Composition for improving skin aging caused by ultraviolet rays, comprising magnolia flower bud extract and callus culture solution

Abstract

The present invention aims to provide a composition for improving skin aging comprising a magnolia flower bud extract and a callus culture medium that contain polyphenols and flavonoids, have excellent antioxidant activity, and inhibit Elastase and Collagenase to maintain skin elasticity. The composition of the present invention has excellent effects in improving and alleviating skin aging caused by ultraviolet rays.

Description

Technology Field

[0001] The present invention relates to a composition for improving skin aging comprising an extract of Magnolia biondii Pampanini flower buds and a callus culture solution, and aims to provide a composition that maintains skin elasticity and has an effect of improving skin aging. Background Technology

[0003] Magnolia kobus is a deciduous tree belonging to the genus Magnolia, native to South Korea and Japan. In particular, the flower buds of the magnolia are called "Sini" in traditional Korean medicine and are used as a medicinal ingredient. Sini is known to be effective for rhinitis, headaches, poor concentration, and coughs. The *Compendium of Materia Medica*, an ancient text on Korean medicine, records that it eliminates freckles, reduces facial swelling, and adds radiance. Its main components and effects include flavonoids and alkaloids, which are known to provide anti-inflammatory, skin-whitening, and antioxidant properties.

[0004] The callus culture medium used in the present invention is a plant-derived biomaterial, and callus refers to a mass of undifferentiated plant cells formed when plant cells are cultured. In this case, the plant cell mass can be considered a plant stem cell and possesses the ability to redifferentiate into other plant organs through the regulation of appropriate plant hormones. Therefore, the callus culture medium can be described as an extract containing active ingredients obtained by mass-culturing such callus cells in vitro in a nutrient-rich medium, and it possesses various functions and effects depending on the type of plant callus contained therein.

[0005] Skin aging caused by ultraviolet (UV) radiation is called 'photoaging.' Unlike intrinsic aging, which occurs naturally with age, this is a phenomenon of skin damage accelerated by UV exposure. There are two types of UV radiation: UVA (320-400nm) and UVB (280-320nm). UVA has a longer wavelength and penetrates deep into the dermis, becoming the primary cause of tanning and photoaging. UVB, on the other hand, is absorbed by the epidermis, the surface layer of the skin, and is a major cause of sunburn and skin cancer.

[0006] Therefore, due to ultraviolet rays as described above, skin cells generate reactive oxygen species, which induces oxidative stress, and damage to collagen and elastin fibers causes skin elasticity to collapse and can also be a cause of diseases such as cancer. The problem to be solved

[0008] Therefore, while blocking ultraviolet rays is the best solution for preventing skin aging and skin cancer, UV rays are emitted not only from sunlight but also from everyday sources such as fluorescent lights and computer monitors, which can lead to skin aging.

[0009] Therefore, as mentioned above, while UV protection indoors as well as outdoors is very important, it has clear limitations, and consequently, a cosmetic composition that helps restore the skin is required.

[0010] Accordingly, the present invention aims to provide a composition for improving skin aging with enhanced functionality by including a callus culture medium in a magnolia flower bud (Magnolia) extract having anti-inflammatory, antioxidant, and whitening effects. means of solving the problem

[0012] In order to solve the aforementioned problem, the present invention provides a pharmaceutical composition for improving and preventing skin aging comprising magnolia flower bud extract and callus culture solution.

[0013] As an embodiment of the invention, the present invention provides a method for preparing a composition for improving and preventing skin aging, comprising magnolia flower bud extract and callus culture solution.

[0014] As one embodiment of the invention, the present invention provides a food composition for improving and preventing skin aging comprising magnolia flower bud extract and callus culture solution.

[0015] As one embodiment of the invention, the present invention provides a cosmetic composition for improving and preventing skin aging comprising magnolia flower bud extract and callus culture solution. Effects of the invention

[0017] The present invention is an invention that has excellent effects in improving and alleviating skin aging caused by ultraviolet rays, comprising a magnolia flower bud extract and a callus culture solution, which contains polyphenols and flavonoids, has excellent antioxidant capacity, and inhibits Elastase and Collagenase to maintain skin elasticity, and increases the expression of genes related to improving skin aging and decreases the expression of genes related to inducing aging. Brief explanation of the drawing

[0019] Figure 1 is a schematic diagram illustrating the process of preparing the PhytoG callus culture medium, which is a magnolia flower bud (Magnolia) used in this study. Figure 2A is a graph showing the DPPH radical scavenging activity of MDPM, and Figure 2B is a graph showing the ABTS radical scavenging activity of MDPM. Figure 3A shows the elastase inhibitory activity of MDPM. Figure 3B is a graph showing the collagenase inhibitory activity of MDPM. Figure 4A is a graph showing the cell viability of MDPM in HaCaT cells, Figure 4B is a graph showing the cell viability of UVB-irradiated HaCaT cells, and Figure 4C is a graph showing the cell viability of MDPM in UVB-irradiated HaCaT cells. Figure 5A is a graph showing the effect of MDPM on the COL1A1 gene expression level in UVB-irradiated HaCaT cells, Figure 5B is a graph showing the effect of MDPM on the HAS1 gene expression level in UVB-irradiated HaCaT cells, Figure 5C is a graph showing the effect of MDPM on the HAS2 gene expression level in UVB-irradiated HaCaT cells, and Figure 5D is a graph showing the effect of MDPM on the HAS3 gene expression level in UVB-irradiated HaCaT cells. Figure 6A is a graph showing the effect of MDPM on FLG gene expression levels in UVB-irradiated HaCaT cells, Figure 6B is a graph showing the effect of MDPM on LOR gene expression levels in UVB-irradiated HaCaT cells, and Figure 6C is a graph showing the effect of MDPM on IVL gene expression levels in UVB-irradiated HaCaT cells. Figure 7A is a graph showing the effect of MDPM on the HYAL1 gene expression level in UVB-irradiated HaCaT cells, Figure 7B is a graph showing the effect of MDPM on the HYAL2 gene expression level in UVB-irradiated HaCaT cells, Figure 7C is a graph showing the effect of MDPM on the MMP1 gene expression level in UVB-irradiated HaCaT cells, and Figure 7D is a graph showing the effect of MDPM on the MMP2 gene expression level in UVB-irradiated HaCaT cells. Figure 8A is a graph showing the effect of MDPM on the MMP3 gene expression level in UVB-irradiated HaCaT cells, Figure 8B is a graph showing the effect of MDPM on the MMP9 gene expression level in UVB-irradiated HaCaT cells, and Figure 8C is a graph showing the effect of MDPM on the TIMP1 gene expression level in UVB-irradiated HaCaT cells. Figure 9 shows the results of confirming cell viability according to callus culture medium concentration. Figure 10 is a graph showing the DPPH(A) and ABTS(B) radical scavenging activity according to the concentrations of Magnolia extract, callus culture medium, and Magnolia callus culture medium. Figure 11 is a graph showing the total polyphenol content (A) and total flavonoid content (B) of magnolia extract, callus culture, and magnolia callus culture. Figure 12A is a graph regarding the COL1A1 gene expression levels of Magnolia extract, callus culture medium, and Magnolia callus culture medium, and Figure 12B is a graph regarding the HAS1 gene expression levels of Magnolia extract, callus culture medium, and Magnolia callus culture medium. Figure 13A is a graph regarding the HYAL1 gene expression levels of Magnolia extract, callus culture medium, and Magnolia callus culture medium; Figure 13B is a graph regarding the MMP1 gene expression levels of Magnolia extract, callus culture medium, and Magnolia callus culture medium; and Figure 13C is a graph regarding the MMP3 gene expression levels of Magnolia extract, callus culture medium, and Magnolia callus culture medium. Specific details for implementing the invention

[0020] The present invention aims to provide a cosmetic composition for improving or alleviating skin aging, comprising magnolia flower bud extract and callus culture solution.

[0021] In one embodiment of the invention, the skin aging may be exogenous aging caused by environmental factors and lifestyle habits such as exposure to ultraviolet rays (photoaging), smoking, drinking, pollution, stress, lack of sleep, and nutritional imbalance, or endogenous aging caused by natural phenomena; however, in the case of the present invention, it is exogenous skin aging, and more specifically, photoaging caused by exposure to ultraviolet rays.

[0022] As one embodiment of the invention, the magnolia flower bud extract may have a concentration of 50 to 1500 μg / ml, specifically 100 to 1000 μg / ml, and more specifically 200 to 400 μg / ml.

[0023] As one embodiment of the invention, the callus culture solution composition may be a callus culture solution composition composed of purified water, callus culture extract, butylene glycol, and 1,2-hexanediol.

[0024] As one embodiment of the invention, the purified water included in the composition may be included in an amount of 45 to 60 weight %, specifically in an amount of 50 to 55 weight %, and more specifically in an amount of 53 weight %.

[0025] As one embodiment of the invention, the callus culture extract included in the composition may be included in an amount of 10 to 30 weight %, specifically 15 to 25 weight %, and more specifically 20 weight %.

[0026] As one embodiment of the invention, the 1,2-hexanediol included in the composition may be included in an amount of 0 to 5 weight %, specifically in an amount of 1 to 3 weight %, and more specifically in an amount of 2 weight %.

[0027] As one embodiment of the invention, the butylene glycol included in the composition may be included in an amount of 15 to 35 weight %, specifically 20 to 30 weight %, and more specifically 25 weight %.

[0028] As one embodiment of the invention, the callus culture extract may comprise one or more callus cultures selected from the group consisting of ginseng callus culture extract, grape callus culture extract, edelweiss callus culture extract, rose callus culture extract, green tea callus culture extract, apple callus culture extract, and comfrey callus culture extract; specifically, it may comprise one or more callus cultures selected from the group consisting of ginseng callus culture extract, grape callus culture extract, edelweiss callus culture extract, and rose callus culture extract; more specifically, it may comprise edelweiss callus culture It includes Extract.

[0029] As one embodiment of the invention, the callus culture solution may have a concentration of 20 to 60%, specifically 40 to 55%, and more specifically 50%.

[0030] As one embodiment of the invention, the composition of the present invention comprises dissolving a magnolia flower bud extract in a callus culture medium, wherein the magnolia flower bud extract may be included in the callus culture medium at a concentration of 10 to 50 weight %, specifically at 15 to 45 weight %, and more specifically at 20 to 40 weight %.

[0031] As one embodiment of the invention, the present invention may provide a method for preparing a composition for improving and alleviating skin aging, comprising a magnolia flower bud extract and a callus culture solution, comprising the following steps.

[0032] (1) A step of obtaining an extract by hot water extraction of magnolia flower buds with a solvent;

[0033] (2) A step of filtering and freeze-drying the extract from step (1) above; and

[0034] (3) A step of dissolving the magnolia flower bud extract powder from step (2) above in a callus culture medium.

[0035] In one embodiment of the invention, the solvent of step (1) may be one or more selected from the group consisting of water, ethanol, methanol, isopropanol, and combinations thereof, specifically one or more selected from the group consisting of water, ethanol, and combinations thereof, and more specifically ethanol is used as the solvent.

[0036] As one embodiment of the invention, the ethanol may be ethanol with a concentration of 50 to 100%, more specifically ethanol with a concentration of 60 to 80%, and more specifically ethanol with a concentration of 70%.

[0037] As one embodiment of the invention, in step (1), 10 to 100 g of magnolia flower buds may be extracted in 1 L of solvent, specifically 30 to 70 g may be extracted in 1 L of solvent, and more specifically 50 g may be extracted in 1 L of solvent.

[0038] As one embodiment of the invention, in step (1) above, the hot water extraction temperature may vary depending on the type of plant among temperatures of 70 to 100°C, but in the case of the present invention, extraction may be performed at a temperature of 100°C.

[0039] As one embodiment of the invention, the hot water extraction of the magnolia flower bud in step (1) may be performed for 1 to 5 hours, specifically for 2 to 4 hours, and more specifically for 3 hours.

[0040] In one embodiment of the invention, in step (3), the magnolia flower bud extract powder may be included in the callus culture medium in an amount of 10 to 50 weight%, specifically in an amount of 15 to 45 weight%, and more specifically in an amount of 20 to 40 weight%.

[0041] As one embodiment of the invention, the concentration of the callus culture medium may have a concentration of 20 to 100%, specifically 40 to 60%, and more specifically 50%.

[0042] As one embodiment of the invention, the magnolia flower bud extract and callus culture solution may be included in the composition at a concentration of 1 to 1000 μg / mL, specifically at a concentration of 100 to 500 μg / mL, and more specifically at a concentration of 200 to 400 μg / mL.

[0044] As one embodiment of the invention, the cosmetic composition comprising the magnolia flower bud extract and the callus culture solution may increase collagen, elastin, fibronectin, and laminin, specifically may be collagen, elastin, and fibronectin, and more specifically may be collagen and elastin.

[0045] As one embodiment of the invention, a cosmetic composition comprising the magnolia flower bud extract and callus culture solution may increase the expression of genes COL1A1, HAS1, HAS3, LOR, IVL, and TIMP1 associated with skin aging improvement, and decrease the expression of genes HYAL1, HYAL2, MMP1, MMP2, MMP3, and MMP9 associated with aging induction.

[0046] As one embodiment of the invention, the cosmetic composition comprising the magnolia flower bud extract and the callus culture solution may contain 90 to 120 mg / g of polyphenol, specifically 100 to 110 mg / g, and more specifically 105.18 ± 2.59 mg / g.

[0047] As one embodiment of the invention, the cosmetic composition comprising the magnolia flower bud extract and the callus culture solution may contain 5 to 25 mg / g of flavonoid, specifically 10 to 20 mg / g, and more specifically 16.62±3.73 mg / g.

[0049] As an embodiment of the invention, the present invention aims to provide a food composition for improving or preventing skin aging, comprising a composition containing magnolia flower bud extract and a callus culture solution.

[0050] As an embodiment of the invention, the food composition may include food-grade acceptable food additives in addition to the active ingredient. The food additive refers to a component that can be added to food as an auxiliary component, and any food additive known in the industry that is added to the preparation of food of each formulation may be used without limitation. In the present invention, any food additive that assists in the anti-inflammatory effect of the food composition without significantly altering the properties of the food composition may be used without limitation.

[0051] As an embodiment of the invention, the food composition may be, for example, various types of food, beverages, chewing gum, tea, vitamin complexes, health functional foods, etc. Additionally, in the present invention, food includes, but is not limited to, special nutritional foods (e.g., infant formula, baby food, etc.), processed meat products, fish products, tofu products, jelly products, noodles (e.g., ramen, noodles, etc.), health supplements, seasoning foods (e.g., soy sauce, soybean paste, red pepper paste, mixed sauce, etc.), sauces, confectionery products (e.g., snacks), dairy products (e.g., fermented milk, cheese, etc.), other processed foods, kimchi, pickled foods (various types of kimchi, pickled vegetables, etc.), beverages (e.g., fruit and vegetable beverages, soy milk, fermented beverages, etc.), and natural seasonings (e.g., ramen soup mix).

[0052] Examples of food additives include various nutritional supplements, vitamins, minerals (electrolytes), flavoring agents such as synthetic and natural flavoring agents, coloring agents and fillers, pectic acid and its salts, alginic acid and its salts, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohol, and carbonating agents used in carbonated beverages.

[0053] The above food composition may be used as a functional health food. The above health food refers to a food manufactured and processed in the form of tablets, capsules, powders, granules, liquids, pills, etc., using raw materials or ingredients that have functional properties useful to the human body. Here, functional properties mean obtaining effects useful for health purposes, such as regulating nutrients or physiological actions on the structure and function of the human body.

[0054] In addition, the above food composition can be used as an additive to various foods. Foods to which this food composition can be added may include meat, sausage, bread, chocolate, candy, snacks, confectionery, pizza, ramen, other noodles, chewing gum, dairy products including ice cream, various soups, beverages, tea, drinks, alcoholic beverages, and vitamin complexes, without any limitation on the type of food.

[0056] As an embodiment of the invention, the present invention aims to provide a cosmetic composition for improving or preventing skin aging, comprising a composition containing magnolia flower bud extract and a callus culture solution.

[0057] As one embodiment of the invention, the cosmetic composition may be prepared in a formulation selected from the group consisting of a solution, an external ointment, a cream, a foam, a nourishing lotion, a softening lotion, a pack, a softening water, a liquid, a makeup base, an essence, a soap, a liquid cleanser, a bath additive, a sunscreen cream, a sun oil, a suspension, an emulsion, a paste, a gel, a lotion, a powder, a soap, a surfactant-containing cleansing product, an oil, a powder foundation, an emulsion foundation, a wax foundation, a microneedle formulation, a patch, and a spray, but is not limited thereto.

[0058] As an embodiment of the invention, the cosmetic composition may additionally include one or more cosmetically acceptable carriers that are incorporated into general skin cosmetics, and may appropriately incorporate, for example, oils, water, surfactants, moisturizers, lower alcohols, thickeners, chelating agents, colorants, preservatives, fragrances, etc., as common ingredients, but are not limited thereto.

[0059] As one embodiment of the invention, the cosmetically acceptable carrier included in the cosmetic composition may vary depending on the formulation.

[0060] In one embodiment, when the formulation of the cosmetic composition is an ointment, paste, cream, or gel, animal oil, vegetable oil, wax, paraffin, starch, tragacanth, cellulose derivative, polyethylene glycol, silicone, bentonite, silica, talc, zinc oxide, or a mixture thereof may be used as a carrier component.

[0061] In the case where the formulation of the cosmetic composition according to one embodiment is a powder or a spray, it may include a propellant such as lactose, talc, silica, aluminum hydroxide, calcium silicate, polyamide chlorofluorohydrocarbon, propane / butane, or dimethyl ether as a carrier component.

[0062] In the case where the formulation of the cosmetic composition according to one embodiment is a solution or an emulsion, a solvent, a solubilizing agent, or an emulsifying agent is used as a carrier component, such as water, ethanol, isopropanol, diethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butylene glycol, and oil may be used, and in particular, cottonseed oil, peanut oil, corn germ oil, olive oil, castor oil and sesame oil, glycerol aliphatic ester, polyethylene glycol or fatty acid ester of sorbitan may be used.

[0063] In the case where the formulation of the cosmetic composition according to one embodiment is a suspension, a liquid diluent such as water, ethanol, or propylene glycol, a suspending agent such as ethoxylated isostearyl alcohol, polyoxyethylene sorbitol ester, and polyoxyethylene sorbitan ester, microcrystalline cellulose, aluminum methacidoxide, bentonite, agar, or tragacanth may be used as a carrier component.

[0066] As one embodiment of the invention, the present invention aims to provide a pharmaceutical composition for improving and preventing skin aging, or for prevention or treatment, comprising a composition containing magnolia flower bud extract and a callus culture solution.

[0067] In the present invention, "improvement" refers to any act of inhibiting or delaying skin aging through the administration of the above composition.

[0068] In the present invention, the pharmaceutical composition may comprise a pharmaceutically acceptable carrier.

[0069] In one embodiment of the invention, the pharmaceutical composition may further include pharmaceutically acceptable additives. The additives may include, but are not limited to, starch, gelatinized starch, microcrystalline cellulose, lactose, povidone, colloidal silicon dioxide, hydroxy calcium phosphate, lactose, mannitol, malt syrup, gum arabic, pregelatinized starch, corn starch, powdered cellulose, hydroxypropyl cellulose, Opadry, sodium starch glycolate, carnauba wax, synthetic aluminum silicate, stearic acid, magnesium stearate, aluminum stearate, calcium stearate, sucrose, dextrose, sorbitol, and talc.

[0070] According to one embodiment of the present invention, the pharmaceutical composition may include a pharmaceutically acceptable carrier. The carrier is one that is commonly used in the manufacture of pharmaceuticals and includes, but is not limited to, lactose, dextrose, sucrose, sorbitol, mannitol, trehalose, hyaluronic acid, starch, acacia gum, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methylcellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, and mineral oil.

[0071] According to one embodiment of the present invention, the pharmaceutical composition may further include a lubricant, a wetting agent, a sweetener, a flavoring agent, an emulsifier, a suspending agent, a preservative, etc.

[0072] The pharmaceutical composition of the present invention may be administered in various oral and parenteral formulations during actual clinical administration. It may be formulated and used in the form of oral formulations such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, and aerosols, as well as topical preparations, suppositories, and sterile injectable solutions, according to conventional methods. When formulating, it may be prepared using diluents or excipients such as commonly used fillers, volume expanders, binders, humectants, disintegrants, and surfactants. Solid formulations such as tablets, pills, powders, granules, and capsules may be prepared by mixing at least one excipient, for example, starch, calcium carbonate, sucrose, lactose, or gelatin, with the herbal composition of the present invention that has increased fat-soluble polyphenol components. In addition, lubricants such as magnesium stearate and talc may also be used in addition to simple excipients.

[0073] The pharmaceutical composition of the present invention may be administered orally or parenterally depending on the intended method, and when administered parenterally, a transdermal administration, intraperitoneal injection, rectal injection, subcutaneous injection, intravenous injection, intramuscular injection, or intrathoracic injection method may be selected. The dosage varies depending on the patient's weight, age, gender, health condition, diet, time of administration, method of administration, excretion rate, and severity of the disease.

[0074] The pharmaceutical composition of the present invention is administered in a pharmaceutically effective amount. In the present invention, "pharmaceutically effective amount" means an amount sufficient to treat a disease with a reasonable benefit / risk ratio applicable to medical treatment, and the effective dose level may be determined based on factors including the type and severity of the patient's disease, drug activity, sensitivity to the drug, time of administration, route of administration and elimination rate, duration of treatment, concurrently used drugs, and other factors well known in the medical field. A composition according to one embodiment of the present invention may be administered as an individual therapeutic agent or in combination with other therapeutic agents, may be administered sequentially or simultaneously with conventional therapeutic agents, and may be administered as a single or multiple doses. It is important to administer an amount that obtains maximum effect with a minimum amount without side effects by taking all of the above-mentioned factors into account, and this can be easily determined by a person skilled in the art.

[0076] One or more specific examples are described in more detail below through embodiments. However, these embodiments are intended to illustrate one or more specific examples and the scope of the present invention is not limited to these embodiments.

[0078] Example 1. Materials and Method

[0079] 1-1. Sample

[0080] The magnolia flower buds (*Shin-i*) and PhytoG callus culture medium used in this study were provided by Cellex Co., Ltd. The composition of the PhytoG callus culture medium is as shown in Table 1 below (Fig. 1).

[0081] INCI EU cosing (PCPC) All ingredients of Hangul Conc.(%) Water purified water 53.0% Leontopodium Alpinum Callus Culture Extract Edelweiss callus culture extract 20.0% Butylene Glycol Butylene glycol 25.0% 1,2-Hexanediol 1,2-hexanediol 2.00%

[0082] 1-2. Reagents

[0083] In this study, gallic acid, quercetin, sodium carbonate, aluminum nitrate nonahydrate, potassium acetate solution, 1,1-diphenyl-2-picryl-hydrazyl (DPPH), 2,2'-azinobis-3-ethylbenzothiazoline-6-sulfonic acid (ABTS), penicillin-streptomycin, trypan blue, N-succinyl-(L-Ala)3-p-nitroanilide, calcium chloride, 4-phenylazobenzyloxycarbonyl-prolyl-leucyl-glycyl-prolyl-D-arginine (4-phenylazobenzyloxycarbonyl-Pro-Leu-Gly-Pro-D-Arg), collagenase, citric acid, and ethyl acetate were purchased from Sigma-Aldrich (USA); folin & ciocalteu's phenol reagent, ethanol, and methanol were purchased from Merck (Germany); and EZ-cytox was purchased from DoGenBio (Korea). Dulbecco's modified eagle's medium (DMEM) and fetal bovine serum (FBS) were purchased from Gibco (USA).Products from ) company were used, and the easy-spin total RNA extraction kit was purchased from iNtRON Biotechnology (Korea), while the accupower® cyclescript RT premix (dT20) and DEPC-DW were purchased from Bioneer (Korea). In addition, the qPCRBIO SyGreen Blue Mix Lo-ROX was purchased from PCR Biosystems (USA).

[0085] 1-3. Device

[0086] For this study, the extraction mantle was from Misung Scientific (Korea), the rotary vacuum evaporator was from EYELA (Japan), the freeze dryer was from ilShinbiobase (Korea), the CO2 incubator, autoclave (deep-freezer was from Sanyo (Japan), the clean bench was from Vision Scientific (Korea), the vortex mixer, centrifuge, and ice-maker were from Vision Scientific (Korea), the plate shaker was from Lab-Line (USA), the microplate reader was from Molecular Devices (USA), the nanodrop was from Thermo Fisher Scientific (USA), the PCR cycler; alpha cycler 1 PCRmax was from PCRmax (UK), the real-time PCR cycler; Exicycler 96 was from Bioneer (Korea), and the UV lamp stand type was from Vilber Lourmat (France).

[0088] 1-4. Statistical Processing

[0089] The results of the study were expressed as mean ± standard deviation of mean using SPSS Statistics Version 21.0 (IBM, USA). Statistical comparisons between the two groups were performed using an independent sample t-test, and statistical significance was indicated at three significance levels: p < 0.05, p < 0.01, and p < 0.001.

[0091] Example 2. Sample Extraction and Preparation

[0092] 2-1. Method for preparing magnolia flower bud extract

[0093] 50 g of Magnolia flower buds (Sini) were each extracted with 1 L of 70% ethanol at 100 ℃ for 3 hours, and the extracts were filtered using filter paper. The filtered extracts were concentrated under reduced pressure using a rotary vacuum evaporator and freeze-dried using a freeze dryer. After freeze-drying was completed, powders were obtained, and information regarding the extracts is shown in Table 2.

[0094] Scientific name Parts Origin Yield(g) Yield ratio(%) Magnolia biondii Pampanini Flower Korea 8.09 16.18

[0096] 2-2. Method for preparing a PhytoG callus composition containing magnolia flower buds.

[0097] A mixture (Magnolia biondii Pampanini dissolved in phytoG callus culture medium, hereinafter referred to as MDPM) was prepared by dissolving a magnolia flower bud extract in 50% PhytoG callus culture medium. The prepared composition was stored at -20 ℃, aliquoted on the day of the experiment, and dissolved in distilled water for use.

[0099] Example 3. Experimental method for measuring total polyphenol and total flavonoid

[0100] 3-1. Measurement of Total Polyphenol Content

[0101] MDPM was prepared at a concentration of 1 mg / mL, and 0.5 mL of 50% Folin & Ciocalteu's phenol reagent was added to 1 mL of the sample and reacted at room temperature for 3 minutes. 1 mL of saturated Na2CO3 solution and 7.5 mL of distilled water were sequentially mixed into the reaction solution and left to stand for 30 minutes. After centrifugation at 14,000 g for 10 minutes, the supernatant was collected, and the absorbance was measured at a wavelength of 760 nm. The total phenol content was determined according to a calibration curve prepared using gallic acid as a standard.

[0103] 3-2. Measurement of Total Flavonoid Content

[0104] MDPM was prepared at a concentration of 1 mg / mL, and 0.5 mL of a mixture of 0.1 mL of sample and 0.9 mL of 80% ethanol was mixed with 0.1 mL of 10% aluminum nitrate, 0.1 mL of 1 M potassium acetate, and 4.3 mL of 80% ethanol. After leaving the mixture at room temperature for 40 minutes, the absorbance was measured at a wavelength of 415 nm, and the content was determined from a standard curve prepared using quercetin.

[0106] 3-3. Measurement Results

[0107] The total polyphenol content was measured using galic acid as a standard substance to determine the total polyphenol content present in MDPM, and the total flavonoid content present in MDPM was measured using quercetin as a standard substance. The results are shown in Table 3.

[0108] Total polyphenol(mg GAE # / g) 105.18±2.59 Total flavonoid(mg QE ##) / g) 16.62±3.73

[0110] #) Total phenolic content was expressed in milligrams of galic acid equivalent (GAE) per 1g of extract.

[0111] Total flavonoid content was expressed in milligrams of Quercetin equivalent (QE) per 1g of extract.

[0113] Example 4. Experimental method for measuring DPPH radical scavenging activity and ABTS radical scavenging activity

[0114] 4-1. DPPH Radical Scavenging Activity Measurement Method

[0115] MDPM was diluted to final concentrations of 1, 10, 100, and 1,000 μg / mL. 100 μL of the sample was mixed with 150 μL of 0.2 mM DPPH solution dissolved in ethanol and reacted at 37°C for 30 minutes. After the reaction, absorbance was measured at a wavelength of 517 nm. Distilled water was added as the control for the sample, and ethanol was added as the control for the DPPH solution to obtain a correction value. DPPH radical scavenging activity was calculated according to the following formula.

[0116]

[0118] 4-2. ABTS Radical Scavenging Activity Measurement

[0119] MDPM was diluted to final concentrations of 1, 10, 100, and 1000 μg / mL. For the ABTS solution, 7.4 mM ABTS (2,2-azino-bis-(3-ethylbenzothiazoline-6-sulfonic acid)) and 2.6 mM potassium persulphate were prepared and left in the dark for one day to form cations (ABTS·+). The solution was then diluted so that the absorbance value measured at 732 nm was 1.5 or less. 150 μL of the diluted ABTS·+ solution was mixed with 5 μL of the sample, reacted at room temperature for 10 minutes, and then the absorbance was measured at 732 nm. The ABTS radical scavenging activity was calculated according to the following formula.

[0120]

[0122] 4-3. Measurement Results

[0123] As a result of measuring DPPH radical and ABTS radical scavenging activity, MDPM showed a concentration-dependent increase in scavenging activity (Fig. 2).

[0124] Concentration(μg / mL) DPPH radical scavenging activity (%) ABTS radical scavenging activity(%) 1 2.27±1.53 5.02±2.96 10 22.24±1.48 20.78±2.35 100 47.86±2.91 59.75±2.98 1000 82.22±3.00 94.28±2.93

[0127] Example 5. Method for measuring elastase inhibitory activity and collagenase inhibitory activity.

[0128] 5-1. Measurement of Elastase Inhibitory Activity

[0129] MDPM was diluted to final concentrations of 1, 10, 100, and 1,000 μg / mL, and elastase and N-succinyl-(L-Ala)3-p-nitroanilide were dissolved in 50 mM Tris-HCl buffer (pH 8.6) according to each concentration. To 40 μl of each sample, 40 L of 2.5 U / mL elastase and 80 μL of 0.5 mg / mL N-succinyl-(L-Ala)3-p-nitroanilide were added, and the mixture was reacted at 37 °C for 30 minutes. Subsequently, the absorbance was measured at 445 nm using a microplate reader. Elastase inhibitory activity was calculated according to the following formula.

[0130]

[0132] 5-2. Measurement of Collagenase Inhibitory Activity

[0133] MDPM was diluted to final concentrations of 1, 10, 100, and 1,000 μg / mL, and 4-phenylazobenzyloxycarbonyl-Pro-Leu-Gly-Pro-D-Arg was dissolved in 0.1 M Tris-HCl buffer (pH 7.5) containing 4 mM CaCl2. To 100 μL of each sample at each concentration, 250 μL of 4-phenylazobenzyloxycarbonyl-Pro-Leu-Gly-Pro-D-Arg at a concentration of 0.3 mg / mL and 150 μL of collagenase at a concentration of 0.2 mg / mL were added and reacted at room temperature for 20 minutes. Subsequently, 500 μL of 6% citric acid and 1.5 mL of ethyl acetate were added, and the absorbance was measured at 320 nm using a microplate reader. Collagenase inhibitory activity was calculated according to the following formula.

[0134]

[0136] 5-3. Measurement Results

[0137] As a result of measuring elastase inhibitory activity and collagenase inhibitory activity, MDPM showed a concentration-dependent increase in inhibitory activity (Fig. 3).

[0138] Concentration(μg / mL) Elastase inhibitory activity(%) collagenase inhibitory activity(%) 1 3.22±1.91 4.40±2.84 10 9.59±3.39 13.05±2.90 100 26.71±2.10 21.55±3.36 1000 59.68±1.66 40.61±2.39

[0141] Example 6. Cell Culture and Measurement of Cell Viability

[0142] 6-1. Cell Culture Methods

[0143] HaCaT cells, which are human-derived keratinocytes, were purchased from the Korean Cell Line Bank (KCLB) and cultured in DMEM medium supplemented with 10% FBS in a cell culture incubator maintained at 37°C and 5% CO2. Cell subculture was performed at 2-3 day intervals.

[0145] 6-2. Measurement of Cell Viability

[0146] HaCaT cells in a 48-well plate at a rate of 2 x 10 4 Cells were seeded into cells / well and cultured for 24 hours. To measure MDPM cell viability, cells were treated with concentrations of 100, 200, 400, and 500 μg / mL and cultured for another 24 hours. To measure UVB-induced cell viability, the existing medium was removed and replaced with PBS, followed by UVB exposure at 10, 20, 30, and 50 mJ / cm². 2 It was investigated as follows. In addition, to measure the protective ability of MDPM after UVB irradiation, the existing medium was removed and replaced with PBS, and UVB was applied at 30 mJ / cm². 2 The cells were investigated using [method] and treated with MDPM diluted to concentrations of 100, 200, and 400 μg / mL in the medium, followed by incubation. After all cultures were completed, 10 μL of EZ-Cytox solution was added per 100 μL of culture medium and reacted in a cell culture incubator for 30 minutes. After the reaction, the absorbance was measured at a wavelength of 450 nm, and the cell viability relative to the control group was expressed as a percentage (Fig. 4).

[0148] 6-3. Measurement Results

[0149] 1) Cytotoxicity of MDPM

[0150] As a result of measuring the cytotoxicity of MDPM, it was confirmed that MDPM exhibited toxicity to cells, with a cell survival rate of less than 90% at concentrations of 500 μg / mL or higher, so subsequent experiments were conducted up to a concentration of 400 μg / mL.

[0151] Concentration(μg / mL) Cell viability(% of Control) 0 100.00±2.51 100 99.62±6.78 200 98.48±6.16 400 96.02±4.30 500 85.38±7.79

[0152] 2) Cytotoxicity of UVB

[0153] As a result of measuring the cytotoxicity of UVB, a cell survival rate of less than 80% was observed at concentrations of 30 mJ / cm2 or higher, indicating that moderate cell damage was induced; therefore, in subsequent experiments, UVB was set at 30 mJ / cm2 2 It was investigated as.

[0154] UVB irradiation dose (mJ / cm²) Cell viability(% of Control) 0 100.00±3.06 10 94.18±2.73 20 87.09±2.80 30 77.98±2.35 50 57.52±2.46

[0155] 3) Cell protective ability of MDPM

[0156] When the cytoprotective ability of MDPM was measured in UVB-irradiated cells, MDPM proliferated slightly at concentrations of 100, 200, and 400 μg / mL compared to the UVB-alone treatment group, but no significance was observed.

[0157] Concentration (μg / mL) UVB irradiation dose (30 mJ / cm²) Cell viability (% of Control) 0 - 100.00±3.32 0 + 77.23±2.90 100 + 77.07±4.45 200 + 78.65±2.30 400 + 78.34±6.92

[0160] Example 7. Method and result of measuring gene expression levels

[0161] 7-1. Measurement of Gene Expression Levels

[0162] HaCaT cells were seeded into 6-well plates at a density of 1 x 10⁵ cells / well and cultured for 24 hours. After removing the existing medium and replacing it with PBS, the cells were irradiated with UVB at 30 mJ / cm² and treated with MDPM diluted to concentrations of 100, 200, and 400 μg / mL. After all cultures were completed, RNA was extracted from the cells obtained by centrifugation using a total RNA prep kit. The extracted RNA was mixed with a reverse transcription premix, and cDNA was synthesized using a PCR cycler by reacting at 45°C for 60 minutes and 95°C for 5 minutes. Real-time PCR was performed to amplify and verify specific genes from the synthesized cDNA. The cDNA was mixed with primers matching the specific gene and SYBR green premix, reacted at 95°C for 2 minutes, and the specific gene was amplified by repeating the reaction cycle of 95°C for 5 seconds and 62.5°C for 30 seconds 40 times. Gene expression levels were relative to the gene expression levels of the control group, and information on the primers used is shown in Table 9.

[0163] Gene name (Full name) Size (bp) F / R Sequences Seq NO COL1A1 (Collagen type I alpha 1) 144 F GCTCGTGGAAATGATGGTC 1 R ACCCTGGGGCACCTTCAGAG 2 HAS1 (Hyaluronan Synthase 1) 150 F TACTTTTGGGATGACGGCGC 3 R AAGTACGACTTGGACCAGCG 4 HAS2 (Hyaluronan Synthase 2) 119 F TGACAGGCACTCTACGAACC 5 R GGGTCGTGCTGGTTAGCCAT 6 HAS3 (Hyaluronan Synthase 3) 150 F CCCTTTCCCCTACCCAGAG 7 R TCACATAGGCTGCCAGGATG 8 FLG (Filaggrin) 119 F ATCTGAGGGCAGTGAAGGGC 9 R CACTTCGGCTGTAGAGATGT 10 LOR (Loricrin) 107 F GCCGTCCAAATAGATCCCCC 11 R TGCAAACCTCGGGTAGCATC 12 IVL (Involucrin) 128 F CAGGCCAGGTTCCAAGACATT 13 R GGACACTGCGGGTGTATTT 14 Hyal1 (Hyaluronidase 1) 88 F CTGCTGTGGACCCCAATCTG 15 R TGACATGATTCAGGGGCAG 16 Hyal2 (Hyaluronidase 2) 105 F GGACTCCCACACAGTTCCtg 17 R CAGCACCAGGGCGAATGTAA 18 MMP1 (Matrix Metallopeptidase 1) 120 F TGTGGGTGTCTCAGCTTCC 19 R CGCTTTTCAACTTGCCTCCC 20 MMP2 (Matrix Metallopeptidase 2) 72 F ATCCAGACTTCCTCAGGcGG 21 R TCCTGGCAATCCCTTTGTATGT 22 MMP3 (Matrix Metallopeptidase 3) 94 F CAGCAACCTGTGATGCCTGCT 23 R GATTTCGGCCAAAAGTGCCT 24 MMP9 (Matrix Metallopeptidase 9) 92 F GTACTCGACCCTGTACAGCG 25 R AGAAGCCCCTACTTCTTGTG 26 TIMP1 (TIMP Metallopeptidase Inhibitor 1) 124 F GCGGATACTTCACCAGGCC 27 R GCTAAGCTCAGGCTGTTCCA 28 ACTB (Beta actin) 103 F CATTCCAAATATGAGATCGCTTGT 29 R TGTGGGACTTGGGAGAGGACCT 30

[0166] 7-2. Results of Gene Expression Level Verification.

[0167] 1) Expression levels of COL1A1, HAS1, HAS2, and HAS3 genes

[0168] As a result of measuring the gene expression levels of COL1A1, HAS1, HAS2, and HAS3, the COL1A1 gene showed a significant increase compared to the UVB-alone treatment group at MDPM concentrations of 100 μg / mL or higher; for the HAS1 gene, a concentration-dependent significant increase compared to the UVB-alone treatment group was observed at MDPM concentrations of 200 μg / mL or higher; and for the HAS3 gene, a concentration-dependent significant increase compared to the UVB-alone treatment group was observed at MDPM concentrations of 200 μg / mL or higher.

[0169] On the other hand, in the case of HAS2, MDPM did not show a significant difference compared to the UVB-alone treatment group at concentrations of 100 μg / mL or higher (Fig. 5).

[0170] Concentration (μg / mL) UVB irradiation dose (30 mJ / cm²) COL1A1 gene expression (Fold change) HAS1 gene expression (Fold change) HAS2 gene expression (Fold change) HAS3 gene expression (Fold change) 0 - 1.80 ± 0.06 1.72 ± 0.07 1.41 ± 0.16 1.30 ± 0.10 0 + 1.00 ± 0.00** 1.00 ± 0.00** 1.00 ± 0.00* 1.00 ± 0.00* 100 + 1.17 ± 0.05* 1.09 ± 0.07 1.04 ± 0.12 1.06 ± 0.05 200 + 1.36 ± 0.07* 1.11 ± 0.11* 1.02 ± 0.18 1.15 ± 0.08* 400 + 1.44 ± 0.07** 1.29 ± 0.09* 0.99 ± 0.29 1.20 ± 0.06*

[0172] 5) FLG, LOR, and IVL gene expression levels

[0173] As a result of measuring FLG gene expression, MDPM showed an increase compared to the UVB-alone treatment group at concentrations of 100 μg / mL or higher, but the difference was not significant. As a result of measuring LOR gene expression, MDPM showed a concentration-dependent and significant increase compared to the UVB-alone treatment group at concentrations of 100 μg / mL or higher. In addition, as a result of measuring IVL gene expression, MDPM showed a significant increase compared to the UVB-alone treatment group at a concentration of 400 μg / mL (Fig. 6).

[0174] Concentration (μg / mL) UVB irradiation dose (30 mJ / cm²) FLG gene expression (Fold change) LOR gene expression (Fold change) IVL gene expression (Fold change) 0 - 1.47 ± 0.11 1.98 ± 0.05 1.74 ± 0.07 0 + 1.00 ± 0.00* 1.00 ± 0.00** 1.00 ± 0.00** 100 + 1.07 ± 0.05 1.17 ± 0.05* 1.03 ± 0.05 200 + 1.15 ± 0.18 1.25 ± 0.18* 1.10 ± 0.15 400 + 1.22 ± 0.23 1.52 ± 0.18** 1.33 ± 0.13*

[0177] 8) Gene expression levels of HYAL1, HYAL2, MMP1, and MMP2

[0178] When measuring HYAL1 gene expression, MDPM showed a significant decrease compared to the UVB-only treatment group at a concentration of 400 μg / mL, when measuring HYAL2 gene expression, MDPM showed a significant decrease compared to the UVB-only treatment group at a concentration of 400 μg / mL, when measuring MMP1 gene expression, MDPM showed a concentration-dependent and significant decrease compared to the UVB-only treatment group at a concentration of 100 μg / mL or higher, and when measuring MMP2 gene expression, MDPM showed a concentration-dependent and significant decrease compared to the UVB-only treatment group at a concentration of 200 μg / mL or higher (Fig. 7).

[0179] Concentration (μg / mL) UVB irradiation dose (30 mJ / cm²) HYAL1 gene expression (Fold change) HYAL2 gene expression (Fold change) MMP1 gene expression (Fold change) MMP2 gene expression (Fold change) 0 - 0.31 ± 0.08 0.38 ± 0.07 0.26 ± 0.10 0.15 ± 0.05 0 + 1.00 ± 0.00** 1.00 ± 0.00** 1.00 ± 0.00** 1.00 ± 0.00** 100 + 0.99 ± 0.05 0.96 ± 0.05 0.81 ± 0.06* 0.99 ± 0.09 200 + 0.84 ± 0.13 0.84 ± 0.10 0.66 ± 0.12* 0.85 ± 0.05* 400 + 0.73 ± 0.10* 0.67 ± 0.11* 0.55 ± 0.10** 0.68 ± 0.06*

[0181] 12) Expression levels of MMP3, MMP9, and TIMP1 genes

[0182] When MMP3 gene expression was measured, MDPM showed a significant decrease compared to the UVB-alone treatment group at concentrations of 200 μg / mL or higher, and when MMP9 gene expression was measured, MDPM showed a significant decrease compared to the UVB-alone treatment group at a concentration of 400 μg / mL, and when TIMP1 gene expression was measured, MDPM showed a concentration-dependent and significant increase compared to the UVB-alone treatment group at concentrations of 200 μg / mL or higher (Fig. 8).

[0183] Concentration (μg / mL) UVB irradiation dose (30 mJ / cm²) MMP3 gene expression (Fold change) MMP9 gene expression (Fold change) TIMP1 gene expression (Fold change) 0 - 0.26 ± 0.05 0.37 ± 0.06 1.73 ± 0.12 0 + 1.00 ± 0.00** 1.00 ± 0.00** 1.00 ± 0.00** 100 + 0.98 ± 0.07 1.00 ± 0.07 1.07 ± 0.07 200 + 0.72 ± 0.04* 0.96 ± 0.04 1.24 ± 0.04** 400 + 0.45 ± 0.07** 0.81 ± 0.01* 1.40 ± 0.09**

[0186] Example 8. Results of confirming cell viability according to the composition ratio of MDPM magnolia flower bud extract and PhytoG callus culture medium composition.

[0188] It was observed that cell viability decreased as the concentration of the callus culture medium increased, so high concentrations of the callus culture medium were determined to be highly toxic, and the maximum concentration was fixed at 50% to check the viability (Fig. 9).

[0189] Cell viability Control 20 40 50 60 80 100 average 100.00 100.81 99.52 95.13 77.70 51.85 36.87 Standard deviation 3.13 1.92 3.66 2.32 2.58 5.24 4.31

[0191] Example 9. Comparison of radical oxidizing ability of magnolia flower bud extract, PhytoG callus culture medium, and MDPM, respectively.

[0192] To confirm the respective functions of Magnolia flower bud extract, PhytoG callus culture medium, and MDPM, DPPH and ABTS radical oxidizing abilities were evaluated at different concentrations. As a result, MDPM showed excellent radical oxidizing abilities (Fig. 10).

[0193] type M (μg / mL) PM (%) MDPM (μg / mL) DPPH radical oxidizing ability density 100 1000 50 100 100 1000 average 44.96 79.86 5.00 8.07 49.86 82.88 Standard deviation 3.52 3.66 1.92 1.77 1.74 2.10 ABTS radical oxidizing ability average 58.86 92.96 3.07 6.00 60.41 93.28 Standard deviation 3.66 3.52 2.11 1.92 2.07 1.60

[0195] Example 10. Comparison of total polyphenol and flavonoid production according to optimal concentrations of Magnolia flower bud extract, PhytoG callus culture medium, and MDPM

[0196] As a result of comparing polyphenols and flavonoids according to the optimal concentrations of magnolia flower bud extract, PhytoG callus culture medium, and MDPM, it was also confirmed that MDPM was the best (Fig. 11).

[0197] type division M 100 μg / m PM 50% MDPM 100 μg Total Polyphenol average 101.90 7.62 105.01 Standard deviation 8.42 2.48 3.14 Total flavonoid average 14.74 2.67 18.31 Standard deviation 1.03 1.82 1.94

[0199] Example 11. Comparison of gene expression levels of Magnolia flower bud extract, PhytoG callus culture medium, and MDPM.

[0200] The gene expression levels of each culture medium were compared, and MDPM also showed the best gene expression (Figs. 12 and 13).

[0201] Gene division Control UVB M 400 μg / mL PM 50% MDPM 400 μg / mL COL1A1 average 1.81 1.00 1.31 1.03 1.47 Standard deviation 0.08 0.00 0.06 0.03 0.08 HAS1 average 1.99 1.00 1.49 1.09 1.52 Standard deviation 0.14 0.00 0.13 0.11 0.12 HYAL1 average 0.29 1.00 0.58 1.00 0.51 Standard deviation 0.11 0.00 0.05 0.03 0.05 MMP1 average 0.34 1.00 0.65 1.01 0.58 Standard deviation 0.09 0.00 0.06 0.05 0.09 MMP3 average 0.17 1.00 0.60 1.00 0.47 Standard deviation 0.06 0.00 0.06 0.06 0.04

[0202] The present invention has been described above with reference to its preferred embodiments. Those skilled in the art will understand that the present invention may be embodied in modified forms without departing from the essential characteristics of the invention. Therefore, the disclosed embodiments should be considered in an illustrative rather than a restrictive sense. The scope of the invention is defined by the claims, not by the foregoing description, and all variations within the scope of the claims should be interpreted as being included in the invention.

Claims

Claim 1 A cosmetic composition for improving or preventing skin aging comprising magnolia flower bud extract and callus culture solution. Claim 2 A cosmetic composition according to claim 1, wherein the magnolia flower bud extract has a concentration of 50 to 1500 μg / ml. Claim 3 A cosmetic composition according to claim 1, wherein the callus culture solution has a concentration of 20 to 60%. Claim 4 A cosmetic composition according to claim 1, wherein the composition comprises 10 to 50 weight% of magnolia flower bud extract in a callus culture medium. Claim 5 A method for preparing a cosmetic composition of claim 1 comprising the following steps: (1) obtaining an extract by hot water extraction of magnolia flower buds with a solvent; (2) filtering and freeze-drying the extract from step (1); and (3) dissolving the magnolia flower bud extract powder from step (2) in a callus culture medium. Claim 6 A method according to claim 5, wherein the solvent of step (1) is one or more selected from the group consisting of water, ethanol, methanol, isopropanol and combinations thereof. Claim 7 A method according to claim 5, wherein in step (3), the magnolia flower bud extract powder is included in the callus culture medium at a weight of 10 to 50%. Claim 8 A food composition for improving or preventing skin aging comprising magnolia flower bud extract and callus culture solution. Claim 9 A pharmaceutical composition for preventing or treating skin aging comprising magnolia flower bud extract and callus culture solution.

Images