Method for preparing a melting probe for multiple detection of a single fluorescent signal

Abstract

The present invention relates to a method for producing a melting probe for multiple detection of a single fluorescent signal, and can be usefully utilized for multiple target detection because it can detect signals for two or more target nucleic acids without interference with each other even when a single signal is used during the PCR process.

Description

Technology Field

[0001] The present invention relates to a method for fabricating melt probes for multiple detection of a single fluorescence signal. Specifically, the invention relates to a method for detecting multiple targets in a single reaction by designing two or more melt probes having different melting temperatures (Tm) in a single fluorescence signal. Background Technology

[0002] Real-time PCR (Real-time Polymerase Chain Reaction) is one of the most widely utilized techniques in molecular diagnostics. It is a core method that enables simultaneous quantitative and qualitative analysis by amplifying target nucleic acid sequences and monitoring fluorescent signals in real time. This technology is widely used in various application fields, such as the early diagnosis of infectious diseases, single polymorphism (SNP) analysis, and cancer biomarker detection. It has established itself as an essential tool in clinical and research settings due to its ability to provide rapid and accurate results.

[0003] In particular, Real-time PCR possesses high sensitivity and specificity, enabling the detection of target sequences even at extremely low concentrations. It can effectively detect pathogens even in the early stages of infection, making it essential for early infection diagnosis.

[0004] However, Real-time PCR also has several limitations. The most significant limitation among them is the restriction on the number of fluorescence channels. Generally, Real-time PCR supports 4 to 6 fluorescence channels, and each channel is designed to detect a single target. Due to this structural limitation, the number of targets that can be detected in a single PCR reaction is limited, so this restriction on the number of fluorescence channels can act as a major obstacle in complex experiments that require the simultaneous detection of multiple pathogens or the analysis of various genetic mutations.

[0005] Against this backdrop, the inventors developed a technology capable of detecting two or more targets using a single fluorescent signal (Fig. 1). The problem to be solved

[0006] The objective of the present invention is to provide a method for the simultaneous detection of multiple target nucleic acids using a single fluorescence.

[0007] Another objective of the present invention is to provide a method for fabricating a melting probe for multiple detection of a single fluorescent signal.

[0008] Another objective of the present invention is to provide a melting probe for multiple detection of a single fluorescent signal produced by the above method. means of solving the problem

[0009] In order to achieve the above objective,

[0010] The present invention provides a method for the simultaneous detection of multiple target nucleic acids using a single fluorescence, comprising: (a) designing two or more melting probes complementary to each target nucleic acid to simultaneously detect two or more target nucleic acids and labeling each melting probe with fluorescence of the same wavelength; (b) amplifying two or more target nucleic acids to obtain amplification products; (c) hybridizing and melting the amplification products with the melting probes complementary thereto to obtain a melting curve; and (d) analyzing the melting curve.

[0011] In addition, the present invention provides a method for producing a fusion probe for single fluorescent signal multiple detection, comprising the step of producing two or more fusion probes each containing a sequence complementary to two or more target nucleic acids by labeling them with fluorescence of the same wavelength.

[0012] The present invention provides a melting probe for multiple detection of a single fluorescent signal produced by the above method. Effects of the invention

[0013] The present invention relates to a method for producing a melting probe for multiple detection of a single fluorescent signal. Even when using a single signal during the PCR process, signals for two or more target nucleic acids can be detected separately without interference with each other, making it useful for multiple target detection. Brief explanation of the drawing

[0014] Figure 1 is a conceptual diagram illustrating a method for detecting multiple targets with a single fluorescence signal through melting curve analysis using melting probes with different melting temperatures. Figure 2 is a figure showing an example of the PCR process of the present invention. Figure 3 shows the results of confirming the Tm value of the fusion probe using singleplex PCR and the multiplex PCR of the present invention, and confirming the detection of two types of sexually transmitted infection causative pathogens. Figure 4 shows the results of melting curve analysis according to the difference in Tm values ​​between melting probes using singleplex PCR and the multiplex PCR of the present invention. Specific details for implementing the invention

[0015] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by a skilled expert in the art to which this invention pertains. In general, the nomenclature used herein is well known and commonly used in the art.

[0016] The present invention will be described in more detail below.

[0017] The present invention provides a method for the simultaneous detection of multiple target nucleic acids using a single fluorescence, comprising: (a) designing two or more melting probes complementary to each target nucleic acid to simultaneously detect two or more target nucleic acids and labeling each melting probe with fluorescence of the same wavelength; (b) amplifying two or more target nucleic acids to obtain amplification products; (c) hybridizing and melting the amplification products with the melting probes complementary thereto to obtain a melting curve; and (d) analyzing the melting curve.

[0018] In this invention, to demonstrate that target-specific detection is possible using melting probes with different melting temperatures after a PCR reaction for the simultaneous detection of multiple target nucleic acids, this experiment was conducted.

[0019] In the present invention, the term "probe" refers to a nucleic acid fragment, such as RNA or DNA, ranging from a few bases to hundreds of bases in length, capable of forming a specific binding with a target nucleic acid, and is labeled so that the presence or absence of a specific nucleic acid can be confirmed.

[0020] The melting probe of the present invention is characterized by not being hydrolyzed by a polymerase during the PCR process, unlike a hydrolysis probe. This is because fluorescence is emitted when the probe hybridizes with the target sequence, and as the temperature rises, the fluorescence signal decreases as the probe melts with the target sequence at the appropriate melting temperature, and melting curve analysis is possible using the fluorescence signal obtained from this temperature change.

[0021] The above melting probes have a melting temperature (Tm) lower than the annealing temperature of the PCR process, and the difference in melting temperatures (Tm) between the melting probes is 7℃ or more.

[0022] In the present invention, the melting probe may optionally include a sequence that is incompatible with the target in order to have a melting temperature lower than the annealing temperature.

[0023] In the present invention, the melting probe must be designed considering the melting temperature of complementary target nucleic acids, etc., and such design can be achieved by controlling the GC content, sequence length, or these together.

[0024] The melting probe of the present invention has a structure in which a signal is generated when the fluorescent substance and the quenching substance are separated upon binding to a target nucleic acid.

[0025] In the present invention, the term "hybridization" refers to the formation of a double-stranded nucleic acid from complementary single-stranded nucleic acids, and may occur when the sequence is perfectly complementary to the target sequence (perfect match) or when it is partially mismatched (mismatch).

[0026] The probe may include a fluorescent material. The probe may have a reporter and a quencher fluorescent material capable of quenching the reporter fluorescence attached to both ends, and may include an intercalating fluorescent material.

[0027] A fluorescent material may be attached to the 5' end of the probe of the present invention and a quencher that quenches the above fluorescent signal may be attached to the 3' end of the probe, and a fluorescent material may be attached to the 3' end of the probe and a quencher that quenches the fluorescent signal may be attached to the 5' end of the probe.

[0028] The above reporter may be one or more selected from the group consisting of fluorescein, fluorescein chlorotriazinyl, rhodamine green, rhodamine red, tetramethylrhodamine, FITC, Oregon green, Alexa Fluor, FAM (6-carboxyfluorescein), JOE, ROX, HEX (2',4',5',7',-tetrachloro-6 carboxy-4,7-dichlorofluorescein), Texas Red, TET, TRITC, TAMRA, cyanine series dyes and thiadicarbocyanine dyes, but is not limited thereto.

[0029] The above quencher may be one or more selected from the group consisting of Dabcyl, TAMRA, Eclipse, DDQ, QSY, Blackberry Quencher, Black Hole Quencher, Qxl, Iowa Black FQ, Iowa Black RQ, and IRDye QC-1, but is not limited thereto.

[0030] The above intercalating fluorescent material is acridine homodimer and its derivatives, acridine orange and its derivatives, 7-aminoactinomycin D (7-AAD) and its derivatives, actinomycin D and its derivatives, ACMA (9-amino-6-chloro-2-methoxyacridine) and its derivatives, DAPI and its derivatives, dihydroethidium and its derivatives, ethidium bromide and its derivatives, ethidium homodimer-1 (EthD-1) and its derivatives, ethidium homodimer-2 (EthD-2) and its derivatives, ethidium monoazide and its derivatives, It may be selected from the group consisting of hexidium iodide and derivatives thereof, bisbenzimide (Hoechst 33258) and derivatives thereof, Hoechst 33342 and derivatives thereof, Hoechst 34580 and derivatives thereof, hydroxystilbamidine and derivatives thereof, LDS 751 and derivatives thereof, propidium iodide (PI) and derivatives thereof, and Cy-dyes derivatives.

[0031] The above probe may be one or more selected from the group consisting of oligonucleotides, PNA (Peptide nucleic acids), LNA (Locked nucleic acid), HNA (Hexitol Nucleic Acids), ANA (Altritol Nucleic Acids), MNA (Mannitol Nucleic Acids), and BNA (Bridged nucleic acid), but is not limited thereto.

[0032] The above amplification can be performed via a real-time polymerase chain reaction.

[0033] In the present invention, the real-time polymerase chain reaction is an analysis method for monitoring amplified products in real time, enabling accurate quantification that is difficult to measure with conventional PCR methods. The real-time polymerase chain reaction can be used in various ways, not only for quantitative analysis such as nucleotide expression analysis but also for qualitative analysis such as pathogen infection diagnosis. The real-time polymerase chain reaction detects the amount of PCR amplification products using fluorescence.

[0034] In the present invention, the real-time polymerase chain reaction may be an asymmetric PCR, and preferably, a two-step reaction of symmetric PCR and asymmetric PCR may be performed sequentially. When the two-step reaction of symmetric PCR and asymmetric PCR is performed sequentially, symmetric PCR and asymmetric PCR may be performed continuously within a single tube, which can be achieved by varying the annealing temperature of the primers for symmetric PCR and the annealing temperature of the primers for asymmetric PCR. The difference between the annealing temperature of the primers for symmetric PCR and the annealing temperature of the primers for asymmetric PCR is The annealing temperature may be 4-30℃, but is not limited thereto. In this case, the annealing temperature of the primers for symmetric PCR may be higher or lower than the annealing temperature of the primers for asymmetric PCR.

[0035] In the present invention, the asymmetric PCR method is a derivative technique of PCR that selectively amplifies single-stranded DNA from double-stranded DNA, and the asymmetric PCR method induces that the amounts of the amplification product synthesized by the forward primer and the amplification product synthesized by the reverse primer differ by varying the concentrations of the forward and reverse primers.

[0036] In the present invention, in the asymmetric PCR process, in order to produce a complementary strand for annealing by the fusion probe, only one primer may be added, or one of the forward primer and the reverse primer may be added at an excess molar concentration ratio, and in this case, the molar concentration ratio of the forward primer and the reverse primer It can be added in a ratio of 1:2 to 100 or vice versa.

[0037] In the present invention, the term "primer" refers to an oligonucleotide that is complementary to the 5' end sequence and the 3' end sequence adjacent to the target nucleic acid used in PCR, and the terms "forward primer" and "reverse primer" refer to primers that bind to the 3' end and 5' end, respectively, of a specific region of a gene amplified by the polymerase chain reaction. The specific length and sequence of the primer will depend on the complexity of the required target nucleic acid as well as primer usage conditions such as temperature and ionic strength.

[0038] In the present invention, Fluorescence Melting Curve Analysis (FMCA) was used as a hybridization method, and the melting curve analysis is performed using the melting temperature of the amplification product and the melting probe produced after the PCR is completed.

[0039] The melting curve analysis of the present invention is a method for interpreting the melting temperature of a target sequence and a melting probe. When a hybrid is formed between a target sequence and a melting probe that is complementary to a sequence containing a variant that is the target for detection, and the temperature is gradually increased, fluorescence is detected as the target sequence and the melting probe dissociate, and then the melting temperature is determined according to the detection result to determine whether the target sequence is amplified.

[0040] In the present invention, the sample to be analyzed may be any mixture or solution that contains or is suspected of containing the target nucleic acid to be detected and thus requires detection. The sample may be a biological sample obtained from a human or animal, as well as a processed sample in which such biological samples are processed to increase the concentration of the target nucleic acid. Furthermore, it may be a sample requiring examination, such as water, food, industrial wastewater, environmental pollutants, toxic agents, or organic samples obtained from food processing equipment, which contain or are believed to contain the target nucleic acid. Such samples may include a titrating diluent or a buffer solution, and when the presence of bacteria or viruses is to be detected, they may be a culture medium or a bacterial or viral culture containing culture medium components.

[0041] In the present invention, the sample may preferably be a biological sample obtained from a human or animal or a processed sample thereof. The biological sample may be obtained from a human or animal that contains or is suspected of containing the target nucleic acid to be detected and thus requires detection, such as whole blood, serum, plasma, umbilical cord blood, urine, feces, saliva, nasal mucus, semen, amniotic fluid, lavage fluid (bronchial alveoli, stomach, abdominal cavity, etc.), lymph fluid, sputum, tissue, cells, etc. The processed sample may be, for example, plasma, serum, a biological sample in which the nucleic acid (DNA and / or RNA) concentration has been increased using a nucleic acid extraction kit, tissue extract, cells obtained from tissue, cell lysates, cell cultures, bacterial cultures, virus cultures, etc.

[0042] In the present invention, the target nucleic acid refers to any nucleic acid that can bring about any usefulness, such as being used for the diagnosis or prognosis of diseases, the identification of biological indicators, as well as research on functions or properties, by measuring the presence and amount of the nucleic acid to be detected.

[0043] In the present invention, the target nucleic acid refers to a single-stranded DNA containing a sequence to which the melting probe binds, i.e., a sequence complementary to the probe, or a double-stranded DNA to which the single-stranded DNA is bound. This single-stranded or double-stranded DNA may be genomic DNA in a sample, particularly a biological sample; cDNA generated by reverse transcription from RNA such as mRNA or rRNA; or an artificial target nucleic acid composed of an artificial arbitrary sequence generated from an actual target nucleic acid.

[0044] The present invention is characterized by the ability to simultaneously analyze two or more target nucleic acids labeled with a single fluorescence in a single tube.

[0045] In addition, the present invention provides a method for producing a fusion probe for single fluorescent signal multiple detection, comprising the step of producing two or more fusion probes each containing a sequence complementary to two or more target nucleic acids by labeling them with fluorescence of the same wavelength.

[0046] The above melting probes are characterized by having a melting temperature lower than the annealing temperature of the PCR process, and the difference in melting temperatures (Tm) between the melting probes is designed to be 7°C or more.

[0047] When using the fusion probe produced by the above method, 2-3 target nucleic acids can be analyzed simultaneously with one fluorescence, and when using 5 fluorescence channels, 10-15 target nucleic acids can be analyzed simultaneously.

[0048] The present invention provides a melting probe for multiple detection of a single fluorescent signal produced by the above method.

[0049] The melting probe of the present invention is identical to the above description, and to avoid excessive complexity in this specification, the description of the duplicate content is omitted.

[0050] The present invention will be explained in more detail below through examples.

[0051] The examples are solely for illustrating the invention, and it will be obvious to those skilled in the art that the scope of the invention is not to be interpreted as being limited by these examples.

[0052] <Example 1> Detection of 2 Types of Sexually Transmitted Infection Causative Pathogens Using Multiplex PCR

[0053] <1-1> Preparation of target substances for the detection of pathogens causing sexually transmitted infections

[0054] Causative agents that cause sexually transmitted infections (STIs) using targeted nucleic acids Neisseria gonorrhoeae and Chlamydia trachomatisSelected and artificially synthesized the target substance as shown in Table 1 below (Bionia Co., Ltd.).

[0055] name Sequence number Sequence(5'-3') Neisseria gonorrhoeae (NG) 1 CATCGGTAATAACTGTAAAAGACTTCAGAACCGGATACCCTTCTTGTGAAGTGATGTCTTTGGATACAATCAACTCTACTTCATACCAAGGTCGTGGTTTGACAAACCCTCGTTTATCTCGTCGACCTTCTCCAAAAAATACATTCAAAATTACTTTTTTCTTCGGTTTTAGCTGGAATTGAGAAATGATATTCTGACGTTTGGGCAAATAATTGCCGAATCTGTTCTGGTGCAATTTTCTGAACACCCAAACAATTTTC TAAATGGCTATTATGTTCAATAAATTTACTTGGTCTTTCAACTTCTTGGATATTTTTGCCTAGCTTATGAATAGTACTTTGAATATCTGCCTGCAAAATCTGTGCAGGCTTACCGTTCAAATGCAACAT AGTTTCATAAGTACGTTCCGTGCTATCCCAAAAACACGTTAAGTTAGCAGAACCAATTAATCCATTGATTTTTTGATAATTTTTTAAAGGAATACATTTTGCCGTGAAATTTCACAAAGGGGGAAACATAG Chlamydia trachomatis (CT) 2 ATTTTTGCAAAAAAAACTGGACCCGACCGAAGTCGAGCCCAGAAACACGGATAGTGTTATTAACGTTATTAACAAAGATAAACTTGCCAAAGTTTAACAAAATTATACAATTAATTAGAAGCGGAATTGTGCATTTACGTGAGCAGCTCTCTCATCGATCAAGCGAGTCTCAACTGTAACTGCGTATTTGTCTGCATCCACAATA GTTGTCCTACTGCAATACCGCAAGATTTTCTAGATTTCATCTTGTTCAATTGCAAGGAAACGATTTGCATGGTATCTCCGAGCTGACCCTCTGCGCTAGCTTTCACATCGCCAGCTCCAGCAATAGTTGGGTTCAGAGTGGTAACATCAAAGACAGTTGTAGCTGACTTCGGCTGAGCAATACGAATCGTGTCTGCATCAAAAC

[0056] <1-2> Primer Design for PCR

[0057] Primers were designed to amplify the target substance of Example <1-1>. PCR was performed sequentially using symmetric PCR and asymmetric PCR. The primers for symmetric PCR (indicated as sy_F, sy_R) and asymmetric PCR (indicated as asy_F) for each designed target are shown in Table 2. The primers for symmetric PCR and asymmetric PCR were designed to have different annealing temperatures.

[0058] name Sequence number Sequence(5'-3') Annealing temperature (°C) amplification product size (bp) NG_sy_F 3 CCAAGGTCGTGGTTTGACAAACCCTCG 62 302 NG_sy_R 4 TGTTGCATTTGAACGGTAAGCCTGCAC 62 NG_asy_F 5 CTTCGGTTTTAGCTGGAATTG 54 CT_sy_F 6 CGTGAGCAGCTCTCTCATCGATCAAGC 62 164 CT_sy_R 7 CGCAGAGGGTCAGCTCGGAG 62 CT_asy_F 8 GCATCCACAATAGTTGTTCCT 54

[0059] <1-3> Melting probe for melting curve analysis Fabrication and verification of Tm values ​​for each melting probe

[0060] To analyze the melting curve after amplifying the target substance of Example <1-1>, melting probes were prepared as shown in Table 3 below. The Tm value of the melting probes was designed to be lower than the annealing temperature (56°C) of the PCR process. Two targets were labeled per fluorescence, and each melting probe labeled with the same fluorescence was designed to have a different Tm value.

[0061] name Sequence number Sequence(5'-3') NG melting probe(1) 9 / FAM / TCAGAAAATTGCAGGAGAACAGATTCG / BHQ1 / CT melting probe (1) 10 / FAM / CTAGAAAATCTTTAGGTATTG / BHQ1 /

[0062] First, singleplex PCR was performed to check the Tm value of the fabricated fusion probe.

[0063] Specifically, to perform PCR, NEXpro TMA PCR mixture was prepared by adding 10 µl of qPCR 2X Master Mix (NexQ-4000, Genes Lab, Korea), 1 µl of sy_F (F primer) (10 pmol / µl), 1 µl of sy_R (R primer) (10 pmol / µl), 1 µl of asy_F (30 pmol / µl), 1 µl of melting probe (5 pmol / µl), 1 µl of TE buffer, and 5 µl of sample to a final volume of 20 µl. Real-time PCR was performed using the PCR mixture prepared by the above method, and amplification and melting curve analyses were conducted. The instrument used for the analysis was a CFX96 TM A real-time system (Bio-Rad, USA) was used.

[0064] For amplification curve analysis, the initial denaturation was performed by pre-denaturation at 95°C for 5 minutes, followed by a total of 45 cycles of denaturation at 95°C for 10 seconds and annealing at 62°C for 30 seconds, followed by a total of 20 cycles of denaturation at 95°C for 10 seconds and annealing at 56°C for 30 seconds. For melting curve analysis, after a denaturation step at 95°C for 3 minutes, fluorescence was measured while increasing the temperature from 28°C to 60°C in increments of 0.5°C. A resting state was maintained for 5 seconds between each step (Fig. 2).

[0065] As a result, as shown in Figure 3, the Tm value of the NG melting probe was confirmed to be 54.5℃, and the Tm value of the CT melting probe was 44℃.

[0066] <1-4> Results of Analysis of Two Causative Pathogens of Sexually Transmitted Infections Using Multiplex PCR

[0067] An experiment was conducted to determine whether two types of sexually transmitted infection pathogens could be tested and detected in one tube.

[0068] As a result, as shown in Fig. 3, labeled with FAM (quencher: BHQ1) Neisseria gonorrhoeae (NG) and Chlamydia trachomatisIn the case of (CT), two melting peaks were identified. Consequently, it was confirmed that two targets per fluorescence could be distinguished by Tm values.

[0069] Through the above results, it was confirmed that multiple targets can be analyzed simultaneously in one tube by analyzing melting curves using melting probes with various Tm values ​​with a single fluorescence. This suggests that when using five different fluorescences, 2 to 3 targets per fluorescence, totaling 10 to 15 targets, can be analyzed simultaneously in one tube.

[0070] <Example 2> Confirmation of the difference in Tm values ​​between fusion probes for Multiplex PCR

[0071] <2-1> Preparation of Target Substances

[0072] Example <1-1> Neisseria gonorrhoeae (NG) and Chlamydia trachomatis (CT) was selected as the target substance and artificially synthesized (Bionia Co., Ltd.).

[0073] <2-2> Primer Design for PCR

[0074] Primers for amplifying the target substance of Example <2-1> were prepared as shown in Table 2.

[0075] <2-3> Melting Probe Fabrication and verification of Tm values ​​for each melting probe

[0076] To analyze the melting curve after amplifying the target substance of Example <2-1>, melting probes were prepared as shown in Table 5 below. The Tm value of the melting probes was designed to be lower than the annealing temperature (56°C) of the PCR process. Two targets were labeled per fluorescence, and each melting probe labeled with the same fluorescence was designed with a different Tm value. Meanwhile, to determine the effect of the difference in Tm values ​​between melting probes on the melting curve analysis when performing multiplex PCR, the probes were prepared so that the difference in Tm values ​​was 6°C (Sequence No. 11 and Sequence No. 10) or 7°C (Sequence No. 12 and Sequence No. 13) (Table 4).

[0077] name Sequence number Sequence(5'-3') NG melting probe(2) 11 / FAM / AGAAAATTGCAGGAGAACAGATTCT / BHQ1 / CT melting probe (1) 10 / FAM / CTAGAAAATCTTTAGGTATTG / BHQ1 / NG melting probe(3) 12 / FAM / CAGAAAATTGCAGGAGAACAGATTC / BHQ1 / CT melting probe (2) 13 / FAM / TCTAGAAAATCTTTAGGTATT / BHQ1 /

[0078] First, an experiment was conducted to verify the Tm value of each fabricated melting probe.

[0079] Specifically, to perform PCR, NEXpro TM A PCR mixture was prepared by adding 10 µl of qPCR 2X Master Mix (NexQ-4000, Genes Lab, Korea), 1 µl of sy_F (F primer) (10 pmol / µl), 1 µl of sy_R (R primer) (10 pmol / µl), 1 µl of asy_F (30 pmol / µl), 1 µl of melting probe (5 pmol / µl), 1 µl of TE buffer, and 5 µl of sample to a final volume of 20 µl. Real-time PCR was performed using the PCR mixture prepared by the above method, and amplification and melting curve analyses were conducted. The instrument used for the analysis was a CFX96 TM A real-time system (Bio-Rad, USA) was used.

[0080] For amplification curve analysis, the initial denaturation was performed by pre-denaturation at 95°C for 5 minutes, followed by a total of 45 cycles of denaturation at 95°C for 10 seconds and annealing at 62°C for 30 seconds, followed by a total of 20 cycles of denaturation at 95°C for 10 seconds and annealing at 56°C for 30 seconds. For melting curve analysis, after a denaturation step at 95°C for 3 minutes, fluorescence was measured while increasing the temperature from 28°C to 60°C in increments of 0.5°C. A resting state was maintained for 5 seconds between each step (Fig. 2).

[0081] As a result, the Tm value of the NG melting probe (1) was found to be 50°C, the Tm value of the CT melting probe (1) was 44°C, the Tm value of the NG melting probe (2) was 50.5°C, and the Tm value of the CT melting probe (2) was 43.5°C (Fig. 4).

[0082] <2-4> Analysis Results of Melting Curves Based on the Difference in Tm Values ​​Between Melting Probes

[0083] To detect different targets labeled with the same fluorescence in one tube, an experiment was conducted to determine whether it is possible to analyze the melting curve by varying the difference in Tm values ​​between the melting probes.

[0084] To perform PCR, NEXpro TM A PCR mixture was prepared by adding 10 µl of qPCR 2X Master Mix (NexQ-4000, Genes Lab, Korea), 1 µl of NG_sy_F / NG_sy_R / CT_sy_F / CT_sy_R Primer mix (10 pmol / µl each), 1 µl of NG / CT_sy_F (30 pmol / µl each), 1 µl of NG / CT melting probe mix (5 pmol / µl each), 2 µl of TE buffer, and 5 µl of sample to make a final volume of 20 µl.

[0085] Real-time PCR was performed using the PCR mixture prepared by the above method, and amplification and melting curve analyses were conducted. The CFX96 instrument was used for the analysis. TM A real-time system (Bio-Rad, USA) was used.

[0086] As a result of performing multiplex PCR, as shown in Figure 4, it was confirmed that the melting peak was not clearly distinguished when the difference in Tm value was 6℃, but the melting peak was clearly distinguished when the difference in Tm value was 7℃.

[0087] Through the above experiment, it can be seen that when using a single signal, multiple targets can be detected simultaneously in a single reaction in one tube by designing the melting temperatures of the melting probes of each target to differ by more than 7°C.

Claims

Claim 1 A method for the simultaneous detection of multiple target nucleic acids using a single fluorescence, comprising: (a) designing two or more melting probes complementary to each target nucleic acid to simultaneously detect two or more target nucleic acids and labeling each melting probe with fluorescence of the same wavelength; (b) amplifying two or more target nucleic acids to obtain amplification products; (c) hybridizing and melting the amplification products and the melting probes complementary thereto to obtain a melting curve; and (d) analyzing the melting curve, wherein the melting probes have a melting temperature (Tm) lower than the annealing temperature of the PCR process, and the difference in melting temperatures (Tm) between the melting probes is 7°C or more. Claim 2 A method for the simultaneous detection of multiple target nucleic acids using a single fluorescence, characterized in that, in claim 1, the melting probe is not cleaved during the amplification process. Claim 3 A method for the simultaneous detection of multiple target nucleic acids using a single fluorescence, wherein, in claim 1, the melting probe is characterized by having a reporter and a quencher attached to both ends. Claim 4 A method for the simultaneous detection of multiple target nucleic acids using a single fluorescence, wherein, in claim 3, the reporter is one or more selected from the group consisting of fluorescein, fluorescein chlorotriazinyl, rhodamine green, rhodamine red, tetramethylrhodamine, FITC, Oregon green, Alexa Fluor, FAM (6-carboxyfluorescein), JOE, ROX, HEX (2',4',5',7',-tetrachloro-6 carboxy-4,7-dichlorofluorescein), Texas Red, TET, TRITC, TAMRA, cyanine-based dyes, and thiadicarbocyanine dyes. Claim 5 A method for the simultaneous detection of multiple target nucleic acids using a single fluorescence, wherein, in claim 3, the quencher is one or more selected from the group consisting of Dabcyl, TAMRA, Eclipse, DDQ, QSY, Blackberry Quencher, Black Hole Quencher, Qxl, Iowa Black FQ, Iowa Black RQ, and IRDye QC-1. Claim 6 A method for the simultaneous detection of multiple target nucleic acids using a single fluorescence, characterized in that, in claim 1, the amplification is performed through a real-time polymerase chain reaction (Real-time PCR). Claim 7 A method for the simultaneous detection of multiple target nucleic acids using a single fluorescence, characterized in that, in claim 6, the real-time polymerase chain reaction is an asymmetric PCR. Claim 8 A method for the simultaneous detection of multiple target nucleic acids using a single fluorescence, wherein, in claim 6, the real-time polymerase chain reaction is characterized by sequentially performing symmetric PCR and asymmetric PCR. Claim 9 A method for producing melt probes for single fluorescent signal multiplex detection, comprising the step of producing two or more melt probes each containing sequences complementary to two or more target nucleic acids by labeling them with fluorescence of the same wavelength, wherein the melt probes have a melting temperature lower than the annealing temperature of the PCR process, and the difference in melting temperatures (Tm) between the melt probes is designed to be 7°C or more. Claim 10 A melting probe for single fluorescence signal multiple detection fabricated by the method of claim 9.

Images