Composition for diagnosing pork meat quality and method for diagnosing pork meat quality using thereof
The MYH3 gene-based primer sets for pork meat quality assessment address the limitations of PCR-RFLP by providing rapid and accurate classification through PCR amplification and electrophoresis, overcoming time and cost issues.
Patent Information
- Authority / Receiving Office
- KR · KR
- Patent Type
- Patents
- Current Assignee / Owner
- NATIONAL INSTITUTE OF ENVIRONMENTAL RESEARCH
- Filing Date
- 2023-09-06
- Publication Date
- 2026-07-15
AI Technical Summary
Existing methods for determining pork meat quality, such as PCR-RFLP, are time-consuming and prone to errors due to the use of restriction enzymes, making accurate and rapid quality assessment challenging.
A composition and method using primer sets targeting the MYH3 gene for pork meat quality determination, allowing for rapid and accurate classification through PCR amplification and electrophoresis without restriction enzymes, based on amplification product length differences.
Enables quick and error-free classification of pork meat quality into low, medium, and high grades within 3-5 hours, reducing analysis time and costs while ensuring accuracy.
Smart Images

Figure 112023098622084-PAT00001_ABST
Abstract
Description
Technology Field
[0001] The present invention relates to a composition for determining the meat quality of pork and a method for determining the meat quality of pork using the same. Background Technology
[0002] The pig industry has focused primarily on improving productivity related to meat quantity and the distribution of fresh meat, which has led to a decline in pork quality (Cameron, 1990, Cliplef and McKay, 1993). In Korea, fresh meat is consumed in large quantities as grilled pork and boiled pork account for the majority of pork consumption patterns.
[0003] Basically, meat quality is an important selection criterion for purchasing meat. Inconsistent meat quality lowers consumer confidence and reduces consumers' willingness to choose good meat (Jung et al, 2011). Therefore, to overcome these problems and satisfy consumer demands for pork quality, an attempt was made to develop a meat quality trait improvement system (Lee et al, 2012).
[0004] Recently, in order to improve the quality of pork, pigs are being raised under standardized specifications and managed scientifically, and the resulting pork is being branded; as a result, various brands of pork are already being sold commercially. However, it is difficult for the general public to distinguish between such branded pork and non-branded pork with the naked eye.
[0005] Meanwhile, most economic traits in pigs are known to be quantitative traits resulting from the influence of various genes, and research is actively underway to identify causative genes involved in these traits and to explore their genetic locations. In particular, to discover trait-related gene markers, research on the identification of single nucleotide polymorphisms (SNPs) and their correlation with traits is actively being conducted on functional genes, and various trait-related SNPs have been discovered to date.
[0006] However, the analysis method based on PCR (Polymerase Chain Reaction)-RFLP (Restriction Fragment Length Polymorphism) to predict pork meat quality traits using SNP markers could not be applied to field analysis because it required a process of diagnosing the genotype by treating with restriction enzymes after PCR amplification, which took approximately two days to reach the final analysis. Additionally, the use of restriction enzymes resulted in increased analysis costs. Furthermore, there was a problem requiring additional analysis due to the high possibility of errors in genotype reading results depending on the activity of the restriction enzymes used or the treatment time.
[0007] Therefore, there is still a demand in the industry for a method to accurately determine pork quality based on PCR techniques without the use of restriction enzymes. Prior art literature
[0008] Republic of Korea Registered Patent No. 10-1941893 (Published Jan. 25, 2019) Republic of Korea Registered Patent No. 10-2019997 (Published Sep. 10, 2019) The problem to be solved
[0009] The problem that the present invention aims to solve is to provide a composition for determining pork meat quality that can rapidly and accurately determine pork meat quality by utilizing the difference in length of amplification products derived from pork meat quality causative genes.
[0010] Another problem that the present invention aims to solve is to provide a method for rapidly and accurately determining the meat quality of pork using a primer set composed of primers produced using the MYH3 gene, which is a causative gene for pork meat quality. means of solving the problem
[0011] One aspect of the present invention is a composition for determining the meat quality of pork, comprising: a first primer set consisting of nucleotide sequences represented by SEQ ID NO. 1 and SEQ ID NO. 2; and a second primer set consisting of nucleotide sequences represented by SEQ ID NO. 3 and SEQ ID NO. 4.
[0012] In the present invention, the composition can amplify the target gene MYH3 to produce an amplified product that exhibits a length difference during electrophoresis.
[0013] In the present invention, the composition can be determined as low-quality pork if the length of the amplification product is 311 bp, as medium-quality pork if the length of the amplification product is 311 bp and 650 bp, and as high-quality pork if the length of the amplification product is 650 bp.
[0014] In the present invention, the meat quality may be related to one or more meat quality trait factors selected from intramuscular fat content, meat color, shear force, water-holding capacity, and fatty acid composition.
[0015] Another aspect of the present invention is a kit for determining the meat quality of pork, comprising a composition for determining the meat quality of pork.
[0016] In the present invention, the kit may further include an instruction manual.
[0017] Another aspect of the present invention is a method for determining the meat quality of pork, comprising: a) a step of extracting genomic DNA from a pig sample; b) a step of performing an amplification reaction using the isolated genomic DNA as a template and a composition for determining the meat quality of pork or a kit for determining the meat quality of pork; and c) a step of determining the meat quality of pork by electrophoresis of the amplified product to confirm the size difference of the amplified product.
[0018] In the present invention, as a result of the electrophoresis of step c), if the amplification product appears as a single band of 311 bp, it is determined to be low-quality pork, if a single band of 650 bp appears, it is determined to be high-quality pork, and if both bands of 311 bp and 650 bp appear, it is determined to be medium-quality pork. Effects of the invention
[0019] According to the present invention, there is an advantage in that the meat quality of pork can be accurately determined into low-quality, medium-quality, and high-quality grades solely by determining the difference in length of the amplification product by electrophoresis after PCR amplification, without restriction enzyme treatment.
[0020] The present invention has the advantage of being able to accurately determine the quality of pork within a short time of approximately 3 hours by obtaining reading results through electrophoresis after PCR amplification, and the analysis cost is very low because expensive restriction enzymes are not used.
[0021] Furthermore, since the present invention can determine the meat quality of pork without errors in reading the causative genotype of meat quality using only PCR amplification, it is convenient as there is no need to perform additional or auxiliary analyses separately.
[0022] In addition, the present invention prevents errors occurring in previous simplified meat quality diagnosis methods and can accurately determine the meat quality of pork by classifying it into low-quality, medium-quality, and high-quality grades. Brief explanation of the drawing
[0023] Figure 1 shows variations within gene loci for predicting pork meat quality through next-generation sequencing (NGS) analysis. Figure 2 shows candidate genes related to pig meat quality within locations identified on the Ensembl Database. Figure 3 shows the variation region within the gene location. Figure 4 shows the results of determining the meat quality of pork using the composition according to the present invention. Figure 5 is the result of comparing the conventional HpyCH4-RFLP method, the existing simple identification composition, and the method for determining the meat quality of pork using the composition of the present invention. Specific details for implementing the invention
[0024] Hereinafter, embodiments of the present invention will be described in detail with reference to the attached drawings so that those skilled in the art can easily implement the present invention. However, the present invention may be implemented in various different embodiments and is not limited to the embodiments described herein. Throughout the specification, similar parts are denoted by the same reference numerals.
[0025] Additionally, where terms such as “about,” “approximately,” or similar expressions are used in relation to numerical values in this specification, it is intended that theoretical, experimental, statistical, or empirical error of ±10%, ±7%, ±5%, ±3%, ±2%, or ±1% is permitted based on such numerical values.
[0027] As a result of diligent research efforts to develop a method for determining the meat quality of pork through genetic traits, the inventors identified that the MYH3 gene is a gene that determines the meat quality traits of pigs, and confirmed that using this, the genetically determined meat quality traits of pork can be predicted.
[0028] In the present invention, "MYH3 gene" refers to a gene encoding myosin heavy chain 3, which is one of the heavy chain proteins included in myosin that constitutes animal muscles, and its nucleotide sequence can be obtained from known databases such as NCBI's GenBank (GenBank Accession No KX549311(LAND), KX549312(KNP)).
[0029] The inventors have confirmed that the meat quality traits of pigs, specifically intramuscular fat content and redness, are determined by the MYH3 gene, and have revealed that since genetic variations exist between native breeds with superior meat quality traits and foreign breeds with inferior traits, pig meat quality traits can be determined by detecting genetic markers containing these variations.
[0030] In this regard, QTL analysis and Linkage and linkage disequilibrium (LALD) mapping were performed on offspring obtained by crossing Jeju native pigs with Landrace or Duroc pigs regarding the meat quality traits of pigs, and it was revealed that the MYH3 gene located on chromosome 12 is the causative gene involved in the meat quality traits of pigs.
[0031] Meanwhile, the "PCR-RFLP" method is a technique that combines PCR technology with restriction enzyme-treated gene fragments to analyze restriction fragment length polymorphisms among various DNA analysis technologies for improving the genetic characteristics or capabilities of livestock. It utilizes the fact that when a restriction enzyme recognition site is present at a specific point mutation location, the length of the fragments cleaved by the restriction enzyme varies depending on the genotype of each individual, thereby enabling more rapid and accurate determination of the genotype of the subject being analyzed.
[0032] The PCR-RFLP method is widely used for analyzing the meat quality of pigs, but it has limitations for field analysis because it takes approximately two days from gene amplification to genotype reading. In addition, since this existing analysis method uses restriction enzymes, there is always a possibility of errors in reading depending on the condition of the restriction enzymes, such as their activity, and there is also the problem of increased analysis costs due to the use of restriction enzymes.
[0033] Accordingly, the inventors designed primer(s) capable of accurately diagnosing the meat quality of pigs by grade—namely, low meat quality, medium meat quality, and high meat quality—simply by analyzing the difference in length of amplification products by PCR-electrophoresis based on the MYH3 gene, which was identified as a causative gene for meat quality. They also confirmed that the primer set designed in this way can determine the meat quality of pork simply and quickly. Furthermore, the inventors discovered that some errors occurred in previous simplified diagnostic methods and, as a result of diligent research efforts regarding this, discovered that errors occurring in previous simplified diagnostic methods could be resolved by designing a primer set using a new variant region instead of an existing variant region, leading to the present invention.
[0034] In one embodiment, the present invention provides a composition for determining the meat quality of pork, comprising: a first primer set consisting of nucleotide sequences represented by SEQ ID NO. 1 and SEQ ID NO. 2; and a second primer set consisting of nucleotide sequences represented by SEQ ID NO. 3 and SEQ ID NO. 4.
[0035] As used herein, the term "primer" refers to a short sequence having a short free 3' hydroxyl group, capable of forming base pairs with a complementary template, and functioning as a starting point for template strand replication. In the present invention, the primer used for gene marker amplification may be a single-stranded oligonucleotide capable of acting as a starting point for template-directed DNA synthesis under appropriate components such as a suitable buffer (e.g., four different nucleoside triphosphates and a polymerizer such as DNA, RNA polymerase, or reverse transcriptase) and a suitable temperature, wherein the appropriate length of the primer may vary depending on the intended use. The primer sequence does not need to be completely complementary to the polynucleotide containing the gene marker or its complementary polynucleotide, but may be used if it is sufficiently complementary to hybridize.
[0036] In addition, primers can be modified, specific examples of which include methylation, capping, substitution of nucleotides, or modification between nucleotides, such as modification into uncharged linkages (e.g., methyl phosphonate, phosphotriester, phosphoromidate, carbamate, etc.) or charged linkages (e.g., phosphorothioate, phosphorodithioate, etc.).
[0037] In the present invention, the primer may be a polynucleotide composed of a nucleotide sequence represented by SEQ ID NOs 1, 2, 3, or 4, respectively.
[0038] Since a person skilled in the art can design a suitable variant based on the sequence information (including the sequence of nucleotides and sequence length) of a primer consisting of a base sequence represented by SEQ ID NO. 1, 2, 3, or 4 disclosed in the present invention, the range of primers according to the present invention is not necessarily limited to primers having the base sequence of SEQ ID NO. 1, 2, 3, or 4.
[0039] The primers constituting the primer set according to the present invention can amplify the target gene, MYH3 gene, to produce an amplification product that exhibits a length difference during electrophoresis.
[0040] In one embodiment of the present invention, a first primer set consisting of nucleotide sequences represented by SEQ ID NO. 1 and SEQ ID NO. 2; and a second primer set consisting of nucleotide sequences represented by SEQ ID NO. 3 and SEQ ID NO. 4; were used to amplify a target gene related to the meat quality or meat quality traits of pigs, namely the MYH3 gene, and then perform electrophoresis. It was confirmed that the meat quality of pork can be determined based on the difference in length of the amplification products that appear (Figs. 4, 5).
[0041] In detail, when the target gene MYH3 is amplified using the composition according to the present invention and then subjected to electrophoresis, if the length of the amplified product is 311 bp, it is determined to be low-quality pork (qq); if the length of the amplified product is 311 bp and 650 bp, it is determined to be medium-quality pork (qQ, Qq); and if the length of the amplified product is 650 bp, it is determined to be high-quality pork (QQ).
[0042] Therefore, the composition for determining pork meat quality according to the present invention enables further subdivision of the meat quality grade of a target pig—specifically into high-quality, medium-quality, and low-quality types—by means of only electrophoresis following PCR amplification. Furthermore, it allows for reduced analysis time and enables on-site analysis application. In addition, since the present invention does not use restriction enzymes, it has the effect of reducing analysis costs.
[0043] According to an embodiment of the present invention, the aforementioned meat quality may be related to meat quality trait-related factors including intramuscular fat content, meat color, shear force, water-holding capacity, and fatty acid composition, although it is not limited thereto.
[0044] As used in this specification, the term "meat quality trait" refers to various phenotypic traits indicating the condition of a slaughtered animal, excluding bones, obtained from a pig. These phenotypic traits may include, but are not specifically limited to, intramuscular fat content, meat color, water-holding capacity, shear force, etc. Intramuscular fat content refers to the amount of fat contained within the muscle, meat color refers to the color of the meat as judged by the naked eye, water-holding capacity refers to the ability of the meat to retain moisture, and shear force refers to the degree of toughness when the meat is torn. The quality of the meat quality can be judged to be higher when the intramuscular fat content is higher, when the meat color is redder, and when the water-holding capacity and shear force are lower.
[0045] In another aspect, the present invention provides a kit for determining the meat quality of pork, comprising a composition for determining the meat quality of pork.
[0046] According to an embodiment of the present invention, the kit may include a composition and instructions for use according to the present invention. The kit of the present invention can determine the level of meat quality traits in pigs by confirming other marker genes, including the MYH3 marker gene which is a causative gene for pig meat quality, through PCR amplification, or by confirming the mRNA expression levels of these marker genes. For example, the kit may be an RT-PCR kit, but is not limited thereto.
[0047] In the case of an RT-PCR kit, it includes the essential elements required to perform RT-PCR, namely the composition according to the present invention, and may also include primers capable of amplifying other meat quality-related marker genes, test tubes or other suitable containers, reaction buffer, deoxynucleotides (dNTPs), dideoxynucleotides (ddNTPs), enzymes such as Taq-polymerase and reverse transcriptase, DNase, RNAse inhibitors, DEPC-water, sterile water, etc. It may also include a set of primers specific to the gene used as a quantitative control.
[0048] In another aspect, the present invention provides a method for determining the meat quality of pork, comprising: a) extracting genomic DNA from a pig sample; b) performing an amplification reaction using the isolated genomic DNA as a template and a composition for determining pork meat quality or a kit for determining pork meat quality; and c) determining the meat quality of pork by electrophoresis of the amplified product to confirm the size difference of the amplified product.
[0049] In the meat quality determination method of the present invention, the pig sample may be a sample such as hair, urine, blood, various body fluids, separated tissue, separated cell, or saliva, but is not particularly limited thereto.
[0050] In the present invention, nucleic acid means including not only DNA but also cDNA and RNA molecules synthesized from mRNA.
[0051] In one embodiment of the present invention, the primer set included in the composition or kit used in step b) may be produced based on the MYH3 gene.
[0052] In one embodiment of the present invention, in step c), electrophoresis may be performed on a commonly used agarose gel. Electrophoresis may be performed within 50 minutes, preferably within 40 minutes, more preferably within 30 minutes.
[0053] In one embodiment of the present invention, as a result of the electrophoresis of step c), if the amplification product appears as a single band of 311 bp, it is determined to be low-quality pork, if a single band of 650 bp appears, it is determined to be high-quality, and if both bands of 311 bp and 650 bp appear, it is determined to be medium-quality pork.
[0054] In one embodiment of the present invention, the entire process of determining the meat quality of pork according to the present invention may vary depending on the condition of the sample, the skill level of the equipment operator, etc., but the determination of the meat quality of pork can be completed within approximately 3 hours, or at the latest within 5 hours.
[0055] The present invention will be explained in more detail below through examples. However, these examples are intended to illustrate the invention and the scope of the invention is not limited to these examples.
[0057] Examples 1. Preparation of the pig
[0058] The experimental animals used in the present invention consisted of 32 low-meat type pigs (11), 46 medium-meat type pigs (12), and 30 high-meat type pigs (12), with a total of 108 pigs prepared as shown in Tables 1 and 2 below.
[0060] 11 12 22 1 LD21-1 25 F15-85 49 F15-75 2 LD21-3 26 F15-96 50 F15-80 3 LD21-7 27 F15-103 51 F15-89 4 LD21-17 28 F15-108 52 F15-91 5 D23-1 29 LD21-4 53 F15-97 6 D23-18 30 LD21-8 54 F15-101 7 D23-23 31 LD21-14 55 F15-109 8 D23-45 32 LD21-18 56 F15-114 9 L22-60 33 L22-84 57 LD21-2 10 L22-72 34 L22-89 58 LD21-23 11 L22-80 35 L22-93 59 LD21-31 12 L22-87 36 L23-48 60 LD21-37 13 L23-73 37 L23-52 61 L23-110 14 L23-78 38 L23-74 62 L23-116 15 L23-84 39 L23-82 63 L23-122 16 L23-128 40 L23-85 64 D22-40 17 D22-36 41 D22-35 65 D22-56 18 D22-43 42 D22-51 66 D23-6 19 D22-46 43 D22-63 67 D23-17 20 D22-50 44 D23-4 68 D23-24 21 D22-59 45 D23-5 69 D23-39 22 D22-65 46 D23-16 70 D23-53 23 D22-68 47 D23-43 71 D23-55 24 D22-71 48 D23-46 72 D23-65
[0061] 11 12 22 1 D20-195 9 D20-84 31 DK21-288 2 D20-200 10 D20-90 32 DK21-289 3 D22-65 11 D20-106 33 DK21-290 4 D22-67 12 D20-107 34 DK21-291 5 DK21-332 13 D20-108 35 DK21-293 6 DK21-333 14 D20-112 36 DK21-296 7 DK21-334 15 D20-114 8 DK21-335 16 D22-64 17 D22-69 18 DK21-81 19 DK21-92 20 DK21-292 21 DK21-294 22 DK21-295 23 DK21-336 24 DK21-337 25 DK21-338 26 DK21-339 27 DK21-340 28 DK21-341 29 DK21-342 30 DK21-343
[0063] Examples 2. DNA Isolation
[0064] For the pigs (test animals) used in this study, DNA was extracted from the jugular vein or the tails of the piglets produced and used for genetic analysis. DNA isolation was performed using a modified sucrose-proteinase K method (Sambrook et al., 1989). The absorbance of the isolated DNA was measured using a NanoDrop ND-1000 spectrophotometer (NanoDrop Technologies, USA), and genomic DNA with an A260 / A280 ratio of 1.8 or higher was used as a template for the polymerase chain reaction (PCR).
[0066] Examples 3. For judging pork quality primer Extraction and analysis of included nucleotide sequences
[0067] Through Next Generation Sequencing (NGS), a region (s55372428) with a higher P-value than the existing high meat quality type discrimination SNP (s55373709) was discovered (Figs. 1, 2, Table 3). As a result of gene function analysis, the MYH3 gene was identified as the causative gene determining pig meat quality (intramuscular fat content and red meat), and through function analysis, the SNP of 55373709 was identified as the causative variant, and the distance between the two SNPs was confirmed to be approximately 1.3 Kb.
[0069] SNP NAME p-value PP s54928391 2.50E-71 0.2033 s54929336 6.00E-71 0.2179 s54980229 6.55E-85 0.0536 s55001064 3.31E-72 0.7553 s55023157 1.32E-74 0.3297 s55028305 1.56E-76 0.1188 s55028439 1.13E-74 0.0602 s55030506 4.03E-74 0.2072 s55030788 3.13E-74 0.2091 s55063463 3.05E-71 0.1978 s55086498 4.55E-69 0.0814 s55281687 6.08E-70 0.2432 s55372428 3.08E-85 0.6782 s55373709 4.52E-78 0.0247
[0071] Examples 4. Pork quality For judgment primer produce
[0072] Primers were designed as follows based on the sequence information of the MYH3 gene (Table 4) containing SNPs found in Example 3 (variation 1 (SSC12: 55,373,090; 55,373,067; 55,373,066; 55,373,052), 2 (SSC12: 55,372,428), 3) (Fig. 3).
[0073] Sequence No. 9: MYH3(ENSSSCG00000018007) ACAGCAGGAGGACTGCTGTTGTTCCCCCACAAGTTGTACAATCACACATTCCTGCCACAACCCTGTGTTGTAACAAAAGCCTTGCTCAAAACTCCAAGAGGATTTAAACTTTTCCGTCCTTGGCTTCATCCCTTTGCCCACAGGCCGAGATTCTAGGTCCCCGCTGTCCCAGAGACCAGGCTCATCTCCAGCCGTGTGGCGCCTGTGGGATGGAGCGAGGGCTCCCGGCAAGGCTGTCCCATCACTGAGCCGCCGGTTCAGAGAAAGGCATCCCAAACTTCCAGCTTTCTCCAGCTAGGATCCTGTCATTTCTATATATACCTCTCTCTTGGCAGCGGCAAAAAAAAGTGAGGAAGGAGCTGGTCCTCACTTGTGGTGTCGGTCACTCTCTTTCCAAATATAGAGAAGGAATGAGTGGCGGGGGTTAGCAGGGGCTATAAAAGCCCGCGGGGAGCGCCCCTTGTAGCTGCTCTGTGGGCGGAGGAG AGTCACAGTGCCCCTTGTGCGGGTCCTTCCCATCTGAGGCTCAGAGGCTCGTGTGGCCCTGCCCGGCTTTG GTAAGGACCAGACGTGCGGCTGATTCTCAGCCCCTCCCCGCCTCCAGCATCCCGCTTCCTTCACCTGTTCTCCCCCGCCCTCATCCTCCAGAGC CCTCTTGGGCAGGGTCCCTGCGG ATGCTCTGTGGACCACTGCCCGTCACCCCGGCCCATGAACGCTGCCACCTCTCTGACTTGTACAGAGGCCAGTGGGCCTGGCCGCCTCCCCACCTGCGCTGCGGGCCTGCGGTGTCTGTCCTCTCAAGGCCACGCTGGCTGTGCATCCGTCGGCTTGTCTGAGACTTCACCCTGCCTGCCCACAGAAGACAGGGGGCCTGGCCCTGGCTTGGAGGCACAGGCTTTTCAAACAGAGCTTCTGTCCTGACTGCTCACCTCTGAGGAGGAGGCACGGCAGACAGAGGGTGGTGCCACCCGGGCAGGAGGGAGCCAGGTCTGGGGCGGCTGGGGGCTCTCCTGCCTTCAGGGCTCACCTGTGGGCCAGGTCCCATTTGCTCCTCCAGCTTGTCTCTGGGCCAAGGCTCTTTTAAAGTTATTCGTCCTTTCTCTTCATTTGGTTAATTGATTAAGGCCCATTCAGAACTGAACCAGACACTCCCACGTCTCCTGACCTTTTGTGTATTTATTGCAG GTCTGATTTCTCACGGCTGCTGCTGTCTGCTGTCCTCCTGCGGGTGTGACTCTCAG GTGAGAAAGCAGGTCAGGTCCCCTGGCTCAGCCATCTCCA GGGTACTGGTTCCCCCCCCCCGG CCACGGCCTTGCGGCGAGCAGGACAGGTTAGGCTGGAGAGGAGCCCCAGGGAAGGCTGCCAAGCAGATGCTGATGTGAGAAGCCGCTTGTTTGTAGAAGGGACTGAAGCCGGTTTCCAGGTGGGAGATGGAGCCACCCTGAATCCGAGCGGTTCCAAAACTCCTTAGCTATTTGCCCTTTAACACGCTCTTTGAAG / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / 생략 / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / GATGAACAAGCCAATGCTCATCTCACCAAGTTCCGAAAAGCTCAGCATGAGCTCGAGGAGGCTGAAGAACGGGCTGATATCGCCGAATCTCAGGTCAATAAGCTTCGCGCAAAGACCCGAGACTTCACCTCCAGCCGGG TACGTG GTCCCCCGGCACCAGGT GCGGGGCGGTGGTGCTGCGGGAGGTGTGGCTCCTGGGGAGGAACCTGCTGGGAGGAAGACATTTCTGAGATGGAAGGGACCGAGGTCAGTCTCAGGCTCAGGAAAGGAAAGGATTTGCTTAAAGCCACCCAGCTCCGTAAGTCACAATAAAGCGCCGTCCTGATTATCACATTTTAAATCGACTATACTTCAATAAAAGTTAAAAACAAAAAGCAAACCAAAAAAACACACAACGAAAAAACAAAAAAACTCACCATCCTGAAA AGCAAAGGCGGGTCCCACAGTGAG CTTTCGGCGCCCTCTGCTGGCCAGTCCCCGTCACTGTACGTGTAGGTACGGGGACGCCCGCCTGTGAGTGGGAAG
[0075] Primer Design:
[0076] MYH3_3del_KF: CTT-CCC-GGG-CAG-GGT-CCC-TTC (Sequence No. 1)
[0077] MYH3_3del_KR: CCG-GGG-GGG-AAC-CAG-TAC-CC (Sequence No. 2)
[0078] MYH3_int40_qF: TAC-GTG-GTC-CCC-CGG-CAC-CAG-GT (Sequence No. 3)
[0079] MYH3_int40_qR: CTC-ACT-GTG-GGA-CCC-GCC-TTT-GCT (Sequence No. 4)
[0081] Comparative example . For judging pork quality primer produce
[0082] Primers were designed as follows based on the sequence information (Table 4) of the MYH3 gene containing the SNP found in Example 3 (previous analysis region (SSC12:55,393,709)) (Fig. 3).
[0084] Primer Design:
[0085] MYH3_1Q_F: AGG-ACG-TGT-GTT-CCC-CAC-AC (Sequence No. 5)
[0086] MYH3_1Q_R: GGA-ACC-AGT-ACC-CTG-GAG-ATG-G (Sequence No. 6)
[0087] MYH3_1q_F: ACg-GCT-GAC-ACC-AGA-ATG-AAC (Sequence No. 7)
[0088] MYH3_1q_R: GGG-GAA-CAA-CAG-CAG-TCC-TCC (Sequence No. 8)
[0090] Test example 1. According to the present invention primer Meat quality determination using a set
[0091] Fifteen pork samples (5 low-quality, 5 medium-quality, and 5 high-quality) were analyzed after PCR amplification using the primer set according to Example 4.
[0092] Specifically, the PCR reaction was performed as shown in Table 5 below by placing primers containing all of the SEQ ID NOs 1, 2, 3, and 4 specified above into a single tube, adding 1.0 µl of DNA isolated from the blood of each pig, 10.0 µl of 2X HS Prime Taq Premix, 0.5 µl each of two pairs of forward and reverse primers, 2.0 µl of DMSO (Dimethyl sulfoxide), and 5 µl of sterile deionized water to make a total volume of 20 µl. PCR amplification was carried out using a mastercycler X50 (Eppendorf, Germany). The amplification products were subjected to electrophoresis on a 1.5% agarose gel containing EtBr (ethidium bromide), and the genotype was identified using the presence of gene amplification and length under UV light.
[0093] Temp(℃) Time Cycles 95 5 min 1 94 30 sec 35 65 30 sec 72 30 sec 72 10 min 1 4 forever 1
[0094] As shown in Figure 4, the 311 bp band was specifically observed in the 5 low-meat type (qq), the 650 bp band was specifically observed in the 5 high-meat type (QQ), and both the 311 bp and 650 bp bands were observed in the 5 medium-meat type (qQ).
[0096] Test example 2. Analysis of the accuracy of the method for determining pork meat quality according to the present invention
[0097] 107 pork samples (31 low-quality, 46 medium-quality, and 30 high-quality) were analyzed after PCR amplification using the primer set according to Example 4 and the primer set according to Comparative Example, and the genotype was diagnosed using the conventional PCR-RFLP method.
[0098] Specifically, for the PCR reaction, primers containing all of the sequence numbers 1, 2, 3, and 4 specified above (Example 4) and primers containing all of sequence numbers 5, 6, 7, and 8 (Comparative Example) were placed in separate tubes. Then, 1.0 µl of DNA isolated from the blood of each pig, 10.0 µl of 2X HS Prime Taq Premix, 0.5 µl each of two pairs of forward and reverse primers, 2.0 µl of DMSO (Dimethyl sulfoxide), and 5 µl of sterile deionized water were added to a total volume of 20 µl as shown in Table 5 above. PCR amplification was performed using a mastercycler X50 (Eppendorf, Germany). The amplification products were subjected to electrophoresis on a 1.5% agarose gel containing EtBr (ethidium bromide), and the genotype was identified using the presence of gene amplification and length under UV light.
[0099] The PCR-RFLP method is as follows. Specifically, the region containing the aforementioned base mutation was amplified using primers (forward: 5'-TGG TCT TTC CTA ATT GGT GAC AT-3' (SEQ No. 10) and reverse: 5'-AGT TTT GAG CAA GGC TTT TGT T-3' (SEQ No. 11). A PCR reaction was performed as shown in Table 5 above using a 20 µl volume of 1.0 µl DNA isolated from the blood of each pig, 10.0 µl of 2X HS Prime Taq Premix, 0.5 µl each of two pairs of forward and reverse primers, 2.0 µl of DMSO (Dimethyl sulfoxide), and 5 µl of sterile deionized water. PCR amplification was carried out using a Mastercycler X50 (Eppendorf, Germany). The amplification products were subjected to electrophoresis on a 1.5% agarose gel containing EtBr (ethidium bromide), and then the presence of gene amplification and length were determined under UV light. genotypes were identified using [this method].
[0100] amplified PCR product with restriction enzyme Hpy The DNA was cleaved using CH4IV (recognition site: A▼CGT), and the restriction enzyme reaction conditions were as directed by the supplier: 3 µl of PCR amplification product, 1 µl of 10X buffer, 0.3 µl of restriction enzyme, and 5.7 µl of distilled water were mixed and reacted at 37°C for 12 hours. The cleavage pattern of the MYH3 gene by the restriction enzyme was confirmed by electrophoresis on a 1.5% agarose gel containing EtBr (ethidium bromide). The results are shown in Table 6 and Figure 5 below.
[0102] division Analysis of head count myh3_genotype qq Qq QQ Comparative example 107 11 40 56 Hpy CH4-RFLP 107 31 46 30 Example 4 107 31 46 30
[0103] qq : Low meaty type, qQ : Medium meat texture, QQ : fleshy
[0105] Referring to FIG. 5 and Table 6, it can be seen that when the primer set according to the comparative example was used, errors occurred in all low-meat, medium-meat, and high-meat types; however, when the primer set according to the present invention was used, the conventional Hpy It can be confirmed that it shows the same results as the CH4-RFLP method.
[0106] In addition, as a result of the analysis of differences in amplified product lengths based on PCR-electrophoresis according to the present invention, it can be confirmed that low-meat pork (qq) shows a 311 bp band, medium-meat pork shows 311 bp and 650 bp bands, and high-meat pork (QQ) shows a 650 bp band.
[0108] Consequently, the present invention can accurately determine the meat quality of pork into low-quality, medium-quality, and high-quality grades within a short time solely by determining the difference in length of the amplification product via electrophoresis after PCR amplification without restriction enzyme treatment, and can demonstrate superior effects compared to existing primer sets.
Claims
Claim 1 A composition for determining the meat quality of pork, comprising: a first primer set consisting of nucleotide sequences represented by SEQ ID NO. 1 and SEQ ID NO. 2; and a second primer set consisting of nucleotide sequences represented by SEQ ID NO. 3 and SEQ ID NO.
4. Claim 2 A composition for determining the meat quality of pork according to claim 1, wherein the composition is capable of amplifying the target gene MYH3 gene to produce an amplified product that exhibits a length difference during electrophoresis. Claim 3 A composition for determining the meat quality of pork according to claim 2, wherein the composition determines the pork as low-quality pork if the length of the amplification product is 311 bp, determines the pork as medium-quality pork if the length of the amplification product is 311 bp and 650 bp, and determines the pork as high-quality pork if the length of the amplification product is 650 bp. Claim 4 A composition for determining the meat quality of pork according to claim 1, wherein the meat quality of the pork is related to a meat quality grade in which meat quality trait factors such as intramuscular fat content, meat color, shear force, water-holding capacity, and fatty acid composition are comprehensively reflected. Claim 5 A kit for determining the meat quality of pork, comprising the composition of claim 1. Claim 6 In paragraph 5, the above kit is a kit for determining the meat quality of pork, which further includes an instruction manual. Claim 7 a) a step of extracting genomic DNA from a pig sample; b) a step of performing an amplification reaction using the isolated genomic DNA as a template and using a composition for identification according to claim 1 or a kit according to claim 5; and c) a step of determining the meat quality of pork by electrophoresis of the amplified products to confirm the size difference of the amplified products. Claim 8 A method for determining the meat quality of pork according to claim 7, wherein, based on the electrophoresis result of step c), if the amplification product appears as a single band of 311 bp, it is determined to be low-quality pork; if a single band of 650 bp appears, it is determined to be high-quality pork; and if both bands of 311 bp and 650 bp appear, it is determined to be medium-quality pork.