin heavy chain (MYH7), lamin A / C (LMNA), or transcription-reactive deoxyribonucleic acid (DNA)-binding protein 43 (TARDBP). In any aspect or embodiment described herein, the mutation is present in superoxide dismutase 1 (SOD1) or chromosome 9 open transliteration frame 72 (C9Orf72). For example, in any mode or embodiment described herein, the mutation is present in superoxide dismutase 1 (SOD1) or chromosome 9 open transposition frame 72 (C9Orf72), and the cell is derived from (i) a subject having one or more symptoms of amyotrophic lateral sclerosis (ALS) and / or frontotemporal dementia (FTD), or (ii) a subject having or suspected of having amyotrophic lateral sclerosis (ALS) and / or frontotemporal dementia (FTD). Additionally, in any mode or embodiment described herein, the mutation is present in superoxide dismutase 1 (SOD1) or chromosome 9 open transposition frame 72 (C9Orf72), and the method is a method of inhibiting said superoxide dismutase 1 (SOD1) mutant allele or said chromosome 9 open transposition frame 72 (C9Orf72) mutant allele.Additionally, in any aspect or embodiment described herein, the mutation is present in superoxide dismutase 1 (SOD1), chromosome 9 open-translate frame 72 (C9Orf72), kinesin family member 5A (KIF5A), titanium protein (TTN), mitofusin-2 (MFN2), β-myosin heavy chain (MYH7), lamin A / C (LMNA), or transcription-reactive deoxyribonucleic acid (DNA)-binding protein 43 (TARDBP), and the method comprises: a superoxide dismutase 1 (SOD1) mutant allele, a chromosome 9 open-translate frame 72 (C9Orf72) mutant allele, a kinesin family member 5A (KIF5A) mutant allele, a titanium protein (TTN) mutant allele, a mitofusin-2 (MFN2) mutant allele, and a β-myosin heavy chain (MYH7) mutant This is a method to inhibit the allele, the lamin A / C (LMNA) mutant allele, or the transcription-reactive deoxyribonucleic acid (DNA)-binding protein 43 (TARDBP) mutant allele.

[0089] For example, in any mode or embodiment described herein, the mutation is present in kinesin family member 5A (KIF5A), and the cell is derived from (i) a subject having one or more symptoms of amyotrophic lateral sclerosis, neonatal intractable myoclonus (NEIMY), and / or hereditary spastic paraplegia 10 (SPG10), or (ii) a subject having or suspected of having amyotrophic lateral sclerosis, neonatal intractable myoclonus (NEIMY), and / or hereditary spastic paraplegia 10 (SPG10).

[0090] For example, in any aspect or embodiment described herein, the mutation is present in the titanium protein (TTN), and the cell is derived from (i) a subject having one or more symptoms of dilated cardiomyopathy-1G (CMD1G), familial hypertrophic cardiomyopathy-9 (CMH9), myofibular myopathy-9 (MFM9) with early respiratory failure, and / or tibial muscular dystrophy (TMD), or (ii) a subject having or suspected of having dilated cardiomyopathy-1G (CMD1G), familial hypertrophic cardiomyopathy-9 (CMH9), myofibular myopathy-9 (MFM9) with early respiratory failure, and / or tibial muscular dystrophy (TMD).

[0091] For example, in any aspect or embodiment described herein, the mutation is present in mitofusin-2 (MFN2), and the cell is derived from (i) a subject having one or more symptoms of Charcot-Marie-Tooth (CMT) disease type 2A2A (CMT2A2A) and / or Charcot-Marie-Tooth disease type 6A (CMT6A), or (ii) a subject having or suspected of having Charcot-Marie-Tooth (CMT) disease type 2A2A (CMT2A2A) and / or Charcot-Marie-Tooth disease type 6A (CMT6A).

[0092] For example, in any mode or embodiment described herein, the mutation is present in the β-myosin heavy chain (MYH7), and the cell is derived from (i) a subject having one or more symptoms of dilated cardiomyopathy-1S (CMD1S), hypertrophic cardiomyopathy-1 (CMH1), autosomal dominant myosin-accumulating congenital myopathy-7A (CMYP7A), and / or Laing distal myopathy, dilated cardiomyopathy-1S (CMD1S), or (ii) a subject having or suspected of having dilated cardiomyopathy-1S (CMD1S), hypertrophic cardiomyopathy-1 (CMH1), autosomal dominant myosin-accumulating congenital myopathy-7A (CMYP7A), and / or Laing distal myopathy; dilated cardiomyopathy-1S (CMD1S).

[0093] For example, in any mode or embodiment described herein, the mutation is present in lamin A / C (LMNA), and the cell is (i) a subject having one or more symptoms of dilated cardiomyopathy-1A (CMD1A), autosomal dominant Emery-Dreyfus muscular dystrophy 2 (EDMD2), Slovenian heart-hand syndrome, Hutchinson-Gilford progeria syndrome (HGPS), familial partial lipodystrophy type 2 (FPLD2), Mallouf syndrome, and / or congenital muscular dystrophy (MDC), or (ii) dilated cardiomyopathy-1A (CMD1A), autosomal dominant Emery-Dreyfus muscular dystrophy 2 (EDMD2), Slovenian heart-hand syndrome, Hutchinson-Gilford progeria syndrome (HGPS), familial partial lipodystrophy type 2 (FPLD2), Mallouf syndrome, and / or It originates from subjects who have or are suspected of having congenital muscular dystrophy (MDC).

[0094] For example, in any aspect or embodiment described herein, the mutation is present in transcription-reactive deoxyribonucleic acid (DNA) binding protein 43 (TARDBP), and the cell is derived from (i) a subject having one or more symptoms of amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), Alzheimer's disease (AD), and / or limbic-dominant age-related TDP-43 encephalopathy (LATE), or (ii) a subject having or suspected of having amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), Alzheimer's disease (AD), and / or limbic-dominant age-related TDP-43 encephalopathy (LATE).

[0095] In any aspect or embodiment described herein, the antisense oligonucleotide targets an intron region of a target variant allele. In any aspect or embodiment described herein, the antisense oligonucleotide sequence and / or the target variant allele sequence has a guanine-cytosine (GC) content of 35% to 65%. In any aspect or embodiment described herein, the antisense oligonucleotide is 10 to 25 nucleotides long and SEQ ID NOs 1, 2, 64–76, 79, 84, 85, 88, 89, 92, 93, 96, 97, 100, 101, 123, 124, or 125, rs11307260 (SEQ ID NO. 79), rs142843265 (SEQ ID NO. 64), rs3835416 (SEQ ID NO. 125), rs34620383 (SEQ ID NO. 65), rs2453565 (SEQ ID NO. 66), rs700828 (SEQ ID NO. 67), rs774356 (SEQ ID NO. 68), rs774357 (SEQ ID NO It is an oligonucleotide complementary to at least eight consecutive nucleotides of any one of 69), rs774359 (SEQ No. 70), rs2453554 (SEQ No. 71), rs2484319 (SEQ No. 72), rs2453555 (SEQ No. 73), rs2492816 (SEQ No. 74), rs3849945 (SEQ No. 75), or rs10757668 (SEQ No. 76). In any aspect or embodiment described herein, the antisense oligonucleotide is an oligonucleotide having the sequence of SEQ Nos. 80–83, 86, 87, 90, 91, 94, 95, 98, 99, 102, 103–122, or 126–152. In any aspect or embodiment described herein, the antisense oligonucleotide comprises, is essentially made of, or is made of any antisense oligonucleotide described herein. In any aspect or embodiment described herein, the mutation is a superoxide dismutase 1 (SOD1) mutation (e.g., rs11307260 (SEQ No. 79)).In any of the embodiments or types described herein, the mutation is an A5V mutation within superoxide dismutase 1 (SOD1). In any of the embodiments or types described herein, the mutation is a single base pair point mutation within the superoxide dismutase 1 (SOD1) gene. In any of the embodiments or types described herein, the mutation is present in an E134 deletion mutation within superoxide dismutase 1 (SOD1). In any of the embodiments or types described herein, the mutation is a single base pair deletion within the superoxide dismutase 1 (SOD1) gene. In any of the embodiments or types described herein, the mutation is a hexanucleotide repeat extension within intron 1 of the chromosome 9 open decoding frame 72 (C9Orf72) gene. In any embodiment of the embodiments described herein, the mutation is a Q331 mutation (e.g., Q331K) in transcription-reactive deoxyribonucleic acid (DNA) binding protein 43 (TARDBP). In any embodiment or mode described herein, the mutation is an M337 mutation (e.g., M337V) in transcription-reactive deoxyribonucleic acid (DNA) binding protein 43 (TARDBP). In any embodiment or mode described herein, a subject has a target variant allele and a mutation, and the method comprises the step of administering an antisense oligonucleotide to said subject.

[0096] Another aspect of the present disclosure provides a method for treating a subject having a mutation, said method comprising: administering to the subject an antisense oligonucleotide (ASO) (e.g., allele-specific antisense oligonucleotide (asASO)) that targets a target variant allele that is cis-related to said mutation (e.g., gain-of-function mutation or dominant-negative mutation), said subject, wherein (i) said subject is heterozygous for said target variant allele; and (ii) said antisense oligonucleotide is effective for the prevention, treatment, or alleviation of at least one symptom associated with said mutation. In any aspect or embodiment described herein, the target variant allele is a common variant, an indel (e.g., a gene insertion or deletion), or a combination thereof. Accordingly, further aspects of the present disclosure provide a method for treating a subject having a mutant allele, the method comprising: administering to the subject an antisense oligonucleotide (ASO) (e.g., allele-specific antisense oligonucleotide (asASO)) that targets a target mutant allele that is cis-related to the mutation (e.g., gain-of-function mutation or dominant-negative mutation), wherein (i) the subject is heterozygous for the target mutant allele; and (ii) the antisense oligonucleotide is effective for the prevention, treatment, or alleviation of at least one symptom associated with the mutation. In any aspect or embodiment described herein, the target mutant allele is a common mutant, an indel (e.g., a gene insertion or deletion), or a combination thereof.

[0097] In any mode or embodiment described herein, the mutation is present in superoxide dismutase 1 (SOD1) or chromosome 9 open decoding frame 72 (C9Orf72). For example, in any mode or embodiment described herein, the mutation is present in superoxide dismutase 1 (SOD1) or chromosome 9 open decoding frame 72 (C9Orf72), and the subject has (i) one or more symptoms of amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), or both amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD), or (ii) has or is suspected of having amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), or both amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD). As a further example, in any mode or embodiment described herein, the method is a method for treating (i) a subject having one or more symptoms of amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), or both amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD), or (ii) a subject having or suspected of having amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), or both amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD).

[0098] For example, in any mode or embodiment described herein, the mutation is present in kinesin family member 5A (KIF5A), and the subject has (i) one or more symptoms of amyotrophic lateral sclerosis, neonatal intractable myoclonus (NEIMY), and / or hereditary spastic paraplegia 10 (SPG10), or (ii) has or is suspected of having amyotrophic lateral sclerosis, neonatal intractable myoclonus (NEIMY), and / or hereditary spastic paraplegia 10 (SPG10).

[0099] For example, in any aspect or embodiment described herein, the mutation is present in the titanium protein (TTN), and the subject has one or more symptoms of (i) dilated cardiomyopathy-1G (CMD1G), familial hypertrophic cardiomyopathy-9 (CMH9), myofibular myopathy-9 (MFM9) with early respiratory failure, and / or tibial muscular dystrophy (TMD), or (ii) has or is suspected of having dilated cardiomyopathy-1G (CMD1G), familial hypertrophic cardiomyopathy-9 (CMH9), myofibular myopathy-9 (MFM9) with early respiratory failure, and / or tibial muscular dystrophy (TMD).

[0100] For example, in any aspect or embodiment described herein, the mutation is present in mitofusin-2 (MFN2), and the subject has (i) one or more symptoms of Charcot-Marie-Tooth (CMT) disease type 2A2A (CMT2A2A) and / or Charcot-Marie-Tooth disease type 6A (CMT6A), or (ii) has or is suspected of having Charcot-Marie-Tooth (CMT) disease type 2A2A (CMT2A2A) and / or Charcot-Marie-Tooth disease type 6A (CMT6A).

[0101] For example, in any mode or embodiment described herein, the mutation is present in the β-myosin heavy chain (MYH7), and the subject has (i) one or more symptoms of dilated cardiomyopathy-1S (CMD1S), hypertrophic cardiomyopathy-1 (CMH1), autosomal dominant myosin-accumulating congenital myopathy-7A (CMYP7A), and / or Laing distal myopathy, dilated cardiomyopathy-1S (CMD1S), or (ii) has or is suspected of having dilated cardiomyopathy-1S (CMD1S), hypertrophic cardiomyopathy-1 (CMH1), autosomal dominant myosin-accumulating congenital myopathy-7A (CMYP7A), and / or Laing distal myopathy; dilated cardiomyopathy-1S (CMD1S).

[0102] For example, in any mode or embodiment described herein, the mutation is present in lamin A / C (LMNA), and the subject has one or more symptoms of (i) dilated cardiomyopathy-1A (CMD1A), autosomal dominant Emery-Dreyfus muscular dystrophy 2 (EDMD2), Slovenian heart-hand syndrome, Hutchinson-Gilford progeria syndrome (HGPS), familial partial lipodystrophy type 2 (FPLD2), Mallouf syndrome, and / or congenital muscular dystrophy (MDC), or (ii) dilated cardiomyopathy-1A (CMD1A), autosomal dominant Emery-Dreyfus muscular dystrophy 2 (EDMD2), Slovenian heart-hand syndrome, Hutchinson-Gilford progeria syndrome (HGPS), familial partial lipodystrophy type 2 (FPLD2), and / or Mallouf syndrome, congenital muscular dystrophy Has or is suspected of having dystrophy (MDC).

[0103] For example, in any aspect or embodiment described herein, the mutation is present in transcription-reactive deoxyribonucleic acid (DNA) binding protein 43 (TARDBP), and the subject has (i) one or more symptoms of amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), Alzheimer's disease (AD), and / or limbic-dominant age-related TDP-43 encephalopathy (LATE), or (ii) has or is suspected of having at least one of amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), Alzheimer's disease (AD), and / or limbic-dominant age-related TDP-43 encephalopathy (LATE).

[0104] In any aspect or embodiment described herein, the antisense oligonucleotide sequence and / or target variant allele sequence has a guanine-cytosine (GC) content of about 20% to about 80% (e.g., about 35% to about 65%, or about 40% to about 60%, or about 45% to about 55%). For example, in any aspect or embodiment described herein, the antisense oligonucleotide sequence and / or target variant allele sequence is about 20% to about 80%, about 20% to about 75%, about 20% to about 70%, about 20% to about 65%, about 20% to about 60%, about 20% to about 55%, about 20% to about 50%, about 20% to about 45%, about 20% to about 40%, about 20% to about 35%, about 20% to about 30%, about 25% to about 80%, about 25% to about 75%, about 25% to about 70%, about 25% to about 65%, about 25% to about 60%, about 25% to about 55%, about 25% to about 50%, about 25% to about 45%, about 25% to about 40%, about 25% to about 35%, about 30% to about 80%, about 30% to about 75%, about 30% to about 70%, about 30% to about 65%, about 30% to about 60%, about 30% to about 55%, about 30% to about 50%, about 30% to about 45%, about 30% to about 40%, about 35% to about 80%, about 35% to about 75%, about 35% to about 70%, about 35% to about 65%, about 35% to about 60%, about 35% to about 55%, about 35% to about 50%, about 35% to about 45%, about 40% to about 80%, about 40% to about 75%, about 40% to about 70%, about 40% to about 65%, about 40% to about 60%, about 40% to about 55%, about 40% to about 50%, about 45% to about 80%, about 45% to about 75%,About 45% to about 70%, about 45% to about 65%, about 45% to about 60%, about 45% to about 55%, about 50% to about 80%, about 50% to about 75%, about 50% to about 70%, about 50% to about 65%, about 50% to about 60%, about 50% to about 80%, about 50% to about 75%, about 50% to about 70%, about 50% to about 65%, about 50% to about 80%, about 50% to about 75%, about 50% to about 70%, about 50% to about 65%, about 50% to about 60%, about 55% to about 80%, about 55% to about 75%, about 55% to about 70%, about 55% to about 65%, about 60% to about 80%, about 60% to about 75%, about 60% to about 80%, about 60% to about 75%, about 60% to It has a guanine-cytosine (GC) content of about 70%, about 65% to about 80%, about 65% to about 75%, or about 70% to about 80%.

[0105] In any mode or embodiment described herein, the antisense oligonucleotide targets an intron region of a gene. In any aspect or embodiment described herein, the antisense oligonucleotide is 10 to 25 nucleotides long and SEQ ID NOs 1, 2, 64–76, 79, 84, 85, 88, 89, 92, 93, 96, 97, 100, 101, 123, 124, or 125, rs11307260 (SEQ ID NO. 79), rs142843265 (SEQ ID NO. 64), rs3835416 (SEQ ID NO. 125), rs34620383 (SEQ ID NO. 65), rs2453565 (SEQ ID NO. 66), rs700828 (SEQ ID NO. 67), rs774356 (SEQ ID NO. 68), rs774357 (SEQ ID NO It is an oligonucleotide complementary to at least eight consecutive nucleotides of any one of 69), rs774359 (SEQ No. 70), rs2453554 (SEQ No. 71), rs2484319 (SEQ No. 72), rs2453555 (SEQ No. 73), rs2492816 (SEQ No. 74), rs3849945 (SEQ No. 75), or rs10757668 (SEQ No. 76). In any aspect or embodiment described herein, the antisense oligonucleotide is an oligonucleotide having the sequence of SEQ Nos. 80–83, 86, 87, 90, 91, 94, 95, 98, 99, 102, 103–122, or 126–152. In any aspect or embodiment described herein, the antisense oligonucleotide comprises, is essentially composed of, or is composed of any antisense oligonucleotide described herein. In any aspect or embodiment described herein, the mutation is present in the A5V mutation in superoxide dismutase 1 (SOD1). In any aspect or embodiment described herein, the mutation is present in the E134 deletion mutation in superoxide dismutase 1 (SOD1).In any of the embodiments or examples described herein, the mutation is a hexanucleotide repeat extension within intron 1 of the chromosome 9 open decoding frame 72 (C9Orf72) gene. In any of the embodiments or examples described herein, the mutation is a Q331 mutation (e.g., Q331K) within transcription-reactive deoxyribonucleic acid (DNA) binding protein 43 (TARDBP). In any of the embodiments or examples described herein, the mutation is an M337 mutation (e.g., M337V) within transcription-reactive deoxyribonucleic acid (DNA) binding protein 43 (TARDBP).

[0106] In any mode or embodiment described herein, the cell is heterozygous for the mutation. In any mode or embodiment described herein, the subject is heterozygous for the mutation. In any mode or embodiment described herein, the target variant allele is a common variant. In any mode or embodiment described herein, the target variant allele is an indel (e.g., a gene insertion or deletion). In any mode or embodiment described herein, the mutation includes a repeat extension, a single base pair point mutation, a structural variant, a copy number variant, an indel, or a combination thereof.

[0107] In any embodiment or aspect described herein, the method further comprises the step of determining or identifying the genotype of a target variant within a gene (e.g., through the sequencing and / or haploid analysis method described herein). For example, in any embodiment or aspect described herein, the method further comprises the step of determining or identifying the genotype of a target variant within a gene through the sequencing, haploid analysis method, or a combination thereof described herein.

[0108] In any aspect or embodiment described herein, the method further comprises the step of determining or identifying whether the target variant allele is cis-related to the mutation (e.g., through the sequence and / or haplotype analysis method described herein). For example, in any aspect or embodiment described herein, the method further comprises the step of determining or identifying whether the target variant allele is cis-related to the mutation through the sequencing, haplotype analysis method, or a combination thereof described herein. For example, the target variant allele and the mutation are cis-related if the antisense oligonucleotide is knocked down or if the expression of both the target variant allele and the mutation or the second variant allele is reduced. In other words, the target variant allele and the mutation are cis-related if the antisense oligonucleotide targeting the target variant allele knocks down or reduces the expression of the mutation or the second variant allele (i.e., other than the variant target of the antisense oligonucleotide).

[0109] A further aspect of the present disclosure provides a method for determining the haploid type of two variants of a gene (e.g., a first target variant allele and a second variant allele or a mutant allele) in a cell, the method comprising: providing one or more (e.g., at least one, at least two, one, two, three, four, five, six, seven, eight, or more) antisense oligonucleotides (ASO), wherein each of the one or more antisense oligonucleotides targets a different allele of the first target variant allele of the gene (e.g., a common variant; an indel; and / or, if an indel, the first antisense oligonucleotide targets an insertion of the first target variant allele and the second antisense oligonucleotide targets a deletion of the first or target variant allele); and administering each of the one or more antisense oligonucleotides (ASO) individually to the cell. and includes the step of measuring the level of expression (e.g., allele-specific expression) of one or more (e.g., at least one, at least two, one, two, three, four, five, six, seven, eight, or more) alleles for a second variant allele (e.g., a mutant or mutant allele) in each cell administered with the antisense oligonucleotide (ASO) of the one or more antisense oligonucleotides (ASO).Accordingly, a method for determining the haploid type of two variants of a gene in a cell (or a haploid type analysis method) comprises the step of administering each of one or more antisense oligonucleotides (ASO), wherein each of the one or more antisense oligonucleotides targets a first or target variant allele separately (i.e., individually) to the same cell (e.g., common variant; indel; and / or indel, the first antisense oligonucleotide targets the insertion of the first or target variant allele and the second antisense oligonucleotide targets the deletion of the first variant), thereby enabling the expression levels of one or more alleles for the second variant allele to be investigated independently for each antisense oligonucleotide (ASO) (i.e., without administering another antisense to the same cell). For example, in any aspect or embodiment described herein, two antisense oligonucleotides (ASO) are administered individually for haploid type analysis. In any mode or embodiment described herein, the second variant allele is a mutation.

[0110] As a further example, in any aspect or embodiment described herein, one antisense oligonucleotide (ASO) is administered individually for haploid type analysis. Accordingly, another aspect of the present disclosure provides a method for determining the haploid type of two variants of a gene (e.g., a first target variant allele and a second variant allele or mutant allele) in a cell, said method comprising: providing an antisense oligonucleotide (ASO), said antisense oligonucleotide targeting an allele of the first target variant allele of said gene (e.g., a common variant; an indel; and / or, if an indel, the first antisense oligonucleotide targets an insertion of the first or target variant allele and the second antisense oligonucleotide targets a deletion of the first or target variant allele); and administering said antisense oligonucleotide (ASO) to said cell; and includes the step of measuring the level of expression (e.g., allele-specific expression) of an allele for a second variant allele (e.g., a mutant or mutant allele) in cells administered with the antisense oligonucleotide (ASO).

[0111] A further aspect of the present disclosure provides a method for determining the haploid type of two variants of a gene (e.g., a first target variant allele and a second variant allele or mutant allele) in a cell, the method comprising: providing a plurality of (e.g., at least two, one, two, three, four, five, six, seven, eight, or more) antisense oligonucleotides (ASO), wherein each of the antisense oligonucleotides targets a different allele of the first target variant allele of the gene (e.g., a common variant; an indel; and / or, if an indel, the first antisense oligonucleotide targets an insertion of the first or target variant allele and the second antisense oligonucleotide targets a deletion of the first or target variant allele); and administering each of the plurality of antisense oligonucleotides (ASO) individually to the cell. and includes the step of measuring the level of expression (e.g., allele-specific expression) of the plurality (e.g., at least two, or two) alleles for a second variant allele (e.g., mutant or mutant allele) in each cell administered with the antisense oligonucleotide (ASO) of the plurality of antisense oligonucleotides (ASO).Accordingly, a method for determining the haploid type of two variants of a gene in a cell (or a haploid type analysis method) comprises the step of administering each of a plurality of antisense oligonucleotides (ASO), wherein each of the antisense oligonucleotides targets a first or target variant allele separately (i.e., individually) to the same cell (e.g., in the case of a common variant; indel; and / or indel, the first antisense oligonucleotide targets the insertion of the first or target variant allele and the second antisense oligonucleotide targets the deletion of the first variant), thereby enabling the expression levels of the plurality of alleles for the second variant allele to be investigated independently for each antisense oligonucleotide (ASO) (i.e., without administering another antisense to the same cell). For example, in any aspect or embodiment described herein, two antisense oligonucleotides (ASO) are administered individually for haploid type analysis. In any mode or embodiment described herein, the second variant allele is a mutation.

[0112] In any mode or embodiment described herein, a decrease in expression of the second variant allele indicates that the cell has the second variant allele and the allele of the first or target variant allele that is cis-related to or is the same haploid type as the antisense oligonucleotide target.

[0113] In any mode or embodiment described herein, a decrease in expression of the second variant allele indicates that the second variant allele (e.g., mutant or mutant allele) is in a cis relationship with the first or target variant allele targeted by the antisense oligonucleotide. In any mode or embodiment described herein, a decrease in expression for only one allele of the first or target variant allele indicates that the cell is homozygous for the allele of the second variant allele with reduced expression. In any mode or embodiment described herein, a decrease in expression for two alleles of the second variant allele (e.g., mutant or mutant allele) indicates that the cell is heterozygous for said two alleles of the second variant allele with reduced expression and homozygous for the first or target variant allele targeted by the antisense oligonucleotide.

[0114] In any mode or embodiment described herein, (a) the expression reduction indicates that a second variant allele (e.g., a mutant) is in a cis relationship with a first or target variant allele targeted by an antisense oligonucleotide;

[0115] In any mode or embodiment described herein, the first or target variant allele is a common variant. In any mode or embodiment described herein, the first or target variant allele is an indel (e.g., a gene insertion or deletion). In any mode or embodiment described herein, the second variant allele is a mutation comprising a repeat extension, a single base pair point mutation, a structural variant, a copy number variant, an indel, or a combination thereof.

[0116] In any aspect or embodiment described herein, the antisense oligonucleotide sequence and / or target variant allele sequence has a guanine-cytosine (GC) content of about 20% to about 80% (e.g., 35% to 65%, or about 40% to about 60%, or about 45% to about 55%). For example, in any aspect or embodiment described herein, the antisense oligonucleotide sequence and / or target variant allele sequence is about 20% to about 80%, about 20% to about 75%, about 20% to about 70%, about 20% to about 65%, about 20% to about 60%, about 20% to about 55%, about 20% to about 50%, about 20% to about 45%, about 20% to about 40%, about 20% to about 35%, about 20% to about 30%, about 25% to about 80%, about 25% to about 75%, about 25% to about 70%, about 25% to about 65%, about 25% to about 60%, about 25% to about 55%, about 25% to about 50%, about 25% to about 45%, about 25% to about 40%, about 25% to about 35%, about 30% to about 80%, about 30% to about 75%, about 30% to about 70%, about 30% to about 65%, about 30% to about 60%, about 30% to about 55%, about 30% to about 50%, about 30% to about 45%, about 30% to about 40%, about 35% to about 80%, about 35% to about 75%, about 35% to about 70%, about 35% to about 65%, about 35% to about 60%, about 35% to about 55%, about 35% to about 50%, about 35% to about 45%, about 40% to about 80%, about 40% to about 75%, about 40% to about 70%, about 40% to about 65%, about 40% to about 60%, about 40% to about 55%, about 40% to about 50%, about 45% to about 80%, about 45% to about 75%, about 45% to about 70%,About 45% to about 65%, about 45% to about 60%, about 45% to about 55%, about 50% to about 80%, about 50% to about 75%, about 50% to about 70%, about 50% to about 65%, about 50% to about 60%, about 50% to about 80%, about 50% to about 75%, about 50% to about 70%, about 50% to about 65%, about 50% to about 60%, about 50% to about 65%, about 50% to about 60%, about 55% to about 80%, about 55% to about 75%, about 55% to about 70%, about 55% to about 65%, about 60% to about 80%, about 60% to about 75%, about 60% to about 70%, about 60% to about 70%, about 65% to about 80%, about 60% to about 75%, about 60% to about 70%, about 65% to It has a guanine-cytosine (GC) content of about 80%, about 65% to about 75%, or about 70% to about 80%.

[0117] In any embodiment or aspect described herein, the antisense oligonucleotide targets an intron region of a gene. In any embodiment or aspect described herein, the antisense oligonucleotide is an oligonucleotide 10 to 25 nucleotides long. In any embodiment or aspect described herein, the antisense oligonucleotide comprises at least one modified nucleotide. In any embodiment or aspect described herein, the antisense oligonucleotide comprises a phosphorothioate modified linkage. In any embodiment or aspect described herein, the antisense oligonucleotide is a morpholino. In any embodiment or aspect described herein, the antisense oligonucleotide comprises lock nucleic acid (LNA) and ribonucleic acid (RNA) (e.g., alternating lock nucleic acid (LNA) and ribonucleic acid (RNA) nucleotides). In any aspect or embodiment described herein, the antisense oligonucleotide comprises lock nucleic acid (LNA) and deoxyribonucleic acid (DNA) (e.g., alternating lock nucleic acid (LNA) and deoxyribonucleic acid (DNA) nucleotides). In any aspect or embodiment described herein, the antisense oligonucleotide comprises ribonucleic acid (RNA) and deoxyribonucleic acid (DNA) (e.g., alternating ribonucleic acid (RNA) and deoxyribonucleic acid (DNA) nucleotides). In any aspect or embodiment described herein, the antisense oligonucleotide is a gapmer.

[0118] In any aspect or embodiment described herein, at least one modified nucleotide is a 2'-modified nucleotide. In any aspect or embodiment described herein, each 2'-modified nucleotide comprises a 2'-deoxy-modified nucleotide, a 2'-fluoro-modified nucleotide, a 2'-O-methyl-modified nucleotide, a 2'-O-methoxyethyl-modified nucleotide, a 2'-amino-modified nucleotide, or a 2'-aminoalkoxy-modified nucleotide, or is independently one of these.

[0119] In any mode or embodiment described herein, the variant is present in at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, or at least 75% of one or more gene mutations.

[0120] As used herein, the terms “treat,” “treatment,” “treating,” and “therapy” refer to therapeutic treatments and prophylactic or preventive operations. These terms further include the alleviation of existing symptoms, prevention of additional symptoms, alleviation or prevention of the underlying cause of symptoms, and prevention or reversal of the cause of symptoms (e.g., symptoms associated with ALS and / or FTD). Accordingly, these terms indicate that a beneficial outcome has been provided to a subject who has a disease, disorder, condition, or symptom, or who is at risk of developing such disease, disorder, condition, or symptom. Additionally, the treatment may include the step of applying or administering an inhibitory nucleic acid (e.g., a therapeutic ASO, or a pharmaceutical composition containing an ASO) to a subject or tissue or cell line isolated from such subject that may have a disease, disorder, condition, or symptoms of a disease, disorder, or condition, or a predisposition to such disease, disorder, or condition, for the purpose of curing, resolving, alleviating, reducing, altering, rescuing, improving, or enhancing the said disease, disorder, condition, or symptoms of such disease, disorder, or condition, or a predisposition to such disease, disorder, or condition.

[0121] As disclosed herein, repressive nucleic acids (e.g., antisense oligonucleotides (ASOs)) may be administered via any suitable route. For therapeutic use, an effective amount of antisense nucleic acid and / or other therapeutic agent may be administered to a subject via any method that delivers the agent to the desired tissue, e.g., neuronal tissue. In any aspect or embodiment described herein, the repressive nucleic acid (e.g., antisense oligonucleotides (ASOs)) is administered intravenously. Other suitable routes of administration include, but are not limited to, oral, parenteral, intravenous, intraperitoneal, intranasal, sublingual, intratracheal, inhalation, subcutaneous, ocular, vaginal, and rectal. Systemic routes include oral and parenteral. For administration by inhalation, a number of types of devices are regularly used. These types of devices include metered-dose inhalers (MDIs), breath-actuated MDIs, dry powder inhalers (DPIs), spacers / holding chambers combined with MDIs, and nebulizers.

[0122] For oral administration, the inhibitory nucleic acid (e.g., antisense oligonucleotide (ASO)) can be readily formulated by combining the active compound(s) with a pharmaceutically acceptable carrier known in the art. Through such a carrier, the formulation of the present disclosure can be formulated into tablets, pills, drags, capsules, liquids, gels, syrups, slurries, suspensions, etc., for oral intake by a patient to be treated. The oral pharmaceutical formulation can be obtained as a solid excipient, and optionally, the resulting mixture can be ground, and after adding a suitable adjuvant as needed, the granulated mixture can be processed to be obtained as a tablet or drag core. Suitable excipients include, in particular, fillers such as sugars comprising lactose, sucrose, mannitol, or sorbitol; For example, it is a cellulose preparation such as corn starch, wheat starch, rice starch, potato starch, gelatin, gum tragacanth, methyl cellulose, hydroxypropylmethyl cellulose, sodium carboxymethylcellulose, and / or polyvinylpyrrolidone (PVP). If necessary, a disintegrant such as cross-linked polyvinylpyrrolidone, agar, or alginic acid or a salt thereof, such as sodium alginate, may be added. Optionally, the oral formulation may also be formulated in saline or buffer solution to neutralize internal acid conditions, or administered without any carrier.

[0123] Delivery of an inhibitory nucleic acid (e.g., antisense oligonucleotide (ASO)) to a subject may be achieved, for example, by administration into the subject's bloodstream. Administration into the bloodstream may be achieved by injection into a vein, an artery, or any other blood vessel. Additionally, in certain cases, it may be desirable to deliver the inhibitory nucleic acid (e.g., antisense oligonucleotide (ASO)) to brain tissue, meninges, neurons, glial cells, astrocytes, oligodendrocytes, cerebrospinal fluid (CSF), interstitial space, etc. In any mode or embodiment described herein, the repressive nucleic acid (e.g., antisense oligonucleotide (ASO)) may be delivered directly to the spinal cord or brain (e.g., prefrontal cortex) by injecting into the ventricular region with a needle, catheter, or associated device using neurosurgical techniques known in the art, e.g., stereotactic injection, and may also be delivered to the striatum (e.g., the caudate nucleus or putamen of the striatum) and the neuromuscular junction, or to the cerebellar lobules (e.g., Stein et al. [J Virol 73:3424-3429, 1999]; Davidson et al. [PNAS 97:3428-3432, 2000]; Davidson et al. [Nat. Genet. 3:219-223, 1993]; and Alisky and Davidson [Hum. Gene [See Ther. 11:2315-2329, 2000]).

[0124] Pharmaceutical formulations suitable for oral use include push-fit capsules made of gelatin, as well as soft-sealed capsules made of gelatin and a plasticizer (e.g., glycerol or sorbitol). Push-fit capsules may contain the active ingredient in the form of a mixture with a filler such as lactose, a binder such as starch, and / or a lubricant such as talc or magnesium stearate, and optionally a stabilizer. In the case of soft capsules, the active ingredient may be dissolved or suspended in a suitable liquid such as fatty oil, liquid paraffin, or liquid polyethylene glycol. Additionally, a stabilizer may be added. Furthermore, microspheres formulated for oral administration may be used. Such microspheres are well defined in the art. Oral formulations generally have a dosage suitable for the corresponding administration.

[0125] For oral administration, the composition may take the form of a tablet or a lorenge formulated in a conventional manner.

[0126] In the case of administration by inhalation, the inhibitory nucleic acid (e.g., antisense oligonucleotide (ASO)) for use according to the present disclosure may be conveniently delivered in the form of an aerosol spray from a pressurized pack or nebulizer using a suitable propellant, e.g., dichlorodifluoromethane, trifluoromethane, dichlorotetrafluoroethane, carbon dioxide, or other suitable gas. In the case of a pressurized aerosol, the dosage unit may be determined by providing a valve for delivering a metered amount. For example, capsules and cartridges of gelatin for use in an inhaler or blower may be formulated in such a manner that they contain a powder mixture of the compound and a suitable powder base, such as lactose or starch.

[0127] If systemic delivery of an inhibitory nucleic acid (e.g., an antisense oligonucleotide (ASO)) is required, it may be formulated for parenteral administration via injection, e.g., a bolus injection or a serial infusion. The injectable formulation may be provided in a unit dose form with added preservatives, e.g., in an ampoule or a multi-dose container. The composition may take the form of a suspension, solution, or emulsion in an oily or aqueous vehicle and may contain formulation agents such as a suspending agent, a stabilizer, and / or a dispersing agent.

[0128] Pharmaceutical formulations for parenteral administration comprise an aqueous solution of an inhibitory nucleic acid (e.g., an antisense oligonucleotide (ASO)) in a water-soluble form. Additionally, a suspension of the formulation may be prepared as a suitable oily infusion suspension. Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, synthetic fatty acid esters such as ethyl oleate or triglycerides, or liposomes. The aqueous infusion suspension may contain substances that increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol, or dextran. Optionally, the suspension may also contain suitable stabilizers or agents that increase the solubility of the formulation to enable the preparation of a highly concentrated solution. Alternatively, the formulation (e.g., ASO) may be provided in powder form so that it can be reconstituted in a suitable vehicle, such as sterile non-pyrogen water, before use. Inhibitory nucleic acids (e.g., antisense oligonucleotides (ASOs)) can also be formulated into rectal or vaginal administration compositions, such as suppositories or enemas, containing a conventional suppository base, such as cocoa butter or other glycerides.

[0129] Other delivery systems may include staggered-release, delayed-release, or sustained-release delivery systems. These systems allow for the avoidance of repeated administration of the relevant formulation (e.g., ASO) and can increase convenience for the subject and the physician. A number of types of release delivery systems are available. These include polymer-based systems such as poly(lactide glycolide), copolyoxalate, polycaprolactone, polyesteramide, polyorthoester, polyhydroxybutyric acid, and polyanhydride. Delivery systems also include the following non-polymer systems: lipids including sterols such as cholesterol, cholesterol esters, and fatty acids, or neutral fats such as monoglycerides, diglycerides, and triglycerides; hydrogel-release systems; Sillast systems; peptide-based systems; wax coatings; compressed tablets using conventional binders and excipients; partially fused implants; and other non-polymer systems disclosed herein.

[0130] Inhibitory nucleic acid

[0131] In any aspect or embodiment described herein, the repressive nucleic acid is an antisense oligonucleotide (ASO). As used herein, the terms “antisense oligonucleotide (ASO)” or “antisense nucleic acid” refer to a nucleic acid that has sequence complementarity with respect to a target sequence and can specifically hybridize with the nucleic acid having the target sequence (e.g., under strict conditions). An antisense oligonucleotide (ASO) can be specifically hybridized when the binding of the antisense oligonucleotide (ASO) to the target nucleic acid is sufficient to create a complementarity-based pairing between the antisense oligonucleotide (ASO) and the target nucleic acid, and when there is a sufficient degree of complementarity to avoid non-specific binding of the antisense oligonucleotide (ASO) to the non-target nucleic acid under conditions where specific binding is required, e.g., under physiological conditions in the case of in vivo assays or therapeutic treatments, and under the conditions under which the assay is performed in the case of in vitro assays. In any aspect or embodiment described herein, the antisense oligonucleotide (ASO) is a single-stranded oligonucleotide.

[0132] One aspect of the present disclosure provides an inhibitory nucleic acid (e.g., an antisense oligonucleotide (ASO)), wherein SEQ ID NOs 1, 2, 64–67, 79, 84, 85, 88, 89, 92, 93, 96, 97, 100, 101, 123, 124, or 125, rs11307260 (SEQ ID NO. 79), rs142843265 (SEQ ID NO. 64), rs3835416 (SEQ ID NO. 125), rs34620383 (SEQ ID NO. 65), rs2453565 (SEQ ID NO. 66), rs700828 (SEQ ID NO. 67), rs774356 (SEQ ID NO. 68), rs774357 (SEQ ID NO. 69), At least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, or more consecutive nucleotides (e.g., 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, ) of a sequence complementary to any one of the nucleic acid sequences rs774359 (SEQ No. 70), rs2453554 (SEQ No. 71), rs2484319 (SEQ No. 72), rs2453555 (SEQ No. 73), rs2492816 (SEQ No. 74), rs3849945 (SEQ No. 75), or rs10757668 (SEQ No. 76). It includes a complementary region that is complementary to 23, 24, or 25 consecutive nucleotides.

[0133] A further aspect of the present disclosure provides an inhibitory nucleic acid (e.g., an antisense oligonucleotide (ASO)) having a length of 10 to 25 nucleotides, SEQ ID NOs 1, 2, 64–76, 79, 84, 85, 88, 89, 92, 93, 96, 97, 100, 101, 123, 124, or 125, rs11307260 (SEQ ID NO. 79), rs142843265 (SEQ ID NO. 64), rs3835416 (SEQ ID NO. 125), rs34620383 (SEQ ID NO. 65), rs2453565 (SEQ ID NO. 66), rs700828 (SEQ ID NO. 67), rs774356 (SEQ ID NO. 68), At least 8 of any one of rs774357 (sequence number 69), rs774359 (sequence number 70), rs2453554 (sequence number 71), rs2484319 (sequence number 72), rs2453555 (sequence number 73), rs2492816 (sequence number 74), rs3849945 (sequence number 75), or rs10757668 (sequence number 76) (e.g., at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, It includes a complementary region that is complementary to a sequence of 23, 24, or 25 nucleotides. In any aspect or embodiment described herein, the antisense oligonucleotide targets an intron region of a gene.

[0134] In any aspect or embodiment described herein, the antisense oligonucleotide sequence and / or target variant allele sequence has a guanine-cytosine (GC) content of about 20% to about 80% (e.g., about 35% to about 65%, or about 40% to about 60%, or about 45% to about 55%). For example, in any aspect or embodiment described herein, the antisense oligonucleotide sequence and / or target variant allele sequence is about 20% to about 80%, about 20% to about 75%, about 20% to about 70%, about 20% to about 65%, about 20% to about 60%, about 20% to about 55%, about 20% to about 50%, about 20% to about 45%, about 20% to about 40%, about 20% to about 35%, about 20% to about 30%, about 25% to about 80%, about 25% to about 75%, about 25% to about 70%, about 25% to about 65%, about 25% to about 60%, about 25% to about 55%, about 25% to about 50%, about 25% to about 45%, about 25% to about 40%, about 25% to about 35%, about 30% to about 80%, about 30% to about 75%, about 30% to about 70%, about 30% to about 65%, about 30% to about 60%, about 30% to about 55%, about 30% to about 50%, about 30% to about 45%, about 30% to about 40%, about 35% to about 80%, about 35% to about 75%, about 35% to about 70%, about 35% to about 65%, about 35% to about 60%, about 35% to about 55%, about 35% to about 50%, about 35% to about 45%, about 40% to about 80%, about 40% to about 75%, about 40% to about 70%, about 40% to about 65%, about 40% to about 60%, about 40% to about 55%, about 40% to about 50%, about 45% to about 80%, about 45% to about 75%,About 45% to about 70%, about 45% to about 65%, about 45% to about 60%, about 45% to about 55%, about 50% to about 80%, about 50% to about 75%, about 50% to about 70%, about 50% to about 65%, about 50% to about 60%, about 50% to about 80%, about 50% to about 75%, about 50% to about 70%, about 50% to about 65%, about 50% to about 80%, about 50% to about 75%, about 50% to about 70%, about 50% to about 65%, about 50% to about 60%, about 55% to about 80%, about 55% to about 75%, about 55% to about 70%, about 55% to about 65%, about 60% to about 80%, about 60% to about 75%, about 60% to about 80%, about 60% to about 75%, about 60% to It has a guanine-cytosine (GC) content of about 70%, about 65% to about 80%, about 65% to about 75%, or about 70% to about 80%.

[0135] In any aspect or embodiment described herein, the antisense oligonucleotide comprises any one of the nucleic acid sequences SEQ ID NOs 80–83, 86, 87, 90, 91, 94, 95, 98, 99, 102, 103–122, or 125–145. In any aspect or embodiment described herein, the antisense oligonucleotide comprises, is essentially composed of, or is composed of any antisense oligonucleotide described herein.

[0136] In any aspect or embodiment described herein, (i) the antisense oligonucleotide comprises at least one modified nucleotide; (ii) the antisense oligonucleotide comprises at least one modified nucleotide which is a 2'-modified nucleotide (e.g., each 2'-modified nucleotide comprises a 2'-deoxy-modified nucleotide, a 2'-fluoro-modified nucleotide, a 2'-O-methyl-modified nucleotide, a 2'-O-methoxyethyl-modified nucleotide, a 2'-amino-modified nucleotide, or a 2'-aminoalkoxy-modified nucleotide, or is independently one of these); (iii) the antisense oligonucleotide comprises a phosphorothioate modified bond; (iv) the antisense oligonucleotide is a morpholino; and (v) the antisense oligonucleotide comprises a lock nucleic acid (LNA) and ribonucleic acid (RNA) (e.g., alternating lock nucleic acid (LNA) and ribonucleic acid (RNA) nucleotides); (vi) the antisense oligonucleotide comprises lock nucleic acid (LNA) and deoxyribonucleic acid (DNA) (e.g., alternating lock nucleic acid (LNA) and deoxyribonucleic acid (DNA) nucleotides); (v) the antisense oligonucleotide comprises ribonucleic acid (RNA) and deoxyribonucleic acid (DNA) (e.g., alternating ribonucleic acid (RNA) and deoxyribonucleic acid (DNA) nucleotides); (vi) the antisense oligonucleotide is a gapmer; or (vii) a combination thereof.

[0137] In any aspect or embodiment described herein, the present disclosure relates to a mutated superoxide dismutase 1 that is cis-related to an allele of a 1-base-pair indel (e.g., a gene insertion or deletion and / or rs11307260 (SEQ No. 79)). SOD1 Provides an inhibitory nucleic acid (e.g., ASO) that inhibits the expression of a superoxide dismutase 1 (SOD1) gene comprising the ) allele. In any aspect or embodiment described herein, a mutated superoxide dismutase 1 ( SOD1 The ) allele is a mutated superoxide dismutase 1 that is cis-related to the allele of the 1-base-pair indel (e.g., gene insertion or deletion, E134 deletion, and / or rs11307260 (SEQ No. 79)) SOD1 It includes the ) sequence. In any aspect or embodiment described herein, the mutated superoxide dismutase 1 ( SOD1 The ) allele is a mutated superoxide dismutase 1 that is cis-related to the allele of the 1-base-pair indel (e.g., gene insertion or deletion, E134 deletion, and / or rs11307260 (SEQ No. 79)) SOD1 ) includes a sequence. An inhibitory nucleic acid, such as an antisense oligonucleotide (ASO), comprises, in any aspect or embodiment described herein, a superoxide dismutase 1 (comprising an allele of a 1-base-pair indel (e.g., E134 deletion, rs11307260, or SEQ ID NO. 79) SOD1 ) The allele can be preferentially repressed (e.g., its expression can be reduced). In any aspect or embodiment described herein, superoxide dismutase 1 ( SOD1 The ) allele includes the A5V mutation. In any aspect or embodiment described herein, the allele single-base pair SOD1-indel is cis-related to the A5V mutation.

[0138] In any aspect or embodiment described herein, the present disclosure relates to a chromosome 9 open decoding frame 72 having a repeat extension containing an allele of a 2-base-pair indel (e.g., a gene insertion or deletion). C9Orf72 ) provides an inhibitory nucleic acid (e.g., an antisense oligonucleotide (ASO)) that inhibits the expression of an allele. In any aspect or embodiment described herein, a mutant chromosome 9 open decoding frame 72 comprising an allele with a 2-base pair deletion ( C9Orf72The ) allele comprises SEQ ID NO. 2. A repressive nucleic acid, such as an antisense oligonucleotide (ASO), comprises, in any aspect or embodiment described herein, a chromosome 9 open reading frame 72 containing a 2-base pair C9 deletion ( C9Orf72 ) mutant alleles can be preferentially suppressed (e.g., their expression can be reduced). In any mode or embodiment described herein, chromosome 9 open decoding frame 72 ( C9Orf72 The ) allele includes a repeat extension within intron 1. In any mode or embodiment described herein, a 2-base-pair C9 deletion is chromosome 9 open decoding frame 72 ( C9Orf72 Repeat extensions within intron 1 of the gene are (i) on the same haploid type, or (ii) cis related.

[0139] In any aspect or embodiment described herein, the present disclosure provides a repressive nucleic acid (e.g., an antisense oligonucleotide (ASO)) that suppresses the expression of a transcription-reactive deoxyribonucleic acid (DNA)-binding protein 43 (TARDBP) allele containing a mutation (e.g., a point mutation). In any aspect or embodiment described herein, the mutant transcription-reactive deoxyribonucleic acid (DNA)-binding protein 43 (TARDBP) allele contains a point mutation at Q331 (e.g., a Q331K mutation). The repressive nucleic acid, such as the antisense oligonucleotide (ASO), may preferentially suppress (e.g., reduce the expression thereof) the transcription-reactive deoxyribonucleic acid (DNA)-binding protein 43 (TARDBP) mutant allele containing the mutation (e.g., a point mutation or a Q331K mutation) in any aspect or embodiment described herein.

[0140] In any mode or embodiment described herein, the repressive nucleic acid has a stronger binding affinity for one allele of the variant (e.g., common variant and / or indel) compared to another allele of the variant. For example, in any mode or embodiment described herein, the repressive nucleic acid has at least 2, 3, 4, or 5 times stronger binding affinity for a nucleic acid sequence containing a variant allele (e.g., common variant and / or indel) compared to the binding affinity for an alternative allele of the variant. In any aspect or embodiment described herein, the repressive nucleic acid has a binding affinity that is at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% stronger than the binding affinity for an alternative allele of said variant, for a nucleic acid sequence containing a variant allele (e.g., a common variant and / or an indel). Binding affinity may be measured using a fluorescence-based method, a single-molecule kinetics method, or any other binding assay known to those skilled in the art.

[0141] In any mode or embodiment described herein, the repressive nucleic acid inhibits or reduces the expression level (e.g., protein expression, gene expression, RNA expression, etc.) of a mutated allele, including a mutant and a target variant allele (e.g., common variant and / or indel), in a cell (e.g., a cell of the central nervous system) or a target, wherein the mutant is a gain-of-function mutant or a dominant-negative mutant. In any aspect or embodiment described herein, the repressive nucleic acid represses or reduces the expression level (e.g., protein expression, gene expression, RNA expression, etc.) of a mutated allele containing the mutation and the target variant allele (e.g., common variant and / or indel) by at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% compared to a control (e.g., baseline measurements or a control subject not administered the repressive nucleic acid), wherein the mutation is a gain-of-function mutation or a dominant-negative mutation. In any aspect or embodiment described herein, the repressive nucleic acid represses or reduces the expression level of a mutated allele containing the mutation and the target variant allele (e.g., common variant and / or indel), but does not substantially repress or reduce the expression level of an alternative allele. ,Herein, the mutation is a gain-of-function mutation or a dominant negative mutation. In any aspect or embodiment described herein, the repressive nucleic acid represses or reduces the expression level of the mutated allele, including the mutation and the target variant allele (e.g., common variant and / or indel), by at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% compared to the control group (e.g., baseline measurements or control subjects not administered the repressive nucleic acid), wherein the mutation is a gain-of-function mutation or a dominant negative mutation. In any aspect or embodiment described herein, the repressive nucleic acid represses or reduces the expression level of a mutated allele, including the mutant and target variant allele (e.g., common variant and / or indel), by at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% relative to the wild-type allele, wherein the mutant is a gain-of-function mutant or a dominant-negative mutant.

[0142] The repressive nucleic acid may also be 10 to 50 bases long, or 5 to 50 bases long. In any aspect or embodiment described herein, the repressive nucleic acid is 5 to 30 bases long (e.g., 10 to 30, 10 to 25, 15 to 25, or 19 to 22 bases). For example, in any aspect or embodiment described herein, the inhibitory nucleic acid is 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 bases long, or any combination of these numbers. In any aspect or embodiment described herein, the repressive nucleic acid comprises or consists of a base sequence having at least 80% or 90% complementarity with respect to the target nucleic acid, e.g., at least 5, 10, 15, 20, 25, or 30 bases of the target nucleic acid, or up to 30 or 40 bases. In any aspect or embodiment described herein, the repressive nucleic acid comprises or consists of a base sequence having up to 3 discrepancies (e.g., 0, 1, 2, or 3 discrepancies; up to 1 discrepancy; or up to 2 discrepancies) across 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 bases of the target nucleic acid.

[0143] In any aspect or embodiment described herein, any one or more thymidine (T) nucleotides or uridine (U) nucleotides in the sequence provided herein may be replaced with any other nucleotide suitable for base pairing with an adenosine nucleotide (e.g., via Watson-Crick base pairing). For example, T may be replaced with U, and U may be replaced with T. In any aspect or embodiment described herein, inhibition of gene expression in cells of the central nervous system A nucleic acid is provided. In any mode or embodiment described herein, the cell is a neuron, an astrocyte, or a oligodendrocyte.

[0144] In any aspect or embodiment described herein, the cell expresses a mutated allele comprising a target variant allele (e.g., common variant and / or indel) and a mutation that is a gain-of-function mutation or a dominant-negative mutation. In any aspect or embodiment described herein, the subject expresses a mutated allele comprising a target variant allele (e.g., common variant and / or indel) and a mutation that is a gain-of-function mutation or a dominant-negative mutation.

[0145] In any embodiment or aspect described herein, the antisense oligonucleotide (ASO) has a complementary region that is fully complementary to a portion of the target nucleic acid (e.g., target RNA). However, it should be understood that in any embodiment or aspect described herein, an antisense oligonucleotide (ASO) having less than 100% sequence complementarity with the target nucleic acid may be used. In any embodiment or aspect described herein, the complementary region of the antisense oligonucleotide (ASO) is complementary to at least six consecutive nucleotides of the target nucleic acid (e.g., at least seven, at least eight, at least nine, at least ten, at least eleven, at least twelve, at least thirteen, at least fourteen, at least fifteen, or more). In addition, in any aspect or embodiment described herein, in order to minimize the possibility of off-target effects, the antisense oligonucleotide (ASO) is designed not to have a sequence (e.g., five or more consecutive nucleotides) that has high complementarity with off-target nucleic acids (e.g., wild-type alleles, different mutant alleles, or combinations thereof).

[0146] Complementarity refers to the ability for precise pairing between two nucleotides. For example, if a nucleotide at a specific position on an antisense nucleic acid can hydrogen bond with a nucleotide at a corresponding position on a target nucleic acid (e.g., target RNA), the antisense nucleic acid and the target nucleic acid are considered complementary at that position. The antisense nucleic acid and the target nucleic acid are complementary if a sufficient number of corresponding positions within their respective molecules are occupied by nucleotides capable of hydrogen bonding with each other via their bases. Therefore, "complementarity" is a term used to indicate a sufficient degree of complementarity or precise pairing to allow for a stable and specific binding between the repressor nucleic acid (e.g., antisense nucleic acid) and the target nucleic acid. However, it must be understood that 100% complementarity is not essential. For example, in any aspect or embodiment described herein, the repressive nucleic acid (e.g., antisense nucleic acid, oligonucleotide, or a combination thereof) may be at least 80% (e.g., at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) complementary to a sequence of nucleotides of the target nucleic acid.

[0147] Accordingly, it is understood in the art that a complementary nucleotide sequence does not need to be 100% complementary to its target nucleotide sequence to be specifically hybridized. In any aspect or embodiment described herein, a complementary nucleic acid sequence for the purposes of this disclosure may be specifically hybridized if there is a sufficient degree of complementarity to avoid non-specific binding to a non-target nucleic acid, where binding of the sequence to the target nucleic acid produces the desired inhibition or reduction in expression, and under conditions where avoidance of non-specific binding is required, e.g., under physiological conditions in the case of in vivo assays or therapeutic treatments, and under appropriate strict conditions in the case of in vitro assays where such assays are performed.

[0148] Sequence identity for nucleic acid sequences can be determined through sequence comparison and alignment algorithms known in the art, including determining sequence complementarity. To determine the percentage of identity between two nucleic acid sequences, the sequences are aligned for the purpose of optimal comparison (e.g., a gap may be introduced in the first sequence or the second sequence for optimal alignment). Subsequently, nucleotides are compared at corresponding nucleotide positions. If a position in the first sequence is occupied by the same residue at the corresponding position in the second sequence, the molecules are identical at that position. In any aspect or embodiment described herein, the percentage of identity between two sequences is a function of the number of identical positions shared by the sequences (e.g., homology (%) = number of identical positions / total number of positions × 100), and the score may be arbitrarily penalized for the number of introduced gaps and / or the length of the introduced gaps.

[0149] In any aspect or embodiment described herein, the inhibitory nucleic acid of the present disclosure (e.g., antisense oligonucleotide (ASO)) has a length in the range of 5 to 40 nucleotides, 5 to 30 nucleotides, 10 to 30 nucleotides, 10 to 25 nucleotides, or 15 to 25 nucleotides. In any aspect or embodiment described herein, the repressive nucleic acid (e.g., antisense oligonucleotide (ASO)) has a length of 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, or more.

[0150] In any aspect or embodiment described herein, the repressive nucleic acid (e.g., antisense oligonucleotide (ASO)) is provided as a homogeneous preparation in which, for example, at least 85%, at least 90%, at least 95%, or at least 99% of the oligonucleotides are identical. For example, in any aspect or embodiment described herein, a homogeneous preparation of oligonucleotides is provided in which at least 85%, at least 90%, at least 95%, or at least 99% of the oligonucleotides in the preparation are 10 to 25 nucleotides long and the oligonucleotides comprise a complementary region that is complementary to at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 consecutive nucleotides of a target sequence comprising a variant (e.g., a first variant, a common variant, an indel, or a combination thereof; e.g., any one described herein).

[0151] The antisense nucleic acid of the present disclosure may be modified to achieve one or more desired properties (e.g., improved cellular uptake, improved stability, reduced immunogenicity, improved efficacy, improved target hybridization, sensitivity to RNase cleavage, etc.). The antisense nucleic acid may be modified in base moiety, sugar moiety, and / or phosphate backbone. Accordingly, the antisense nucleic acid may have one or more modified nucleotides (e.g., nucleotide analogs) and / or one or more backbone modifications (e.g., linkages between modified nucleotides). The antisense nucleic acid may have a combination of modified nucleotides and unmodified nucleotides. The antisense nucleic acid may also have a combination of linkages between modified nucleotides and linkages between unmodified nucleotides.

[0152] In any aspect or embodiment described herein, the inhibitory nucleic acid of the present disclosure (e.g., antisense oligonucleotide (ASO)) may comprise ribonucleotides, deoxyribonucleotides, and combinations thereof. Examples of modified nucleotides that may be used in the antisense nucleic acids of the present disclosure are, for example, as follows: 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-ioduracil, hypoxanthine, xanthine, 4-acetylcytosine, 5-(carboxyhydroxymethyl)uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylquinosine, inosine, N6-isopentenyladenine, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7-methylguanine, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, beta-D-mannosylquinosine, 5′-methoxycarboxymethyluracil, 5-methoxyuracil, 2-methylthio-N6-isopentenyladenine, uracil-5-oxyacetic acid(v), ybutoxin, pseudouracil, quiosin, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, uracil-5-oxyacetic acid methyl ester, uracil-5-oxyacetic acid(v), 5-methyl-2-thiouracil, 3-(3-amino-3-N-2-carboxypropyl)uracil, and 2,6-diaminopurine.

[0153] In any aspect or embodiment described herein, the repressive nucleic acid (e.g., antisense oligonucleotide (ASO)) is a capmer oligonucleotide. As used herein, the capmer oligonucleotide has the formula 5'-ABC-3', wherein B is the central segment of a nucleotide located on the sides of the 'A' and 'C' segments. In any aspect or embodiment described herein, the central 'B' segment comprises a continuous deoxynucleotide. The central segment may comprise 6 to 15 continuous deoxynucleotides (e.g., 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 continuous deoxynucleotides). In any aspect or embodiment described herein, the 'A' and / or 'C' side segments comprise a continuous ribonucleotide. The lateral segment may comprise 3 to 10 consecutive ribonucleotides (e.g., 3, 4, 5, 6, 7, 8, 9, or 10 consecutive ribonucleotides). In any embodiment or aspect described herein, the central segment may mobilize RNase (e.g., RNase H). In any embodiment or aspect described herein, the capmer binds to the target nucleic acid to mobilize RNase. In any embodiment or aspect described herein, the lateral segment comprises a modified nucleotide. In any embodiment or aspect described herein, each nucleotide of the lateral segment is a modified nucleotide (e.g., a modified ribonucleotide). In any embodiment or aspect described herein, the modified nucleotide is a 2' methoxyethyl modified nucleotide, a 2' o-methyl modified nucleotide, or a lock nucleic acid. In any embodiment or mode described herein, the two lateral segments comprise the same number of nucleotides. In any embodiment or mode described herein, the two lateral segments comprise different numbers of nucleotides.In some embodiments, the gapmer is a 5-10-5 gapmer (e.g., comprising a central segment of 10 2' deoxynucleotides flanked by 5 ribonucleotides, e.g., 5 2' methoxyethyl (MOE) ribonucleotides). In any aspect or embodiment described herein, the gapmer is a 4-8-4 gapmer (e.g., comprising a central segment of 8 2' deoxynucleotides flanked by 4 nucleotides, e.g., 4 lock nucleic acid (LNA) nucleotides).

[0154] In any aspect or embodiment described herein, the modified nucleotide is a 2'-modified nucleotide. For example, in any aspect or embodiment described herein, each 2'-modified nucleotide is a 2'-deoxy-modified nucleotide, a 2'-fluoro-modified nucleotide, a 2'-O-methyl-modified nucleotide, a 2'-O-methoxyethyl-modified nucleotide, a 2'-amino-modified nucleotide, or a 2'-aminoalkoxy-modified nucleotide. In any aspect or embodiment described herein, the 2'-modified nucleotide may comprise a 2'-O-4'-C methylene crosslink, such as a lock nucleic acid (LNA) nucleotide. In any aspect or embodiment described herein, the 2'-modified nucleotide may have a 2'-hydroxyl group connected to the 3' or 4' carbon atom of the corresponding sugar ring, thereby forming a cyclic sugar moiety. In these aspects and embodiments, the bond is a methylene (-CH2-) that crosslinks the 2' oxygen atom with the 3' or 4' carbon atom n It can be a period, where n is 1 or 2.

[0155] In any aspect or embodiment described herein, the repressive nucleic acid (e.g., antisense oligonucleotide (ASO)) comprises a combination of LNA nucleotides and unmodified nucleotides. In any aspect or embodiment described herein, the repressive nucleic acid (e.g., antisense oligonucleotide (ASO)) comprises a combination of LNA and RNA nucleotides. In any aspect or embodiment described herein, the repressive nucleic acid (e.g., antisense oligonucleotide (ASO)) comprises a combination of LNA and DNA nucleotides. In any aspect or embodiment described herein, the oligonucleotide modification of the repressive nucleic acid (e.g., antisense oligonucleotide (ASO)) comprises a lock nucleic acid (LNA) in which a 2'-hydroxyl group is connected to the 3' or 4' carbon atom of the corresponding sugar ring, thereby forming a cyclic sugar moiety.

[0156] In any aspect or embodiment described herein, the repressive nucleic acid (e.g., antisense oligonucleotide (ASO)) comprises a nucleobase-modified nucleotide (e.g., a nucleotide containing a non-naturally occurring nucleobase instead of a naturally occurring nucleobase). For example, in any aspect or embodiment described herein, the base may be modified to block the activity of adenosine deaminase. In any aspect or embodiment described herein, the modified nucleobase comprises, but is not limited to: uridine and / or cytidine modified at the 5-position (e.g., 5-(2-amino)propyl uridine, 5-bromo uridine); adenosine and / or guanosine modified at the 8-position (e.g., 8-bromo guanosine); deaza nucleotide (e.g., 7-deaza-adenosine); O- and N-alkylated nucleotides (e.g., N6-methyladenosine). It should be noted that the aforementioned variations can be combined.

[0157] In the inhibitory nucleic acid of the present disclosure (e.g., antisense oligonucleotide (ASO)), a number of nucleotides as few as one and as many as all nucleotides may be modified. For example, an oligonucleotide (e.g., a 20-nucleotide-long oligonucleotide) may contain 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 modified nucleotides. In any aspect or embodiment described herein, the modified oligonucleotide contains the minimum number of modified nucleotides necessary to achieve the desired level of in vitro or in vivo stability and / or bioaccessibility or other desired properties.

[0158] In any aspect or embodiment described herein, the repressive nucleic acid (e.g., antisense oligonucleotide (ASO)) may comprise nonionic DNA analogs, such as alkyl-phosphates and / or aryl-phosphates (where the charged phosphonate oxygen is replaced by an alkyl or aryl group), phosphodiesters and / or alkylphosphotriesters (where the charged oxygen moiety is alkylated), or combinations thereof. Nucleic acids containing a diol, such as tetraethylene glycol or hexaethylene glycol, at either or both of the ends have also been found to be substantially resistant to nuclease degradation and may be used herein. In any aspect or embodiment described herein, the antisense nucleic acid may comprise at least one lipophilic substituted nucleotide analog and / or pyrimidine-purine dinucleotide.

[0159] In any embodiment or aspect described herein, the antisense nucleic acid (e.g., oligonucleotide) may have one or two accessible 5' ends. In any embodiment or aspect described herein, the modified oligonucleotide has two such 5' ends (e.g., by attaching two oligonucleotides via a 3'-3' linkage to produce an oligonucleotide having one or two accessible 5' ends). In any embodiment or aspect described herein, the 3'3'-linkage may be a phosphodiester, a phosphorothioate, or any other crosslink between modified nucleosides. Additionally, in any aspect or embodiment described herein, 3'3'-linked oligonucleotides in which the linkage between 3'-terminal nucleosides is not a phosphodiester, phosphorothioate, or other modified crosslinking may be prepared using additional spacers such as tri-ethylene glycol phosphate moiety or tetra-ethylene glycol phosphate moiety.

[0160] In any aspect or embodiment described herein, the linkage between phosphodiester nucleotides of the antisense nucleic acid may be replaced with a modified linkage. In any aspect or embodiment described herein, the modified linkage may be selected, for example, from the following: phosphorothioate, phosphorodithioate, NR1R2-phosphomidate, boranophosphate, α-hydroxybenzyl phosphonate, phosphate-(C1-C21)-O-alkyl ester, phosphate-[(C6-C12)aryl-(C1-C21)-O-alkyl]ester, (C1-C8)alkylphosphonate and / or (C6-C12)arylphosphonate crosslinking, and (C7-C12)-α-hydroxymethyl-aryl.

[0161] In any aspect or embodiment described herein, the phosphate backbone of a repressive nucleic acid (e.g., antisense oligonucleotide (ASO)) is modified to produce a peptide nucleic acid molecule. As used herein, the term “peptide nucleic acid” or “PNA” refers to a nucleic acid mimic, for example, a DNA mimic in which the deoxyribose phosphate backbone is replaced by a pseudopeptide backbone and which retains only four natural nucleotides. . The neutral backbone of PNA has been found to enable specific hybridization with DNA and RNA under conditions of low ionic strength. The synthesis of PNA oligomers can be performed, for example, using standard solid-phase peptide synthesis protocols.

[0162] In any aspect or embodiment described herein, the repressive nucleic acid (e.g., antisense oligonucleotide (ASO)) is formulated into a morpholino oligonucleotide. In such an embodiment, the riboside moiety of each subunit of the oligonucleotide of the oligonucleotide reagent is converted to a morpholine moiety. In any aspect or embodiment described herein, the morpholino may be modified, for example, as a peptide-conjugated morpholino, a phosphorodiamidate morpholino, etc.

[0163] In any aspect or embodiment described herein, the inhibitory nucleic acid (e.g., antisense oligonucleotide (ASO)) is linked to a functional group such as a peptide (e.g., a peptide for targeting a host cell receptor in vitro or in vivo) or an agent that facilitates transport across a cell membrane or the blood-brain barrier. In any aspect or embodiment described herein, the oligonucleotide reagent of the present disclosure is modified with a chemical moiety (e.g., cholesterol) that improves the in vivo pharmacological properties of the oligonucleotide reagent.

[0164] Pharmaceutical composition

[0165] According to some aspects of the present disclosure, a composition comprising a formulation (e.g., an inhibitory nucleic acid (e.g., an antisense oligonucleotide (ASO) or a vector containing the same)) and a carrier is provided. As used herein, the term “carrier” refers to a natural or synthetic organic or inorganic component that is combined with an active ingredient to promote an intended use. For example, a pharmaceutical composition comprising an antisense nucleic acid and a pharmaceutically acceptable carrier is provided. As used herein, the term “pharmaceutically acceptable carrier” refers to a carrier suitable for pharmaceutical administration. The term pharmaceutically acceptable carrier includes a compatible solid or liquid filler, diluent, or encapsulating material suitable for administration to humans or other vertebrates.

[0166] The components of the pharmaceutical composition may also be mixed with and together with the formulations of the present disclosure in such a manner that no interactions occur that would substantially impair the desired pharmaceutical efficacy. The pharmaceutical composition may include solvents, dispersion media, coatings, antimicrobial and antifungal agents, isotonic and absorption retardants, and other suitable components suitable for pharmaceutical administration. Co-activators may also be incorporated into the composition. The active ingredient (e.g., inhibitory nucleic acid or antisense oligonucleotide (ASO)) may be mixed or combined with any conventional pharmaceutically acceptable carrier or excipient. The pharmaceutical composition is generally sterile and is prepared using aseptic techniques. Sterile phosphate-buffered saline is an example of a pharmaceutically acceptable carrier. Other suitable carriers may be used. The pharmaceutical composition may also include suitable solid or gel carriers or excipients. Examples of such carriers or excipients include, but are not limited to, calcium carbonate, calcium phosphate, various sugars, starch, cellulose derivatives, gelatin, and polymers such as polyethylene glycol.

[0167] Inhibitory nucleic acid may be administered as itself (pure) or in the form of a pharmaceutically acceptable salt. When used in medicine, the salt is generally pharmaceutically acceptable, but pharmaceutically unacceptable salts may also be conveniently used to prepare a pharmaceutically acceptable salt thereof. Such salts include, but are not limited to, salts prepared from the following acids: hydrochloric acid, hydrobromide, sulfuric acid, nitric acid, phosphoric acid, maleic acid, acetic acid, salicylic acid, p-toluenesulfonic acid, tartaric acid, citric acid, methanesulfonic acid, formic acid, malonic acid, succinic acid, naphthalene-2-sulfonic acid, and benzenesulfonic acid. Additionally, such salts may be prepared as alkali metal salts or alkaline earth metal salts, such as sodium, potassium, or calcium salts of carboxylic acid groups.

[0168] Exemplary buffers include acetic acid and salt (1–2% w / v); citric acid and salt (1–3% w / v); boronic acid and salt (0.5–2.5% w / v); and phosphate and salt (0.8–2% w / v). Suitable preservatives include benzalkonium chloride (0.003–0.03% w / v); chlorobutanol (0.3–0.9% w / v); parabens (0.01–0.25% w / v); and thimerosal (0.004–0.02% w / v).

[0169] The composition may be conveniently provided in unit dosage forms and may be prepared by any method known in the pharmaceutical field. All methods include the step of combining the said formulation with a carrier constituting one or more auxiliary components. Generally, the composition is prepared by the step of uniformly and closely combining the said formulation with a liquid carrier, a finely ground solid carrier, or both, and then, if necessary, molding the said product. Liquid dosage units are vials or ampoules. Solid dosage units are tablets, capsules, and suppositories.

[0170] An effective amount of an inhibitory nucleic acid (e.g., an antisense oligonucleotide (ASO)) capable of inhibiting a mutated allele, including a target variant allele and a mutation, is also referred to as a therapeutic effective amount, wherein said mutation is a gain-of-function mutation or a dominant-negative mutation, and said effective amount is an amount sufficient to alleviate at least one adverse effect associated with gene expression in a cell or organism requiring such regulation, or an amount sufficient to reduce expression. The therapeutic effective amount to be included in a pharmaceutical composition may be selected based on a number of factors, e.g., the type, physique, and condition of the patient to be treated, the intended mode of administration, the patient's ability to accept the intended mode of administration, etc.

[0171] In any aspect or embodiment described herein, the inhibitory nucleic acid may be prepared as a colloidal dispersant system. Colloidal dispersant systems include lipid-based systems comprising oil-in-water emulsions, micelles, mixed micelles, and liposomes. An example of a colloidal system that can be used in the method provided herein is a liposome. A liposome is an artificial membrane vessel useful for delivering antisense nucleic acid in vivo or in vitro. Large monolayer vesicles have been found to be capable of encapsulating large macromolecules. Nucleic acids and other components (e.g., viral vectors) can be encapsulated within an aqueous medium and delivered to cells in a biologically active form. Liposomes can be targeted to specific tissues by coupling the liposome to a specific ligand, such as a monoclonal antibody, sugar, glycolipid, or protein. For example, ligands that may be useful for the targeting of liposomes to smooth muscle cells or skeletal muscle cells include, but are not limited to, whole molecules or fragments thereof, such as molecules that interact with muscle cell-specific receptors and antibodies that interact with cell surface markers. Lipid formulations for transfection are commercially available from QIAGEN, for example, as EFFECTENE™ (non-liposomal lipids with specialized DNA condensation enhancers) and SUPERFECT™ (dendritic technique). Liposomes are commercially available from Invitrogen, Life Technologies, for example, as LIPOFECTIN™, which is formed from cationic lipids such as N-[1-(2,3-dioleyloxy)-propyl]-N,N,N-trimethylammonium chloride (DOTMA) and dioleoyl phosphotidylethanolamine (DOPE), as well as other lipid-based reagents including lipofectamine and oligofectamine. In particular, certain cationic lipids, including N-[1-(2,3-dioleoyloxy)-propyl]-N,N,N-trimethylammonium methyl-sulfate (DOTAP), may be advantageous when combined with the ASO analogs of the present disclosure.

[0172] In any aspect or embodiment described herein, a repressive nucleic acid (e.g., an antisense oligonucleotide (ASO)) is formulated with a biocompatible microparticle or implant suitable for implantation or administration to a recipient. The biodegradable implant may comprise a biodegradable polymer matrix for containing, for example, an exogenous expression construct engineered to express the antisense nucleic acid under the control of a suitable promoter. The polymer matrix may be used to achieve sustained-release of the therapeutic agent in the subject. The polymer matrix may be in the form of microparticles, such as microspheres, in which the antisense nucleic acid and / or other therapeutic agent is dispersed throughout a solid polymer matrix or microcapsule, wherein the antisense nucleic acid and / or other therapeutic agent is stored in the core of the polymer shell. Other forms of the polymer matrix for containing the therapeutic agent include films, coatings, gels, implants, and stents. The matrix composition may also be selected to release via diffusion over an extended period without degradation. In some embodiments, the repressive nucleic acid is administered to the subject via the implant while the other therapeutic agent is administered.

[0173] Both non-biodegradable and biodegradable polymer matrices can be used to deliver ASOs and / or other therapeutic agents to a target. Preferably, a biodegradable matrix is ​​used. Such polymers may be natural or synthetic polymers. Based on the required release period, the polymer is generally selected within the range of several hours to one year or longer. Typically, release over a period ranging from several hours to 3 to 12 months may be used. The polymer may be in the form of a hydrogel, for example, capable of absorbing water up to about 90% by weight, and may optionally be in the form of a hydrogel cross-linked with polyvalent ions or other components, for example, the polymer.

[0174] Other exemplary compositions that can be used to facilitate the absorption of nucleic acids include calcium phosphate and other chemical mediators of intracellular transport, microinjection compositions, electroporation, and homologous recombination compositions (e.g., for incorporating nucleic acids into pre-selected sites within target cell chromosomes). .

[0175] In addition to the formulations described above, the formulation may also be formulated as a depot formulation. Such long-acting formulations may be formulated with a suitable polymer or hydrophobic material or ion exchange resin (e.g., as an emulsion in an acceptable oil), or as a sparingly soluble derivative, such as a sparingly soluble salt.

[0176] Other suitable liquid or solid pharmaceutical formulation forms are, for example, aqueous solutions or saline solutions for inhalation, microencapsulated forms, cochleated forms, forms coated on fine gold particles, forms contained in liposomes, spray forms, aerosol forms, pellets for intradermal implantation, or forms dried on a sharp object for scraping and penetrating the skin. Pharmaceutical compositions also include granules, powders, tablets, coated tablets, (micro)capsules, suppositories, syrups, emulsions, suspensions, creams, droplets, or formulations releasing the active compound in a sustained-release form, and excipients and additives and / or adjuvants such as disintegrants, binders, coating agents, swelling agents, lubricants, flavoring agents, sweeteners, or solubilizers are customarily used in their preparation as described above. Suitable carriers can be readily selected by those skilled in the art in consideration of the indications in which inhibitory nucleic acids (e.g., ASOs) are induced. For example, one of the suitable carriers includes a saline solution that can be formulated using various buffer solutions (e.g., phosphate-buffered saline). .Other exemplary carriers include sterile saline, lactose, sucrose, calcium phosphate, gelatin, dextran, agar, pectin, peanut oil, sesame oil, and water. Other carriers will also be obvious to those skilled in the art.

[0177] Optionally, the composition of the present invention may contain other conventional pharmaceutical components, such as preservatives or chemical stabilizers, in addition to the ASO and carrier(s). Suitable exemplary preservatives include chlorobutanol, potassium sorbate, sorbic acid, sulfur dioxide, propyl gallate, parabens, ethyl vanillin, glycerin, phenol, and parachlorophenol. Suitable chemical stabilizers include gelatin and albumin.

[0178] The pharmaceutical composition is suitable for use in various drug delivery systems. Delivery vehicles such as liposomes, nanocapsules, microparticles, microspheres, lipid particles, vesicles, etc., can be used to introduce the composition of the present invention into suitable host cells.

[0179] The formation and use of liposomes are generally known to those skilled in the art. Recently, liposomes with improved serum stability and circulating half-life have been developed (U.S. Patent No. 5,741,516). In addition, various methods for liposomes and liposome-like formulations as potential drug carriers have been described (U.S. Patents No. 5,567,434; 5,552,157; ​​5,565,213; 5,738,868, and 5,795,587).

[0180] Liposomes have been successfully used in numerous cell types that normally exhibit resistance to transfection through other procedures. Furthermore, liposomes do not have DNA length constraints, which are typical limitations of virus-based delivery systems. Liposomes have been effectively used to introduce genes, drugs, radiotherapeutics, viruses, transcription factors, and allosteric effectors into various cultured cell lines and animals. Additionally, several successful clinical trials investigating the efficacy of liposome-mediated drug delivery have been completed.

[0181] Liposomes are formed from phospholipids dispersed in an aqueous medium and spontaneously form multilayer concentric bilayer vesicles (also referred to as multilayer vesicles (MLVs)). MLVs generally have a diameter of 25 nm to 4 μm. Ultrasonic treatment of MLVs forms small monolayer vesicles (SUVs) with a diameter in the range of 200 to 500 Angstroms, containing an aqueous solution within the core.

[0182] Alternatively, nanocapsule formulations of inhibitory nucleic acids (e.g., ASOs) may be used. Nanocapsules can generally capture substances in a stable and reproducible manner. To avoid adverse effects caused by intracellular polymer overload, these ultrafine particles (approx. 0.1 μm in size) must be designed using polymers that can degrade in vivo. For such applications, biodegradable polyalkyl-cyanoacrylate nanoparticles that meet these requirements are considered.

[0183] In addition to the delivery methods described above, the following techniques are also considered as alternative methods for delivering inhibitory nucleic acid (e.g., ASO) compositions to a host. Ultrasonics (e.g., ultrasound) has been used as a device to enhance the rate and efficiency of drug penetration into the circulatory system, as described in U.S. Patent No. 5,656,016. Other alternatives for drug delivery considered include intraosseous injection (U.S. Patent No. 5,779,708), microchip devices (U.S. Patent No. 5,797,898), ophthalmic formulations, transdermal substrates (U.S. Patents No. 5,770,219 and 5,783,208), and feedback-controlled delivery (U.S. Patent No. 5,697,899).

[0184] Kit and related composition

[0185] The inhibitory nucleic acids (e.g., antisense oligonucleotides) and compositions described herein may, in one embodiment, be assembled into a pharmaceutical, diagnostic, or research kit to facilitate their use in therapeutic, diagnostic, or research applications. The kit may comprise one or more containers containing the components of the present invention and instructions for use. Specifically, such a kit may contain one or more of the formulations described herein, along with instructions describing the intended application and the proper use of these formulations. In certain embodiments, the formulations within the kit may be present in pharmaceutical formulations and dosages suitable for specific uses and methods of administration of the corresponding formulations. Kits for research purposes may contain components at appropriate concentrations or amounts for performing various experiments.

[0186] Kits may be designed to facilitate the use of the methods described herein by researchers and may take on a number of forms. Each composition of the kit may be provided, where applicable, in a liquid form (e.g., in a solution form) or in a solid form (e.g., in a dry powder form). In certain cases, some of the compositions may be reconstituted by the addition of a suitable solvent or other substance (e.g., water or cell culture medium) or otherwise treated (e.g., converted into an active form), and such solvent or substance may or may not be provided with the kit. As used herein, “Instructions” may define instructions and / or promotional content and typically include written instructions listed on the packaging of the invention or associated therewith. Instructions may also include any oral or electronic instructions, provided that the user can clearly recognize that such instructions are related to the kit, such as audiovisual instructions (e.g., videotapes, DVDs, etc.), internet instructions, and / or web-based communication instructions. Written guidance may be in a form prescribed by the government agency regulating the manufacture, use, or sale of the medicine or biological product, and such guidance may also reflect the relevant agency's approval for manufacture, use, or sale for animal administration.

[0187] The kit may contain any one or more of the components described herein in one or more containers. As an example, in one embodiment, the kit may include instructions for mixing one or more of the components of the kit and / or isolating and mixing samples, and for application to a subject. The kit may include a container for containing the formulation described herein. The formulation may be in liquid, gel, or solid (powder) form. The formulation may be manufactured under sterile conditions, packaged in a syringe, and shipped under refrigeration. Alternatively, the formulation may be contained in a vial or other container for storage. The second container may contain another formulation manufactured under sterile conditions. Alternatively, the kit may include a form in which an active agent is pre-mixed and shipped in a syringe, vial, tube, or other container. The kit may have one or more or all components required for administering the formulation to a subject, such as a syringe, a topical application device, or an IV needle tube and bag.

[0188] Exemplary embodiments of the present invention are described in more detail through the following examples. These embodiments are examples of the present invention, and those skilled in the art will recognize that the present invention is not limited to such exemplary embodiments.

[0189] Example 1. Identification of C9Orf72 Indels and SNPs

[0190] 204 people reported to have repeated expansion C9Orf72 Using whole-genome sequencing (WGS) data from patients, which can be used as targets for allele-specific antisense technology C9Orf72 Variants of were identified. C9Orf72 Two insertion / deletion (indel) variants and 10 single nucleotide polymorphisms (SNPs) exhibiting a high heterozygosity rate (approx. 80%) in patients were identified and evaluated.

[0191] The RS numbers for the two indels were rs142843265 (sequence number 64) and rs34620383 (sequence number 65). The variant alleles in the non-equilibrium linkage (LD) were consistently located on the same chromosome (co-inherited). As shown in Fig. 1, C9orf72 A two-base pair deletion in (C9-deletion or C9-del; rs142843265 (SEQ No. 64)) was identified as a non-equilibrium connection state with a G4C2 repeat extension. The heterozygosity frequency of the C9-deletion indel is C9Orf72 It was 79% in patients. The inventors found that a 2-base pair deletion (e.g., see FIG. 1; referred to as a "C9 deletion") C9Orf72 It was identified that G4C2 iterative expansion and non-equilibrium connection state were present. C9Orf72 The sequence variant includes a 2-base pair C9 deletion and includes SEQ ID NO. 2. Accordingly, targeting of this single indel allele is C9Orf72 Patient (e.g., , C9Orf72 It can treat about 80% of patients who have recurrence, or who have or are suspected of having ALS or FTD.

[0192] The RS numbers for the 10 SNPS were as follows: rs2453565 (sequence number 66), rs700828 (sequence number 67), rs774356 (sequence number 68), rs774357 (sequence number 69), rs774359 (sequence number 70), rs2453554 (sequence number 71), rs2484319 (sequence number 72), rs2453555 (sequence number 73), rs2492816 (sequence number 74), and rs3849945 (sequence number 75).

[0193] Example 2. ASO-targeted indel exhibits allele-specific knockdown

[0194] Mutated containing C9 deletion C9Orf72Antisense oligonucleotides (ASOs) for targeting genes were designed using 1-base pair tiling across the corresponding indel sites (Fig. 1). ASOs were synthesized using two different chemical methods: (1) a 5-10-5 MOE capmer technique (a central segment of 10 2' deoxynucleotides flanked by 5 2' methoxyethyl (MOE) ribonucleotides); and (2) a 4-8-4 LNA capmer technique (a central segment of 8 or 9 2' deoxynucleotides flanked by 4 lock nucleotides (LNA) nucleotides). The specific antisense oligonucleotides synthesized and tested are provided in Table 1.

[0195] In individual experiments, either a cell homozygous for the minor allele of rs142843265 (C9-del / C9-del; described in Fig. 1) or a cell homozygous for the major allele of rs142843265 (WT / WT; described in Fig. 1) was contacted with the synthesized ASO (at a concentration of 100 nM). As shown in Fig. 2, the ASO C9Orf72 To suppress expression, cells homozygous for the minor allele of rs142843265 (C9-del / C9-del) were preferentially targeted. It was found that positioning a segment of the ASO complementary to the C9-deleted indel at the center of the ASO often provided the best choice for C9-deleted suppression compared to wild-type suppression. See also Figures 4a and 6a. For example, an ASO containing a sequence complementary to SEQ ID NO. 12 or 13 in C9-del / C9-del cells C9Orf72 Repression of expression by about 80%, and in wild-type cells C9Orf72 It caused about 5–10% inhibition of expression.

[0196] In addition, a double luciferase assay was performed to evaluate the allele-specific ASO of the present example. Briefly, as shown in FIG. 3a, the double luciferase assay used two luciferase genes, wherein the first gene is at its 3' end C9Orf72 It included a portion of the gene. At the 3' end of the first luciferase gene. C9Orf72 Binding of the ASO to the gene (SEQ No. 1 or SEQ No. 2) reduced expression from the first luciferase gene. The second luciferase gene served as an internal control for normalization purposes. The candidate target regions were cloned into a luciferase expression vector (pmirGLO vector, as shown in Fig. 3b). Subsequently, these expression vectors were transfected into HEK293 cells in a 96-well plate format. Cells were exposed to antisense oligonucleotides (ASOs), and luciferase expression was measured. Untreated cells, scrambled ASO (i.e., C9Orf72 Cells treated with (not specific to the target region, WT, or C9-del) and a non-selective ASO (targeting both allelic target sequences) were used as controls. Table 1 and Figures 4a (MOE capmer) and 6a (LNA capmer) provide mean inhibition percentage data obtained using these luciferase screening assays.

[0197]

[0198]

[0199] As provided in Table 1, several tested MOE capmer ASOs (Fig. 4a) were found to be effective in reducing gene expression in an allele-specific manner in these luciferase assays (i.e. ,(The expression of the mutant C9-del allele was reduced more significantly compared to the normal allele). In particular, MOE Gapmer (ASO 8) of SEQ ID NO. 30 showed a strong allele-specific reduction in gene expression (Fig. 4b). In addition, MOE Gapmer (ASO 8) of SEQ ID NO. 30 was able to reduce gene expression in a dose-dependent manner (Fig. 4c).

[0200] As provided in Table 1, several tested LNA capmer ASOs (Fig. 6a) were found to be effective in reducing gene expression in an allele-specific manner in these luciferase assays (i.e. , (The expression of the mutant C9-del allele was reduced more significantly compared to the normal allele). In particular, the LNA Gapmer of SEQ ID NO. 51 (LNA 9) and the LNA Gapmer of SEQ ID NO. 52 (LNA 10) exhibited a strong allele-specific reduction in gene expression (Fig. 6b). Furthermore, while the LNA Gapmer of SEQ ID NO. 52 (LNA 10) could reduce gene expression in a dose-dependent manner, the LNA Gapmer of SEQ ID NO. 51 (LNA 9) was found to possess a strong knockdown ability even at the lowest concentration tested (Fig. 6c).

[0201] Example 3. Additional cell experiments demonstrating the efficacy of ASO

[0202] The efficacy of the ASO synthesized in Example 2 was further evaluated in additional cell experiments. qRT-PCR assays were also used to determine the total C9Orf72 Knockdown was measured directly. Fibroblasts were plated in 6-well plates, grown overnight, and then treated with 100 nM ASO for 72 hours. RNA was isolated from the cells, converted to complementary DNA (cDNA), and used as input material for qRT-PCR. Using 100 ng from each sample, HPRT (control) and C9Orf72Probing was performed. The procedure was run twice for each sample, and C9 levels were normalized to HPRT and untreated controls as shown in Figs. 2, 5, 7, 16a, 16c, and 17. Bulk RNAseq analysis was used to determine allele-specific knockdown of mutant C9 proliferation containing relative levels of alleles and WT alleles.

[0203] MOE capmer (C9_GM_9; ASO 8) of SEQ ID NO. 30 and LNA capmer (C9_LNA_9; ASO 9) of SEQ ID NO. 51 were shown to be capable of specifically reducing alleles in gene expression in fibroblasts. Refer to Fig. 5 (MOE capmer) and Fig. 7 (LNA capmer). The control group did not show an allele-specific reduction in gene expression. In particular, the control ASO from the literature by Lagier-Tourenne, C et al. [ "Targeted degradation of sense and antisense C9orf72 RNA foci as therapy for ALS and frontotemporal degeneration". PNAS 2013 Nov 19;110(47):E4530-9] did not show the ability to provide an allele-specific reduction in gene expression (Fig. 7).

[0204] Example 4: Location of the C9 deletion variant and the second variant within the C9Orf72 gene

[0205] Figure 8 shows the location of a second variant (rs10757668) within the C9Orf72 transcription region that can be used to evaluate allele-specific transcript knockdown in a sample that is heterozygous for both variants, and a C9 deletion variant (rs142843265) that is a target of C9Orf72 ASO.

[0206] Example 5: Experiment confirming the reduction of individual allele expression in cells

[0207] Using bulk RNA sequencing, the reduction in expression from specific alleles in fibroblasts was evaluated. Fibroblasts were plated in 6-well plates, grown overnight, and then treated with 100 nM ASO for 72 hours. RNA was isolated from the cells and sent to the Yale Genome Center for library construction and sequencing. 100 M reads were performed per sample, and the percentage of present WT alleles was calculated based on the presence of rs9103 levels found in each sample. From this analysis, and as presented in Table 2, treatment with the LNA capmer of SEQ ID NO. 51 (C9_LNA_9; ASO 9) was capable of specifically reducing mutant alleles in gene expression in fibroblasts, resulting in a higher proportion of gene expression generated from WT alleles. In particular, NATMED 22 ASO (a previously described allele-specific C9Orf72 ASO; Tran et al. [Suppression of mutant C9Orf72 expression by a potent mixed backbone antisense oligonucleotide. Nature Medicine Nat Med. 2022 Jan; 28(1) 117-124]) was able to reduce overall C9Orf72 expression but did not increase the expression portion of the WT allele as much as LNA #9 (see table below).

[0208]

[0209] Example 6: Experiment demonstrating that allele-specific ASO treatment on patient cells partially saves the patient phenotype

[0210] The ability of the ASO synthesized in Example 2 to alter known disease phenotypes was evaluated in heterozygous patient C9Orf72 fibroblasts carrying C9-deleted variants and ASP SNPs. See Fig. 8. Fibroblasts were plated in 24-well plates with two duplicates (one set on the coverslip and one set directly on the plate) and then treated with 100 nM ASO for 48 hours. The reduction in C9Orf72 expression in ASO-treated cells was confirmed using the qRT-PCR assay mentioned in Example 3. For RNA lesion staining, duplicate cells on the coverslip were treated with the probe described in the same paper as described in Almeida A et al. ["Modeling key pathological features of frontotemporal dementia with C9ORF72 repeat expansion in iPSC-derived human neurons." Acta Neuropathol (2013) 126:385-399]. As shown in FIGS. 9a, 9b, and 9c, treatment with the LNA capper of SEQ ID NO. 51 (C9_LNA_9; ASO 9) was able to reduce both the number of intracellular lesions and the total number of cells with RNA lesions in the corresponding cells.

[0211] Example 7. Development of an allele-specific antisense oligonucleotide against superoxide dismutase 1 (SOD1)

[0212] Bioinformatics analysis of the superoxide dismutase 1 (SOD1) gene identified common single-base-pair indels in intron 4 (SEQ No. 77 (insertion allele) and SEQ No. 78 (deletion allele)). When determined via the gnomAD database, these indels (rs11307260 SEQ No. 79) exhibit a heterozygotic frequency of 49.8% in the population and are not located in repeat regions. Accordingly, these indels were selected for the development of allele-specific antisense oligonucleotides. Two sets of lock nucleotides (LNA) cappers and two sets of methoxyethyl (MOE) antisense oligonucleotides were synthesized for the insertion / deletion alleles, and the variants were positioned near the center. Antisense oligonucleotides targeting variants with more bases are referred herein as long or insertion antisense oligonucleotides or alleles. Conversely, antisense oligonucleotides targeting variants with fewer bases are referred herein as short or deletion antisense oligonucleotides or alleles.

[0213] The sequence of the short (deletion) allele antisense oligonucleotide (short SOD1 LNA) was as follows:

[0214] +C*+T*+T*A*A*T*A*C*T*T*T*A*G*C*A*A*C*+A*+G*+T, where + represents a lock nucleic acid and * represents a nucleic acid having a phosphorothioate backbone / binding (Sequence No. 80).

[0215] The sequence of the long (inserted) allele antisense oligonucleotide (long SOD1 LNA) was as follows:

[0216] +C*+T*+T*A*A*T*A*C*T*T*T* A*A* G*C*A*A*+C*+A*+G, where + represents a lock nucleic acid and * represents a nucleic acid having a phosphorothioate backbone / binding (Sequence No. 81).

[0217] Tiling was performed on short (deletion) methoxyethyl (MOE) antisense oligonucleotides, referred herein as SOD1 short-1 to SOD1 short-11. The nucleotide sequences of SOD1 short-1 to SOD1 short-11 were as follows:

[0218] SOD1 Short-1:

[0219] / 52MOErA / * / i2MOErA / * / i2MOErA / * / i2MOErT / * / i2MOErC / *T*T*A*A*T*A*C*T*T*T* / i2MOErA / * / i2MOErG / * / i2MOErC / * / i2MOErA / * / 32MOErA / (SEQ No. 104), where i2MOEr represents a 2'-O-methoxy-ethyl base (2'-MOE) and * represents a nucleic acid having a phosphorothioate backbone / bond.

[0220] SOD1 Short-2:

[0221] / 52MOErA / * / i2MOErA / * / i2MOErT / * / i2MOErC / * / i2MOErT / *T*A*A*T*A*C*T*T*T*A* / i2MOErG / * / i2MOErC / * / i2MOErA / * / i2MOErA / * / 32MOErC / (SEQ No. 105), where i2MOEr represents a 2'-O-methoxy-ethyl base (2'-MOE) and * represents a nucleic acid having a phosphorothioate backbone / bond.

[0222] SOD1 Short-3:

[0223] / 52MOErA / * / i2MOErT / * / i2MOErC / * / i2MOErT / * / i2MOErT / *A*A*T*A*C*T*T*T*A*G* / i2MOErC / * / i2MOErA / * / i2MOErA / * / i2MOErC / * / 32MOErA / (SEQ No. 106), where i2MOEr represents a 2'-O-methoxy-ethyl base (2'-MOE) and * represents a nucleic acid having a phosphorothioate backbone / bond.

[0224] SOD1 Short-4:

[0225] / 52MOErT / * / i2MOErC / * / i2MOErT / * / i2MOErT / * / i2MOErA / *A*T*A*C*T*T*T*A*G*C* / i2MOErA / * / i2MOErA / * / i2MOErC / * / i2MOErA / * / 32MOErG / (SEQ No. 107), where i2MOEr represents a 2'-O-methoxy-ethyl base (2'-MOE) and * represents a nucleic acid having a phosphorothioate backbone / bond.

[0226] SOD1 Short-5 (also referred to as Short SOD1 MOE at this hospital):

[0227] / 52MOErC / * / i2MOErT / * / i2MOErT / * / i2MOErA / * / i2MOErA / *T*A*C*T*T*T*A*G*C*A* / i2MOErA / * / i2MOErC / * / i2MOErA / * / i2MOErG / * / 32MOErT / (SEQ No. 82), where i2MOEr represents a 2'-O-methoxy-ethyl base (2'-MOE) and * represents a nucleic acid having a phosphorothioate backbone / bond.

[0228] SOD1 Short-6:

[0229] / 52MOErT / * / i2MOErT / * / i2MOErA / * / i2MOErA / * / i2MOErT / *A*C*T*T*T*A*G*C*A*A* / i2MOErC / * / i2MOErA / * / i2MOErG / * / i2MOErT / * / 32MOErA / (SEQ No. 108), where i2MOEr represents a 2'-O-methoxy-ethyl base (2'-MOE) and * represents a nucleic acid having a phosphorothioate backbone / bond.

[0230] SOD1 Short-7:

[0231] / 52MOErT / * / i2MOErA / * / i2MOErA / * / i2MOErT / * / i2MOErA / *C*T*T*T*A*G*C*A*A*C* / i2MOErA / * / i2MOErG / * / i2MOErT / * / i2MOErA / * / 32MOErT / (SEQ No. 109), where i2MOEr represents a 2'-O-methoxy-ethyl base (2'-MOE) and * represents a nucleic acid having a phosphorothioate backbone / bond.

[0232] SOD1 Short-8:

[0233] 52MOErA / * / i2MOErA / * / i2MOErT / * / i2MOErA / * / i2MOErC / *T*T*T*A*G*C*A*A*C*A* / i2MOErG / * / i2MOErT / * / i2MOErA / * / i2MOErT / * / 32MOErT / (Sequence No. 110), where i2MOEr represents a 2'-O-methoxy-ethyl base (2'-MOE) and * represents a nucleic acid having a phosphorothioate backbone / bond.

[0234] SOD1 Short-9:

[0235] / 52MOErA / * / i2MOErT / * / i2MOErA / * / i2MOErC / * / i2MOErT / *T*T*A*G*C*A*A*C*A*G* / i2MOErT / * / i2MOErA / * / i2MOErT / * / i2MOErT / * / 32MOErT / (Sequence No. 111), where i2MOEr represents a 2'-O-methoxy-ethyl base (2'-MOE) and * represents a nucleic acid having a phosphorothioate backbone / bond.

[0236] SOD1 Short-10:

[0237] / 52MOErT / * / i2MOErA / * / i2MOErC / * / i2MOErT / * / i2MOErT / *T*A*G*C*A*A*C*A*G*T* / i2MOErA / * / i2MOErT / * / i2MOErT / * / i2MOErT / * / 32MOErT / (Sequence No. 112), where i2MOEr represents a 2'-O-methoxy-ethyl base (2'-MOE) and * represents a nucleic acid having a phosphorothioate backbone / bond.

[0238] SOD1 Short-11:

[0239] / 52MOErA / * / i2MOErC / * / i2MOErT / * / i2MOErT / * / i2MOErT / *A*G*C*A*A*C*A*G*T*A* / i2MOErT / * / i2MOErT / * / i2MOErT / * / i2MOErT / * / 32MOErG / (SEQ No. 113), where i2MOEr represents a 2'-O-methoxy-ethyl base (2'-MOE) and * represents a nucleic acid having a phosphorothioate backbone / bond.

[0240] Tiling was performed on long (interstitial) methoxyethyl (MOE) antisense oligonucleotides, referred herein as SOD1 long-1 to SOD1 long-10. The nucleotide sequences of SOD1 long-1 to SOD1 long-10 were as follows:

[0241] SOD1 긺-1:

[0242] / 52MOErA / * / i2MOErA / * / i2MOErT / * / i2MOErC / * / i2MOErT / *T*A*A*T*A*C*T*T*T*A* / i2MOErA / * / i2MOErG / * / i2MOErC / * / i2MOErA / * / 32MOErA / (SEQ No. 114), where i2MOEr represents a 2'-O-methoxy-ethyl base (2'-MOE) and * represents a nucleic acid having a phosphorothioate backbone / bond.

[0243] SOD1 긺-2:

[0244] / 52MOErA / * / i2MOErT / * / i2MOErC / * / i2MOErT / * / i2MOErT / *A*A*T*A*C*T*T*T*A*A* / i2MOErG / * / i2MOErC / * / i2MOErA / * / i2MOErA / * / 32MOErC / (Sequence No. 115), where i2MOEr represents a 2'-O-methoxy-ethyl base (2'-MOE) and * represents a nucleic acid having a phosphorothioate backbone / bond.

[0245] SOD1 긺-3:

[0246] / 52MOErT / * / i2MOErC / * / i2MOErT / * / i2MOErT / * / i2MOErA / *A*T*A*C*T*T*T*A*A*G* / i2MOErC / * / i2MOErA / * / i2MOErA / * / i2MOErC / * / 32MOErA / (SEQ No. 116), where i2MOEr represents a 2'-O-methoxy-ethyl base (2'-MOE) and * represents a nucleic acid having a phosphorothioate backbone / bond.

[0247] SOD1 긺-4:

[0248] / 52MOErC / * / i2MOErT / * / i2MOErT / * / i2MOErA / * / i2MOErA / *T*A*C*T*T*T*A*A*G*C* / i2MOErA / * / i2MOErA / * / i2MOErC / * / i2MOErA / * / 32MOErG / (Sequence No. 117), where i2MOEr represents a 2'-O-methoxy-ethyl base (2'-MOE) and * represents a nucleic acid having a phosphorothioate backbone / bond.

[0249] SOD1 Long-5 (also referred to as Long SOD1 MOE at this clinic):

[0250] / 52MOErC / * / i2MOErT / * / i2MOErT / * / i2MOErA / * / i2MOErA / *T*A*C*T*T*T*A* A *G*C* / i2MOErA / * / i2MOErA / * / i2MOErC / * / i2MOErA / * / 32MOErG / (SEQ No. 83), where i2MOEr represents a 2'-O-methoxy-ethyl base (2'-MOE) and * represents a nucleic acid having a phosphorothioate backbone / bond.

[0251] SOD1 긺-6:

[0252] / 52MOErT / * / i2MOErA / * / i2MOErA / * / i2MOErT / * / i2MOErA / *C*T*T*T*A*A*G*C*A*A* / i2MOErC / * / i2MOErA / * / i2MOErG / * / i2MOErT / * / 32MOErA / (Sequence No. 118), where i2MOEr represents a 2'-O-methoxy-ethyl base (2'-MOE) and * represents a nucleic acid having a phosphorothioate backbone / bond.

[0253] SOD1 긺-7:

[0254] / 52MOErA / * / i2MOErA / * / i2MOErT / * / i2MOErA / * / i2MOErC / *T*T*T*A*A*G*C*A*A*C* / i2MOErA / * / i2MOErG / * / i2MOErT / * / i2MOErA / * / 32MOErT / (Sequence No. 119), where i2MOEr represents a 2'-O-methoxy-ethyl base (2'-MOE) and * represents a nucleic acid having a phosphorothioate backbone / bond.

[0255] SOD1 긺-8:

[0256] / 52MOErA / * / i2MOErT / * / i2MOErA / * / i2MOErC / * / i2MOErT / *T*T*A*A*G*C*A*A*C*A* / i2MOErG / * / i2MOErT / * / i2MOErA / * / i2MOErT / * / 32MOErT / (SEQ No. 120), where i2MOEr represents a 2'-O-methoxy-ethyl base (2'-MOE) and * represents a nucleic acid having a phosphorothioate backbone / bond.

[0257] SOD1 긺-9:

[0258] / 52MOErT / * / i2MOErA / * / i2MOErC / * / i2MOErT / * / i2MOErT / *T*A*A*G*C*A*A*C*A*G* / i2MOErT / * / i2MOErA / * / i2MOErT / * / i2MOErT / * / 32MOErT / (SEQ No. 121), where i2MOEr represents a 2'-O-methoxy-ethyl base (2'-MOE) and * represents a nucleic acid having a phosphorothioate backbone / bond.

[0259] SOD1 긺-10:

[0260] / 52MOErA / * / i2MOErC / * / i2MOErT / * / i2MOErT / * / i2MOErT / *A*A*G*C*A*A*C*A*G*T* / i2MOErA / * / i2MOErT / * / i2MOErT / * / i2MOErT / * / 32MOErT / (Sequence No. 122), where i2MOEr represents a 2'-O-methoxy-ethyl base (2'-MOE) and * represents a nucleic acid having a phosphorothioate backbone / bond.

[0261] In patient-derived fibroblast cell lines (heterozygous A5V fibroblast cell line 120151) harboring A5V mutations, TransIT oligosaccharides were transfected for 72 hours using each antisense oligonucleotide (200 nM), and then these antisense oligonucleotides were evaluated using digital droplet PCT. The assay was performed on mutants for each ASO. SOD1The percentage of expression is analyzed. Accordingly, Figure 11a provides a graph showing a tiling series of short SOD1 MOE capmers (SOD1 short-1 to SOD1 short-11) and a tiling series of long SOD1 MOE capmers (SOD1 long-1 to SOD1 long-10) from a single experiment. For reference, the short SOD1 MOE capmers target mutant alleles in A5V fibroblast cell line 120151, and the long SOD1 MOE capmers target wild-type alleles in A5V fibroblast cell line 120151. The experiment determined that the A5V mutation is cis-relation to the deletion form of the ASO-targeting indel, and that SOD1 short-5 is most effective in knocking down expression from the corresponding allele. From mutants containing the allele SOD1 SOD1 long-5, exhibiting the highest expression, was proven to be the most effective ASO for knocking down expression from alleles containing an inserted form of an ASO-targeting indel. For the most effective SOD1 short-5 and SOD1 long-5, long SOD1 MOE cappers were further investigated as shown in Figures 11c, 12c, 13b, 14b, and 15a and 15b. For comparison, LNA versions of the top SOD1 MOE capper ASOs were prepared and tested, and the corresponding data are also provided herein.

[0262] In fibroblast cell lines carrying the A5V mutation, each antisense oligonucleotide (100 nM LNA or 200 nM MOE) was transfected with TransIT oligonucleotides for 72 hours, and then the antisense oligonucleotide short SOD1 MOE capmers (also referred to herein as SOD1 short-5) and SOD1 long-5 (also referred to herein as long SOD1 MOE capmers) were evaluated using Taqman assay, RNA-Seq, and ddPCR. The former assay was intended to determine how total SOD1 levels were affected by ASO treatment, and the latter assay was intended to evaluate the allele-specific knockdown of each ASO. Figures 11b and 11c show the total relative SOD1 levels observed in A5V fibroblast cell line 220022 after 72 hours of treatment with 100 nM of short SOD1 LNA and long SOD1 LNA (2 experiments) in Figure 11b and 200 nM of short SOD1 MOE and long SOD1 MOE (1 experiment) in Figure 11c, as determined by the Taqman assay. Short SOD1 LNA, long SOD1 LNA, short SOD1 MOE, and long SOD1 MOE were all effective in knocking down total SOD1 expression, and short SOD1 LNA and long SOD1 LNA demonstrated a strong ability to knock down total SOD1 expression levels.

[0263] Figures 12a, 12b, and 12c show the percentage of wild-type SOD1 expression determined by droplet digital polymerase chain reaction (ddPCR) (Figures 12a and 12c) or bulk RNA sequencing (Figure 12b) observed in A5V fibroblast cell line 220022 after 72 hours of treatment with 100 nM of short SOD1 LNA and long SOD1 LNA (2 experiments) for Figures 12a and 12c and 200 nM of short SOD1 MOE and long SOD1 MOE (1 experiment) for Figure 12c. The investigated antisense oligonucleotides demonstrated allele-specific effects, where the short antisense oligonucleotide is responsible for the knockdown of mutant alleles in the corresponding investigated cell lines. These results indicate that allele-specific knockdown of a gene (e.g., SOD1) can be achieved through minimal optimization and antisense oligonucleotide design.

[0264] After 72 hours of treatment with 100 nM short SOD1 LNA and long SOD1 LNA (Epidemic 2), SOD1 expression levels in A5V fibroblast cell line 220022 were investigated using whole-cell RNA sequencing (RNAseq). For each treatment in each experiment, ribonucleic acid (RNA) was extracted from the corresponding treated cells and sequenced with 50 M reads. For the first and second experiments, reads were counted and classified as wild-type (C) or mutant (T) reads. Regarding the data, Table 3 presents the data for the first experiment, and Table 4 presents the data for the second experiment. The data are further presented in Figure 12b as the percentage of wild-type allele expression. For the first and second experiments performed on A5V fibroblast cell line 220022, RNA sequencing (RNAseq) allele-specific knockdown coefficients are consistent with droplet digital polymerase chain reaction (ddPCR) data.

[0265]

[0266] Next, the experiment was repeated as described for A5V fibroblast cell line 210151. Figures 13a and 13b show the total relative SOD1 levels observed in A5V fibroblast cell line 210151 after 72 hours of treatment with 100 nM of short SOD1 LNA and long SOD1 LNA (2 experiments) in Figure 13a and 200 nM of short SOD1 MOE and long SOD1 MOE (1 experiment) in Figure 13b, as determined by Taqman qPCR assay. In A5V fibroblast cell line 210151, SOD1 knockdown using the irradiated antisense oligonucleotides was confirmed, where potent knockdown was observed for both short SOD1 LNA and long SOD1 LNA.

[0267] Figures 14a and 14b show the percentage of wild-type SOD1 expression determined by droplet digital polymerase chain reaction (ddPCR) observed in A5V fibroblast cell line 210151 after 72 hours of treatment with 100 nM of short SOD1 LNA and long SOD1 LNA (2 experiments) in Figure 14a and 200 nM of short SOD1 MOE and long SOD1 MOE (1 experiment) in Figure 14b. The investigated antisense oligonucleotides demonstrated allele-specific effects observed in A5V fibroblast cell line 220022, where the short antisense oligonucleotide is responsible for knockdown of the mutant allele in the investigated cell line.

[0268] Figures 15a and 15b show that treatment with the same SOD1 MOE capmer and LNA antisense oligonucleotide (2 experiments) that successfully reduced SOD1 levels in two different heterozygous A5V patient fibroblasts (Figures 11a, 11b, 12a, 12b, 12c, 13a, 13b, 14a, and 14b) also different SOD1This indicates that mutations can be targeted. Similar to the knockdown study in the 220022 and 210151 heterozygous A5V patient fibroblast cell lines described herein, the SOD1 ASO described herein (SEQN NOs 81–83) showed the total relative observed in the heterozygous Glu134Del patient fibroblast cell line SOD1 Reduced the level. In the corresponding cell line, the patient mutation is cis-related to the insertion form of the ASO-targeting indel, which is supported by increased wild-type allele expression upon treatment using the long form of the ASO. Total SOD1 The levels were determined by Taqman qPCR assay (Fig. 15a) or allele-specific droplet digital polymerase chain reaction (ddPCR) (Fig. 15b) after treatment for 72 hours with 100 nM short SOD1 LNA, 100 nM long SOD1 LNA, 200 nM short SOD1 MOE, or 200 nM long SOD1 MOE (twice for each), as described above for the C9Orf72 study of Example 9, except that an SOD1 probe was used with an HRPT1 control probe instead of the C9Orf72 Taqman probe.

[0269] As discussed in more detail above, SOD1 Among the four antisense oligonucleotides investigated, short SOD1 LNA and long SOD1 LNA were mutants in three biologically distinct cell lines harboring two distinct ALS-associated mutations. SOD1It provided optimal knockdown. Droplet digital polymerase chain reaction (ddPCR) of the two investigated A5V cell lines demonstrates that the respective alleles in the patient cell lines are equally expressed. For short antisense oligonucleotides and long antisense oligonucleotides, allele-specific knockdown of the targeted alleles was observed. In each experiment, the same trend was observed in each of the two distinct A5V cell lines investigated.

[0270] Example 8. Development of an allele-specific antisense oligonucleotide for C9ORF72

[0271] From the analysis of WGS data from C9ORF72 patients and controls, a 2-base pair deletion within intron 3 (rs142843265, AAGGTTCGAGAAGTAGTACCTTAA [AG / -] AACATATCAGAGACA ATTTTTTTTA (SEQ No. 64) was found to be in a state of complete non-equilibrium linkage with the repeat expansion allele observed in C9ORF72 patients, and accordingly represents an optimal target for allele-specific antisense oligonucleotides. This analysis is corroborated by the fact that all European C9ORF72 repeat expansion carriers originated from a single founder mutation (The C9ORF72 expansion mutation is a common cause of ALS+ / -FTD in Europe and has a single founder; Eur J Hum Genet. 2013 Jan;21(1):102-8). Based on the gnomAD / 1000 genome database and this cohort evaluation, it was estimated that 79% of C9ORF72 patients could potentially be targeted via single allele-specific antisense oligonucleotides targeting the short (deletion) allele. To investigate this, antisense oligonucleotides were designed using one-base pair tiling for the short (deleted) allele (referred to as C9-del). The short C9ORF72 MOE capmer and short C9ORF72 LNA capmer synthesized for evaluation are as follows.

[0272] Short C9ORF72 MOE Gapmer:

[0273] / 52MOErT / * / i2MOErA / * / i2MOErG / * / i2MOErT / * / i2MOErA / *C*C*T*T*A*A*A*C*A* / i2MOErT / * / i2MOErA / * / i2MOErT / * / i2MOErC / * / 32MOErA / (SEQ No. 11), where i2MOEr represents the 2'-O-methoxy-ethyl base (2'-MOE) and * represents a nucleic acid having a phosphorothioate backbone / bond

[0274] Short C9ORF72 LNA Gapmer:

[0275] +C*+C*+T*+T*A*A*A*A*C*A*T*A*+T*+C*+A*+G (Sequence No. 51), where + represents a lock nucleic acid and * represents a nucleic acid having a phosphorothioate backbone / binding

[0276] Initial evaluations were performed on two control fibroblast cell lines homozygous for either the short (deletion) allele (C9-del / C9-del) or the long allele (WT / WT). Antisense oligonucleotides (100 nM) were transfected with TransIT oligos for 72 hours according to the manufacturer's instructions. RNA was collected using the Qiagen RNAeasy kit according to the manufacturer's instructions. RNA was converted to cDNA using the Biorad iSCRIPT RT kit according to the manufacturer's instructions, and gene expression was determined using probes targeting C9ORF72 and HPRT1 (control) via the Taqman assay set according to the manufacturer's instructions. Here, both antisense oligonucleotides (short C9ORF72 MOE capmer and short C9ORF72 LNA capmer) reduced C9ORF72 expression in C9-del / C9-del cell lines, but did not show this phenomenon in WT / WT cell lines (see Figures 5 and 7). Short C9ORF72 LNA capmer (LNA #9) was further evaluated through treatment with fibroblasts derived from patients with C9ORF72 repeat expansion (C9-36). Taqman assays confirmed that gene expression was reduced by 43.2% compared to untreated cells (Figures 16a, 16c). Additionally, RNAseq analysis of the same samples (Fig. 16b) showed that when these cells were treated with LNA #9, the relative expression of the WT allele increased to a greater extent compared to NATMED 22, a previously reported allele-specific C9Orf72-targeting ASO (Tran et al. [Suppression of mutant C9Orf72 expression by a potent mixed backbone antisense oligonucleotide. Nat Med. 2022 Jan;28(1):117-124]).

[0277] Using the same methodology in a separate, biologically distinct heterozygous C9Orf72 patient fibroblast cell line (C9-41), the ability of the investigated allele-specific C9Orf72 ASOs, MOE #8 and LNA #9, to reduce total C9 levels was confirmed. The data in Figure 17 confirm the ability of the ASOs to treat patients carrying the C9-del SNP.

[0278] Figure 18 provides a graph of total C9 levels determined by Taqman test present in C9Orf72 patient IPSC-derived cortical neurons of 5 uM MOE capper #8 (MOE8) and LNA capper #C9 (LNA9) after DIV7 gymnotic treatment. This compares an untreated control group (NT), a non-selective ASO that reduces the total levels of both targets at 100 nM (PNAS 2013; Lagier-Tourenne, C et al. ["Targeted degradation of sense and antisense C9Orf72 RNA foci as therapy for ALS and frontotemporal degeneration". PNAS 2013 Nov 19;110(47):E4530-9]), and a non-targeted control ASO that does not affect the levels of either of the targets (MSC). Table 1 shows the allele-specific knockdown effects of ASOs, namely MOE8 and LNA9, relative to the untreated control group on expression from allele-containing C9 expansion mutations in IPSC-derived cortical neurons, as determined by RNA-seq. Allele-specific expression levels were determined by evaluating the coefficients of each version of the ASP SNP mentioned in Figure 8.

[0279]

[0280] Example 9. Development of allele-specific antisense oligonucleotides for additional target genes

[0281] A set of antisense nucleotides was synthesized for kinesin family member 5A (KIF5A), titan protein (TTN), mitofusin-2 (MFN2), β-myosin heavy chain (MYH7), and lamin A / C (LMNA). An initial evaluation of the efficacy of the ASOs was determined using the double luciferase assay as described herein. The target sequences used in the luciferase constructs were as follows:

[0282] Kinesin family member 5A (KIF5A) short target sequence (Sequence No. 84)

[0283] AATACTTGGAAAAATGCCCAAATGTGAGGAGGGGGGATATGGAGTAGGGGAAGAAAAAAGCCTTGATAAGGCTCTGCACAGTGTTGGCATTTCAGTTCTTGGATCACTTTGCAGTGTGGGTCTGGAATCAGATTGCTTGAATTTGAAAACT

[0284] Kinesin family member 5A (KIF5A) long target sequence (Sequence No. 85)

[0285] AATACTTGGAAAAATGCCCAAATGTGAGGAGGGGGGATATGGAGTAGGGGAAGAAAAAAGCCTTGATAAGGCTCTG A CACAGTGTTGGCATTTCAGTTCTTGGATCACTTTGCAGTGTGGGTCTGGAATCAGATTGCTTGAATTTGAAAACT

[0286] Titanium protein (TTN) short target sequence (Sequence No. 88)

[0287] TTCTAATACATATATATAAAGGGCAGCCCAACAGGTTTTGATTTTAGGCTTGACTTTACACCTTGTTGTATTACTCTCAGCGAGTCCTTTAACCAACCTGAGCCTGAAGTTATTTTCCTGTAAATTGGGGATGCTAATATCAGTCTTAAT

[0288] Titanium protein (TTN) long target sequence (Sequence No. 89)

[0289] TTCTAATACATATATATAAAGGGCAGCCCAACAGGTTTTGATTTTAGCGTTGACTTTACACCTTGTTGTATTACTC CTCAGCGAGTCCTTTAACCAACCTGAGCCTGAAGTTATTTTCCTGTAAATTGGGGATGCTAATATCAGTCTTAAT

[0290] Mitofusin-2 (MFN2) short target sequence (Sequence No. 92)

[0291] TTGACCTGGATTTGTTCTAAGCAGTGATATTTGTGAAATGACAGATGCTAGTATTTTTCTCTAATACACATTAAAGTAAGTATGTAACTATTAAAAATAGACGACTTTAAAAATAACCACCTACATACGACTATTTTAAAGTTCAGATTT

[0292] Mitofusin-2 (MFN2) long target sequence (Sequence No. 93)

[0293] TTGACCTGGATTTGTTCTAAGCAGTGATATTTGTGAAATGACAGATGCTAGTATTTTTCTCTAATACACATTAAA A GTAAGTATGTAACTATTAAAAATAGACGACTTTAAAAATAACCACCTACATACGACTATTTTAAAGTTCAGATTT

[0294] β-myosin heavy chain (MYH7) short target sequence (Sequence No. 96)

[0295] GGAGGAGGTTAAGGTAAGGGCTAGACTCGGGCCACCTGGCCCAAGCAAGGAGCACACTGACTAGCCTTGCATCAAATCACTTCCCTTCCCAGCAATAAGGCTGGCTGTGGACCAACAGTTCTCCAAGAATTCTAAAAAGAAATCACAGCC

[0296] β-myosin heavy chain (MYH7) long target sequence (Sequence No. 97)

[0297] GGAGGAGGTTAAGGTAAGGGCTAGACTCGGGCCACCTGGCCCAAGCAAGGAGCACACTGACTAGCCTTGCATCAA C ATCACTTCCCTTCCCAGCAATAAGGCTGGCTGTGGACCAACAGTTCTCCAAGAATTCTAAAAAGAAATCACAGCC

[0298] Lamin A / C (LMNA) short target sequence (Sequence No. 100)

[0299] CTAAGCTTGTCCAGTCAGAAAAGCAGAGGCTGAGGGGTGGCCTTTTCTTGAGAACTACATTCAAGTTGCAGCAAGGACAGTGGTCTGAATTTGACGGGGACAAATGGAAGGGAGATAGGACACATGAGTTCCTTTAGGTCTGGCTCAGGG

[0300] Lamin A / C (LMNA) long target sequence (Sequence No. 101)

[0301] CTAAGCTTGTCCAGTCAGAAAAGCAGAGGCTGAGGGGTGGCCTTTTCTTGAGAACTACATTCAAGTTGCAGCAAG AAG GACAGTGGTCTGAATTTGACGGGGACAAATGGAAGGGAGATAGGACACATGAGTTCCTTTTAGGTCTGGCTCAGGG

[0302] The sequence of the antisense oligonucleotide for allele 1 of KIF5A was as follows:

[0303] +A*+A*+C*+A*C*T*G*T*G*C*A*G*+A*+G*+C*+C, where + represents a lock nucleic acid and * represents a nucleic acid having a phosphorothioate backbone / binding (SEQ No. 86).

[0304] The sequence of the antisense oligonucleotide of allele 2 for KIF5A was as follows:

[0305] +A*+A*+C*+A*C*T*G*T*G*T*C*A*+G*+A*+G*+C, where + represents a lock nucleic acid and * represents a nucleic acid having a phosphorothioate backbone / binding (SEQ No. 87).

[0306] The sequence of the antisense oligonucleotide of allele 1 for TTN was as follows:

[0307] +T*+C*+G*+C*T*G*A*G*G*A*G*T*+A*+A*+T*+A, where + represents a lock nucleic acid and * represents a nucleic acid having a phosphorothioate backbone / binding (SEQ No. 90).

[0308] The sequence of the antisense oligonucleotide of allele 2 for TTN was as follows:

[0309] +T*+C*+G*+C*T*G*A*G*A*G*T*A*+A*+T*+A*+C, where + represents a lock nucleic acid and * represents a nucleic acid having a phosphorothioate backbone / binding (SEQ No. 91).

[0310] The sequence of the antisense oligonucleotide for allele 1 of MFN2 was as follows:

[0311] +T*+A*+C*+T*T*A*C*T*T*T*A*A*+T*+G*+T*+G, where + represents a lock nucleic acid and * represents a nucleic acid having a phosphorothioate backbone / binding (SEQ No. 94).

[0312] The sequence of the antisense oligonucleotide of allele 2 for MFN2 was as follows:

[0313] +A*+C*+T*+T*A*C*T*T*T*T*A*A*+T*+G*+T*+G, where + represents a lock nucleic acid and * represents a nucleic acid having a phosphorothioate backbone / binding (SEQ No. 95).

[0314] The sequence of the antisense oligonucleotide for allele 1 of MYH7 was as follows:

[0315] +G*+T*+G*+A*T*T*T*G*A*T*G*C*+A*+A*+G*+G, where + represents a lock nucleic acid and * represents a nucleic acid having a phosphorothioate backbone / binding (SEQ No. 98).

[0316] The sequence of the antisense oligonucleotide sequence of allele 2 for MYH7 was as follows:

[0317] +G*+A*+A*+G*T*G*A*T*G*T*T*G*+A*+T*+G*+C, where + represents a lock nucleic acid and * represents a nucleic acid having a phosphorothioate backbone / binding (SEQ No. 99).

[0318] The sequence of the antisense oligonucleotide of allele 1 for LMNA was as follows:

[0319] +C*+A*+C*+T*G*T*C*C*T*T*G*C*+T*+G*+C*+A, where + represents a lock nucleic acid and * represents a nucleic acid having a phosphorothioate backbone / binding (SEQ No. 102).

[0320] The sequence of the antisense oligonucleotide sequence of allele 2 for LMNA was as follows:

[0321] +A*+C*+T*+G*T*C*C*T*T*C*T*T*+G*+C*+T*+G, where + represents a lock nucleic acid and * represents a nucleic acid having a phosphorothioate backbone / binding (SEQ No. 103).

[0322] Figure 19 demonstrates that allele-specific knockdown was achieved for each of the kinesin family member 5A (KIF5A), titan protein (TTN), mitofusin-2 (MFN2), β-myosin heavy chain (MYH7), and lamin A / C (LMNA). This further demonstrates the ability to perform allele-specific knockdown using the method described herein, as well as its efficacy.

[0323] Example 10. Development of an allele-specific antisense oligonucleotide for transcription-reactive deoxyribonucleic acid (DNA)-binding protein 43 (TARDBP)

[0324] Tiling was performed on long (interstitial) methoxyethyl (MOE) antisense oligonucleotides, referred herein as TARDBP short-1 to TARDBP short-11. The nucleotide sequences of TARDBP short-1 to TARDBP short-11 were as follows:

[0325] TARDBP Short-1:

[0326] / 52MOErG / * / i2MOErA / * / i2MOErA / * / i2MOErC / * / i2MOErA / *T*C*A*T*T*T*C*A*T*T* / i2MOErT / * / i2MOErA / * / i2MOErA / * / i2MOErA / * / 32MOErC / (SEQ No. 126), where i2MOEr represents a 2'-O-methoxy-ethyl base (2'-MOE) and * represents a nucleic acid having a phosphorothioate backbone / bond.

[0327] TARDBP Short-2:

[0328] / 52MOErT / * / i2MOErG / * / i2MOErA / * / i2MOErA / * / i2MOErC / *A*T*C*A*T*T*T*C*A*T* / i2MOErT / * / i2MOErT / * / i2MOErA / * / i2MOErA / * / 32MOErA / (Sequence No. 127), where i2MOEr represents a 2'-O-methoxy-ethyl base (2'-MOE) and * represents a nucleic acid having a phosphorothioate backbone / bond.

[0329] TARDBP Short-3:

[0330] / 52MOErA / * / i2MOErT / * / i2MOErG / * / i2MOErA / * / i2MOErA / *C*A*T*C*A*T*T*T*C*A* / i2MOErT / * / i2MOErT / * / i2MOErT / * / i2MOErA / * / 32MOErA / (SEQ No. 128), where i2MOEr represents a 2'-O-methoxy-ethyl base (2'-MOE) and * represents a nucleic acid having a phosphorothioate backbone / bond.

[0331] TARDBP Short-4:

[0332] / 52MOErA / * / i2MOErA / * / i2MOErT / * / i2MOErG / * / i2MOErA / *A*C*A*T*C*A*T*T*T*C* / i2MOErA / * / i2MOErT / * / i2MOErT / * / i2MOErT / * / 32MOErA / (SEQ No. 129), where i2MOEr represents a 2'-O-methoxy-ethyl base (2'-MOE) and * represents a nucleic acid having a phosphorothioate backbone / bond.

[0333] TARDBP Short-5:

[0334] / 52MOErC / * / i2MOErA / * / i2MOErA / * / i2MOErT / * / i2MOErG / *A*A*C*A*T*C*A*T*T*T* / i2MOErC / * / i2MOErA / * / i2MOErT / * / i2MOErT / * / 32MOErT / (SEQ No. 130), where i2MOEr represents a 2'-O-methoxy-ethyl base (2'-MOE) and * represents a nucleic acid having a phosphorothioate backbone / bond.

[0335] TARDBP Short-6:

[0336] / 52MOErG / * / i2MOErC / * / i2MOErA / * / i2MOErA / * / i2MOErT / *G*A*A*C*A*T*C*A*T*T* / i2MOErT / * / i2MOErC / * / i2MOErA / * / i2MOErT / * / 32MOErT / (SEQ No. 131), where i2MOEr represents a 2'-O-methoxy-ethyl base (2'-MOE) and * represents a nucleic acid having a phosphorothioate backbone / bond.

[0337] TARDBP Short-7:

[0338] / 52MOErA / * / i2MOErG / * / i2MOErC / * / i2MOErA / * / i2MOErA / *T*G*A*A*C*A*T*C*A*T* / i2MOErT / * / i2MOErT / * / i2MOErC / * / i2MOErA / * / 32MOErT / (SEQ No. 132), where i2MOEr represents a 2'-O-methoxy-ethyl base (2'-MOE) and * represents a nucleic acid having a phosphorothioate backbone / bond.

[0339] TARDBP Short-8:

[0340] / 52MOErA / * / i2MOErA / * / i2MOErG / * / i2MOErC / * / i2MOErA / *A*T*G*A*A*C*A*T*C*A* / i2MOErT / * / i2MOErT / * / i2MOErT / * / i2MOErC / * / 32MOErA / (SEQ No. 133), where i2MOEr represents a 2'-O-methoxy-ethyl base (2'-MOE) and * represents a nucleic acid having a phosphorothioate backbone / bond.

[0341] TARDBP Short-9:

[0342] / 52MOErT / * / i2MOErA / * / i2MOErA / * / i2MOErG / * / i2MOErC / *A*A*T*G*A*A*C*A*T*C* / i2MOErA / * / i2MOErT / * / i2MOErT / * / i2MOErT / * / 32MOErC / (SEQ No. 134), where i2MOEr represents a 2'-O-methoxy-ethyl base (2'-MOE) and * represents a nucleic acid having a phosphorothioate backbone / bond.

[0343] TARDBP Short-10:

[0344] / 52MOErA / * / i2MOErT / * / i2MOErA / * / i2MOErA / * / i2MOErG / *C*A*A*T*G*A*A*C*A*T* / i2MOErC / * / i2MOErA / * / i2MOErT / * / i2MOErT / * / 32MOErT / (SEQ No. 135), where i2MOEr represents a 2'-O-methoxy-ethyl base (2'-MOE) and * represents a nucleic acid having a phosphorothioate backbone / bond.

[0345] TARDBP Short-11:

[0346] / 52MOErA / * / i2MOErA / * / i2MOErT / * / i2MOErA / * / i2MOErA / *G*C*A*A*T*G*A*A*C*A* / i2MOErT / * / i2MOErC / * / i2MOErA / * / i2MOErT / * / 32MOErT / (SEQ No. 136), where i2MOEr represents a 2'-O-methoxy-ethyl base (2'-MOE) and * represents a nucleic acid having a phosphorothioate backbone / bond.

[0347] Tiling was performed on long (interstitial) methoxyethyl (MOE) antisense oligonucleotides, referred herein as TARDBP long-1 to TARDBP long-10. The nucleotide sequences of TARDBP long-1 to TARDBP long-10 were as follows:

[0348] TARDBP 긺-1:

[0349] / 52MOErG / * / i2MOErA / * / i2MOErA / * / i2MOErC / * / i2MOErA / *C*T*C*A*T*T*T*C*A*T* / i2MOErT / * / i2MOErT / * / i2MOErA / * / i2MOErA / * / 32MOErA / (Sequence No. 137), where i2MOEr represents a 2'-O-methoxy-ethyl base (2'-MOE) and * represents a nucleic acid having a phosphorothioate backbone / bond.

[0350] TARDBP Gil-2:

[0351] / 52MOErT / * / i2MOErG / * / i2MOErA / * / i2MOErA / * / i2MOErC / *A*C*T*C*A*T*T*T*C*A* / i2MOErT / * / i2MOErT / * / i2MOErT / * / i2MOErA / * / 32MOErA / (SEQ No. 138), where i2MOEr represents a 2'-O-methoxy-ethyl base (2'-MOE) and * represents a nucleic acid having a phosphorothioate backbone / bond.

[0352] TARDBP Gil-3:

[0353] / 52MOErA / * / i2MOErT / * / i2MOErG / * / i2MOErA / * / i2MOErA / *C*A*C*T*C*A*T*T*T*C* / i2MOErA / * / i2MOErT / * / i2MOErT / * / i2MOErT / * / 32MOErA / (SEQ No. 139), where i2MOEr represents a 2'-O-methoxy-ethyl base (2'-MOE) and * represents a nucleic acid having a phosphorothioate backbone / bond.

[0354] TARDBP Gil-4:

[0355] / 52MOErA / * / i2MOErA / * / i2MOErT / * / i2MOErG / * / i2MOErA / *A*C*A*C*T*C*A*T*T*T* / i2MOErC / * / i2MOErA / * / i2MOErT / * / i2MOErT / * / 32MOErT / (SEQ No. 140), where i2MOEr represents a 2'-O-methoxy-ethyl base (2'-MOE) and * represents a nucleic acid having a phosphorothioate backbone / bond.

[0356] TARDBP Gil-5:

[0357] / 52MOErC / * / i2MOErA / * / i2MOErA / * / i2MOErT / * / i2MOErG / *A*A*C*A*C*T*C*A*T*T* / i2MOErT / * / i2MOErC / * / i2MOErA / * / i2MOErT / * / 32MOErT / (Sequence No. 141), where i2MOEr represents a 2'-O-methoxy-ethyl base (2'-MOE) and * represents a nucleic acid having a phosphorothioate backbone / bond.

[0358] TARDBP Gil-6:

[0359] / 52MOErG / * / i2MOErC / * / i2MOErA / * / i2MOErA / * / i2MOErT / *G*A*A*C*A*C*T*C*A*T* / i2MOErT / * / i2MOErT / * / i2MOErC / * / i2MOErA / * / 32MOErT / (SEQ No. 142), where i2MOEr represents a 2'-O-methoxy-ethyl base (2'-MOE) and * represents a nucleic acid having a phosphorothioate backbone / bond.

[0360] TARDBP Gil-7:

[0361] / 52MOErA / * / i2MOErG / * / i2MOErC / * / i2MOErA / * / i2MOErA / *T*G*A*A*C*A*C*T*C*A* / i2MOErT / * / i2MOErT / * / i2MOErT / * / i2MOErC / * / 32MOErA / (SEQ No. 143), where i2MOEr represents a 2'-O-methoxy-ethyl base (2'-MOE) and * represents a nucleic acid having a phosphorothioate backbone / bond.

[0362] TARDBP Gil-8:

[0363] / 52MOErA / * / i2MOErA / * / i2MOErG / * / i2MOErC / * / i2MOErA / *A*T*G*A*A*C*A*C*T*C* / i2MOErA / * / i2MOErT / * / i2MOErT / * / i2MOErT / * / 32MOErC / (SEQ No. 144), where i2MOEr represents a 2'-O-methoxy-ethyl base (2'-MOE) and * represents a nucleic acid having a phosphorothioate backbone / bond.

[0364] TARDBP Gil-9:

[0365] / 52MOErT / * / i2MOErA / * / i2MOErA / * / i2MOErG / * / i2MOErC / *A*A*T*G*A*A*C*A*C*T* / i2MOErC / * / i2MOErA / * / i2MOErT / * / i2MOErT / * / 32MOErT / (SEQ No. 145), where i2MOEr represents a 2'-O-methoxy-ethyl base (2'-MOE) and * represents a nucleic acid having a phosphorothioate backbone / bond.

[0366] TARDBP Gil-10:

[0367] / 52MOErA / * / i2MOErT / * / i2MOErA / * / i2MOErA / * / i2MOErG / *C*A*A*T*G*A*A*C*A*C* / i2MOErT / * / i2MOErC / * / i2MOErA / * / i2MOErT / * / 32MOErT / (SEQ No. 146), where i2MOEr represents a 2'-O-methoxy-ethyl base (2'-MOE) and * represents a nucleic acid having a phosphorothioate backbone / bond.

[0368] Figure 20 shows mutants determined by digital droplet PCR in heterozygous Q331K-induced cortical neuron cell lines after DIV7 gymnotic treatment with 5 μM of the short TARDBP MOE capper (TARDBP short-1 to TARDBP short-11) tiling series and the long TARDBP MOE capper (TARDBP long-1 to TARDBP long-10) tiling series in a single experiment. TARDBPA graph showing the expression percentage is provided. The experiment determined that the Q331K mutation is cis-relation to the insertion form of the ASO-targeting indel, and that TARDBP length-7 and length-8 are most effective in knocking down expression from the corresponding allele. From mutants containing the allele TARDBP TARDBP short-7 and short-8, which exhibit the highest expression, were proven to be the most effective ASOs for knocking down expression from alleles containing the deletion form of the ASO-targeting indel.

[0369] Figure 21 shows the top 5 performance results screened in Figure 19 from the first experiment. TARDBP Mutants determined by digital droplet PCR in heterozygous M337V-induced cortical neuron cell lines after DIV7 gymnotic treatment using 5 µM of MOE cappers (TDP43 short-5 to TDP43 short-9 and TDP43 long-5 to TDP43 long-9) TARDBP A graph showing the expression percentage is provided. The experiment determined that the M337V mutation is cis-related to the deletion form of the ASO-targeting indel and confirmed that TDP43 ASO 7 and 8 (TARDBP short-7 and TDP43 short-8 in the corresponding cell line) are most effective in knocking down expression from the corresponding allele. Consequently, TARDBP long-7 and long-8, which exhibit the highest expression of TARDBP in mutants containing the allele, were proven to be the most effective ASOs for knocking down expression from the allele containing the insert form of the ASO-targeting indel.

[0370] Figure 22 shows mutants determined by digital droplet PCR in heterozygous Q331K and M337V IPSC-derived cortical neuron cell lines after DIV7 gymnotic treatment with 5 uM ASO. TARDBP Epigenetic knockdown at the level of allele-specific knockdown TARDBPWe provide a graph showing the effect of the ASO backbone modification of MOE #7. The treatment was also compared with untreated mutant TARDBP samples (TDP43 UT) and untreated WT parent cell lines (KOLF UT).

[0371] TARDBP The sequence of the TARDBP short 7-2M for was as follows:

[0372] / 52MOErA / * / i2MOErG / / i2MOErC / * / i2MOErA / / i2MOErA / *T*G*A*A*C*A*T*C*A*T* / i2MOErT / / i2MOErT / * / i2MOErC / / i2MOErA / * / 32MOErT / (Sequence No. 147), where i2MOEr represents a 2'-O-methoxy-ethyl base (2'-MOE) and * represents a nucleic acid having a phosphorothioate backbone / bond.

[0373] TARDBP The sequence of the TARDBP short 7-3M for was as follows:

[0374] / 52MOErA / * / i2MOErG / / i2MOErC / / i2MOErA / / i2MOErA / *T*G*A*A*C*A*T*C*A*T* / i2MOErT / / i2MOErT / / i2MOErC / / i2MOErA / * / 32MOErT / (SEQ No. 148), where i2MOEr represents a 2'-O-methoxy-ethyl base (2'-MOE) and * represents a nucleic acid having a phosphorothioate backbone / bond.

[0375] TARDBP The sequence of the TARDBP short 7-4M for was as follows:

[0376] / 52MOErA / * / i2MOErG / / i2MOErC / / i2MOErA / / i2MOErA / T*G*A*A*C*A*T*C*A*T / i2MOErT / / i2MOErT / / i2MOErC / / i2MOErA / * / 32MOErT / (Sequence No. 149), where i2MOEr represents a 2'-O-methoxy-ethyl base (2'-MOE) and * represents a nucleic acid having a phosphorothioate backbone / bond.

[0377] TARDBP The sequence of the TARDBP long 7-2M for was as follows:

[0378] / 52MOErA / * / i2MOErG / / i2MOErC / * / i2MOErA / / i2MOErA / *T*G*A*A*C*A*C*T*C*A* / i2MOErT / * / i2MOErT / / i2MOErT / * / i2MOErC / / 32MOErA / (SEQ No. 150), where i2MOEr represents a 2'-O-methoxy-ethyl base (2'-MOE) and * represents a nucleic acid having a phosphorothioate backbone / bond.

[0379] TARDBP The sequence of the long 7-3M TARDBP for was as follows:

[0380] / 52MOErA / * / i2MOErG / / i2MOErC / / i2MOErA / / i2MOErA / *T*G*A*A*C*A*C*T*C*A* / i2MOErT / / i2MOErT / / i2MOErT / / i2MOErC / * / 32MOErA / (SEQ No. 151), where i2MOEr represents a 2'-O-methoxy-ethyl base (2'-MOE) and * represents a nucleic acid having a phosphorothioate backbone / bond.

[0381] TARDBP The sequence of the TARDBP long 7-4M for was as follows:

[0382] / 52MOErA / * / i2MOErG / / i2MOErC / / i2MOErA / / i2MOErA / T*G*A*A*C*A*C*T*C*A / i2MOErT / / i2MOErT / / i2MOErT / / i2MOErC / * / 32MOErA / (SEQ No. 152), where i2MOEr represents a 2'-O-methoxy-ethyl base (2'-MOE) and * represents a nucleic acid having a phosphorothioate backbone / bond.

[0383] FIG. 22 is for the same ASO having a modified backbone connection at two (2M), three (3M), or four (4M) positions of the ASO wing. TARDBP Compare the efficacy of knockdown of MOE #7(M). The experiment determined that ASO backbone modification at two or three positions of the wing increased allele-specific knockdown of mutant alleles in M337V and Q331K cell lines, respectively.

[0384] All references, patents, pending patent applications, and published patents cited throughout this application are expressly incorporated herein by reference for all purposes.

[0385] Those skilled in the art will be able to recognize or identify, using only conventional experiments, specific embodiments of the disclosure described herein and many equivalents. Such equivalents are intended to be included in the following claims. It should be understood that the detailed embodiments and embodiments described herein are given as examples for illustrative purposes only and are not to be construed as limiting the disclosure in any way. Various modifications or changes may be proposed to those skilled in the art in light of this specification, and such modifications and changes are included within the spirit and scope of the application and are deemed to be within the appended claims. For example, the relative amounts of components may be varied to optimize the desired effect, additional components may be added and / or similar components may substitute for one or more of the components described herein. Additional advantageous features and functions associated with the systems, methods, and processes of the disclosure will become apparent from the appended claims. Additionally, those skilled in the art will be able to recognize or identify, using only conventional experiments, specific embodiments of the disclosure described herein and many equivalents. Such equivalents are intended to be included in the following claims.

[0386] Selected sequence

[0387] Wild type C9Orf72 Allele (Sequence No. 1)

[0388] AATTGCATGAGTCTTAACGATACAACATAAGACTTAGAAGAAATATTGTGTGGACCTGGGCCTACACCCCAGACAGATACCTCAGGGGTACATATGCTCTCCTTCTGTTACAGCTACTTCTAGGGAAAGGTTCGAGAAGTAGTACCTTAA AGAACATATCAGAGACAATTTTTTTTATTTTTACTATGAACAAGTTATCCAAAATTTATTCTGGGCAAACAGAAAAAAAGGGGAGCAAATATTAATTTGTAGATGCAATTACTATTTTTCCTTTGTTTACTGATTTAACTCTTTGGGTTTAAG

[0389] Includes 2-base pair deletions C9Orf72 Allele (C9-deletion) (Sequence No. 2)

[0390] AATTGCATGAGTCTTAACGATACAACATAAGACTTAGAAGAAATATTGTGTGGACCTGGGCCTACACCCCAGACAGATACCTCAGGGGTACATATGCTCTCCTTCTGTTACAGCTACTTCTAGGGAAAGGTTCGAGAAGTAGTACCTTAA A ACATATCAGAGACAATTTTTTTTATTTTTACTATGAACAAGTTATCCAAAATTTATTCTGGGCAAACAGAAAAAAAGGGGAGCAAATATTAATTTGTAGATGCAATTACTATTTTTCCTTTGTTTACTGATTTAACTCTTTGGGTTTAAG

[0391] antisense oligonucleotide C9Orf72 Target (Indel +10) (Sequence No. 3)

[0392] TCGAGAAGTACCTTAA A

[0393] antisense oligonucleotide C9Orf72 Target (Indel +9) (Sequence No. 4)

[0394] CGAGAAGTAGTACCTTAA A A

[0395] antisense oligonucleotide C9Orf72 Target (Indel +8) (Sequence No. 5)

[0396] GAGAAGTACCTTAA A AC

[0397] antisense oligonucleotide C9Orf72 Target (Indel +7) (Sequence No. 6)

[0398] AGAAGTACCTTAA A ACA

[0399] antisense oligonucleotide C9Orf72 Target (Indel +6) (Sequence No. 7)

[0400] GAAGTAGTACCTTAA A ACAT

[0401] antisense oligonucleotide C9Orf72 Target (Indel +5) (Sequence No. 8)

[0402] AAGTAGTACCTTAA A ACATA

[0403] antisense oligonucleotide C9Orf72 Target (Indel +4) (Sequence No. 9)

[0404] YOU ARE STILL A ACATAT

[0405] antisense oligonucleotide C9Orf72 Target (Indel +3) (Sequence No. 10)

[0406] GTAGTACCTTAA A ACATATC

[0407] antisense oligonucleotide C9Orf72 Target (Indel +2) (Sequence No. 11)

[0408] TAGTACCTTAA A ACATATCA

[0409] antisense oligonucleotide C9Orf72 Target (Indel +1) (Sequence No. 12)

[0410] AGTACCTTAA A ACATATCAG

[0411] antisense oligonucleotide C9Orf72 Target (Indel +0) (Sequence No. 13)

[0412] GTACCTTAA A ACATATCAGA

[0413] antisense oligonucleotide C9Orf72 Target (Indel-1) (Sequence No. 14)

[0414] TACCTA A WAVE

[0415] antisense oligonucleotide C9Orf72 Target (Indel-2) (Sequence No. 15)

[0416] NOT ACCEPTED A ACATATCAGAGA

[0417] antisense oligonucleotide C9Orf72 Target (Indel-3) (Sequence No. 16)

[0418] CCTTAA A ACATATCAGAC

[0419] antisense oligonucleotide C9Orf72 Target (Indel-4) (Sequence No. 17)

[0420] CTTAA A ACTATEACTIVITY

[0421] antisense oligonucleotide C9Orf72 Target (Indel-5) (Sequence No. 18)

[0422] TTAA A ACTATACTION

[0423] antisense oligonucleotide C9Orf72 Target (Indel-6) (Sequence No. 19)

[0424] TAA A CHAPTERCHAPTER

[0425] antisense oligonucleotide C9Orf72 Target (Indel-7) (Sequence No. 20)

[0426] AA A ACATATACATTATT

[0427] antisense oligonucleotide C9Orf72 Target (Indel-8) (Sequence No. 21)

[0428] A A ACATATTACHATTT

[0429] antisense oligonucleotide C9Orf72 Target (Indel-9) (Sequence No. 22)

[0430] AACATATGAGACATTTT

[0431] ASO 1 (Sequence No. 23)

[0432] CGAGAGTAGTACTTAAAA

[0433] ASO 2 (Sequence No. 24)

[0434] GAGAGTAGTACTTAAAC

[0435] ASO 3 (Sequence No. 25)

[0436] REVIEW

[0437] ASO 4 (Sequence No. 26)

[0438] COMPACTACTAAAAC

[0439] ASO 5 (Sequence No. 27)

[0440] DOWNLOADACCTAAWAY

[0441] ASO 6 (Sequence No. 28)

[0442] WITH THE KEYWORDSTROUGHT

[0443] ASO 7 (Sequence No. 29)

[0444] GTAGTACCTTAAAAACATATC

[0445] ASO 8 (Sequence No. 30)

[0446] ENVIRONMENT

[0447] ASO 9 (Sequence No. 31)

[0448] AGTACCTAAAATACCAG

[0449] ASO 10 (Sequence No. 32)

[0450] GTACCTAAAATAQUAKE

[0451] ASO 11 (Sequence No. 33)

[0452] TACCTTAAAWATERSURFACE

[0453] ASO 12 (Sequence No. 34)

[0454] ACCTTAAACATATCAGAG

[0455] ASO 13 (Sequence No. 35)

[0456] CCTTAAACATATCAGAGAC

[0457] ASO 14 (Sequence No. 36)

[0458] CTTAAAACATATCAGAGAC

[0459] ASO 15 (Sequence No. 37)

[0460] TTAAACATATCAGAGAACAA

[0461] ASO 16 (Sequence No. 38)

[0462] TAAAACATATCAGAGAACAAT

[0463] ASO 17 (Sequence No. 39)

[0464] AAAACATATCAGAGAACAATT

[0465] ASO 18 (Sequence No. 40)

[0466] AAACATATCAGAGACAATTT

[0467] LNA 1 (Sequence No. 41)

[0468] AAGTAGTACCTTAAAA

[0469] LNA 1b (Sequence No. 42)

[0470] AAGTAGTACCTTAAAC

[0471] LNA 2 (Sequence No. 43)

[0472] AGTAGTACCTTAAAAC

[0473] LNA 3 (Sequence No. 44)

[0474] GTAGTACCTTAAAACA

[0475] LNA 4 (Sequence No. 45)

[0476] TAGTACCTTAAAAACAT

[0477] LNA 5 (Sequence No. 46)

[0478] AGTACCTTAAAACATA

[0479] LNA 6 (Sequence No. 47)

[0480] GTACCTTAAAACATAT

[0481] LNA 7 (Sequence No. 48)

[0482] TACCTTAAAACATATC

[0483] LNA 7b (Sequence No. 49)

[0484] GTACCTTAAAACATATC

[0485] LNA 8 (sequence number 50)

[0486] ACCTTAAAACATATCA

[0487] LNA 9 (Sequence No. 51)

[0488] CCTTAAAACATATCAG

[0489] LNA 10 (Sequence No. 52)

[0490] CTTAAAACATATCAGA

[0491] LNA 10b (Sequence No. 53)

[0492] CCTTAAAACATATCAGA

[0493] LNA 11 (Sequence No. 54)

[0494] TTAAAACATATCAGAG

[0495] LNA 12 (sequence number 55)

[0496] TAAAACATATCAGAGA

[0497] LNA 13 (Sequence No. 56)

[0498] AAAACATATCAGAGAC

[0499] LNA 14 (Sequence No. 57)

[0500] AAACATATCAGAGACA

[0501] Forward primer (Sequence No. 58)

[0502] ACACTCTTTC CCTACACGAC GCTCTTCCGA TCTACACTCT TTCCCTACAC GACGCTCTTCCGATCTGATA TCTCCGGAGC ATT

[0503] Reverse primer (Sequence No. 59)

[0504] GTGACTGGAG TTCAGACGTG TGCTCTTCCG ATCTNNNNNN NNNN

[0505] C9 ASP target primer forward (Sequence No. 60)

[0506] ACACTCTTTC CCTACACGAC GCTCTTCCGA TCTGATATCT CCGGAGCATT

[0507] C9 ASP target primer reverse (Sequence No. 61)

[0508] GTGACTGGAG TTCAGACGTG TGCTCTTCCG ATCTNNNNNN NNNNTGAAAC AATAATCACTCCC

[0509] HPRT target primer forward (Sequence No. 62)

[0510] ACACTCTTTC CCTACACGAC GCTCTTCCGA TCTCATTGTA GCCCTCTGTG TGC

[0511] HPRT target primer reverse (SEQ No. 63)

[0512] GTGACTGGAG TTCAGACGTG TGCTCTTCCG ATCTNNNNNN NNNNCAAGGG CATATCCTACAAACAAAC

[0513] rs142843265 (sequence number 64) of chromosome 9 open sequence frame 72 (C9orf72)

[0514] AAGGTTCGAGAAGTAGTACCTTAA [AG / -] AACATATCAGAGACAATTTTTTTTTA

[0515] rs34620383 (sequence number 65) of chromosome 9 open sequence frame 72 (C9orf72)

[0516] TGTTTAGGATTGTTTGTGATTTTTCTTTT [T / -] GAGACAGGGTCTCACTCCGTTGCCCAGGCT

[0517] rs2453565 (sequence number 66) of chromosome 9 open sequence frame 72 (C9orf72)

[0518] TCATCTTTTAAAAAAAGTAGAGACC [C / T] TTAGGCAATTAATAAAACTAC

[0519] rs700828 (sequence number 67) of chromosome 9 open sequence frame 72 (C9orf72)

[0520] TATTAAATTTTTTTCATTAGATCA [T / C] AGTTTTGAAATTTCCTCTAGGCATC

[0521] rs774356 (sequence number 68) of chromosome 9 open sequence frame 72 (C9orf72)

[0522] AATGTAACTGTTCATTAATCCTTAA [C / T] TAACTCAAGTAGCACTGAAGGAAAG

[0523] rs774357 (sequence number 69) of chromosome 9 open sequence frame 72 (C9orf72)

[0524] GAAGGGACAGATTTAGAAGGAAAGC [A / G] AAGACAATGAATCAAGATGAATA

[0525] rs774359 (sequence number 70) of chromosome 9 open sequence frame 72 (C9orf72)

[0526] TCTTACTCAATGCTTATAACACCC [C / T] ACACATTAGGTACTATTACTATTAT

[0527] rs2453554 (sequence number 71) of chromosome 9 open sequence frame 72 (C9orf72)

[0528] GACTCCCCAAAAAACAATCTCTGTG [C / T] ACTACCATAAACTTCAGAAGAACAA

[0529] rs2484319 (sequence number 72) of chromosome 9 open sequence frame 72 (C9orf72)

[0530] TGCTGAAAGTTTTTTTAAAAAAAA [A / C] CCATCCTTTAGTAACCTCCACAACT

[0531] rs2453555 (sequence number 73) of chromosome 9 open sequence frame 72 (C9orf72)

[0532] ACACATTCAATCTAACAAGAATAAT[A / G]ACTAGATCCGTGTTAAATTTCCTTC

[0533] rs2492816 (sequence number 74) of chromosome 9 open sequence frame 72 (C9orf72)

[0534] TCTTAACGATACAACATAAGACTTA [A / G] AAGAAATATTGTGTGGACCTGGGCC

[0535] rs3849945 (sequence number 75) of chromosome 9 open sequence frame 72 (C9orf72)

[0536] TCACTATACTATGCCTTTTATTGTTATTTT [A / G] GAGTGCACTCCTTCTACTTTTTTTTTTTTT

[0537] rs10757668 (sequence number 76) of chromosome 9 open sequence frame 72 (C9orf72)

[0538] ACTGCATTCCAACTGTCACATTATC [C / T] AAATGCTCCGGAGATATCTAAACAA

[0539] Superoxide dismutase 1 (SOD1) insertion (long) target sequence (Sequence No. 77)

[0540] TGAACAAAATTCAAAATACTGTTGCTTAAAGTATTAAGATTTTTTAGGATT

[0541] Superoxide dismutase 1 (SOD1) deletion (short) target sequence (Sequence No. 78)

[0542] TGAACAAAATTCAAAATACTGTTGCTAAAGTATTAAGATTTTTTAGGATT

[0543] rs11307260 (SEQ No. 79) of superoxide dismutase 1 (SOD1)

[0544] TGAACAAAATTCAAAATACTGTTGC [T / -] TAAAGTATTAAGATTTTTTAGGATT

[0545] Short superoxide dismutase 1 (SOD1) LNA (Sequence No. 80)

[0546] CTTAATACTTTAGCAACAGT

[0547] (e.g., +C*+T*+T*A*A*T*A*C*T*T*T*A*G*C*A*A*C*+A*+G*+T, where + represents a lock nucleic acid and * represents a nucleic acid with a phosphorothioate backbone / binding)

[0548] Long superoxide dismutase 1 (SOD1) LNA (Sequence No. 81)

[0549] CTTAATACTTT AA GCAACAG

[0550] (e.g., +C*+T*+T*A*A*T*A*C*T*T*T* A*A* G*C*A*A*+C*+A*+G, where + represents a lock nucleic acid and * represents a nucleic acid with a phosphorothioate backbone / binding)

[0551] Short superoxide dismutase 1 (SOD1) MOE (Sequence No. 82)

[0552] CTTAATACTTTAGCAACAGT

[0553] (for example,

[0554] / 52MOErC / * / i2MOErT / * / i2MOErT / * / i2MOErA / * / i2MOErA / *T*A*C*T*T*T*A*G*C*A* / i2MOErA / * / i2MOErC / * / i2MOErA / * / i2MOErG / * / 32MOErT / , where i2MOEr represents the 2'-O-methoxy-ethyl base (2'-MOE) and * represents a nucleic acid having a phosphorothioate backbone / bond)

[0555] Long superoxide dismutase 1 (SOD1) MOE) (Sequence No. 83)

[0556] CTTAATACTTTA A GCAACAG

[0557] (for example,

[0558] / 52MOErC / * / i2MOErT / * / i2MOErT / * / i2MOErA / * / i2MOErA / *T*A*C*T*T*T*A* A *G*C* / i2MOErA / * / i2MOErA / * / i2MOErC / * / i2MOErA / * / 32MOErG / , where i2MOEr represents the 2'-O-methoxy-ethyl base (2'-MOE) and * represents a nucleic acid having a phosphorothioate backbone / bond)

[0559] Kinesin family member 5A (KIF5A) short target sequence (Sequence No. 84)

[0560] AATACTTGGAAAAATGCCCAAATGTGAGGAGGGGGGATATGGAGTAGGGGAAGAAAAAAGCCTTGATAAGGCTCTGCACAGTGTTGGCATTTCAGTTCTTGGATCACTTTGCAGTGTGGGTCTGGAATCAGATTGCTTGAATTTGAAAACT

[0561] Kinesin family member 5A (KIF5A) long target sequence (Sequence No. 85)

[0562] AATACTTGGAAAAATGCCCAAATGTGAGGAGGGGGGATATGGAGTAGGGGAAGAAAAAAGCCTTGATAAGGCTCTG A CACAGTGTTGGCATTTCAGTTCTTGGATCACTTTGCAGTGTGGGTCTGGAATCAGATTGCTTGAATTTGAAAACT

[0563] Short ASO for kinesin family member 5A (KIF5A) (Sequence No. 86)

[0564] AACACTGTGCAGAGCC

[0565] (e.g., +A*+A*+C*+A*C*T*G*T*G*C*A*G*+A*+G*+C*+C, where + represents a lock nucleic acid and * represents a nucleic acid with a phosphorothioate backbone / binding)

[0566] Long ASO for kinesin family member 5A (KIF5A) (Sequence No. 87)

[0567] AACACTGTGTCAGAGC

[0568] (e.g., +A*+A*+C*+A*C*T*G*T*G*T*C*A*+G*+A*+G*+C, where + represents a lock nucleic acid and * represents a nucleic acid with a phosphorothioate backbone / binding)

[0569] Titanium protein (TTN) short target sequence (Sequence No. 88)

[0570] TTCTAATACATATATATAAAGGGCAGCCCAACAGGTTTTGATTTTAGGCTTGACTTTACACCTTGTTGTATTACTCTCAGCGAGTCCTTTAACCAACCTGAGCCTGAAGTTATTTTCCTGTAAATTGGGGATGCTAATATCAGTCTTAAT

[0571] Titanium protein (TTN) long target sequence (Sequence No. 89)

[0572] TTCTAATACATATATATAAAGGGCAGCCCAACAGGTTTTGATTTTAGCGTTGACTTTACACCTTGTTGTATTACT C CTCAGCGAGTCCTTTAACCAACCTGAGCCTGAAGTTATTTTCCTGTAAATTGGGGATGCTAATATCAGTCTTAAT

[0573] Short ASO for titanium protein (TTN) (Sequence No. 90)

[0574] TCGCTGAGGAGTAATA

[0575] (e.g., +T*+C*+G*+C*T*G*A*G*G*A*G*T*+A*+A*+T*+A, where + represents a lock nucleic acid and * represents a nucleic acid with a phosphorothioate backbone / binding)

[0576] Long ASO for titanium protein (TTN) (Sequence No. 91)

[0577] TCGCTGAGAGTAATAC

[0578] (e.g., +T*+C*+G*+C*T*G*A*G*A*G*T*A*+A*+T*+A*+C, where + represents a lock nucleic acid and * represents a nucleic acid with a phosphorothioate backbone / binding)

[0579] Mitofusin-2 (MFN2) short target sequence (Sequence No. 92)

[0580] TTGACCTGGATTTGTTCTAAGCAGTGATATTTGTGAAATGACAGATGCTAGTATTTTTCTCTAATACACATTAAAGTAAGTATGTAACTATTAAAAATAGACGACTTTAAAAATAACCACCTACATACGACTATTTTAAAGTTCAGATTT

[0581] Mitofusin-2 (MFN2) long target sequence (Sequence No. 93)

[0582] TTGACCTGGATTTGTTCTAAGCAGTGATATTTGTGAAATGACAGATGCTAGTATTTTTCTCTAATACACATTAAA A GTAAGTATGTAACTATTAAAAATAGACGACTTTAAAAATAACCACCTACATACGACTATTTTAAAGTTCAGATTT

[0583] Short ASO for Mitofusin-2 (MFN2) (Sequence No. 94)

[0584] TACTTACTTTAATGTG

[0585] (e.g., +T*+A*+C*+T*T*A*C*T*T*T*A*A*+T*+G*+T*+G, where + represents a lock nucleic acid and * represents a nucleic acid with a phosphorothioate backbone / binding)

[0586] Long ASO for Mitofusin-2 (MFN2) (Sequence No. 95)

[0587] ACTTACTTTTAATGTG

[0588] (e.g., +A*+C*+T*+T*A*C*T*T*T*T*A*A*+T*+G*+T*+G, where + represents a lock nucleic acid and * represents a nucleic acid with a phosphorothioate backbone / binding)

[0589] β-myosin heavy chain (MYH7) short target sequence (Sequence No. 96)

[0590] GGAGGAGGTTAAGGTAAGGGCTAGACTCGGGCCACCTGGCCCAAGCAAGGAGCACACTGACTAGCCTTGCATCAAATCACTTCCCTTCCCAGCAATAAGGCTGGGCTGTGGACCAACAGTTCTCCAAGAATTCTAAAAAGAAATCACAGCC

[0591] β-myosin heavy chain (MYH7) long target sequence (Sequence No. 97)

[0592] GGAGGAGGTTAAGGTAAGGGCTAGACTCGGGCCACCTGGCCCAAGCAAGGAGCACACTGACTAGCCTTGCATCAA C ATCACTTCCCTTCCCAGCAATAAGGCTTGGCTGTGGACCAACAGTTCTCCAAGAATTCTAAAAGAAATCACAGCC

[0593] Short ASO for β-myosin heavy chain (MYH7) (Sequence No. 98)

[0594] GTGATTTGATGCAAGG

[0595] (e.g., +G*+T*+G*+A*T*T*T*G*A*T*G*C*+A*+A*+G*+G, where + represents a lock nucleic acid and * represents a nucleic acid with a phosphorothioate backbone / binding)

[0596] Long ASO for β-myosin heavy chain (MYH7) (Sequence No. 99)

[0597] GAAGTGATGTTGATGC

[0598] (e.g., +G*+A*+A*+G*T*G*A*T*G*T*T*G*+A*+T*+G*+C, where + represents a lock nucleic acid and * represents a nucleic acid with a phosphorothioate backbone / binding)

[0599] Lamin A / C (LMNA) short target sequence (Sequence No. 100)

[0600] CTAAGCTTGTCCAGTCAGAAAAGCAGAGGCTGAGGGGTGGCCTTTTCTTGAGAACTACATTCAAGTTGCAGCAAGGACAGTGGTCTGAATTTGACGGGGACAAATGGAAGGGAGATAGGACACATGAGTTCCTTTAGGTCTGGCTCAGGG

[0601] Lamin A / C (LMNA) long target sequence (Sequence No. 101)

[0602] CTAAGCTTGTCCAGTCAGAAAAGCAGAGGCTGAGGGGTGGCCTTTTCTTGAGAACTACATTCAAGTTGCAGCAAG AAG GACAGTGGTCTGAATTTGACGGGGACAAATGGAAGGGAGATAGGACACATGAGTTCCTTTTAGGTCTGGCTCAGGG

[0603] Short ASO for lamin A / C (LMNA) (Sequence No. 102)

[0604] CACTGTCCTTGCTGCA

[0605] (e.g., +C*+A*+C*+T*G*T*C*C*T*T*G*C*+T*+G*+C*+A, where + represents a lock nucleic acid and * represents a nucleic acid with a phosphorothioate backbone / binding)

[0606] Long ASO for lamin A / C (LMNA) (Sequence No. 103)

[0607] ACTGTCCTTCTTGCTG

[0608] (e.g., +A*+C*+T*+G*T*C*C*T*T*C*T*T*+G*+C*+T*+G, where + represents a lock nucleic acid and * represents a nucleic acid with a phosphorothioate backbone / binding)

[0609] SOD1 short-1 (sequence number 104)

[0610] AAATCTTAATACTTTAGCAA

[0611] (for example,

[0612] / 52MOErA / * / i2MOErA / * / i2MOErA / * / i2MOErT / * / i2MOErC / *T*T*A*A*T*A*C*T*T*T* / i2MOErA / * / i2MOErG / * / i2MOErC / * / i2MOErA / * / 32MOErA / , where i2MOEr represents the 2'-O-methoxy-ethyl base (2'-MOE) and * represents a nucleic acid having a phosphorothioate backbone / bond)

[0613] SOD1 short-2 (sequence number 105)

[0614] AATCTTAATACTTTAGCAAC

[0615] (for example,

[0616] / 52MOErA / * / i2MOErA / * / i2MOErT / * / i2MOErC / * / i2MOErT / *T*A*A*T*A*C*T*T*T*A* / i2MOErG / * / i2MOErC / * / i2MOErA / * / i2MOErA / * / 32MOErC / , where i2MOEr represents the 2'-O-methoxy-ethyl base (2'-MOE) and * represents a nucleic acid having a phosphorothioate backbone / bond)

[0617] SOD1 short-3 (sequence number 106)

[0618] ATCTTAATACTTTAGCAACA

[0619] (for example,

[0620] / 52MOErA / * / i2MOErT / * / i2MOErC / * / i2MOErT / * / i2MOErT / *A*A*T*A*C*T*T*T*A*G* / i2MOErC / * / i2MOErA / * / i2MOErA / * / i2MOErC / * / 32MOErA / , where i2MOEr represents the 2'-O-methoxy-ethyl base (2'-MOE) and * represents a nucleic acid having a phosphorothioate backbone / bond)

[0621] SOD1 short-4 (sequence number 107)

[0622] TCTTAATACTTTAGCAACAG

[0623] (for example,

[0624] / 52MOErT / * / i2MOErC / * / i2MOErT / * / i2MOErT / * / i2MOErA / *A*T*A*C*T*T*T*A*G*C* / i2MOErA / * / i2MOErA / * / i2MOErC / * / i2MOErA / * / 32MOErG / , where i2MOEr represents the 2'-O-methoxy-ethyl base (2'-MOE) and * represents a nucleic acid having a phosphorothioate backbone / bond)

[0625] SOD1 short-5 (sequence number 82)

[0626] CTTAATACTTTAGCAACAGT

[0627] (for example,

[0628] / 52MOErC / * / i2MOErT / * / i2MOErT / * / i2MOErA / * / i2MOErA / *T*A*C*T*T*T*A*G*C*A* / i2MOErA / * / i2MOErC / * / i2MOErA / * / i2MOErG / * / 32MOErT / , where i2MOEr represents the 2'-O-methoxy-ethyl base (2'-MOE) and * represents a nucleic acid having a phosphorothioate backbone / bond)

[0629] SOD1 short-6 (sequence number 108)

[0630] TTAATACTTTAGCAACAGTA

[0631] (for example,

[0632] / 52MOErT / * / i2MOErT / * / i2MOErA / * / i2MOErA / * / i2MOErT / *A*C*T*T*T*A*G*C*A*A* / i2MOErC / * / i2MOErA / * / i2MOErG / * / i2MOErT / * / 32MOErA / , where i2MOEr represents the 2'-O-methoxy-ethyl base (2'-MOE) and * represents a nucleic acid having a phosphorothioate backbone / bond)

[0633] SOD1 short-7 (sequence number 109)

[0634] TAATACTTTAGCAACAGTAT

[0635] (for example,

[0636] / 52MOErT / * / i2MOErA / * / i2MOErA / * / i2MOErT / * / i2MOErA / *C*T*T*T*A*G*C*A*A*C* / i2MOErA / * / i2MOErG / * / i2MOErT / * / i2MOErA / * / 32MOErT / , where i2MOEr represents the 2'-O-methoxy-ethyl base (2'-MOE) and * represents a nucleic acid having a phosphorothioate backbone / bond)

[0637] SOD1 short-8 (sequence number 110)

[0638] AATACTTTAGCAACAGTATT

[0639] (for example,

[0640] / 52MOErA / * / i2MOErA / * / i2MOErT / * / i2MOErA / * / i2MOErC / *T*T*T*A*G*C*A*A*C*A* / i2MOErG / * / i2MOErT / * / i2MOErA / * / i2MOErT / * / 32MOErT / , where i2MOEr represents the 2'-O-methoxy-ethyl base (2'-MOE) and * represents a nucleic acid having a phosphorothioate backbone / bond)

[0641] SOD1 short-9 (sequence number 111)

[0642] ATACTTTAGCAACAGTATTT

[0643] (for example,

[0644] / 52MOErA / * / i2MOErT / * / i2MOErA / * / i2MOErC / * / i2MOErT / *T*T*A*G*C*A*A*C*A*G* / i2MOErT / * / i2MOErA / * / i2MOErT / * / i2MOErT / * / 32MOErT / )

[0645] SOD1 short-10 (sequence number 112)

[0646] TACTTTAGCAACAGTATTTT

[0647] (for example,

[0648] / 52MOErT / * / i2MOErA / * / i2MOErC / * / i2MOErT / * / i2MOErT / *T*A*G*C*A*A*C*A*G*T* / i2MOErA / * / i2MOErT / * / i2MOErT / * / i2MOErT / * / 32MOErT / , where i2MOEr represents the 2'-O-methoxy-ethyl base (2'-MOE) and * represents a nucleic acid having a phosphorothioate backbone / bond)

[0649] SOD1 short-11 (sequence number 113)

[0650] ACTTTAGCAACAGTATTTTG

[0651] (for example,

[0652] / 52MOErA / * / i2MOErC / * / i2MOErT / * / i2MOErT / * / i2MOErT / *A*G*C*A*A*C*A*G*T*A* / i2MOErT / * / i2MOErT / * / i2MOErT / * / i2MOErT / * / 32MOErG / , where i2MOEr represents the 2'-O-methoxy-ethyl base (2'-MOE) and * represents a nucleic acid having a phosphorothioate backbone / bond)

[0653] SOD1 long-1 (sequence number 114)

[0654] AATCTTAATACTTTAAGCAA

[0655] (for example,

[0656] / 52MOErA / * / i2MOErA / * / i2MOErT / * / i2MOErC / * / i2MOErT / *T*A*A*T*A*C*T*T*T*T*A* / i2MOErA / * / i2MOErG / * / i2MOErC / * / i2MOErA / * / 32MOErA / , where i2MOEr represents the 2'-O-methoxy-ethyl base (2'-MOE) and * represents a nucleic acid having a phosphorothioate backbone / bond)

[0657] SOD1 long-2 (sequence number 115)

[0658] ATCTTAATACTTTAAGCAAC

[0659] (for example,

[0660] / 52MOErA / * / i2MOErT / * / i2MOErC / * / i2MOErT / * / i2MOErT / *A*A*T*A*C*T*T*T*A*A* / i2MOErG / * / i2MOErC / * / i2MOErA / * / i2MOErA / * / 32MOErC / , where i2MOEr represents the 2'-O-methoxy-ethyl base (2'-MOE) and * represents a nucleic acid having a phosphorothioate backbone / bond)

[0661] SOD1 long-3 (sequence number 116)

[0662] TCTTAATACTTTAAGCAACA

[0663] (for example,

[0664] / 52MOErT / * / i2MOErC / * / i2MOErT / * / i2MOErT / * / i2MOErA / *A*T*A*C*T*T*T*A*A*G* / i2MOErC / * / i2MOErA / * / i2MOErA / * / i2MOErC / * / 32MOErA / , where i2MOEr represents the 2'-O-methoxy-ethyl base (2'-MOE) and * represents a nucleic acid having a phosphorothioate backbone / bond)

[0665] SOD1 long-4 (sequence number 117)

[0666] CTTAATACTTTAAGCAACAG

[0667] (for example,

[0668] / 52MOErC / * / i2MOErT / * / i2MOErT / * / i2MOErA / * / i2MOErA / *T*A*C*T*T*T*A*A*G*C* / i2MOErA / * / i2MOErA / * / i2MOErC / * / i2MOErA / * / 32MOErG / , where i2MOEr represents the 2'-O-methoxy-ethyl base (2'-MOE) and * represents a nucleic acid having a phosphorothioate backbone / bond)

[0669] SOD1 long-5 (sequence number 83)

[0670] TTAATACTTTAAGCAACAGT

[0671] (for example,

[0672] / 52MOErT / * / i2MOErT / * / i2MOErA / * / i2MOErA / * / i2MOErT / *A*C*T*T*T*A*A*G*C*A* / i2MOErA / * / i2MOErC / * / i2MOErA / * / i2MOErG / * / 32MOErT / )

[0673] SOD1 long-6 (sequence number 118)

[0674] TAATACTTTAAGCAACAGTA

[0675] (for example,

[0676] / 52MOErT / * / i2MOErA / * / i2MOErA / * / i2MOErT / * / i2MOErA / *C*T*T*T*A*A*G*C*A*A* / i2MOErC / * / i2MOErA / * / i2MOErG / * / i2MOErT / * / 32MOErA / , where i2MOEr represents the 2'-O-methoxy-ethyl base (2'-MOE) and * represents a nucleic acid having a phosphorothioate backbone / bond)

[0677] SOD1 long-7 (sequence number 119)

[0678] AATACTTTAAGCAACAGTAT

[0679] (for example,

[0680] / 52MOErA / * / i2MOErA / * / i2MOErT / * / i2MOErA / * / i2MOErC / *T*T*T*A*A*G*C*A*A*C* / i2MOErA / * / i2MOErG / * / i2MOErT / * / i2MOErA / * / 32MOErT / , where i2MOEr represents the 2'-O-methoxy-ethyl base (2'-MOE) and * represents a nucleic acid having a phosphorothioate backbone / bond)

[0681] SOD1 긺-8 (Sequence No. 120)

[0682] ATACTTTAAGCAACAGTATT

[0683] (for example,

[0684] / 52MOErA / * / i2MOErT / * / i2MOErA / * / i2MOErC / * / i2MOErT / *T*T*A*A*G*C*A*A*C*A* / i2MOErG / * / i2MOErT / * / i2MOErA / * / i2MOErT / * / 32MOErT / , where i2MOEr represents the 2'-O-methoxy-ethyl base (2'-MOE) and * represents a nucleic acid having a phosphorothioate backbone / bond)

[0685] SOD1 긺-9 (Sequence No. 121)

[0686] TACTTTAAGCAACAGTATTT

[0687] (for example,

[0688] / 52MOErT / * / i2MOErA / * / i2MOErC / * / i2MOErT / * / i2MOErT / *T*A*A*G*C*A*A*C*A*G* / i2MOErT / * / i2MOErA / * / i2MOErT / * / i2MOErT / * / 32MOErT / , where i2MOEr represents the 2'-O-methoxy-ethyl base (2'-MOE) and * represents a nucleic acid having a phosphorothioate backbone / bond)

[0689] SOD1 long-10 (sequence number 122)

[0690] ACTTTAAGCAACAGTATTTT

[0691] (for example,

[0692] / 52MOErA / * / i2MOErC / * / i2MOErT / * / i2MOErT / * / i2MOErT / *A*A*G*C*A*A*C*A*G*T* / i2MOErA / * / i2MOErT / * / i2MOErT / * / i2MOErT / * / 32MOErT / , where i2MOEr represents the 2'-O-methoxy-ethyl base (2'-MOE) and * represents a nucleic acid having a phosphorothioate backbone / bond)

[0693] Transcription-reactive deoxyribonucleic acid (DNA)-binding protein 43 (TARDBP) short target sequence (Sequence No. 123)

[0694] GGGTCTCCCTGTGTTGTCTAGGCTGCCAGGCTAGTCTTGAACTATTGGCCTCACACAGTCCTCCCACCTTGGCCTCCCAAAGCGCTAGGATTACAGGCATGAGCCACCATGCCCAGCCTATGTCTTTTGAAAATCGACTGAAATATCACTGCTGCTGTTAATAAAACTAAAAGCTGTATTGGGGGTTTAAATGAAATGATGTTCATTGCTTATTTTTCCTCTGGCTTTTTAGATAAATTAATGCTTGTAATCTAAGTTTTGTTGCTACTTTAAATATATGAATCAGTGGTTTTAATCTTCTTTGTTTACATCCCTTATTTCTTATAGATTGCGCAGTCTCTTTGTGGAGAGGACTTGATCATTAAAGGAATCAGCGTTCATATATCCAATGCCGAACCTAA

[0695] Transcription-reactive deoxyribonucleic acid (DNA)-binding protein 43 (TARDBP) long target sequence (Sequence No. 124)

[0696] GGGTCTCCCTGTGTTGTCTAGGCTGCCAGGCTAGTCTTGAACTATTGGCCTCACACAGTCCTCCCACCTTGGCCTCCCAAAGCGCTAGGATTACAGGCATGAGCCACCATGCCCAGCCTATGTCTTTTGAAAATCGACTGAAATATCACTGCTGCTGTTAATAAAACTAAAAGCTGTATTGGGGGTTTAAATGAAATGAGTGTTCATTGCTTATTTTTCCTCTGGCTTTAGATAAATTAATGCTTGTAATCTAAGTTTTGTTGCTACTTTAAATATATGAATCAGTGGTTTAATCTTCTTTGTTTACATCCCTTATTTCTTATAGATTGCGCAGTCTCTTTGTGGAGAGGACTTGATCATTAAAGGAATCAGCGTTCATATATCCAATGCCGAACCTAA

[0697] rs3835416 of transcription-reactive deoxyribonucleic acid (DNA)-binding protein 43 (TARDBP) (Sequence No. 125)

[0698] GGGGTCTCCCTGTGTTGTCTAGGCTGCCAGGCTAGTCTTGAACTATTGGCCTCACACAGTCCTCCCACCTTGGCCTCCCAAAGCGCTAGGATTACAGGCATGAGCCACCATGCCCAGCCTATGTCTTTTGAAAATCGACTGAAATATCACTGCTGCTGTTAATAAAACTAAAAGCTGTATTGGGGGTTTAAATGAAATGA [G / -

[0699] ] TGTTCATTGCTTATTTTTCCTCTGGCTTTAGATAAATTAATGCTTGTAATCTAAGTTTTGTTGCTACTTTAAATATATGAATCAGTGGTTTAATCTTCTTTGTTTACATCCCTTATTTCTTATAGATTGCGCAGTCTCTTTGTGGAGAGGACTTGATCATTAAAGGAATCAGCGTTCATATATCCAATGCCGAACCTAA

[0700] TARDBP short-1 (sequence number 126)

[0701] GAACATCATTTCATTTAAAC

[0702] (for example,

[0703] / 52MOErG / * / i2MOErA / * / i2MOErA / * / i2MOErC / * / i2MOErA / *T*C*A*T*T*T*T*C*A*T*T* / i2MOErT / * / i2MOErA / * / i2MOErA / * / i2MOErA / * / 32MOErC / , where i2MOEr represents the 2'-O-methoxy-ethyl base (2'-MOE) and * represents a nucleic acid having a phosphorothioate backbone / bond)

[0704] TARDBP short-2 (sequence number 127)

[0705] TGAACATCATTTCATTTAAA

[0706] (for example,

[0707] / 52MOErT / * / i2MOErG / * / i2MOErA / * / i2MOErA / * / i2MOErC / *A*T*C*A*T*T*T*C*A*T* / i2MOErT / * / i2MOErT / * / i2MOErA / * / i2MOErA / * / 32MOErA / , where i2MOEr represents the 2'-O-methoxy-ethyl base (2'-MOE) and * represents a nucleic acid having a phosphorothioate backbone / bond)

[0708] TARDBP short-3 (sequence number 128)

[0709] ATGAACATCATTTCATTTAA

[0710] (for example,

[0711] / 52MOErA / * / i2MOErT / * / i2MOErG / * / i2MOErA / * / i2MOErA / *C*A*T*C*A*T*T*T*C*A* / i2MOErT / * / i2MOErT / * / i2MOErT / * / i2MOErA / * / 32MOErA / , where i2MOEr represents the 2'-O-methoxy-ethyl base (2'-MOE) and * represents a nucleic acid having a phosphorothioate backbone / bond)

[0712] TARDBP short-4 (sequence number 129)

[0713] AATGAACATCATTTCATTTA

[0714] (for example,

[0715] / 52MOErA / * / i2MOErA / * / i2MOErT / * / i2MOErG / * / i2MOErA / *A*C*A*T*C*A*T*T*T*C* / i2MOErA / * / i2MOErT / * / i2MOErT / * / i2MOErT / * / 32MOErA / , where i2MOEr represents the 2'-O-methoxy-ethyl base (2'-MOE) and * represents a nucleic acid having a phosphorothioate backbone / bond)

[0716] TDP43 short-5 (sequence number 130)

[0717] CAATGAACATCATTTCATTT

[0718] (for example,

[0719] / 52MOErC / * / i2MOErA / * / i2MOErA / * / i2MOErT / * / i2MOErG / *A*A*C*A*T*C*A*T*T*T* / i2MOErC / * / i2MOErA / * / i2MOErT / * / i2MOErT / * / 32MOErT / , where i2MOEr represents the 2'-O-methoxy-ethyl base (2'-MOE) and * represents a nucleic acid having a phosphorothioate backbone / bond)

[0720] TARDBP short-6 (sequence number 131)

[0721] GCAATGAACATCATTTCATT

[0722] (for example,

[0723] / 52MOErG / * / i2MOErC / * / i2MOErA / * / i2MOErA / * / i2MOErT / *G*A*A*C*A*T*C*A*T*T* / i2MOErT / * / i2MOErC / * / i2MOErA / * / i2MOErT / * / 32MOErT / , where i2MOEr represents the 2'-O-methoxy-ethyl base (2'-MOE) and * represents a nucleic acid having a phosphorothioate backbone / bond)

[0724] TARDBP short-7 (sequence number 132)

[0725] AGCAATGAACATCATTTCAT

[0726] (for example,

[0727] / 52MOErA / * / i2MOErG / * / i2MOErC / * / i2MOErA / * / i2MOErA / *T*G*A*A*C*A*T*C*A*T* / i2MOErT / * / i2MOErT / * / i2MOErC / * / i2MOErA / * / 32MOErT / , where i2MOEr represents the 2'-O-methoxy-ethyl base (2'-MOE) and * represents a nucleic acid having a phosphorothioate backbone / bond)

[0728] TARDBP short-8 (sequence number 133)

[0729] AAGCAATGAACATCATTTCA

[0730] (for example,

[0731] / 52MOErA / * / i2MOErA / * / i2MOErG / * / i2MOErC / * / i2MOErA / *A*T*G*A*A*C*A*T*C*A* / i2MOErT / * / i2MOErT / * / i2MOErT / * / i2MOErC / * / 32MOErA / , where i2MOEr represents the 2'-O-methoxy-ethyl base (2'-MOE) and * represents a nucleic acid having a phosphorothioate backbone / bond)

[0732] TARDBP short-9 (sequence number 134)

[0733] TAAGCAATGAACATCATTTC

[0734] (for example,

[0735] / 52MOErT / * / i2MOErA / * / i2MOErA / * / i2MOErG / * / i2MOErC / *A*A*T*G*A*A*C*A*T*C* / i2MOErA / * / i2MOErT / * / i2MOErT / * / i2MOErT / * / 32MOErC / , where i2MOEr represents the 2'-O-methoxy-ethyl base (2'-MOE) and * represents a nucleic acid having a phosphorothioate backbone / bond)

[0736] TARDBP short-10 (sequence number 135)

[0737] ATAAGCAATGAACATCATTT

[0738] (for example,

[0739] / 52MOErA / * / i2MOErT / * / i2MOErA / * / i2MOErA / * / i2MOErG / *C*A*A*T*G*A*A*C*A*T* / i2MOErC / * / i2MOErA / * / i2MOErT / * / i2MOErT / * / 32MOErT / , where i2MOEr represents the 2'-O-methoxy-ethyl base (2'-MOE) and * represents a nucleic acid having a phosphorothioate backbone / bond)

[0740] TARDBP short-11 (sequence number 136)

[0741] AATAAGCAATGAACATCATT

[0742] (for example,

[0743] / 52MOErA / * / i2MOErA / * / i2MOErT / * / i2MOErA / * / i2MOErA / *G*C*A*A*T*G*A*A*C*A* / i2MOErT / * / i2MOErC / * / i2MOErA / * / i2MOErT / * / 32MOErT / , where i2MOEr represents the 2'-O-methoxy-ethyl base (2'-MOE) and * represents a nucleic acid having a phosphorothioate backbone / bond)

[0744] TARDBP Gil-1 (Sequence No. 137)

[0745] GAACACTCATTTCATTTAAA

[0746] (for example,

[0747] / 52MOErG / * / i2MOErA / * / i2MOErA / * / i2MOErC / * / i2MOErA / *C*T*C*A*T*T*T*T*C*A*T* / i2MOErT / * / i2MOErT / * / i2MOErA / * / i2MOErA / * / 32MOErA / , where i2MOEr represents the 2'-O-methoxy-ethyl base (2'-MOE) and * represents a nucleic acid having a phosphorothioate backbone / bond)

[0748] TARDBP Gil-2 (Sequence No. 138)

[0749] TGAACACTCATTTCATTTAA

[0750] (for example,

[0751] / 52MOErT / * / i2MOErG / * / i2MOErA / * / i2MOErA / * / i2MOErC / *A*C*T*C*A*T*T*T*C*A* / i2MOErT / * / i2MOErT / * / i2MOErT / * / i2MOErA / * / 32MOErA / , where i2MOEr represents the 2'-O-methoxy-ethyl base (2'-MOE) and * represents a nucleic acid having a phosphorothioate backbone / bond)

[0752] TARDBP Gil-3 (Sequence No. 139)

[0753] ATGAACACTCATTTCATTTA

[0754] (for example,

[0755] / 52MOErA / * / i2MOErT / * / i2MOErG / * / i2MOErA / * / i2MOErA / *C*A*C*T*C*A*T*T*T*C* / i2MOErA / * / i2MOErT / * / i2MOErT / * / i2MOErT / * / 32MOErA / , where i2MOEr represents the 2'-O-methoxy-ethyl base (2'-MOE) and * represents a nucleic acid having a phosphorothioate backbone / bond)

[0756] TARDBP long-4 (sequence number 140)

[0757] AATGAACACTCATTTCATTT

[0758] (for example,

[0759] / 52MOErA / * / i2MOErA / * / i2MOErT / * / i2MOErG / * / i2MOErA / *A*C*A*C*T*C*A*T*T*T* / i2MOErC / * / i2MOErA / * / i2MOErT / * / i2MOErT / * / 32MOErT / , where i2MOEr represents the 2'-O-methoxy-ethyl base (2'-MOE) and * represents a nucleic acid having a phosphorothioate backbone / bond)

[0760] TARDBP long-5 (sequence number 141)

[0761] CAATGAACACTCATTTCATT

[0762] (for example,

[0763] / 52MOErC / * / i2MOErA / * / i2MOErA / * / i2MOErT / * / i2MOErG / *A*A*C*A*C*T*C*A*T*T* / i2MOErT / * / i2MOErC / * / i2MOErA / * / i2MOErT / * / 32MOErT / , where i2MOEr represents the 2'-O-methoxy-ethyl base (2'-MOE) and * represents a nucleic acid having a phosphorothioate backbone / bond)

[0764] TARDBP long-6 (sequence number 142)

[0765] GCAATGAACACTCATTTCAT

[0766] (for example,

[0767] / 52MOErG / * / i2MOErC / * / i2MOErA / * / i2MOErA / * / i2MOErT / *G*A*A*C*A*C*T*C*A*T* / i2MOErT / * / i2MOErT / * / i2MOErC / * / i2MOErA / * / 32MOErT / , where i2MOEr represents the 2'-O-methoxy-ethyl base (2'-MOE) and * represents a nucleic acid having a phosphorothioate backbone / bond)

[0768] TARDBP Gil-7 (Sequence No. 143)

[0769] AGCAATGAACACTCATTTCA

[0770] (for example,

[0771] / 52MOErA / * / i2MOErG / * / i2MOErC / * / i2MOErA / * / i2MOErA / *T*G*A*A*C*A*C*T*C*A* / i2MOErT / * / i2MOErT / * / i2MOErT / * / i2MOErC / * / 32MOErA / , where i2MOEr represents the 2'-O-methoxy-ethyl base (2'-MOE) and * represents a nucleic acid having a phosphorothioate backbone / bond)

[0772] TARDBP Gil-8 (Sequence No. 144)

[0773] AAGCAATGAACACTCATTTC

[0774] (for example,

[0775] / 52MOErA / * / i2MOErA / * / i2MOErG / * / i2MOErC / * / i2MOErA / *A*T*G*A*A*C*A*C*T*C* / i2MOErA / * / i2MOErT / * / i2MOErT / * / i2MOErT / * / 32MOErC / , where i2MOEr represents the 2'-O-methoxy-ethyl base (2'-MOE) and * represents a nucleic acid having a phosphorothioate backbone / bond)

[0776] TARDBP Gil-9 (Sequence No. 145)

[0777] TAAGCAATGAACACTCATTT

[0778] (for example,

[0779] / 52MOErT / * / i2MOErA / * / i2MOErA / * / i2MOErG / * / i2MOErC / *A*A*T*G*A*A*C*A*C*T* / i2MOErC / * / i2MOErA / * / i2MOErT / * / i2MOErT / * / 32MOErT / , where i2MOEr represents the 2'-O-methoxy-ethyl base (2'-MOE) and * represents a nucleic acid having a phosphorothioate backbone / bond)

[0780] TARDBP Gil-10 (Sequence No. 146)

[0781] ATAAGCAATGAACACTCATT

[0782] (for example,

[0783] / 52MOErA / * / i2MOErT / * / i2MOErA / * / i2MOErA / * / i2MOErG / *C*A*A*T*G*A*A*C*A*C* / i2MOErT / * / i2MOErC / * / i2MOErA / * / i2MOErT / * / 32MOErT / , where i2MOEr represents the 2'-O-methoxy-ethyl base (2'-MOE) and * represents a nucleic acid having a phosphorothioate backbone / bond)

[0784] TARDBP short 7-2M (sequence number 147)

[0785] AGCAATGAACATCATTTCAT

[0786] (for example,

[0787] / 52MOErA / * / i2MOErG / / i2MOErC / * / i2MOErA / / i2MOErA / *T*G*A*A*C*A*T*C*A*T* / i2MOErT / / i2MOErT / * / i2MOErC / / i2MOErA / * / 32MOErT / , where i2MOEr represents the 2'-O-methoxy-ethyl base (2'-MOE) and * represents a nucleic acid having a phosphorothioate backbone / bond)

[0788] TARDBP short 7-3M (Sequence No. 148)

[0789] AGCAATGAACATCATTTCAT

[0790] (for example,

[0791] / 52MOErA / * / i2MOErG / / i2MOErC / / i2MOErA / / i2MOErA / *T*G*A*A*C*A*T*C*A*T* / i2MOErT / / i2MOErT / / i2MOErC / / i2MOErA / * / 32MOErT / , where i2MOEr represents the 2'-O-methoxy-ethyl base (2'-MOE) and * represents a nucleic acid having a phosphorothioate backbone / bond)

[0792] TARDBP short 7-4M (sequence number 149)

[0793] AGCAATGAACATCATTTCAT

[0794] (for example,

[0795] / 52MOErA / * / i2MOErG / / i2MOErC / / i2MOErA / / i2MOErA / T*G*A*A*C*A*T*C*A*T / i2MOErT / / i2MOErT / / i2MOErC / / i2MOErA / * / 32MOErT / , where i2MOEr represents the 2'-O-methoxy-ethyl base (2'-MOE) and * represents a nucleic acid having a phosphorothioate backbone / bond)

[0796] TARDBP long 7-2M (sequence number 150)

[0797] AGCAATGAACACTCATTTCA

[0798] (for example,

[0799] / 52MOErA / * / i2MOErG / / i2MOErC / * / i2MOErA / / i2MOErA / *T*G*A*A*C*A*C*T*C*A* / i2MOErT / * / i2MOErT / / i2MOErT / * / i2MOErC / / 32MOErA / , where i2MOEr represents the 2'-O-methoxy-ethyl base (2'-MOE) and * represents a nucleic acid having a phosphorothioate backbone / bond)

[0800] TARDBP long 7-3M (Sequence No. 151)

[0801] AGCAATGAACACTCATTTCA

[0802] (for example,

[0803] / 52MOErA / * / i2MOErG / / i2MOErC / / i2MOErA / / i2MOErA / *T*G*A*A*C*A*C*T*C*A* / i2MOErT / / i2MOErT / / i2MOErT / / i2MOErC / * / 32MOErA / , where i2MOEr represents the 2'-O-methoxy-ethyl base (2'-MOE) and * represents a nucleic acid having a phosphorothioate backbone / bond)

[0804] TARDBP long 7-4M (Sequence No. 152)

[0805] AGCAATGAACACTCATTTCA

[0806] (for example,

[0807] / 52MOErA / * / i2MOErG / / i2MOErC / / i2MOErA / / i2MOErA / T*G*A*A*C*A*C*T*C*A / i2MOErT / / i2MOErT / / i2MOErT / / i2MOErC / * / 32MOErA / , where i2MOEr represents the 2'-O-methoxy-ethyl base (2'-MOE) and * represents a nucleic acid having a phosphorothioate backbone / bond)

Claims

Claim 1 A method for suppressing an allele containing a mutation within a cell, wherein the method comprises the step of delivering to the cell an antisense oligonucleotide (ASO), e.g., an allele-specific antisense oligonucleotide (asASO), which targets a target variant allele (e.g., an allele of a variant or common variant, and / or an indel such as an insertion or deletion of one or more bases) that is cis-related to the mutation (e.g., the mutation is a gain-of-function mutation or a dominant-negative mutation), wherein the cell (e.g., a target) is heterozygous with respect to the target variant allele. Claim 2 In paragraph 1, the method wherein the cell is an in vitro cell. Claim 3 A method according to claim 1 or 2, wherein the cell is a human cell (e.g., a central nervous system human cell). Claim 4 In any one of claims 1 to 3: the mutation is present in superoxide dismutase 1 (SOD1) or chromosome 9 open decoding frame 72 (C9Orf72), and the cell originates from (i) a subject having at least one of at least one of amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), or a combination thereof, or (ii) a subject having or suspected of having at least one of amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), or a combination thereof; or the mutation is present in kinesin family member 5A (KIF5A), and the cell originates from (i) a subject having at least one of at least one of amyotrophic lateral sclerosis, neonatal intractable myoclonus (NEIMY), hereditary spastic paraplegia 10 (SPG10), or a combination thereof, or (ii) amyotrophic lateral sclerosis, neonatal intractable myoclonus Derived from a subject having or suspected of having at least one of Neimy, hereditary spastic paraplegia 10 (SPG10), or a combination thereof; the mutation is present in the titanium protein (TTN), and the cell is derived from (i) a subject having at least one of at least one of dilated cardiomyopathy-1G (CMD1G), familial hypertrophic cardiomyopathy-9 (CMH9), myofibular myopathy-9 (MFM9), tibial muscular dystrophy (TMD), or a combination thereof, or (ii) a subject having or suspected of having at least one of dilated cardiomyopathy-1G (CMD1G), familial hypertrophic cardiomyopathy-9 (CMH9), myofibular myopathy-9 (MFM9), tibial muscular dystrophy (TMD), or a combination thereof;The mutation is present in Mitofusin-2 (MFN2), and the cell originates from (i) a subject having at least one of the symptoms of Charcot-Marie-Tooth (CMT) disease type 2A2A (CMT2A2A), Charcot-Marie-Tooth disease type 6A (CMT6A), or a combination thereof, or (ii) a subject having or suspected of having at least one of Charcot-Marie-Tooth (CMT) disease type 2A2A (CMT2A2A), Charcot-Marie-Tooth disease type 6A (CMT6A), or a combination thereof; the mutation is present in the β-myosin heavy chain (MYH7), and the cell originates from (i) Dilated Cardiomyopathy-1S (CMD1S), Hypertrophic Cardiomyopathy-1 (CMH1), Autosomal Dominant Myosin Accumulating Congenital Myopathy-7A (CMYP7A), (ii) derived from a subject having at least one of the symptoms of Laing distal myopathy, dilated cardiomyopathy-1S (CMD1S), or a combination thereof, or (ii) having or suspected of having at least one of dilated cardiomyopathy-1S (CMD1S), hypertrophic cardiomyopathy-1 (CMH1), autosomal dominant myosin-accumulating congenital myopathy-7A (CMYP7A), Laing distal myopathy, dilated cardiomyopathy-1S (CMD1S), or a combination thereof;The mutation is present in lamin A / C (LMNA), and the cell is (i) a subject having at least one of at least one of dilated cardiomyopathy-1A (CMD1A), autosomal dominant Emery-Dreyfus muscular dystrophy 2 (EDMD2), Slovenian heart-hand syndrome, Hutchinson-Gilford progeria syndrome (HGPS), familial partial lipodystrophy type 2 (FPLD2), Mallouf syndrome, congenital muscular dystrophy (MDC), or a combination thereof, or (ii) dilated cardiomyopathy-1A (CMD1A), autosomal dominant Emery-Dreyfus muscular dystrophy 2 (EDMD2), Slovenian heart-hand syndrome, Hutchinson-Gilford progeria syndrome (HGPS), familial partial lipodystrophy type 2 (FPLD2), Mallouf syndrome, congenital muscular dystrophy (MDC), or a combination thereof A method derived from a subject having or suspected of having at least one; wherein the mutation is present in transcription-reactive deoxyribonucleic acid (DNA) binding protein 43 (TARDBP), and the cell is derived from (i) a subject having at least one of the symptoms of amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), Alzheimer's disease (AD), limbic-dominant age-related TDP-43 encephalopathy (LATE), or a combination thereof, or (ii) a subject having or suspected of having at least one of amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), Alzheimer's disease (AD), limbic-dominant age-related TDP-43 encephalopathy (LATE), or a combination thereof. Claim 5 In any one of claims 1 to 4: the mutation is present in superoxide dismutase 1 (SOD1) and the method is a method of suppressing the expression of a superoxide dismutase 1 (SOD1) gene mutation; the mutation is present in chromosome 9 open decoding frame 72 (C9Orf72) and the method is a method of suppressing the expression of a chromosome 9 open decoding frame 72 (C9Orf72) gene mutation; the mutation is present in kinesin family member 5A (KIF5A) and the method is a method of suppressing the expression of a kinesin family member 5A (KIF5A) gene mutation; the mutation is present in titanium protein (TTN) and the method is a method of suppressing the expression of a titanium protein (TTN) gene mutation; the mutation is present in mitofusin-2 (MFN2) and the method is a method of suppressing the expression of a mitofusin-2 (MFN2) gene mutation; the mutation is A method in which the mutation is present in the β-myosin heavy chain (MYH7) and the method is a method for suppressing the expression of the β-myosin heavy chain (MYH7) gene mutation; the mutation is present in lamin A / C (LMNA) and the method is a method for suppressing the expression of the lamin A / C (LMNA) gene mutation; the mutation is present in the transcription-reactive deoxyribonucleic acid (DNA) binding protein 43 (TARDBP) and the method is a method for suppressing the expression of the transcription-reactive deoxyribonucleic acid (DNA) binding protein 43 (TARDBP) gene mutation. Claim 6 A method according to any one of claims 1 to 5, characterized by at least one of the following: the antisense oligonucleotide targets an intron region of a gene; the antisense oligonucleotide sequence and / or the target variant allele sequence has a guanine-cytosine (GC) content of about 20% to about 80%; the antisense oligonucleotide is SEQ ID NOs 1, 2, 64–76, 79, 84, 85, 88, 89, 92, 93, 96, 97, 100, 101, 123, 124, or 125, rs11307260, rs142843265, rs3835416, rs34620383, rs2453565, rs700828, rs774356, An oligonucleotide of length 10 to 25 nucleotides that is complementary to at least 8 consecutive nucleotides of any one of rs774357, rs774359, rs2453554, rs2484319, rs2453555, rs2492816, rs3849945, or rs10757668; the antisense oligonucleotide is an oligonucleotide having the sequence of SEQ NOs 80–83, 86, 87, 90, 91, 94, 95, 98, 99, 102, 103–122, or 126–152, or the antisense oligonucleotide comprises, is essentially composed of, or is composed of any antisense oligonucleotide described herein; the mutation is within superoxide dismutase 1 (SOD1). A5V mutation; the mutation is an E134 deletion mutation in superoxide dismutase 1 (SOD1); the mutation is a repeat extension in intron 1 of chromosome 9 open read frame 72 (C9Orf72); the mutation is a Q331 mutation (e.g., Q331K) in transcription-reactive deoxyribonucleic acid (DNA) binding protein 43 (TARDBP); the mutation is an M337 mutation (e.g., M337V) in transcription-reactive deoxyribonucleic acid (DNA) binding protein 43 (TARDBP); or a combination thereof. Claim 7 A method according to any one of claims 1 to 6, wherein the subject has a target variant allele and a mutation, and the method comprises the step of administering an antisense oligonucleotide to the subject. Claim 8 A method for treating a subject having an allele containing a mutation, the method comprising: administering to the subject an antisense oligonucleotide (ASO, e.g., an allele-specific antisense oligonucleotide (asASO)) that targets a target variant allele (e.g., an allele of a variant or common variant, and / or an indel such as an insertion or deletion of one or more bases) that is cis-related to the mutation (e.g., the mutation is a gain-of-function mutation or a dominant-negative mutation), wherein: the subject is heterozygous for the target variant allele; and the antisense oligonucleotide is effective in preventing, treating, or alleviating at least one symptom associated with the mutation. Claim 9 In paragraph 8: the mutation is present in superoxide dismutase 1 (SOD1) or chromosome 9 open decoding frame 72 (C9Orf72), and the subject has (i) one or more symptoms of amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), or both amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD), or (ii) has or is suspected of having amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), or both amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD); or the mutation is present in kinesin family member 5A (KIF5A), and the subject has (i) at least one symptom of amyotrophic lateral sclerosis, neonatal intractable myoclonus (NEIMY), hereditary spastic paraplegia 10 (SPG10), or a combination thereof (ii) having one or more of the following, or (ii) having or suspected of having at least one of amyotrophic lateral sclerosis, neonatal intractable myoclonus (NEIMY), hereditary spastic paraplegia 10 (SPG10), or a combination thereof; the mutation is present in the titanium protein (TTN), and the subject has (i) having one or more of the following symptoms: dilated cardiomyopathy-1G (CMD1G), familial hypertrophic cardiomyopathy-9 (CMH9), myofibular myopathy-9 (MFM9), tibial muscular dystrophy (TMD), or a combination thereof, or (ii) having or suspected of having at least one of dilated cardiomyopathy-1G (CMD1G), familial hypertrophic cardiomyopathy-9 (CMH9), myofibular myopathy-9 (MFM9), tibial muscular dystrophy (TMD), or a combination thereof;The mutation is present in Mitofusin-2 (MFN2), and the subject has (i) at least one of the symptoms of Charcot-Marie-Tooth (CMT) disease type 2A2A (CMT2A2A), Charcot-Marie-Tooth disease type 6A (CMT6A), or a combination thereof, or (ii) has or is suspected of having at least one of Charcot-Marie-Tooth (CMT) disease type 2A2A (CMT2A2A), Charcot-Marie-Tooth disease type 6A (CMT6A), or a combination thereof; the mutation is present in the β-myosin heavy chain (MYH7), and the subject has (i) dilated cardiomyopathy-1S (CMD1S), hypertrophic cardiomyopathy-1 (CMH1), autosomal dominant myosin-accumulating congenital myopathy-7A (CMYP7A), Laing distal myopathy, dilated (ii) having at least one of the symptoms of cardiomyopathy-1S (CMD1S) or a combination thereof, or (ii) having or suspected of having at least one of dilated cardiomyopathy-1S (CMD1S), hypertrophic cardiomyopathy-1 (CMH1), autosomal dominant myosin-accumulating congenital myopathy-7A (CMYP7A), Laing distal myopathy, dilated cardiomyopathy-1S (CMD1S), or a combination thereof; the mutation is present in lamin A / C (LMNA), and the cell is (i) dilated cardiomyopathy-1A (CMD1A), autosomal dominant Emery-Dreyfus muscular dystrophy 2 (EDMD2), Slovenian heart-hand syndrome, Hutchinson-Gilford progeria syndrome (HGPS), familial partial lipodystrophy type 2 (FPLD2), Mallouf syndrome, congenital muscular dystrophy (MDC), or (ii) having at least one of the combinations of these symptoms, or (ii) having or suspected of having at least one of dilated cardiomyopathy-1A (CMD1A), autosomal dominant Emery-Dreyfus muscular dystrophy 2 (EDMD2), Slovenian heart-hand syndrome, Hutchinson-Gilford progeria syndrome (HGPS), familial partial lipodystrophy type 2 (FPLD2), Mallouf syndrome, congenital muscular dystrophy (MDC), or a combination thereof;A method in which a mutation is present in transcription-reactive deoxyribonucleic acid (DNA) binding protein 43 (TARDBP), and the subject has at least one of the following conditions: (i) amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), Alzheimer's disease (AD), limbic-dominant age-related TDP-43 encephalopathy (LATE), or a combination thereof; or (ii) has or is suspected of having at least one of amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), Alzheimer's disease (AD), limbic-dominant age-related TDP-43 encephalopathy (LATE), or a combination thereof.; Claim 10 In paragraph 9: the method is a method for treating (i) a subject having one or more symptoms of amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), or both amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD), or (ii) a subject having or suspected of having both amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), or both amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD); or the method is a method for treating (i) a subject having one or more symptoms of at least one of amyotrophic lateral sclerosis, neonatal intractable myoclonus (NEIMY), hereditary spastic paraplegia 10 (SPG10), or a combination thereof, or (ii) amyotrophic lateral sclerosis, neonatal intractable myoclonus (NEIMY), hereditary spastic paraplegia 10 (SPG10), or their A method for treating a subject having or suspected of having at least one of the combinations; the method is a subject having at least one of the symptoms of (i) dilated cardiomyopathy-1G (CMD1G), familial hypertrophic cardiomyopathy-9 (CMH9), myofibrillar myopathy-9 with early respiratory failure (MFM9), tibial muscular dystrophy (TMD), or a combination thereof, or (ii) a subject having or suspected of having at least one of dilated cardiomyopathy-1G (CMD1G), familial hypertrophic cardiomyopathy-9 (CMH9), myofibrillar myopathy-9 with early respiratory failure (MFM9), tibial muscular dystrophy (TMD), or a combination thereof; the method is a subject having at least one of the symptoms of (i) Charcot-Marie-Tooth (CMT) disease type 2A2A (CMT2A2A), Charcot-Marie-Tooth disease type 6A (CMT6A), or a combination thereof, or (ii) a method for treating a subject who has or is suspected of having at least one of Charcot-Marie-Tooth (CMT) disease type 2A2A (CMT2A2A), Charcot-Marie-Tooth disease type 6A (CMT6A), or a combination thereof;The method is a method for treating (i) a subject having at least one of the symptoms of dilated cardiomyopathy-1S (CMD1S), hypertrophic cardiomyopathy-1 (CMH1), autosomal dominant myosin-accumulating congenital myopathy-7A (CMYP7A), Laing's distal myopathy, dilated cardiomyopathy-1S (CMD1S), or a combination thereof, or (ii) a subject having or suspected of having at least one of dilated cardiomyopathy-1S (CMD1S), hypertrophic cardiomyopathy-1 (CMH1), autosomal dominant myosin-accumulating congenital myopathy-7A (CMYP7A), Laing's distal myopathy, dilated cardiomyopathy-1S (CMD1S), or a combination thereof; or the method is, (i) dilated cardiomyopathy-1A (CMD1A), autosomal dominant Emery-Dreyfus muscular dystrophy 2 (EDMD2), A method for treating a subject having at least one of the following symptoms: Slovenian heart-hand syndrome, Hutchinson-Gilford progeria syndrome (HGPS), familial partial lipodystrophy type 2 (FPLD2), Mallouf syndrome, congenital muscular dystrophy (MDC), or a combination thereof; or (ii) dilated cardiomyopathy-1A (CMD1A), autosomal dominant Emery-Dreyfus muscular dystrophy 2 (EDMD2), Slovenian heart-hand syndrome, Hutchinson-Gilford progeria syndrome (HGPS), familial partial lipodystrophy type 2 (FPLD2), Mallouf syndrome, congenital muscular dystrophy (MDC), or a combination thereof; or the method comprising: (i) amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), Alzheimer's disease (AD), limbic-dominant age-related A method for treating a subject having at least one of the symptoms of TDP-43 encephalopathy (LATE) or a combination thereof, or (ii) a subject having or suspected of having at least one of amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), Alzheimer's disease (AD), limbic-predominant age-related TDP-43 encephalopathy (LATE), or a combination thereof.; Claim 11 A method according to any one of claims 8 to 10, characterized by at least one of the following: the antisense oligonucleotide targets an intron region of a gene; the antisense oligonucleotide sequence and / or the target variant allele sequence has a guanine-cytosine (GC) content of about 20% to about 80%; the antisense oligonucleotide is SEQ ID NOs 1, 2, 64–76, 84, 79, 85, 88, 89, 92, 93, 96, 97, 100, 101, 123, 124, or 125, rs11307260, rs142843265, rs3835416, rs34620383, rs2453565, rs700828, rs774356, An oligonucleotide of length 10 to 25 nucleotides that is complementary to at least 8 consecutive nucleotides of any one of rs774357, rs774359, rs2453554, rs2484319, rs2453555, rs2492816, rs3849945, or rs10757668; the antisense oligonucleotide is an oligonucleotide having the sequence of SEQ NOs 80–83, 86, 87, 90, 91, 94, 95, 98, 99, 102, 103–122, or 126–152, or the antisense oligonucleotide comprises, is essentially composed of, or is composed of any antisense oligonucleotide described herein; the mutation is within superoxide dismutase 1 (SOD1). A5V mutation; the mutation is an E134 deletion mutation in superoxide dismutase 1 (SOD1); the mutation is a repeat extension in intron 1 of chromosome 9 open read frame 72 (C9Orf72); the mutation is a Q331 mutation (e.g., Q331K) in transcription-reactive deoxyribonucleic acid (DNA) binding protein 43 (TARDBP); the mutation is an M337 mutation (e.g., M337V) in transcription-reactive deoxyribonucleic acid (DNA) binding protein 43 (TARDBP); or a combination thereof. Claim 12 A method according to any one of claims 1 to 11, characterized by at least one of the following: the cell or target is heterozygous for the mutation; the target variant allele is a common variant; the target variant allele is an indel (e.g., an insertion or deletion); the mutation comprises a repeat expansion, a single base pair point mutation, a structural variant, a copy number variant, an indel, or a combination thereof; or a combination thereof. Claim 13 A method according to any one of claims 1 to 12, further comprising at least one of the following: determining or identifying the genotype of a target variant allele of a gene (e.g., through a sequence and / or haploid type analysis method described herein); determining or identifying whether the target variant allele is cis-related to a mutation (e.g., through a sequence and / or haploid type analysis method described herein); or a combination thereof. Claim 14 A method for determining the haploid type of two variants of a gene (e.g., a first or target variant and a second variant or mutation) in a cell, the method comprising: providing one or more (e.g., at least one, one, at least two, or two) antisense oligonucleotides (ASO), wherein each of the one or more (e.g., one) antisense oligonucleotides targets a different allele of the first or target variant allele of the gene (e.g., a common variant; an indel; and / or, if an indel, the first antisense oligonucleotide targets an insertion of the first or target variant allele and the second antisense oligonucleotide targets a deletion of the first or target variant allele); and administering each of the one or more antisense oligonucleotides (ASO) individually to the cell. A method comprising the step of measuring the level of expression (e.g., allele-specific expression) of one or more (e.g., at least one, one, at least two, or two) alleles for a second variant allele (e.g., mutant allele) in each cell administered with the antisense oligonucleotide (ASO) of the one or more antisense oligonucleotides (ASO). Claim 15 In paragraph 14, the reduction in expression of the second variant allele for the allele indicates that the cell has the second variant allele and the first or target variant allele targeted by the antisense oligonucleotide. Claim 16 A method according to claim 14 or 15, characterized by at least one of the following: a reduction in expression indicates that a second variant allele (e.g., a mutant or mutant allele) is in a cis relationship with a first or target variant allele targeted by an antisense oligonucleotide; a reduction in expression for two alleles of the second variant allele indicates that the cell is heterozygous with respect to said two alleles of the second variant allele with reduced expression and homozygous with respect to the first or target variant allele targeted by the antisense oligonucleotide; or a combination thereof. Claim 17 A method according to any one of claims 14 to 16, characterized by at least one of the following: the first or target variant allele is a common variant; the first or target variant allele is an indel (e.g., an insertion or deletion); the second variant allele is a mutant allele comprising a repeat extension, a single base pair point mutation, a structural variant, a copy number variant, an indel, or a combination thereof; or a combination thereof. Claim 18 A method according to any one of claims 1 to 17, characterized by at least one of the following: the antisense oligonucleotide targets an intron region of a gene; the antisense oligonucleotide sequence and / or the target variant allele sequence has a guanine-cytosine (GC) content of about 20% to about 80%; the antisense oligonucleotide is an oligonucleotide of 10 to 25 nucleotides in length; the antisense oligonucleotide comprises at least one modified nucleotide; the antisense oligonucleotide comprises a phosphorothioate modified bond; the antisense oligonucleotide is a morpholino; the antisense oligonucleotide comprises a lock nucleic acid (LNA) and ribonucleic acid (RNA) (e.g., alternating lock nucleic acid (LNA) and ribonucleic acid (RNA) nucleotides); the antisense oligonucleotide comprises a lock nucleic acid (LNA) and deoxyribonucleic acid (DNA) (e.g., alternating lock nucleic acid (LNA) Comprising ribonucleic acid (RNA) and deoxyribonucleic acid (DNA) nucleotides; antisense oligonucleotides comprising ribonucleic acid (RNA) and deoxyribonucleic acid (DNA) (e.g., alternating ribonucleic acid (RNA) and deoxyribonucleic acid (DNA) nucleotides); antisense oligonucleotides being gapmers; or a combination thereof. Claim 19 The method of claim 18, wherein at least one modified nucleotide is a 2'-modified nucleotide (each 2'-modified nucleotide comprises a 2'-deoxy-modified nucleotide, a 2'-fluoro-modified nucleotide, a 2'-O-methyl-modified nucleotide, a 2'-O-methoxyethyl-modified nucleotide, a 2'-amino-modified nucleotide, or a 2'-aminoalkoxy-modified nucleotide, or is independently one of these). Claim 20 A method according to any one of claims 1 to 19, wherein the variant is present in at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, or at least 75% of one or more gene mutations. Claim 21 As an antisense oligonucleotide (ASO), having a length of 10 to 25 nucleotides, SEQ ID NOs 1, 2, 64–76, 79, 84, 85, 88, 89, 92, 93, 96, 97, 100, 101, 123, 124, or 125, rs11307260, rs142843265, rs3835416, rs34620383, rs2453565, rs700828, rs774356, rs774357, rs774359, rs2453554, rs2484319, rs2453555, rs2492816, rs3849945, or An antisense oligonucleotide (ASO) comprising a nucleic acid sequence comprising a complementary region that is complementary to at least eight consecutive nucleotides of any one of the sequences rs10757668. Claim 22 In claim 21, the antisense oligonucleotide comprises, is essentially composed of, or is composed of any one of the nucleic acid sequences SEQ ID NOs 80–83, 86, 87, 90, 91, 94, 95, 98, 99, 102, 103–122, or 126–152; the antisense oligonucleotide comprises, is essentially composed of, or is composed of any antisense oligonucleotide described herein. Claim 23 An antisense oligonucleotide according to claim 21 or 22, characterized by at least one of the following: the antisense oligonucleotide comprises at least one modified nucleotide; the antisense oligonucleotide comprises at least one modified nucleotide which is a 2'-modified nucleotide (each 2'-modified nucleotide comprises a 2'-deoxy-modified nucleotide, a 2'-fluoro-modified nucleotide, a 2'-O-methyl-modified nucleotide, a 2'-O-methoxyethyl-modified nucleotide, a 2'-amino-modified nucleotide, or a 2'-aminoalkoxy-modified nucleotide, or is independently one of these); the antisense oligonucleotide comprises a phosphorothioate modified bond; the antisense oligonucleotide is a morpholino; the antisense oligonucleotide comprises lock nucleic acid (LNA) and ribonucleic acid (RNA) (e.g., alternating lock nucleic acid (LNA) and ribonucleic acid (RNA) nucleotides). Including; antisense oligonucleotides include lock nucleic acid (LNA) and deoxyribonucleic acid (DNA) (e.g., alternating lock nucleic acid (LNA) and deoxyribonucleic acid (DNA) nucleotides); antisense oligonucleotides include ribonucleic acid (RNA) and deoxyribonucleic acid (DNA) (e.g., alternating ribonucleic acid (RNA) and deoxyribonucleic acid (DNA) nucleotides); antisense oligonucleotides are gapmers; or a combination thereof. Claim 24 A pharmaceutical composition comprising an antisense oligonucleotide of any one of claims 21 to 23 and a pharmaceutically acceptable carrier.

Images