Novel heterocycle compounds and their use as an arylhydrocarbon receptor modulator
Novel heterocyclic compounds with structural modifications address the lack of AhR agonist activity in existing compounds, offering effective regulation and treatment of AhR-mediated diseases through AhR signaling pathways.
Patent Information
- Application Number
- KR1020250151802
- Authority / Receiving Office
- KR · KR
- Patent Type
- Patents
- Current Assignee / Owner
- Filing Date
- 2025-10-20
- Publication Date
- 2026-07-15
- Estimated Expiration
- 2045-10-20
Smart Images

Figure 112025116898329-PAT00099_ABST
Abstract
Description
Technology Field
[0001] The present invention relates to novel heterocyclic compounds capable of regulating the activity of aryl hydrocarbon receptors (AhR). Furthermore, the present invention relates to preventing, treating, or improving diseases or disorders associated with AhR signaling, specifically disorders of immune and / or inflammatory response regulation, more specifically autoimmune and inflammatory diseases, dermatological disorders, metabolic and cardiovascular diseases, cancer, neurodegenerative diseases, etc. Background Technology
[0003] The aryl hydrocarbon receptor (AhR) is a cytoplasmic ligand-activating transcription factor widely expressed in various tissues and cells, and is well known as an important intracellular sensor that responds to metabolites or chemicals from natural and artificial environments. The aryl hydrocarbon receptor is a member of the periodic circadian protein (PER) – AhR nuclear translocator (ARNT) – single-minded protein (SIM) superfamily of transcription factors, and the PER-ARNT-SIM (PAS) domain detects xenobiotics such as polycyclic aromatic hydrocarbons (e.g., 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD)). AhR, which is activated by binding to these ligands and forms a complex with several proteins (HSP90, AIP, p23, SRC, etc.), translocates to the nucleus and dimerizes with its partner protein, ARNT. This heterodimeric complex binds to xenobiotic response elements (XREs) and directly or indirectly activates the expression of AhR-related genes. (Shen et al., J. Biol. Chem. , 1992, 267(10):6815-6819; McIntosh et al., Annu. Rev. Physiol. , 2010, 72:625-645; Ehrlich et al., Curr. Opin. Toxicol. , 2017, 2, 72-78)
[0004] Recently, it has been reported that AhR regulates various cellular functions of the innate and adaptive immune systems. AhR inhibits the induction of cytokines that promote the polarization of pathogenic T cell subtypes and reduces MHC class II expression. In addition, AhR activation by prototypical agonists not only inhibits the differentiation of helper T-17 cells but also stabilizes regulatory T cells. Activated AhR is well known to regularly regulate several target genes, such as phase I metabolizing enzymes (e.g., CYP1A1, CYP1A2, CYP1B1), and to exert antioxidant activity by activating nuclear factor-erythroid 2-related factor-2 (NRF-2). It is known that activated AhR can irregularly interact with various inflammatory and immunomodulatory proteins, such as the Epidermal Growth Factor Receptor (EGFR), mitogen-activated protein kinases (MAPK), nuclear factor kappa-light-chain-enhancer of activated B cells (NF-kB), and signal transducer and activator of transcription (STAT). (Nguyen et al., PNAS , 2010, 107(46):19961-19966; Hauben E. et al., Blood 2008, 112:1158-1165; Park and Matsumura, Toxicology2006, 217:139-46; Vogel et al., Mol Endocrinol, 21:2941-55; Kimura et al., J Exp Med, 206:2027-35; Mascanfroni, ID et al. Nat. Med. , 2015 , 21:638-646)
[0005] Heterocyclic compounds having a benzoxazolone backbone structure are well known as compounds exhibiting various biological activities, such as antidepressants, antimicrobial agents, acid ceramidase inhibitors, DprE1 inhibitors, and IDO1 inhibitors.
[0006] The inventors of this invention have a wide range of in silico ( in silico Through screening studies, we identified heat compounds with a benzoxazolone backbone structure expected to exhibit AhR agonist activity, but found that most of these compounds did not actually exhibit significant AhR agonist activity.
[0007] Accordingly, the inventors prepared various heterocyclic compounds by introducing a heterocyclic moiety into the main backbone structure of a benzoxazolone compound, and completed the present invention by identifying a compound exhibiting excellent AhR agonist activity through SAR (Structure-Activity Relationship) studies. The problem to be solved
[0009] The present invention aims to provide a novel heterocyclic compound that exhibits excellent activity as an AhR regulator, particularly as an AhR agonist.
[0010] In addition, the present invention aims to provide a pharmaceutical composition comprising a novel heterocyclic compound having excellent effects in preventing, improving, or treating AhR-mediated diseases or disorders.
[0011] In addition, the present invention aims to provide a health functional food having excellent preventive or corrective effects for AhR-mediated diseases or disorders, comprising a novel heterocyclic compound.
[0012] In addition, the present invention aims to provide a feed composition having excellent preventive or corrective effects for AhR-mediated diseases or disorders, comprising a novel heterocyclic compound.
[0013] In addition, the present invention aims to provide a kit for use in preventing, improving, or treating an AhR-mediated disease or disorder, comprising a container containing a composition including a novel heterocyclic compound and instructions for use. means of solving the problem
[0015] To achieve the above objective, the present invention provides a heterocyclic compound represented by Formula 1 or a pharmaceutically acceptable salt thereof:
[0016] [Chemical Formula 1]
[0017]
[0018] In Chemical Formula 1,
[0019] A is oxygen (O) or sulfur (S);
[0020] Z1, Z2, Z3, and Z4 may be the same or different from each other and are each independently C-R1 or nitrogen (N), where R1 is hydrogen, deuterium, halogen (X), C1-C 10 Alkyl, hydroxy, C1-C 10 It is an alkoxy, -NH2, -CN, or -CX3, where the halogen (X) is fluorine (F), chloro (Cl), bromo (Br), or iodo (I);
[0021] B is oxygen (O) or sulfur (S);
[0022] R is hydrogen, deuterium, halogen (X), C1-C 10 Alkyl, hydroxy, C1-C 10It is an alkoxy, -NH2, -CN, or -CX3, where the halogen (X) is fluorine (F), chloro (Cl), bromo (Br), or iodo (I);
[0023] W is a heterocyclic moiety in which a first ring (W1) and a second ring (W2) are fused, and at least one of the first and second rings is aromatic, and is represented by the following chemical formula 1A;
[0024] [Chemical Formula 1A]
[0025]
[0026] In chemical formula 1A,
[0027] Y1 is carbon (C) or nitrogen (N); Y2 is carbon (C), provided that when n is 0, Y2 and Y6 combine to form a ring; Y3 is carbon (C), nitrogen (N), oxygen (O), or C-R2, where R2 is hydrogen, deuterium, halogen (X), C1-C 10 Alkyl, hydroxy, C1-C 10 It is an alkoxy, -NH2, -CN, or -CX3, where halogen (X) is fluorine (F), chloro (Cl), bromo (Br), or iodo (I); Y4 is carbon (C), oxygen (O), nitrogen (N), NH, or N-CH3; Y5 is carbon (C); Y6 is carbon (C) or nitrogen (N); Y7, Y8, Y9, and Y 10 is a carbon (C) that forms an aromatic ring or a non-aromatic ring together with Y5 and Y6;
[0028] n is 0 or 1 and;
[0029] m is 0 or 1, and;
[0030] represents the connection position.
[0031] In addition, the present invention provides a pharmaceutical composition for use in preventing, improving, or treating an AhR-mediated disease or disorder, comprising a compound represented by Formula 1 or a pharmaceutically acceptable salt thereof as an active ingredient.
[0032] In addition, the present invention provides a health functional food for use in preventing or improving AhR-mediated diseases or disorders, comprising a compound represented by Formula 1 or a food-grade acceptable salt thereof as an active ingredient.
[0033] In addition, the present invention provides a feed composition for use in preventing or improving AhR-mediated diseases or disorders, comprising a compound represented by Formula 1 or a feed-grade acceptable salt thereof as an active ingredient.
[0034] In addition, the present invention provides a kit for use in preventing, improving, or treating an AhR-mediated disease or disorder, comprising: a container containing a compound represented by Formula 1 or a composition containing said compound as an active ingredient, such as a pharmaceutical composition, a health functional food, or a feed composition; and instructions for use.
[0035] In addition, the present invention provides a use of a heterocyclic compound represented by Formula 1 in manufacturing a pharmaceutical composition, health functional food, feed composition, or kit for use in preventing, improving, or treating an AhR-mediated disease or disorder.
[0036] In addition, the present invention provides a method for preventing, improving, or treating an AhR-mediated disease or disorder, comprising the step of administering an effective amount of a heterocyclic compound represented by Formula 1 or a composition containing said compound as an active ingredient, such as a pharmaceutical composition, a health functional food, or a feed composition, to a subject who requires prevention, improvement, or treatment of an AhR-mediated disease or disorder. Effects of the invention
[0038] The novel heterocyclic compound according to the present invention exhibits excellent activity as an AhR modulator, more specifically as an AhR agonist, and can be usefully employed to prevent, improve, or treat various diseases or disorders related to AhR signaling through single administration or combined administration with other active substances. Brief explanation of the drawing
[0040] Figure 1 is a figure showing the effect of the heterocyclic compound of Example 8 according to one embodiment of the present invention on CYP1A1 expression in HaCaT cells. Figure 2 is a figure showing the effect of the heterocyclic compound of Example 9 according to one embodiment of the present invention on CYP1A1 expression in HaCaT cells. Figure 3 is a figure showing the effect of the heterocyclic compound of Example 25 according to one embodiment of the present invention on CYP1A1 expression in HaCaT cells. Figure 4 is a figure showing the effect of the heterocyclic compound of Example 27 according to one embodiment of the present invention on CYP1A1 expression in HaCaT cells. Figure 5 is a figure showing the effect of the heterocyclic compound of Example 29 according to one embodiment of the present invention on CYP1A1 expression in HaCaT cells. Figure 6 is a figure showing the effect of the heterocyclic compound of Example 40 according to one embodiment of the present invention on CYP1A1 expression in HaCaT cells. Specific details for implementing the invention
[0041] The present invention will be described in detail below.
[0042] In this specification, compounds are basically named according to the rules established by IUPAC, but if necessary, they may also be named by common names commonly used in the art.
[0043] In one embodiment, the present invention relates to a novel heterocyclic compound represented by Formula 1 or a pharmaceutically acceptable salt thereof:
[0044] [Chemical Formula 1]
[0045]
[0046] where A; B; Z1, Z2, Z3, Z4, R1; W, W1, W2, Y1, Y2, Y3, Y4, Y5, Y6, Y7, Y8, Y9, Y 10 , R2, n, m; The definitions of and R are the same as those described above.
[0047] In an exemplary embodiment of the heterocyclic compound of Formula 1 according to the present invention, A may be oxygen (O) or sulfur (S); preferably, it may be oxygen (O).
[0048] In an exemplary embodiment of the heterocyclic compound of Formula 1 according to the present invention, Z1, Z2, Z3, and Z4 may be the same or different from one another and are each independently C-R1 or nitrogen (N), wherein R1 is hydrogen, deuterium, halogen (X) (e.g., fluorine (F), chloro (Cl), bromo (Br), or iodo (I), preferably fluorine (F) or chloro (Cl)), C1-C 10 Alkyl (preferably, C1-C5 alkyl, e.g., methyl, ethyl, propyl, iso-propyl, n-butyl, iso-butyl, sec-butyl, tert-butyl, iso-pentyl, neo-pentyl, sec-pentyl, tert-pentyl), hydroxy, C1-C 10It may be an alkoxy (preferably a C1-C5 alkoxy, e.g., methoxy, ethoxy, propoxy, iso-propoxy, n-butoxy, iso-butoxy, sec-butoxy, tert-butoxy, iso-pentoxy, neo-pentoxy, sec-pentoxy, tert-pentoxy), -NH2, -CN, or -CX3 (wherein the halogen (X) is fluorine (F), chloro (Cl), bromo (Br), or iodo (I), preferably fluorine (F) or chloro (Cl)). Preferably, Z1, Z2, and Z4 are CH; and Z3 may be CX (wherein X is a halogen, e.g., fluorine (F), chloro (Cl), bromo (Br), or iodo (I), preferably fluorine (F) or chloro (Cl)).
[0049] In an exemplary embodiment of the heterocyclic compound of Formula 1 according to the present invention, B may be oxygen (O) or sulfur (S); preferably, it may be oxygen (O).
[0050] In an exemplary embodiment of a heterocyclic compound of Formula 1 according to the present invention, W is a heterocyclic moiety in which a first ring (W1) and a second ring (W2) are fused, and at least one of rings W1 and W2 has aromaticity, and can be represented by the following Formula 1A:
[0051] [Chemical Formula 1A]
[0052]
[0053] In chemical formula 1A,
[0054] n can be 0 or 1, preferably 1;
[0055] m can be 0 or 1, preferably 1;
[0056] Y1 may be carbon (C) or nitrogen (N), preferably nitrogen (N); Y2 is carbon (C), provided that when n is 0, Y2 and Y6 are combined to form a ring; Y3 may be carbon (C), nitrogen (N), oxygen (O), or C-R2, preferably carbon (C) or C-R2, where R2 is hydrogen, deuterium, halogen (X) (e.g., fluorine (F), chloro (Cl), bromo (Br), or iodo (I), preferably fluorine (F) or chloro (Cl)), C1-C 10 Alkyl, hydroxy, C1-C 10 It may be an alkoxy, -NH2, or -CN; Y4 may be carbon (C), oxygen (O), nitrogen (N), NH, or N-CH3, preferably carbon (C), oxygen (O), nitrogen (N), or NH; Y5 is carbon (C); Y6 may be carbon (C) or nitrogen (N), preferably nitrogen (N); Y7, Y8, Y9, and Y 10 The carbon (C) may form an aromatic ring or a non-aromatic ring together with Y5 and Y6, preferably a carbon (C) that forms an aromatic ring;
[0057] means the location where it is connected.
[0058] In an exemplary embodiment of the heterocyclic compound of Formula 1 according to the present invention, W represented by Formula 1A is It may have any one of the heterocyclic structures selected from the group consisting of; preferably, It may have any one of the heterocyclic structures selected from the group consisting of; more preferably, It may have any one of the heterocyclic structures selected from the group consisting of, wherein R2 is hydrogen, deuterium, halogen (X) (e.g., fluorine (F), chloro (Cl), bromo (Br), or iodo (I), preferably fluorine (F) or chloro (Cl)), C1-C 10 Alkyl (preferably, C1-C5 alkyl), hydroxy, C1-C 10 It may be an alkoxy (preferably a C1-C5 alkoxy), -NH2, -CN, or -CX3 (wherein X is a halogen, such as fluorine (F), chloro (Cl), bromo (Br), or iodo (I), preferably fluorine (F) or chloro (Cl)).
[0059] In an exemplary embodiment of the heterocyclic compound of Formula 1 according to the present invention, R is hydrogen, deuterium, halogen (X) (e.g., fluorine (F), chloro (Cl), bromo (Br), or iodo (I), preferably fluorine (F) or chloro (Cl)) C1-C 10 Alkyl (preferably, C1-C5 alkyl), hydroxy, C1-C 10 It may be an alkoxy (preferably a C1-C5 alkoxy), -NH2, -CN, or -CX3 (wherein X is a halogen, e.g., fluorine (F), chloro (Cl), bromo (Br), or iodo (I), preferably fluorine (F) or chloro (Cl). Preferably, R is fluorine (F), chloro (Cl), C1-C5 alkyl, C1-C5 alkoxy, -CF3, or - It could be CCl3.
[0060] In an exemplary embodiment of a heterocyclic compound of Formula 1 according to the present invention, the heterocyclic compound represented by Formula 1 may have a structure represented by either Formula 1-1 or Formula 1-3 below; preferably, it may have the structure of Formula 1-1:
[0061] [Chemical Formula 1-1]
[0062]
[0065] [Chemical Formula 1-3]
[0066] ,
[0067] In the above chemical formula 1-1 or 1-3, A; B; Z1, Z2, Z3, Z 4; W, W1, W2; Y1, Y2, Y3, Y4, Y5, Y6, Y7, Y8, Y9, Y 10 ; The definitions of and R are the same as those of Chemical Formula 1 or Chemical Formula 1A described above.
[0068] In an exemplary embodiment of a heterocyclic compound represented by Formula 1-1 according to the present invention, A is oxygen (O); B is oxygen (O); and Z1, Z2, Z3, and Z4 are CH; Y4 is nitrogen (N); Y6 is nitrogen (N); Y1 is absent; Y2, Y3, Y5, Y7, Y8, Y9, and Y 10 Each is a carbon (C) forming an aromatic ring; R is absent or the above-described substituent, preferably a halogen (X) (e.g., fluorine (F), chloro (Cl), bromo (Br), or iodo (I), preferably fluorine (F) or chloro (Cl)), C 1-10 Alkyl (e.g., methyl, ethyl, propyl, butyl, or pentyl; including cases where it is straight or branched) or C 1-10 It may be an alkoxy (e.g., methoxy, ethoxy, propoxy, butoxy, or pentoxy; including cases where the alkyl portion is a straight chain or a branched chain). In a specific embodiment, the heterocyclic compound represented by Formula 1-1 according to the present invention may be the compound of Example 15.
[0069] In an exemplary embodiment of a heterocyclic compound represented by Formula 1-1 according to the present invention, A is oxygen (O); B is oxygen (O); and Z1, Z2 and Z4 are CH, and Z3 is CX, where X is fluorine (F), chloro (Cl), bromo (Br), or iodo (I), preferably fluorine (F) or chloro (Cl); Y4 is nitrogen (N); Y6 is nitrogen (N); Y1 is absent; Y2, Y3, Y5, Y7, Y8, Y9, and Y 10 Each is a carbon (C) forming an aromatic ring; R is absent or the above-described substituent, preferably a halogen (X) (e.g., fluorine (F), chloro (Cl), bromo (Br), or iodo (I), preferably fluorine (F) or chloro (Cl)), C 1-10 Alkyl (e.g., methyl, ethyl, propyl, butyl, or pentyl; including cases where it is straight or branched) or C 1-10 It may be an alkoxy (e.g., methoxy, ethoxy, propoxy, butoxy, or pentoxy; including cases where the alkyl portion is a straight chain or a branched chain). In specific embodiments, the heterocyclic compound represented by Formula 1-1 according to the present invention may be the compound of Examples 4, 20, 22, or 27.
[0070] In an exemplary embodiment of a heterocyclic compound represented by Formula 1-1 according to the present invention, A is oxygen (O); B is oxygen (O); and Z1, Z2 and Z4 are CH; Z3 is C-X, where X is fluorine (F), chloro (Cl), bromo (Br), or iodo (I), preferably fluorine (F) or chloro (Cl); Y4 is NH; Y1 is absent; Y2, Y3, Y5, Y6, Y7, Y8, Y9, and Y 10 Each is a carbon (C) forming an aromatic ring; R is absent or the above-described substituent, preferably a halogen (X) (e.g., fluorine (F), chloro (Cl), bromo (Br), or iodo (I), preferably fluorine (F) or chloro (Cl)), C 1-10Alkyl (e.g., methyl, ethyl, propyl, butyl, or pentyl; including cases where it is straight or branched) or C 1-10 It may be an alkoxy (e.g., methoxy, ethoxy, propoxy, butoxy, or pentoxy; including cases where the alkyl portion is a straight chain or a branched chain). In a specific embodiment, the heterocyclic compound represented by Formula 1-1 according to the present invention may be the compound of Examples 9, 48, 49, 50, or 51.
[0071] In an exemplary embodiment of a heterocyclic compound represented by Formula 1-1 according to the present invention, A is oxygen (O); B is oxygen (O); and Z1, Z2 and Z4 are CH, and Z3 is CX, where X is fluorine (F), chloro (Cl), bromo (Br), or iodo (I), preferably fluorine (F) or chloro (Cl); Y4 is oxygen (O); Y1 is absent; Y2, Y3, Y5, Y6, Y7, Y8, Y9, and Y 10 Each is a carbon (C) forming an aromatic ring; R is absent or the above-described substituent, preferably a halogen (X) (e.g., fluorine (F), chloro (Cl), bromo (Br), or iodo (I), preferably fluorine (F) or chloro (Cl)), C 1-10 Alkyl (e.g., methyl, ethyl, propyl, butyl, or pentyl; including cases where it is straight or branched) or C 1-10 It may be an alkoxy (e.g., methoxy, ethoxy, propoxy, butoxy, or pentoxy; including cases where the alkyl portion is a straight chain or a branched chain). In a specific embodiment, the heterocyclic compound represented by Formula 1-1 according to the present invention may be the compound of Example 52.
[0072] In an exemplary embodiment of a heterocyclic compound represented by Formula 1-1 according to the present invention, A is oxygen (O); B is oxygen (O); and Z1, Z2 and Z4 are CH; Z3 is CX, where X is fluorine (F), chloro (Cl), bromo (Br), or iodo (I), preferably fluorine (F) or chloro (Cl); Y4 is oxygen (O); Y3 is CX, where X is fluorine (F), chloro (Cl), bromo (Br), or iodo (I), preferably fluorine (F) or chloro (Cl); Y1 is absent; Y2, Y5, Y6, Y7, Y8, Y9, and Y 10 Each is a carbon (C) forming an aromatic ring; R is absent or the above-described substituent, preferably a halogen (X) (e.g., fluorine (F), chloro (Cl), bromo (Br), or iodo (I), preferably fluorine (F) or chloro (Cl)), C 1-10 Alkyl (e.g., methyl, ethyl, propyl, butyl, or pentyl; including cases where it is straight or branched) or C 1-10 It may be an alkoxy (e.g., methoxy, ethoxy, propoxy, butoxy, or pentoxy; including cases where the alkyl portion is a straight chain or a branched chain). In a specific embodiment, the heterocyclic compound represented by Formula 1-1 according to the present invention may be the compound of Example 53.
[0074] In an exemplary embodiment of a heterocyclic compound represented by Formula 1-3 according to the present invention, A is oxygen (O); B is oxygen (O); and Z1, Z2, Z3 and Z4 are CH; Y1 is nitrogen (N); Y4 is nitrogen (N); Y3 is C-R2, and R2 is C 1-10 alkyl (e.g., C 1-5 alkyl) or halogen (X) (e.g., fluorine (F), chloro (Cl), bromo (Br), or iodo (I), preferably fluorine (F) or chloro (Cl)); and Y2, Y5, Y6, Y7, Y8, Y9, and Y 10Each is a carbon (C) forming an aromatic ring; R is absent or the aforementioned substituent, preferably a halogen (X) (e.g., fluorine (F), chloro (Cl), bromo (Br), or iodo (I)), C 1-10 Alkyl (e.g., methyl, ethyl, propyl, butyl, or pentyl; including cases where it is straight or branched) or C 1-10 It may be an alkoxy (e.g., methoxy, ethoxy, propoxy, butoxy, or pentoxy; including cases where the alkyl portion is a straight chain or a branched chain). In a specific embodiment, the heterocyclic compound represented by Formula 1-3 according to the present invention may be the compound of Example 60.
[0075] In an exemplary embodiment of a heterocyclic compound represented by Formula 1-3 according to the present invention, A is oxygen (O); B is oxygen (O); and Z1, Z3, and Z4 is CH; Z2 is CX, where X is fluorine (F), chloro (Cl), bromo (Br), or iodo (I), preferably fluorine (F) or chloro (Cl); Y1 is nitrogen (N); Y4 is nitrogen (N); Y3 is C-R2, where R2 is hydrogen, C 1-10 alkyl (e.g., C 1-5 alkyl) or halogen (X) (e.g., fluorine (F), chloro (Cl), bromo (Br), or iodo (I), preferably fluorine (F) or chloro (Cl)); and Y2, Y5, Y6, Y7, Y8, Y9, and Y 10 Each is a carbon (C) forming an aromatic ring; R is absent or the above-described substituent, preferably a halogen (X) (e.g., fluorine (F), chloro (Cl), bromo (Br), or iodo (I), preferably fluorine (F) or chloro (Cl)), C 1-10 Alkyl (e.g., methyl, ethyl, propyl, butyl, or pentyl; including cases where it is straight or branched) or C 1-10It may be an alkoxy (e.g., methoxy, ethoxy, propoxy, butoxy, or pentoxy; including cases where the alkyl portion is a straight chain or a branched chain). In a specific embodiment, the heterocyclic compound represented by Formula 1-3 according to the present invention may be the compound of Example 24.
[0076] In an exemplary embodiment of a heterocyclic compound represented by Formula 1-3 according to the present invention, A is oxygen (O); B is oxygen (O); and Z1, Z2, and Z4 is CH; Z3 is CX, where X is fluorine (F), chloro (Cl), bromo (Br), or iodo (I), preferably fluorine (F) or chloro (Cl); Y1 is nitrogen (N); Y4 is nitrogen (N); Y3 is C-R2, where R2 is hydrogen, C 1-10 alkyl (e.g., C 1-5 alkyl) or halogen (X) (e.g., fluorine (F), chloro (Cl), bromo (Br), or iodo (I), preferably fluorine (F) or chloro (Cl)); and Y2, Y5, Y6, Y7, Y8, Y9, and Y 10 Each is a carbon (C) forming an aromatic ring; R is absent or the above-described substituent, preferably a halogen (X) (e.g., fluorine (F), chloro (Cl), bromo (Br), or iodo (I), preferably fluorine (F) or chloro (Cl)), C 1-10 Alkyl (e.g., methyl, ethyl, propyl, butyl, or pentyl; including cases where it is straight or branched) or C 1-10 It may be an alkoxy (e.g., methoxy, ethoxy, propoxy, butoxy, or pentoxy; including cases where the alkyl portion is a straight chain or a branched chain). In specific embodiments, the heterocyclic compound represented by Formula 1-3 according to the present invention may be the compound of Examples 7, 8, 25, or 40.
[0077] In an exemplary embodiment of a heterocyclic compound represented by Formula 1-3 according to the present invention, A is oxygen (O); B is oxygen (O); Z1 and Z4 are CH; and Z2 and Z3 may be the same or different and are each independently CX, where X is fluorine (F), chloro (Cl), bromo (Br), or iodo (I), preferably fluorine (F) or chloro (Cl), preferably fluorine (F) or chloro (Cl); Y1 is nitrogen (N); Y4 is nitrogen (N); Y3 is C-R2, and R2 is C 1-10 alkyl (e.g., C 1-5 alkyl) or halogen (X) (e.g., fluorine (F), chloro (Cl), bromo (Br), or iodo (I), preferably fluorine (F) or chloro (Cl)); and Y2, Y5, Y6, Y7, Y8, Y9, and Y 10 Each is a carbon (C) forming an aromatic ring; R is absent or the aforementioned substituent, preferably a halogen (X) (e.g., fluorine (F), chloro (Cl), bromo (Br), or iodo (I)), C 1-10 Alkyl (e.g., methyl, ethyl, propyl, butyl, or pentyl; including cases where it is straight or branched) or C 1-10 It may be an alkoxy (e.g., methoxy, ethoxy, propoxy, butoxy, or pentoxy; including cases where the alkyl portion is a straight chain or a branched chain). In a specific embodiment, the heterocyclic compound represented by Formula 1-1 according to the present invention may be the compound of Example 61 or 62.
[0078] In an exemplary embodiment of a heterocyclic compound represented by Formula 1-3 according to the present invention, A is oxygen (O); B is oxygen (O); Z1, Z2, and Z3 is CH; Z4 is CX, where X is fluorine (F), chloro (Cl), bromo (Br), or iodo (I), preferably fluorine (F) or chloro (Cl); Y1 is nitrogen (N); Y4 is nitrogen (N); Y3 is C-R2, and R2 is C 1-10 alkyl (e.g., C 1-5 alkyl) or halogen (X) (e.g., fluorine (F), chloro (Cl), bromo (Br), or iodo (I), preferably fluorine (F) or chloro (Cl)); and Y2, Y5, Y6, Y7, Y8, Y9, and Y 10 Each is a carbon (C) forming an aromatic ring; R is absent or the above-described substituent, preferably a halogen (X) (e.g., fluorine (F), chloro (Cl), bromo (Br), or iodo (I), preferably fluorine (F) or chloro (Cl)), C 1-10 Alkyl (e.g., methyl, ethyl, propyl, butyl, or pentyl; including cases where it is straight or branched) or C 1-10 It may be an alkoxy (e.g., methoxy, ethoxy, propoxy, butoxy, or pentoxy; including cases where the alkyl portion is a straight chain or a branched chain). In a specific embodiment, the heterocyclic compound represented by Formula 1-3 according to the present invention may be the compound of Example 30.
[0079] In an exemplary embodiment of a heterocyclic compound represented by Formula 1-3 according to the present invention, A is oxygen (O); B is oxygen (O); Z1, Z2, and Z4 is CH; Z3 is C-X, where X is fluorine (F), chloro (Cl), bromo (Br), or iodo (I), preferably fluorine (F) or chloro (Cl); Y4 is nitrogen (N); Y3 is C-R2, where R2 is C 1-10alkyl (e.g., methyl, ethyl, propyl, butyl, or pentyl; including cases where it is straight-chain or branched) or halogen (X) (e.g., fluorine (F), chloro (Cl), bromo (Br), or iodo (I), preferably fluorine (F) or chloro (Cl)); and Y1, Y2, Y5, Y6, Y7, Y8, Y9, and Y 10 Each is a carbon (C) forming an aromatic ring; R is absent or the above-described substituent, preferably a halogen (X) (e.g., fluorine (F), chloro (Cl), bromo (Br), or iodo (I), preferably fluorine (F) or chloro (Cl)), C 1-10 Alkyl (e.g., methyl, ethyl, propyl, butyl, or pentyl; including cases where it is straight or branched) or C 1-10 It may be an alkoxy (e.g., methoxy, ethoxy, propoxy, butoxy, or pentoxy; including cases where the alkyl portion is a straight chain or a branched chain). In a specific embodiment, the heterocyclic compound represented by Formula 1-3 according to the present invention may be the compound of Example 23.
[0080] In an exemplary embodiment of a heterocyclic compound represented by Formula 1-3 according to the present invention, A is oxygen (O); B is oxygen (O); Z1, Z2, and Z4 is CH; Z3 is C-X, where X is fluorine (F), chloro (Cl), bromo (Br), or iodo (I), preferably fluorine (F) or chloro (Cl); Y1 is nitrogen (N); Y3 is C-R2, where R2 is C 1-10 alkyl (e.g., C 1-5 alkyl) or halogen (X) (e.g., fluorine (F), chloro (Cl), bromo (Br), or iodo (I), preferably fluorine (F) or chloro (Cl)); and Y2, Y4, Y5, Y6, Y7, Y8, Y9, and Y 10Each is a carbon (C) forming an aromatic ring; R is absent or the above-described substituent, preferably a halogen (X) (e.g., fluorine (F), chloro (Cl), bromo (Br), or iodo (I), preferably fluorine (F) or chloro (Cl)), C 1-10 Alkyl (e.g., methyl, ethyl, propyl, butyl, or pentyl; including cases where it is straight or branched) or C 1-10 It may be an alkoxy (e.g., methoxy, ethoxy, propoxy, butoxy, or pentoxy; including cases where the alkyl portion is a straight chain or a branched chain). In a specific embodiment, the heterocyclic compound represented by Formula 1-3 according to the present invention may be the compound of Example 29.
[0081] In an exemplary embodiment of the present invention, the heterocyclic compound represented by Formula 1 may be the compound of Examples 2 to 64, preferably the compound of Examples 4, 7, 8, 9, 15, 20, 22, 23, 24, 25, 27, 29, 30, 40, 48, 49, 50, 51, 52, 53, 60, 61, or 62.
[0082] In this specification, 'AhR' refers to the aryl hydrocarbon receptor, and AhR is a transcription factor that exists in an inactive state without a ligand in the cytoplasm bound to HSP90. When a ligand binds to AhR, AhR translocates to the nucleus, where it is dimerized by Arnt to form a functional transcription factor. AhR / Arnt binds to the dioxin response element (DRE) present in the promoters of numerous genes that regulate gene transcription. Representative genes regulated by AhR include cytochrome P450 genes, for example CyP1a1 , CyP1a2 , Cyp1b1 This is the best known. Because the activation of AhR significantly increases the expression of these genes, Cyp1a1 , CyP1a2 , Cyp1b1 mRNA levels are useful as an indicator for reading AhR activation.
[0083] According to one embodiment, the heterocyclic compound represented by Formula 1 according to the present invention was confirmed to act as an AhR agonist by directly interacting with and binding to the AhR ligand binding site. The heterocyclic compound represented by Formula 1 [shows] EC according to AhR-Luc Human agonism analysis 50 The value may be 1.0 μM or less and greater than 0.1 μM, preferably 0.1 μM or less and greater than 0.01 μM, more preferably less than 0.01 μM. The heterocyclic compound represented by Chemical Formula 1 can regulate various immune and inflammatory responses involving AhR in the body by directly binding to AhR and inducing its activation.
[0084] According to another embodiment, a heterocyclic compound represented by Formula 1 according to the present invention effectively induces a translocation from the cytoplasm to the nucleus of AhR, and also Cyp1a1 It was shown to increase gene expression in a concentration-dependent manner. The heterocyclic compound represented by Chemical Formula 1 induces the nuclear potential of AhR, thereby, CyP1a1 , CyP1a2 , Cyp1b1 By inducing or increasing the expression of AhR-related genes such as the above, diseases, disorders, and adverse reactions that have occurred or may occur in the body due to toxic or carcinogenic substances can be suppressed, reduced, alleviated, or treated.
[0085] Therefore, the heterocyclic compound according to the present invention is expected to be very useful as an AhR regulator, particularly as an AhR agonist, for preventing, improving, or treating AhR-mediated diseases or disorders.
[0086] AhR-mediated diseases may be one or more selected from the group consisting of autoimmune and inflammatory diseases, dermatological disorders, metabolic and cardiovascular diseases, cancer, and neurodegenerative diseases.
[0087] Examples of autoimmune and inflammatory diseases include, but are not limited to, systemic lupus erythematosus (SLE), rheumatoid arthritis (RA), multiple sclerosis (MS), asthma, allergic responses, or inflammatory bowel disease (IBD).
[0088] Examples of dermatological disorders include, but are not limited to, psoriasis, atopic dermatitis (AD), acne, or hidradenitis suppurativa.
[0089] Examples of metabolic and cardiovascular diseases include, but are not limited to, metabolic syndromes, obesity, dyslipidemia, fatty liver, insulin resistance syndrome, diabetes mellitus (including type 2 diabetes mellitus), atherosclerosis, diabetic nephropathy, chronic kidney disease (CKD), or coronary artery disease (CAD).
[0090] Examples of cancer include, but are not limited to, breast cancer, prostate cancer, colorectal cancer, liver cancer, head and neck cancer, or pancreatic cancer.
[0091] Examples of neurodegenerative diseases include, but are not limited to, brain inflammation, damage to the blood-brain barrier (BBB), cognitive decline, Alzheimer's disease, or multiple sclerosis.
[0092] Unless otherwise specified, the heterocyclic compounds disclosed herein also include all isomers of the compound having the structure represented by Formula 1 (e.g., enantiomers, diastereomers, geometric isomers (or conformation isomers), e.g., R and / or S isomers for each asymmetric center, and Z and / or E isomers). Accordingly, monostereomers, enantiomers, diastereomers, geometric (or conformation) isomers, and mixtures thereof of the heterocyclic compounds of the present invention are also within the scope of the present invention.
[0093] Unless otherwise specified, all tautomeric forms of the heterocyclic compound according to the present invention are also within the scope of the present invention.
[0094] Additionally, unless otherwise specified, the heterocyclic compounds according to the present invention are intended to comprise compounds that differ only in the presence of one or more isotope-rich atoms. For example, hydrogen is replaced with deuterium or tritium, or carbon 13 C- or 14 Compounds replaced with C-rich carbons are also within the scope of the present invention. Such compounds may be used, for example, as analytical tools, probes in biological analysis, or as AhR regulators, AhR agonists, AhR therapeutic agents, etc., according to the present invention.
[0095] In another aspect, the present invention relates to a pharmaceutical composition for use in preventing, improving, or treating an AhR-mediated disease or disorder, comprising a heterocyclic compound represented by Formula 1 or a pharmaceutically acceptable salt thereof as an active ingredient.
[0096] As used herein, the term "prevention" refers to any act of inhibiting, suppressing, delaying, or preventing the occurrence, spread, exacerbation, and recurrence of an AhR-mediated disease or disorder by administering a pharmaceutical composition according to the present invention.
[0097] As used herein, the term "treatment" refers to any act of alleviating, suppressing, blocking, improving, or reversing the adverse effects (or related symptoms) themselves and / or their exacerbation (development) in a subject who has developed or is at risk of developing an AhR-mediated disease or disorder by administering a pharmaceutical composition according to the present invention, or of altering complications associated with the AhR-mediated disease or disorder, the overall health status, etc., in a manner favorable to the subject's survival.
[0098] As used herein, terms such as "improvement" or similar terms such as "alleviation" refer to any action in which AhR-mediated diseases or disorders and / or related symptoms, complications, etc. are improved or beneficially altered for the subject's overall health status and survival through the administration of a pharmaceutical composition comprising a heterocyclic compound according to the present invention or a pharmaceutically acceptable salt thereof.
[0099] As used herein, the term "pharmaceuticalally acceptable" means exhibiting properties that are not toxic to cells or humans exposed to the pharmaceutical composition according to the present invention. Pharmaceutically acceptable carriers, excipients, or diluents may be used without particular limitation if they are known and commonly used in the pharmaceutical field as buffers, preservatives, analgesics, solubilizers, isotonics, stabilizers, excipients, lubricants, etc.
[0100] According to one embodiment, the pharmaceutical composition of the present invention may further comprise one or more selected from the group consisting of pharmaceutically acceptable carriers, adjuvants, and vehicles.
[0101] Pharmaceutically acceptable carriers, adjuvants, and vehicles refer to non-toxic carriers, adjuvants, or vehicles that do not impair the pharmacological activity of the compound being formulated, and may be used without special restriction as long as they are known in the art.
[0102] For example, it may include, but is not limited to, one or more selected from the group consisting of ion exchange agents, alumina, aluminum stearate, lecithin, serum proteins, such as human serum albumin, buffering substances, such as phosphate, glycine, sorbic acid, potassium sorbate, mixtures of partial glycerides of saturated vegetable fatty acids, water, salts or electrolytes, such as protamine sulfate, disodium hydrogen phosphate, potassium hydrogen phosphate, sodium chloride, zinc salt, colloidal silica, magnesium trisilicate, polyvinylpyrrolidone, cellulose-based materials, polyethylene glycol, sodium carboxymethylcellulose, polyacrylates, waxes, polyethylene-polyoxypropylene-block polymers, polyethylene glycol, and wool fat.
[0103] The pharmaceutical composition of the present invention may be administered orally, parenterally, by inhalation spray, topically, rectally, nasally, buccally, vaginally, or through an implanted reservoir.
[0104] The pharmaceutical composition of the present invention may be formulated for oral administration into any orally acceptable dosage form, including, but not limited to, capsules, tablets, aqueous suspensions, or solutions. In the case of oral tablets, commonly used carriers may include lactose and corn starch, and lubricants such as magnesium stearate may also be conventionally added. Additionally, a useful diluent for oral administration in capsule form may include lactose and dried corn starch, and if an aqueous suspension is required for oral use, a combination of an emulsifying agent and a suspending agent may be used as the active ingredient. Optionally, the pharmaceutical composition of the present invention may further include specific sweeteners, flavoring agents, or coloring agents, but is not limited thereto.
[0105] The pharmaceutical composition of the present invention is administered in a pharmaceutically effective amount. As used herein, the term "pharmaceuticalally effective amount" means an amount sufficient to treat a disease with a reasonable benefit / risk ratio applicable to medical treatment and that does not cause adverse effects, and the effective dose level may be determined based on factors including, but not limited to, the health status of the subject, the type and severity of the disease, the activity of the drug, sensitivity to the drug, the method of administration, the time of administration, the route of administration and elimination rate, the duration of treatment, drugs used in combination or concurrently, and other factors well known in the medical field.
[0106] The pharmaceutical composition of the present invention may be administered as a single agent or in combination with other anticancer agents / therapeutic agents, may be administered sequentially or simultaneously with conventional anticancer agents / therapeutic agents, and may be administered as a single or multiple doses. A person skilled in the art can determine, without particular difficulty, an dosage that obtains maximum effect with a minimum amount without side effects by considering all of the above-mentioned factors.
[0107] In one embodiment, the effective dosage of the pharmaceutical composition of the present invention may be, for example, 0.1 μg / kg / day to 100.0 mg / kg / day based on the amount of active ingredient to be administered to the subject, but is not limited thereto, and the effective dosage may vary depending on the patient's weight, age, disease state, etc. In one embodiment, the pharmaceutical composition of the present invention may be administered once to three times a day, but is not limited thereto, and the number of administrations may vary depending on the patient's weight, age, disease state, etc.
[0108] As used herein, the term “subject” means any animal including monkeys, cattle, horses, sheep, pigs, chickens, turkeys, quails, cats, dogs, mice, rats, rabbits, or guinea pigs, including humans, who require prevention, improvement, or treatment of an AhR-mediated disease or disorder.
[0109] In one embodiment, the subject may be a human patient who already has an AhR-mediated disease or disorder or is at risk of developing one.
[0110] In one embodiment, the subject may be a human patient who is currently receiving, has received, or is scheduled to receive a drug to treat an AhR-mediated disease or disorder.
[0111] The route of administration of the pharmaceutical composition of the present invention may be oral, intravenous, intramuscular, intra-arterial, intramedullary, intradural, intracardiac, transdermal, subcutaneous, intraperitoneal, intranasal, intestinal, topical, sublingual, or rectal, but the route of administration may be appropriately selected as needed.
[0112] The pharmaceutical composition of the present invention can be administered orally or parenterally.
[0113] When the pharmaceutical composition of the present invention is administered parenterally, it may be administered by external application to the skin or by injection (infusion) methods such as intraperitoneal injection, rectal injection, subcutaneous injection, intravenous injection, intramuscular injection, or thoracic injection, but the method of administration may be appropriately selected as needed.
[0114] The pharmaceutical composition of the present invention may be formulated into a solid dosage form for oral administration, such as a tablet, pill, powder, granule, or capsule.
[0115] The pharmaceutical composition of the present invention may be formulated into a liquid preparation for oral administration, such as a suspension, liquid formulation, emulsion, or syrup.
[0116] The pharmaceutical composition of the present invention may be formulated into preparations for oral administration, such as sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized preparations, and suppositories.
[0117] In another aspect, the present invention relates to a health functional food for use in preventing or improving AhR-mediated diseases or disorders, comprising as an active ingredient a novel heterocyclic compound represented by Formula 1 or a food-grade acceptable salt thereof.
[0118] The health functional food of the present invention refers to a food manufactured and / or processed in various forms to provide a useful function to a subject, namely, to prevent or improve related symptoms or complications, including AhR-mediated diseases or disorders.
[0119] The health functional food of the present invention encompasses not only food in the conventional sense but also functional food.
[0120] There are no specific restrictions on the types of health functional foods that may include the novel heterocyclic compound represented by Formula 1 of the present invention or a food-grade acceptable salt thereof, but, for example, meat, sausage, bread, chocolate, candy, snacks, confectionery, pizza, ramen, other noodles, chewing gum, dairy products including ice cream, various soups, beverages, tea, drinks, alcoholic beverages, vitamin complexes, etc.
[0121] The health functional food of the present invention includes all forms such as functional food, nutritional supplement, health food, and food additives, and these types of food can be manufactured in various forms according to conventional methods known in the art. For example, as a health food, it may be manufactured in the form of a liquid drink for consumption, or consumed by granulation, encapsulation, spherical tablet (pill, etc.), or powdering, and may also be manufactured in the form of powder, soft or hard capsule, tablet, gum, adhesive type liquid, etc. In addition, functional foods include beverages (including alcoholic beverages), fruits and processed foods thereof (e.g., canned fruit, jarred fruit, jam, marmalade, etc.), fish, meat and processed foods thereof (e.g., ham, sausage, corned beef, etc.), bread, noodles (e.g., udon, buckwheat noodles, ramen, spaghetti, macaroni, etc.), fruit juice, various drinks, cookies, malt syrup, dairy products (e.g., butter, cheese, etc.), vegetable edible oils, margarine, vegetable protein, retort foods, frozen foods, medicines, various seasonings (e.g., soybean paste, soy sauce, sauces, etc.).
[0122] The health functional food of the present invention may further include ingredients that are ordinarily added during food manufacturing, provided that such addition does not fall outside the scope of the ultimate purpose of the present invention, for example, may further include proteins, carbohydrates, fats, other nutrients, seasonings, and flavorings.
[0123] The health functional food of the present invention may additionally contain various nutritional supplements, vitamins, electrolytes, flavoring agents, coloring agents, pectic acid and its salts, alginic acid and its salts, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohol, carbonating agents used in carbonated beverages, etc. The health functional food of the present invention may contain fruit pulp for the production of natural fruit juices, fruit juice beverages, and vegetable beverages. These ingredients may be used independently or in combination.
[0124] The effective content of the heterocyclic compound represented by Formula 1 or the food-grade acceptable salt thereof in the health functional food of the present invention may be 0.01 to 50 w / w%, 0.1 to 45 w / w%, or 0.5 to 35 w / w% based on the total weight of the health functional food finally produced, but is not limited thereto.
[0125] The effective content of the heterocyclic compound represented by Formula 1 or the food-grade acceptable salt thereof in the health functional food of the present invention may be 0.01 to 50 w / v%, 0.1 to 45 w / v%, or 0.5 to 35 w / v% based on the total volume of the health functional food finally produced, but is not limited thereto.
[0126] The effective intake amount of the health functional food of the present invention may be, for example, 10 μg / kg / day to 200 mg / kg / day, 50 μg / kg / day to 150 mg / kg / day, or 100 μg / kg / day to 100 mg / kg / day, but is not limited thereto and may vary depending on various factors such as the age, health condition, and complications of the subject.
[0127] In another aspect, the present invention relates to a feed composition for the prevention or improvement of an AhR-mediated disease or disorder, comprising a heterocyclic compound represented by Formula 1 or a feed-chemically acceptable salt thereof as an active ingredient.
[0128] The feed composition may be prepared in a liquid form in which the concentration of the heterocyclic compound represented by Chemical Formula 1 or its feed-grade salt is 10 to 90 w / v%, or in a powder or granule form in which the weight of the heterocyclic compound represented by Chemical Formula 1 or its feed-grade salt is 10 to 90 w / w%. The feed composition may further include additives. Examples of additives include organic acids such as citric acid, fumaric acid, adipic acid, lactic acid, and malic acid; phosphates such as sodium phosphate, potassium phosphate, acidic pyrophosphate, and polyphosphate (polymerized phosphate); and natural antioxidants such as polyphenols, catechins, alpha-tocopherol, rosemary extract, vitamin C, green tea extract, licorice extract, chitosan, tannic acid, and phytic acid; but are not limited thereto.
[0129] The feed composition may be formulated in the form of a conventional feed and may further include commonly used feed ingredients. The feed composition may further include grains, e.g., ground or crushed wheat, oats, barley, corn, rice, or mixtures thereof; plant proteins, e.g., proteins extracted from soybeans, sunflowers, etc.; animal proteins, e.g., blood meal, meat meal, bone meal, fish meal, or mixtures thereof; sugars; dairy products, etc., and may also further include nutritional supplements, digestion and absorption enhancers, growth promoters, etc. The above feed additive may be administered to animals alone or in combination with other feed additives in an edible carrier. Additionally, the above feed additive may be easily administered to animals as a top dressing, by mixing directly into animal feed, or as an oral formulation separate from the feed.
[0130] In another aspect, the present invention relates to a kit for use in preventing, improving, or treating an ArH-mediated disease or disorder, comprising a container containing a composition comprising a heterocyclic compound represented by Formula 1 or a pharmaceutically acceptable salt thereof, and instructions for use.
[0131] The container may be used without special restrictions as long as it is commonly used for medical purposes, but preferably it may be a bottle, ampoule, vial, or syringe (including pre-filled syringe) made of glass or plastic.
[0132] The container may contain a composition in solid form with an appropriate weight, for example, about 5 mg volume, about 10 mg volume, about 15 mg volume, about 17 mg volume, or about 20 mg.
[0133] The container may contain a composition in liquid form of an appropriate volume, for example, about 5 mL, about 10 mL, about 15 mL, about 17 mL, or about 20 mL.
[0134] The instruction manual may be a means of providing detailed descriptions of one or more of the dosage, route of administration, frequency of administration, and precautions of the heterocyclic compound represented by Chemical Formula 1 or its pharmaceutically acceptable salt, as well as information on the proper use and storage method of the kit.
[0135] In one embodiment, the instruction manual may be provided in a printed form using text, pictures, photographs, diagrams, illustrations, etc., or in an electronic (digitized) form using barcodes or holograms, etc.
[0136] Specific embodiments of the present invention are as follows:
[0137] Example 1. A heterocyclic compound represented by the following chemical formula 1 or a pharmaceutically acceptable salt thereof:
[0138] [Chemical Formula 1]
[0139]
[0140] In Chemical Formula 1,
[0141] A is oxygen (O) or sulfur (S);
[0142] Z1, Z2, Z3, and Z4 may be the same or different from each other and are each independently C-R1 or nitrogen (N), where R1 is hydrogen, deuterium, halogen (X), C1-C 10 Alkyl, hydroxy, C1-C 10 It is an alkoxy, -NH2, -CN, or -CX3, where the halogen (X) is fluorine (F), chloro (Cl), bromo (Br), or iodo (I);
[0143] B is oxygen (O) or sulfur (S);
[0144] W is a heterocyclic moiety in which a first ring (W1) and a second ring (W2) are fused, and at least one of rings W1 and W2 has aromaticity, and is represented by the following chemical formula 1A;
[0145] [Chemical Formula 1A]
[0146]
[0147] In chemical formula 1A,
[0148] n is 0 or 1 and;
[0149] m is 0 or 1, and;
[0150] Y1 is carbon (C), nitrogen (N), or oxygen (O); Y2 is carbon (C), provided that when n is 0, Y2 and Y6 combine to form a ring; Y3 is carbon (C), nitrogen (N), oxygen (O), or C-R2, where R2 is hydrogen, deuterium, halogen (X), or C1-C 10 Alkyl, hydroxy, C1-C 10It is an alkoxy, -NH2, -CN, or -CX3, where halogen (X) is fluorine (F), chloro (Cl), bromo (Br), or iodo (I); Y4 is carbon (C), oxygen (O), nitrogen (N), NH, or N-CH3; Y5 is carbon (C); Y6 is carbon (C) or nitrogen (N); Y7, Y8, Y9, and Y 10 is a carbon (C) that forms an aromatic ring or a non-aromatic ring together with Y5 and Y6;
[0151] ... refers to the connected location;
[0152] R is a substituent bonded to the second ring (W2) of W, such as hydrogen, deuterium, halogen (X), or C1-C 10 Alkyl, hydroxy, C1-C 10 It is an alkoxy, -NH2, -CN, or -CX3, where the halogen (X) is fluorine (F), chloro (Cl), bromo (Br), or iodo (I).
[0153] Example 2. The heterocyclic compound or a pharmaceutically acceptable salt thereof in which Ar represented by Formula 1A is selected from the group consisting of the following heterocyclic structures:
[0154]
[0155] Here, R2 is hydrogen, deuterium, halogen(X), C1-C 10 Alkyl, hydroxy, C1-C 10 It is an alkoxy, -NH2, -CN, or -CX3, where the halogen (X) is fluorine (F), chloro (Cl), bromo (Br), or iodo (I); means the location where it is connected.
[0156] Example 3. The heterocyclic compound or a pharmaceutically acceptable salt thereof, wherein the heterocyclic compound represented by Formula 1 is represented by any one of the following Formulas 1-1 to 1-3:
[0157] [Chemical Formula 1-1]
[0158]
[0161] [Chemical Formula 1-3]
[0162]
[0163] In the above chemical formulas 1-1 to 1-3, A; B; Z1, Z2, Z3, Z4; W1, W2; Y1, Y2, Y3, Y4, Y5, Y6, Y7, Y8, Y9, Y 10 ; The definition of and R is the same as in claim 1.
[0164] Example 4. The heterocyclic compound or a pharmaceutically acceptable salt thereof in which the heterocyclic compound represented by Formula 1 is selected from the group consisting of the following compounds:
[0166] 6-chloro-3-(indolezin-3-carbonyl)benzo[d]oxazole-2(3H)-one;
[0167] 6-chloro-3-(7-fluoroindolizine-3-carbonyl)benzo[d]oxazole-2(3H)-one;
[0168] 6-chloro-3-(imidazo[1,2-a]pyridin-3-carbonyl)benzo[d]oxazole-2(3H)-one;
[0169] 6-chloro-3-(6-fluoroimidazo[1,2-a]pyridin-3-carbonyl)benzo[d]oxazole-2(3H)-one;
[0170] 6-chloro-3-(7-fluoroimidazo[1,2-a]pyridin-3-carbonyl)benzo[d]oxazole-2(3H)-one;
[0171] 6-fluoro-3-(quinoxalin-2-carbonyl)benzo[d]oxazole-2(3H)-one;
[0172] 3-(3-chloroquinoxalin-2-carbonyl)-6-fluorobenzo[d]oxazole-2(3H)-one;
[0173] 6-chloro-3-(1H-indole-3-carbonyl)benzo[d]oxazole-2(3H)-one;
[0174] 6-chloro-3-(1H-indazole-3-carbonyl)benzo[d]oxazole-2(3H)-one;
[0175] 3-(3-chloroquinoxalin-2-carbonyl)-6-fluorobenzo[d]oxazole-2(3H)-one;
[0176] 3-(1-methyl-2-oxo-1,2-dihydroquinoline-3-carbonyl)benzo[d]oxazole-2(3H)-one;
[0177] 6-chloro-3-(1-methyl-2-oxo-1,2-dihydroquinoline-3-carbonyl)benzo[d]oxazole-2(3H)-one;
[0178] 6-chloro-3-(1,5-dimethyl-2-oxo-1,2,5,6,7,8-hexahydroquinoline-3-carbonyl)benzo[d]oxazole-2(3H)-one;
[0179] 3-(imidazo[1,2-a]pyridin-3-carbonyl)benzo[d]oxazole-2(3H)-one;
[0180] 6-hydroxy-3-(imidazo[1,2-a]pyridin-3-carbonyl)benzo[d]oxazole-2(3H)-one;
[0181] 3-(3-chloroquinoxalin-2-carbonyl)-6-fluorobenzo[d]oxazole-2(3H)-one;
[0182] 6-amino-3-(imidazo[1,2-a]pyridin-3-carbonyl)benzo[d]oxazole-2(3H)-one;
[0183] 3-(imidazo[1,2-a]pyridine-3-carbonyl)-2-oxo-2,3-dihydrobenzo[d]oxazole-6-carbonitrile;
[0184] 6-fluoro-3-(imidazo[1,2-a]pyridin-3-carbonyl)benzo[d]oxazole-2(3H)-one;
[0185] 6-chloro-3-(7-methylimidazo[1,2-a]pyridin-3-carbonyl)benzo[d]oxazole-2(3H)-one;
[0186] 6-chloro-3-(8-methoxyimidazo[1,2-a]pyridin-3-carbonyl)benzo[d]oxazole-2(3H)-one;
[0187] 3-(2-chloroquinoline-3-carbonyl)-6-fluorobenzo[d]oxazole-2(3H)-one;
[0188] 3-(3-chloroquinoxalin-2-carbonyl)-5-fluorobenzo[d]oxazole-2(3H)-one;
[0189] 6-chloro-3-(3-chloroquinoxalin-2-carbonyl)benzo[d]oxazole-2(3H)-one;
[0190] 1-(imidazo[1,2-a]pyridin-3-carbonyl)oxazolo[5,4-c]pyridin-2(1H)-one;
[0191] 6-chloro-3-(8-methylimidazo[1,2-a]pyridin-3-carbonyl)benzo[d]oxazole-2(3H)-one;
[0192] 6-chloro-3-(7-methoxyimidazo[1,2-a]pyridin-3-carbonyl)benzo[d]oxazole-2(3H)-one;
[0193] 3-(3-chloroquinoline-2-carbonyl)-6-fluorobenzo[d]oxazole-2(3H)-one;
[0194] 3-(3-chloroquinoxalin-2-carbonyl)-7-fluorobenzo[d]oxazole-2(3H)-one;
[0195] 6-fluoro-3-(3-methoxyquinoxalin-2-carbonyl)benzo[d]oxazole-2(3H)-one;
[0196] 6-chloro-3-(2-methylimidazo[1,2-a]pyridin-3-carbonyl)benzo[d]oxazole-2(3H)-one;
[0197] 3-(imidazo[1,2-a]pyridin-3-carbonyl)oxazolo[4,5-b]pyridin-2(3H)-one;
[0198] 3-(imidazo[1,2-a]pyridin-3-carbonyl)oxazolo[4,5-c]pyridin-2(3H)-one;
[0199] 6-chloro-3-(2-chloroimidazo[1,2-a]pyridin-3-carbonyl)benzo[d]oxazole-2(3H)-one;
[0200] 1-(imidazo[1,2-a]pyridin-3-carbonyl)oxazolo[5,4-b]pyridin-2(1H)-one;
[0201] 3-(6-chloro-2-oxo-2,3-dihydrobenzo[d]oxazole-3-carbonyl)imidazo[1,2-a]pyridine-7-carbonitrile;
[0202] 3-(3-chloroquinoxalin-2-carbonyl)-4-fluorobenzo[d]oxazole-2(3H)-one;
[0203] 6-fluoro-3-(3-hydroxyquinoxalin-2-carbonyl)benzo[d]oxazole-2(3H)-one;
[0204] 6-fluoro-3-(3-methylquinoxalin-2-carbonyl)benzo[d]oxazole-2(3H)-one;
[0205] 6-chloro-3-(8-hydroxyimidazo[1,2-a]pyridin-3-carbonyl)benzo[d]oxazole-2(3H)-one;
[0206] 6-chloro-3-(7-hydroxyimidazo[1,2-a]pyridin-3-carbonyl)benzo[d]oxazole-2(3H)-one;
[0207] 3-(7-aminoimidazo[1,2-a]pyridin-3-carbonyl)-6-chlorobenzo[d]oxazole-2(3H)-one;
[0208] 6-chloro-3-(2-hydroxyimidazo[1,2-a]pyridin-3-carbonyl)benzo[d]oxazole-2(3H)-one;
[0209] 6-fluoro-3-(3-fluoroquinoxalin-2-carbonyl)benzo[d]oxazole-2(3H)-one;
[0210] 6-chloro-3-(3-fluoroquinoxalin-2-carbonyl)benzo[d]oxazole-2(3H)-one;
[0211] 5-fluoro-3-(1H-indole-3-carbonyl)benzo[d]oxazole-2(3H)-one;
[0212] 6-chloro-3-(7-fluoro-1H-indole-3-carbonyl)benzo[d]oxazole-2(3H)-one;
[0213] 6-chloro-3-(6-fluoro-1H-indole-3-carbonyl)benzo[d]oxazole-2(3H)-one;
[0214] 6-chloro-3-(5-fluoro-1H-indole-3-carbonyl)benzo[d]oxazole-2(3H)-one;
[0215] 6-chloro-3-(4-fluoro-1H-indole-3-carbonyl)benzo[d]oxazole-2(3H)-one;
[0216] 3-(benzofuran-3-carbonyl)-6-chlorobenzo[d]oxazole-2(3H)-one;
[0217] 6-chloro-3-(2-chlorobenzofuran-3-carbonyl)benzo[d]oxazole-2(3H)-one;
[0218] 6-chloro-5-fluoro-3-(imidazo[1,2-a]pyridin-3-carbonyl)benzo[d]oxazole-2(3H)-one;
[0219] 5-chloro-6-fluoro-3-(imidazo[1,2-a]pyridin-3-carbonyl)benzo[d]oxazole-2(3H)-one;
[0220] 5-fluoro-3-(imidazo[1,2-a]pyridin-3-carbonyl)benzo[d]oxazole-2(3H)-one;
[0221] 3-(imidazo[1,2-a]pyridin-3-carbonyl)-6-(trifluoromethyl)benzo[d]oxazole-2(3H)-one;
[0222] 3-(imidazo[1,2-a]pyridin-3-carbonyl)-5-(trifluoromethyl)benzo[d]oxazole-2(3H)-one;
[0223] 6-chloro-3-(8-(trifluoromethyl)imidazo[1,2-a]pyridin-3-carbonyl)benzo[d]oxazole-2(3H)-one;
[0224] 3-(3-methylquinoxalin-2-carbonyl)benzo[d]oxazole-2(3H)-one;
[0225] 3-(3-chloroquinoxalin-2-carbonyl)-5,6-difluorobenzo[d]oxazole-2(3H)-one;
[0226] 6-chloro-3-(3-chloroquinoxalin-2-carbonyl)-5-fluorobenzo[d]oxazole-2(3H)-one;
[0227] 3-(3-chloro-5-methylquinoxalin-2-carbonyl)-5-fluorobenzo[d]oxazole-2(3H)-one; and
[0228] 3-(3-chloro-5-(trifluoromethyl)quinoxalin-2-carbonyl)-5-fluorobenzo[d]oxazole-2(3H)-one.
[0229] Example 5. The heterocyclic compound or a pharmaceutically acceptable salt thereof, wherein the heterocyclic compound represented by Chemical Formula 1 in Example 1 exhibits activity of binding to and activating an aryl hydrocarbon receptor (AhR).
[0230] Example 6. A pharmaceutical composition for use in preventing, improving, or treating an aryl hydrocarbon receptor (AhR)-mediated disease or disorder, comprising as an active ingredient a heterocyclic compound according to any one of Examples 1 to 5 or a pharmaceutically acceptable salt thereof.
[0231] Example 7. A pharmaceutical composition according to Example 6, wherein the AhR-mediated disease is one or more selected from the group consisting of autoimmune and inflammatory diseases, dermatological disorders, metabolic and cardiovascular diseases, cancer, and neurodegenerative diseases.
[0232] Embodiment 8. The pharmaceutical composition of Embodiment 7, wherein the autoimmune and inflammatory diseases include systemic lupus erythematosus, rheumatoid arthritis, multiple sclerosis, asthma, allergic reaction, or inflammatory bowel disease; the dermatological disorders include psoriasis, atopic dermatitis, acne, or hidradenitis suppurativa; the metabolic and cardiovascular diseases include metabolic syndrome, obesity, dyslipidemia, fatty liver, insulin resistance syndrome, diabetes mellitus, atherosclerosis, diabetic nephropathy, chronic kidney disease, or coronary artery disease; the cancers include breast cancer, prostate cancer, colorectal cancer, liver cancer, head and neck cancer, or pancreatic cancer; and the neurodegenerative diseases include brain inflammation, blood-brain barrier (BBB) damage, cognitive decline, Alzheimer's disease, or multiple sclerosis.
[0233] Embodiment 9. The pharmaceutical composition of Embodiment 7, wherein the pharmaceutical composition further comprises one or more selected from the group consisting of pharmaceutically acceptable carriers, adjuvants, and vehicles.
[0234] Example 10. A health functional food composition for use in preventing or improving aryl hydrocarbon receptor (AhR)-mediated diseases or disorders, comprising as an active ingredient a heterocyclic compound according to any one of Examples 1 to 5 or a food-grade salt thereof.
[0235] Example 11. A feed composition for use in preventing or improving aryl hydrocarbon receptor (AhR)-mediated diseases or disorders, comprising as an active ingredient a heterocyclic compound according to any one of Examples 1 to 5 or a feed-grade salt thereof.
[0236] Example 12. A kit for use in preventing, improving, or treating an aryl hydrocarbon receptor (AhR)-mediated disease or disorder, comprising: a container containing a composition having, as an active ingredient, a heterocyclic compound according to any one of Examples 1 to 5 or a pharmaceutically acceptable salt thereof; and instructions for use.
[0237] Example 13. A method for preventing, improving, or treating an aryl hydrocarbon receptor (AhR)-mediated disease or disorder in a subject, comprising the step of administering to the subject an effective amount of a composition comprising, as an active ingredient, a heterocyclic compound according to any one of Examples 1 to 5 or a pharmaceutically acceptable salt thereof.
[0238] Example 14. A method for preventing, improving, or treating an aryl hydrocarbon receptor (AhR)-mediated disease or disorder in a subject, comprising the step of administering to the subject an effective amount of a composition comprising, as an active ingredient, a heterocyclic compound according to any one of Examples 1 to 5 or a pharmaceutically acceptable salt thereof.
[0239] The terms used in this specification are intended solely for the purpose of describing specific embodiments and are not intended to limit the invention. Terms in which a number is omitted before a noun are not intended to limit the quantity, but rather to indicate that there is one or more objects referred to by the mentioned noun. The terms "comprising," "having," and "containing" are interpreted as open terms.
[0240] In this specification, numeric ranges are merely a convenient alternative to individually referring to each number within the range, and unless otherwise specified, each number should be considered as if it were individually referred to. The end values of all numeric ranges are included within the range and can be combined independently.
[0241] In this specification, the term "approximately" used to describe length, area, volume, time (period), concentration, content, etc., means that there is a tolerance of up to ±20%, and generally ±10%, for the corresponding numerical value or numerical range.
[0242] All methods mentioned herein may be performed in an appropriate order unless otherwise specified or clearly contradictory by the context. The use of any one or all embodiments or exemplary language (e.g., “like”) is merely to better describe the invention, unless otherwise included in the claims, and is not intended to limit the scope of the invention. No language in the specification shall be interpreted as implying that any unclaimed component is essential to the practice of the invention. Unless otherwise defined, technical and scientific terms used herein have the same meaning as generally understood by a person of ordinary skill in the art to which the invention pertains (i.e., a person skilled in the art).
[0243] The preferred embodiment(s) of the present invention include the most optimal mode known to the inventor for carrying out the present invention. Modifications or variations of the preferred embodiment(s) may become apparent to a person skilled in the art upon reading the preceding description. The inventors expect that a person skilled in the art will make appropriate use of such modifications or variations, and the inventors expect the present invention to be practiced in a manner different from that described herein. Accordingly, the present invention includes all modifications and / or variations, including equivalents of the essence of the invention mentioned in the appended claims, as permitted by patent law. Furthermore, any combination of the aforementioned components within all possible modifications and / or variations is included within the scope of the present invention unless otherwise specified herein or clearly contradictory in the context. Although the present invention has been specifically shown and described with reference to exemplary embodiment(s), a person skilled in the art will understand that various changes in form and detail may be made without departing from the spirit and scope of the invention as defined by the following claims.
[0244] Hereinafter, the present invention will be described in detail based on examples and experimental examples to specifically explain the invention. However, the following examples and experimental examples are provided merely to facilitate a better understanding of the invention, and the content of the invention is not limited by the following examples and experimental examples.
[0245] Examples and Experimental Examples
[0246] The present invention can be better understood through the following examples and experimental examples, which are intended to illustrate rather than limit the scope of the invention.
[0247] Common abbreviations well known to those skilled in the art of synthetic technology have been used in this specification.
[0248] All chemical reagents used were commercially available. 1¹H NMR spectra (δ, ppm) were recorded on Bruker 300 MHz to 600 MHz instruments. LCMS was performed using a quadrupole mass spectrometer (operating in ES (+) or (-) ionization mode) with an Agilent MS Spectrometer (e.g., 1260 HPLC and 6120 MSD). T = 30 ℃; flow rate = 1.5 mL / min; detection wavelength: 220 / 254 nm.
[0262] [Example 2] 6-chloro-3-(indolezin-3-carbonyl)benzo[d]oxazole-2(3H)-one
[0263]
[0264] DMAP (37 mg, 0.3 mmol) and 6-chlorobenzo[d]oxazole-2(3H)-one (50 mg, 0.3 mmol) were added to a solution of indolezine-3-carboxylic acid (50 mg, 0.3 mmol) dissolved in DCM (5 mL), and then DIC (76 mg, 0.6 mmol) was added. The reaction mixture was stirred at room temperature for 1 hour. The solid was filtered and washed with DCM (5 mL) to obtain Example 2 (7.3 mg).
[0265] LC / MS: 313.0 [M+H] + .
[0266] 1 H NMR (400 MHz, DMSO) ?9.49 (d, J = 6.5 Hz, 1H), 7.90 - 7.82 (m, 2H), 7.69 (d, J = 2.0 Hz, 1H), 7.48 - 7.43 (m, 2H), 7.33 (dd, J = 8.5, 2.0 Hz, 1H), 7.25 - 7.20 (m, 1H), 6.74 (d, J = 4.9 Hz, 1H).
[0267] [Example 3] 6-chloro-3-(7-fluoroindolizine-3-carbonyl)benzo[d]oxazole-2(3H)-one
[0268] Summary of the synthesis scheme for Example 3:
[0269]
[0270] Intermediate 1: 4-fluoro-2-vinylpyridine
[0271] Pd(PPh3)4 (1.7 g, 1.52 mmol), 4,4,5,5-tetramethyl-2-vinyl-1,3,2-dioxaborolane (2.4 g, 15.2 mmol), Na2CO3 (4.8 g, 45.8 mmol), and H2O (10 mL) were added to a solution of 2-chloro-4-fluoropyridine (2 g, 15.2 mmol) dissolved in dioxane (40 mL). The reaction mixture was stirred at 100°C for 12 hours under an N2 atmosphere. The mixture was diluted with EA (100 mL), washed with H2O (20 mL) and brine (20 mL), dried with Na2SO4, and vacuum concentrated. The resulting concentrate was purified by flash silica column chromatography (EA in PE, 0 to 40%) to obtain intermediate 1 (1.2 g, yield 64.1%). LC / MS: 124.2 [M+H] + .
[0272] Intermediate 2: 7-fluoroindolizine-3-carboxylate
[0273] 4-fluoro-2-vinylpyridine (200 mg, 1.62 mmol), 3-ethoxy-3-oxopropanoic acid (429 mg, 3.24 mmol), NIS (1.28 g, 5.68 mmol), NaOAc (400 mg, 4.87 mmol), and ACN (5 mL) were added to a sealed tube (20 mL). The reaction mixture was stirred at 100°C under N2 for 12 hours. The mixture was diluted with EA (100 mL), washed with H2O (20 mL) and brine (20 mL), dried with Na2SO4, and concentrated under vacuum. The resulting concentrate was purified by flash silica column chromatography (EA in PE, 0 to 40%) to obtain intermediate 2 (50 mg, 14.9% yield). LC / MS: 208.1 [M+H] + .
[0274] Intermediate 3: 7-fluoroindolizine-3-carboxylic acid
[0275] LiOH (55 mg, 1.2 mmol, dissolved in 2 mL of water) was added to a solution of ethyl 7-fluoroindollizine-3-carboxylate (50 mg, 0.25 mmol) dissolved in MeOH (2 mL) and THF (2 mL). The reaction mixture was stirred at room temperature for 2 hours. The organic solvent was removed under vacuum, acidified with HCl until pH=1, and filtered to obtain intermediate 3 (30 mg, yield 67%). LC / MS: 180.1 [M+H] + .
[0276] Example 3: 6-chloro-3-(7-fluoroindolizine-3-carbonyl)benzo[d]oxazole-2(3H)-one
[0277] DMAP (20 mg, 0.16 mmol) and 6-chlorobenzo[d]oxazole-2(3H)-one (28 mg, 0.16 mmol) were added to a solution of 7-fluoroindolizine-3-carboxylic acid (30 mg, 0.16 mmol) dissolved in DCM (5 mL), and then DIC (43 mg, 0.32 mmol) was added. The reaction mixture was stirred at room temperature for 1 hour. The obtained solid was filtered and washed with DCM (5 mL) to obtain Example 3 (22 mg).
[0278] LC / MS: 331.0 [M+H] + .
[0279] 1 H NMR (400 MHz, DMSO) δ9.53 - 9.48 (m, 1H), 7.92 (d, J = 4.8 Hz, 1H), 7.77 - 7.67 (m, 2H), 7.46 (d, J = 8.5 Hz, 1H), 7.33 (dd, J = 8.5, 1.9 Hz, 1H), 7.25 (td, J = 7.5, 2.7 Hz, 1H), 6.70 (d, J = 4.8 Hz, 1H).
[0280] [Example 4] 6-chloro-3-(imidazo[1,2-a]pyridin-3-carbonyl)benzo[d]oxazole-2(3H)-one
[0281] Summary of the synthesis scheme for Example 4:
[0282]
[0283] Intermediate 1: Imidazoo[1,2-a]pyridine-3-carbonyl chloride
[0284] DMF (0.3 mL) and oxalyl chloride (3 mL) were added dropwise at 0°C to a solution of imidazo[1,2-a]pyridine-3-carboxylic acid (200 mg, 1.23 mmol) dissolved in DCM (5 mL). The reaction mixture was stirred at room temperature for 2 hours. The resulting mixture was vacuum concentrated to obtain Intermediate 1 (200 mg, purity 80%, yield 71.8%) in the form of a black oil. LC / MS: 177.0 [M+H] + (MeOH treatment).
[0285] Example 4: 6-chloro-3-(imidazo[1,2-a]pyridin-3-carbonyl)benzo[d]oxazole-2(3H)-one
[0286] Et3N (1.5 mL) was added dropwise to a solution of imidazo[1,2-a]pyridine-3-carbonyl chloride (200 mg, 80% purity, 0.88 mmol) dissolved in benzene (5 mL). Then, 6-chlorobenzo[d]oxazole-2(3H)-one (150 mg, 0.88 mmol) was added. The reaction mixture was stirred at 80°C for 16 hours. The resulting solution was vacuum concentrated to obtain a crude product. The crude product was treated with MeOH (30 mL) and filtered to obtain Example 4 (57.7 mg).
[0287] LC / MS: 314.0 [M+H] +
[0288] 1 H NMR (400 MHz, DMSO) δ 9.31 (d, J = 6.4 Hz, 1H), 8.74 (s, 1H), 7.94 (d, J = 8.8 Hz, 1H), 7.81 - 7.70 (m, 2H), 7.65 (d, J = 8.4 Hz, 1H), 7.43 - 7.36 (m, 2H).
[0289] [Example 5] 6-chloro-3-(6-fluoroimidazo[1,2-a]pyridin-3-carbonyl)benzo[d]oxazole-2(3H)-one
[0290] Summary of the synthesis scheme of Example 5:
[0291]
[0292] Example 5: 6-chloro-3-(6-fluoroimidazo[1,2-a]pyridin-3-carbonyl)benzo[d]oxazole-2(3H)-one
[0293] 6-chlorobenzo[d]oxazole-2(3H)-one (149 mg, 0.88 mmol) and DMAP (5 mg, 0.044 mmol) were added to a solution of 6-fluoroimidazo[1,2-a]pyridine-3-carboxylic acid (80 mg, 0.44 mmol) dissolved in DCM (5 mL). After stirring the mixture at room temperature for 10 minutes, DIC (83 mg, 0.66 mmol) was added dropwise. The reaction mixture was stirred at room temperature for 2 hours. The resulting mixture was vacuum concentrated to obtain a crude product. The crude product was treated with MeOH (10 mL) and filtered to obtain Example 5 (23.3 mg).
[0294] LC / MS: 332.0 [M+H] + .
[0295] 1 H NMR (400 MHz, DMSO) ?9.27 (ddd, J = 4.4, 2.4, 0.8 Hz, 1H), 8.72 (s, 1H), 8.01 - 7.96 (m, 1H), 7.83 (ddd, J = 10.0, 8.0, 2.4 Hz, 1H), 7.71 (d, J = 2.0 Hz, 1H), 7.63 (d, J = 8.4 Hz, 1H), 7.35 (dd, J = 8.4, 2.0 Hz, 1H).
[0296] [Example 6] 6-chloro-3-(7-fluoroimidazo[1,2-a]pyridin-3-carbonyl)benzo[d]oxazole-2(3H)-one
[0297] Summary of the synthesis scheme of Example 6:
[0298]
[0299] Example 6: 6-chloro-3-(7-fluoroimidazo[1,2-a]pyridin-3-carbonyl)benzo[d]oxazole-2(3H)-one
[0300] 6-chlorobenzo[d]oxazole-2(3H)-one (117 mg, 0.7 mmol) was added to a solution of 7-fluoroimidazo[1,2-a]pyridine-3-carboxylic acid (100 mg, 0.55 mmol), DIC (97 mg, 0.6 mmol), and DMAP (61 mg, 0.5 mmol) dissolved in DCM (10 mL). The reaction mixture was stirred at 25°C for 4 hours. The resulting mixture was filtered, washed with MeOH (5 mL * 3), and freeze-dried to obtain Example 6 (17 mg) as a white solid.
[0301] LC / MS: 332.1 [M+H] + .
[0302] 1 H NMR (400 MHz, DMSO) δ 9.32 (dd, J = 7.6, 5.8 Hz, 1H), 8.74 (s, 1H), 7.91 - 7.87 (m, 1H), 7.74 (d, J = 2.1 Hz, 1H), 7.65 (d, J = 8.5 Hz, 1H), 7.44 (td, J = 7.6, 2.7 Hz, 1H), 7.38 (dd, J = 8.5, 2.1 Hz, 1H).
[0303] [Example 7] 6-fluoro-3-(quinoxalin-2-carbonyl)benzo[d]oxazole-2(3H)-one
[0304] Summary of the synthesis scheme for Example 7:
[0305]
[0306] Intermediate 1: Quinoxalin-2-carbonyl chloride
[0307] DMF (0.5 mL) was added dropwise to a solution of quinoxalin-2-carboxylic acid (500 mg, 2.87 mmol) dissolved in SOCl2 (5 mL). The reaction mixture was stirred at 80°C for 16 hours. The resulting mixture was vacuum concentrated to obtain Intermediate 1 (400 mg, purity 90%, yield 65.1%) in the form of a brown oil. LC / MS: 189.2 [M+H]+(treated with MeOH).
[0308] Example 7: 6-fluoro-3-(quinoxalin-2-carbonyl)benzo[d]oxazole-2(3H)-one
[0309] TEA (1 ml) was added dropwise to a solution of quinoxalin-2-carbonyl chloride (70 mg, 90% purity, 0.36 mmol) dissolved in benzene (3 mL). Subsequently, 6-fluorobenzo[d]oxazole-2(3H)-one (55.6 mg, 0.36 mmol) was added. The reaction mixture was stirred at 80°C for 12 hours. The resulting solution was vacuum concentrated to obtain a crude product. The crude product was purified by PREP-HPLC (H2O / ACN = 40–45%) to obtain Example 7 (6 mg).
[0310] LC / MS: 310.1 [M+H] + .
[0311] 1 H NMR (400 MHz, DMSO) δ 9.40 (s, 1H), 8.27 - 8.19 (m, 2H), 8.07 - 7.98 (m, 3H), 7.64 (dd, J = 8.3, 2.6 Hz, 1H), 7.28 (ddd, J = 9.9, 8.9, 2.6 Hz, 1H).
[0312] [Example 8] 3-(3-chloroquinoxalin-2-carbonyl)-6-fluorobenzo[d]oxazole-2(3H)-one
[0313] Summary of the synthesis scheme for Example 8:
[0314]
[0315] Intermediate 1: 3-chloroquinoxalin-2-carbonyl chloride
[0316] DMF (0.3 mL) was added dropwise to a solution of 3-hydroxyquinoxalin-2-carboxylic acid (200 mg, 1.05 mmol) dissolved in SOCl2 (5 mL). The reaction mixture was stirred at 80°C for 1 hour. The resulting mixture was vacuum concentrated to obtain Intermediate 1 (200 mg, purity 80%, yield 67.6%) in the form of a black oil. LC / MS: 209.1 [M+H] + (MeOH treatment).
[0317] Example 8: 3-(3-chloroquinoxalin-2-carbonyl)-6-fluorobenzo[d]oxazole-2(3H)-one
[0318] TEA (1.5 mL) was added dropwise to a solution of 3-chloroquinoxaline-2-carbonyl chloride (200 mg, 80% purity, 0.49 mmol) dissolved in benzene (5 mL). Subsequently, 6-fluorobenzo[d]oxazole-2(3H)-one (50 mg, 0.33 mmol) was added. The reaction mixture was stirred at 80°C for 16 hours. The resulting solution was vacuum concentrated to obtain the crude compound. The crude product was purified by PREP-HPLC (H2O / ACN = 40–45%) to obtain Example 8 (11 mg).
[0319] LC / MS: 344.0 [M+H] + .
[0320] 1 H NMR (400 MHz, DMSO) δ 8.23 (t, J = 9.1 Hz, 2H), 8.13 - 8.02 (m, 3H), 7.65 (dd, J = 8.3, 2.5 Hz, 1H), 7.34 - 7.27 (m, 1H).
[0321] [Example 9] 6-chloro-3-(1H-indole-3-carbonyl)benzo[d]oxazole-2(3H)-one
[0322] Summary of the synthesis scheme of Example 9:
[0323]
[0324] Intermediate 1: 1H-indole-3-carbonyl chloride
[0325] Oxalyl chloride (0.1 g, 0.79 mmol) and 1 drop of DMF were added to a solution of 1H-indole-3-carboxylic acid (0.1 g, 0.62 mmol) dissolved in DCM (10 mL). The mixture was stirred at room temperature for 30 minutes and concentrated to obtain intermediate 1 (0.1 g) in the form of a yellow solid. The crude product was used in the next step without further purification.
[0326] Example 9: 6-chloro-3-(1H-indole-3-carbonyl)benzo[d]oxazole-2(3H)-one
[0327] Pyridine (2 mL) was added to a mixture of 1H-indole-3-carbonyl chloride (0.1 g) and 6-chlorobenzo[d]oxazole-2(3H)-one (95 mg, 0.56 mmol). The mixture was stirred at room temperature for 2 hours. The resulting mixture was purified by PREP-HPLC (A: water (10 mM TFA), B: ACN) to obtain Example 9 (20 mg) as a white solid.
[0328] LC / MS: 335.0 [M+Na] + .
[0329] 1 ¹H NMR (400 MHz, DMSO- d 6 ) δ (ppm) 12.38 (s, 1H), 8.53 (s, 1H), 8.08-8.06 (m, 1H), 7.70 (d, J =4.0 Hz, 1H), 7.58-7.55 (m, 2H), 7.35-7.28 (m, 3H).
[0330] [Example 10] 6-chloro-3-(1H-indazole-3-carbonyl)benzo[d]oxazole-2(3H)-one
[0331]
[0332] Example 10 (5.7 mg) was obtained in the same manner as Example 9 using 1H-indazole-3-carboxylic acid and the PREP-HPLC separation method.
[0333] LC / MS: 314.1 [M+H] + .
[0334] 1 ¹H NMR (400 MHz, DMSO- d 6 ) δ (ppm) 14.24 (s, 1H), 8.03 (d, J = 4.0 Hz 1H), 7.77-7.72 (m, 2H), 7.64 (d, J = 8.0 Hz, 1H), 7.53 (t, J = 2.0 Hz, 1H), 7.39 (t, J = 8.0 Hz, 2H).
[0335] [Example 11] 3-(3-chloroquinoxalin-2-carbonyl)-6-fluorobenzo[d]oxazole-2(3H)-one
[0336]
[0337] Example 11 (23.6 mg) was obtained in the same manner as Example 9 using 1-methyl-1H-indazole-3-carboxylic acid and the PREP-HPLC separation method.
[0338] LC / MS: 328.1 [M+H] + .
[0339] 1 ¹H NMR (400 MHz, DMSO- d 6 ) δ (ppm) 8.03 (d, J = 8.0 Hz, 1H), 7.88 (d, J = 8.0 Hz 1H), 7.72 (d, J = 4.0 Hz, 1H), 7.64 (d, J = 8.0 Hz, 1H), 7.58 (t, J = 8.0 Hz, 1H), 7.43 (t, J = 8.0 Hz, 1H), 7.41-7.36 (m, 1H).
[0340] [Example 12] 3-(1-methyl-2-oxo-1,2-dihydroquinoline-3-carbonyl)benzo[d]oxazole-2(3H)-one
[0341]
[0342] Example 12 (18.9 mg) was obtained in the same manner as Example 9 using 1-methyl-2-oxo-1,2-dihydroquinoline-3-carboxylic acid, benzo[d]oxazole-2(3H)-one, and PREP-HPLC separation method.
[0343] LC / MS: 321.1 [M+H] + .
[0344] 1 ¹H NMR (400 MHz, DMSO- d 6) δ (ppm) 8.35 (s, 1H), 8.02-7.39 (m, 1H), 7.92-7.90 (m, 1H), 7.78-7.76 (m, 1H), 7.66-7.63 (m, 1H), 7.50-7.49 (m, 1H), 7.40 - 7.37 (m, 3H).
[0345] [Example 13] 6-chloro-3-(1-methyl-2-oxo-1,2-dihydroquinoline-3-carbonyl)benzo[d]oxazole-2(3H)-one
[0346]
[0347] Example 13 (23.6 mg) was obtained in the same manner as Example 9 using 1-methyl-2-oxo-1,2-dihydroquinoline-3-carboxylic acid and the PREP-HPLC separation method.
[0348] LC / MS: 355.1 [M+H] + .
[0349] 1 ¹H NMR (400 MHz, DMSO- d 6 ) δ (ppm) 8.36 (s, 1H), 7.99 (d, J = 8.0 Hz, 1H), 7.93 (d, J = 8.0 Hz, 1H), 7.81-7.77 (m, 2H), 7.76 (m, 1H), 7.47(m, 1H), 7.39 (m, 1H),3.66(s, 3H).
[0350] [Example 14] 6-chloro-3-(1,5-dimethyl-2-oxo-1,2,5,6,7,8-hexahydroquinoline-3-carbonyl)benzo[d]oxazole-2(3H)-one
[0351]
[0352] Example 14 (5.1 mg) was obtained in the same manner as Example 9 using 1,5-dimethyl-2-oxo-1,2,5,6,7,8-hexahydroquinoline-3-carboxylic acid and the PREP-HPLC separation method.
[0353] LC / MS: 373.3 [M+H] + .
[0354] 1 ¹H NMR (400 MHz, DMSO- d 6) δ (ppm) 7.84-7.79 (m, 2H), 7.71 (m, 1H), 7.41-7.39 (m, 1H), 3.43 (s, 3H), 2.77 (m, 3H), 1.85-1.76 (m, 3H), 1.48-1.45 (m, 1H),1.19-1.48(d, J = 4.0 Hz, 1H).
[0355] [Example 15] 3-(imidazo[1,2-a]pyridin-3-carbonyl)benzo[d]oxazole-2(3H)-on
[0356]
[0357] Example 15 (40 mg) was obtained in the same manner as Example 4 using the separation method of benzo[d]oxazole-2(3H)-one and PREP-HPLC.
[0358] LC / MS: 279.9 [M+H] + .
[0359] 1 HNMR (DMSO- d 6, 400 MHz): δ 9.33 (d, J = 6.8 Hz, 1H), 8.75 (s, 1H), 7.94 (d, J = 8.8 Hz, 1H), 7.80-7.73 (m, 1H), 7.68-7.64 (m, 1H), 7.50-7.48 (m, 1H), 7.42-7.38 (m, 1H), 7.33-7.30 (m, 2H).
[0360] [Example 16] 6-hydroxy-3-(imidazo[1,2-a]pyridine-3-carbonyl)benzo[d]oxazole-2(3H)-one
[0361] Summary of the synthesis scheme of Example 16:
[0362]
[0363] Intermediate 1: 6-((tert-butyldimethylsilyl)oxy)benzo[d]oxazole-2(3H)-one
[0364] Tert-butyl(chloro)dimethylsilane (549 mg, 3.64 mmol) and imidazole (270 mg, 3.97 mmol) were added to a stirred solution of 6-hydroxy-3H-1,3-benzoxazole-2-one (500 mg, 3.31 mmol) dissolved in DMF (10 mL). The reaction mixture was stirred at 25°C for 16 hours. The reaction mixture was poured into ice / water (10 mL) and extracted with EA (10 mL x 3). The organic layer was collected, washed with water (10 mL) and brine (10 mL x 3), dried with Na2SO4, and vacuum concentrated to obtain the crude product (oil). The crude product was purified by PREP-TLC (PE / EA=3 / 1) to obtain Intermediate 1 (510 mg, 58.08%) as a grayish-white solid.
[0365] LC / MS: 266.1 [M+H] + .
[0366] 1 H NMR (400 MHz, CDCl3) δ 8.73 (s, 1H), 6.90 (d, J = 8.4 Hz, 1H), 6.75 (d, J = 2.0 Hz, 1H), 6.66 - 6.63 (m, 1H), 0.98 (s, 9H), 0.19 (s, 6H).
[0367] Intermediate 2: Imidazoo[1,2-a]pyridine-3-carbonyl chloride
[0368] Thionyl chloride (20 mL) was added to a stirred solution of imidazo[1,2-a]pyridine-3-carboxylic acid (1.0 g, 6.20 mmol) dissolved in DCM (50 mL). The reaction mixture was stirred at 25°C for 16 hours. The resulting mixture was vacuum concentrated to obtain intermediate 2 (1.0 g, yield 88.71%) as a white solid.
[0369] Intermediate 3: 6-((tert-butyldimethylsilyl)oxy)-3-(imidazo[1,2-a]pyridine-3-carbonyl)benzo[d]oxazole-2(3H)-one
[0370] TEA (114 mg, 1.13 mmol) and imidazo[1,2-a]pyridine-3-carbonyl chloride (75 mg, 0.41 mmol) were added to a stirred solution of 6-[(tert-butyldimethylsilyl)oxy]-3H-1,3-benzoxazole-2-one (100 mg, 0.38 mmol) dissolved in THF (5 mL). The reaction mixture was stirred at 25 °C for 2 hours. The resulting mixture was concentrated, poured into ice / water (10 mL), and extracted with DCM (10 mL x 3). The organic layer was collected, washed with water (10 mL) and brine (10 mL x 3), dried with Na2SO4, and vacuum concentrated to obtain the crude product (oil). The crude product was purified by PREP-TLC (PE / EA=1 / 1) to obtain intermediate 3 as a grayish-white solid.
[0371] LC / MS: 410.1 [M+H] + .
[0372] 1 H NMR (400 MHz, CDCl3) δ 9.43 (d, J = 6.8 Hz, 1H), 8.63 (s, 1H), 7.85 (d, J = 8.8 Hz, 1H), 7.61 - 7.56 (m, 2H), 7.22 - 7.17 (m, 1H), 6.80 (d, J = 2.0 Hz, 1H), 6.76 - 6.73 (m, 1H), 1.00 (s, 9H), 0.22 (s, 6H).
[0373] Example 16: 6-hydroxy-3-(imidazo[1,2-a]pyridine-3-carbonyl)benzo[d]oxazole-2(3H)-one
[0374] Tetrabutylammonium fluoride (0.2 mL, 0.22 mmol) was added to a stirred solution in which 6-((tert-butyldimethylsilyl)oxy)-3-(imidazo[1,2-a]pyridine-3-carbonyl)benzo[d]oxazole-2(3H)-one (60 mg, 0.15 mmol) was dissolved in THF (1 mL). The reaction mixture was stirred at 25°C for 2 hours. The reaction mixture was concentrated, poured into ice / water (10 mL), and extracted with DCM (10 mL x 5). The combined organic layer was washed with brine (10 mL x 3), dried with Na2SO4, and vacuum concentrated to obtain the crude product (oil). The crude product was purified by PREP-HPLC (ACN / H2O, 0.5% NH4CO3) to obtain Example 16 (6.7 mg) as a white solid.
[0375] LC / MS: 296.1 [M+H] + .
[0376] 1 H NMR (400 MHz, DMSO-d6) δ 11.77 (s, 1H), 9.22 (d, J = 6.8 Hz, 1H), 8.58 (s, 1H), 7.90 (d, J = 8.8 Hz, 1H), 7.69 - 7.63 (m, 1H), 7.42 (d, J = 2.0 Hz, 1H), 7.34 - 7.29 (m, 1H), 7.20 - 7.09 (m, 2H).
[0377] [Example 17] 3-(3-chloroquinoxalin-2-carbonyl)-6-fluorobenzo[d]oxazole-2(3H)-one
[0378]
[0379] Example 17 (11 mg) was obtained in the same manner as Example 4 using the separation method of 6-methoxybenzo[d]oxazole-2(3H)-one and PREP-HPLC.
[0380] LC / MS: 310.0 [M+H] + .
[0381] 1 HNMR (DMSO- d 6, 400 MHz): δ 9.29 (d, J= 6.8 Hz, 1H), 7.92 (d, J = 8.8 Hz, 1H), 7.80-7.66 (m, 1H), 7.59 (d, J = 8.8 Hz, 1H), 7.37 (t, J = 6.8 Hz, 1H), 7.19 (d, J = 2.4 Hz, 1H), 6.88 (dd, J = 8.8, 2.4 Hz, 1H), 3.32 (s, 3H).
[0382] [Example 18] 3-(3-chloroquinoxalin-2-carbonyl)-6-fluorobenzo[d]oxazole-2(3H)-one
[0383] Summary of the synthesis scheme of Example 18:
[0384]
[0385] Intermediate 1: 3-(imidazo[1,2-a]pyridine-3-carbonyl)-6-nitrobenzo[d]oxazole-2(3H)-on
[0386] Imidazō[1,2-a]pyridin-3-carbonyl chloride (551 mg, 3.05 mmol) and TEA (841 mg, 8.32 mmol) were added to a stirred solution of 6-nitro-3H-1,3-benzoxazole-2-one (500 mg, 2.78 mmol) in THF (5 mL). The reaction mixture was stirred at 25°C for 16 hours. The mixture was poured into water (10 mL), stirred for 0.5 hours, and then filtered. The resulting filter cake was washed with water and dried to obtain intermediate 1 (680 mg, 75.55% yield) as a white solid.
[0387] LC / MS: 325.0 [M+H] + .
[0388] Example 18: 6-amino-3-(imidazo[1,2-a]pyridine-3-carbonyl)benzo[d]oxazole-2(3H)-one
[0389] B2(OH)4 (83 mg, 0.93 mmol) and 4,4-bipyridine (8 mg, 0.15 mmol) were added to a stirred solution of 3-({imidazo[1,2-a]pyridine-3-yl}carbonyl)-6-nitro-1,3-benzoxazole-2-one (100 mg, 0.31 mmol) dissolved in DMF (2 mL). The reaction mixture was stirred at 25°C for 5 minutes. The resulting mixture was poured into water (5 mL) and filtered. The resulting filter cake was washed with water and dried to obtain the crude product. The crude product was purified by PREP-TLC (DCM / MeOH=20 / 1) to obtain Example 18 (5.17 mg) as a yellow solid.
[0390] LC / MS: 295.0 [M+H] + .
[0391] 1 H NMR (400 MHz, DMSO-d6): δ 9.27 (d, J = 6.8 Hz, 1H), 8.66 (s, 1H), 7.90 (d, J = 8.8 Hz, 1H), 7.73 - 7.68 (m, 1H), 7.38 - 7.33 (m, 2H), 6.61 (d, J = 2.0 Hz, 1H), 6.49 - 6.46 (m, 1H), 5.36 (s, 2H).
[0392] [Example 19] 3-(imidazo[1,2-a]pyridine-3-carbonyl)-2-oxo-2,3-dihydrobenzo[d]oxazole-6-carbonitrile
[0393] Summary of the synthesis scheme of Example 19:
[0394]
[0395] Intermediate 1: 2-oxo-2,3-dihydrobenzo[d]oxazole-6-carbonitrile
[0396] CuCN (0.72 g, 7.99 mmol) was added to a stirred solution of 6-bromo-3H-1,3-benzoxazole-2-one (1.0 g, 4.70 mmol) dissolved in DMF (10 mL). The reaction mixture was stirred at 150°C for 16 hours. The resulting mixture was poured into ice / water (10 mL) and extracted with EA (10 mL x 3). The organic layer was collected, washed with water (10 mL) and brine (10 mL x 3), dried with Na2SO4, and vacuum concentrated to obtain the residue. The residue (solid) was placed in PE / DCM=10 / 1 (33 mL) and stirred for 30 minutes. The resulting mixture was filtered, and the filter cake was dried to obtain Intermediate 1 (0.16 g, 21.28%) as a gray solid.
[0397] LC / MS: 161.1 [M+H] + .
[0398] 1 H NMR (400 MHz, DMSO-d6) δ 12.14 (s, 1H), 7.86 (s, 1H), 7.62 (s, 1H), 7.25 (s, 1H).
[0399] Example 19: 3-(imidazo[1,2-a]pyridine-3-carbonyl)-2-oxo-2,3-dihydrobenzo[d]oxazole-6-carbonitrile
[0400] TEA (246 mg, 2.44 mmol) and imidazo[1,2-a]pyridine-3-carbonyl chloride (161 mg, 0.89 mmol) were added to a stirred solution of 2-oxo-3H-1,3-benzoxazole-6-carbonitrile (130 mg, 0.81 mmol) dissolved in THF (5 mL). The reaction mixture was stirred at 25°C for 2 hours. The reaction mixture was concentrated, poured into ice / water (10 mL), and extracted with DCM (10 mL x 5). The organic layer was collected, washed with brine (10 mL x 3), dried with Na2SO4, and vacuum concentrated to obtain the residue. The residue (solid) was dissolved in ACN (20 mL) and stirred for 30 minutes. The resulting mixture was filtered, and the filter cake was dried to obtain Example 19 (5.17 mg) as a white solid.
[0401] LC / MS: 305.1 [M+H] + .
[0402] 1 H NMR (400 MHz, DMSO-d6) δ 9.33 (d, J = 6.8 Hz, 1H), 8.78 (s, 1H), 8.13 (d, J = 0.8 Hz, 1H), 7.96 (d, J = 8.8 Hz, 1H), 7.83 - 7.74 (m, 3H), 7.43 (t, J = 7.2 Hz, 1H).
[0403] [Example 20] 6-fluoro-3-(imidazo[1,2-a]pyridine-3-carbonyl)benzo[d]oxazole-2(3H)-one
[0404]
[0405] Example 20 (94 mg) was obtained in the same manner as Example 4 using the separation method of 6-fluorobenzo[d]oxazole-2(3H)-one and PREP-HPLC.
[0406] LC / MS: 297.9 [M+H] + .
[0407] 1 HNMR (DMSO- d 6, 400 MHz): δ 9.30 (d, J = 7.2 Hz, 1H), 8.73 (s, 1H), 7.93 (d, J = 9.2 Hz, 1H), 7.81-7.72 (m, 1H), 7.69-7.65 (m, 1H), 7.58 (dd, J = 8.4, 2.4 Hz, 1H), 7.40 (t, J = 6.8 Hz, 1H), 7.23-7.12 (m, 1H).
[0408] [Example 21] 6-chloro-3-(7-methylimidazo[1,2-a]pyridin-3-carbonyl)benzo[d]oxazole-2(3H)-one
[0409] Summary of the synthesis scheme of Example 21:
[0410]
[0411] Example 21: 6-chloro-3-(7-methylimidazo[1,2-a]pyridine-3-carbonyl)benzo[d]oxazole-2(3H)-one
[0412] DMF (2 mg, 0.028 mmol) was added to a solution of 7-methylimidazo[1,2-a]pyridine-3-carboxylic acid (50 mg, 0.28 mmol) dissolved in SOCl2 (0.5 mL). The reaction mixture was stirred at 50°C for 2 hours. The mixture was concentrated. 6-chloro-3H-1,3-benzoxazole-2-one (40 mg, 0.23 mmol) and TEA (46 mg, 0.46 mmol) were added to a solution of the mixture dissolved in THF (2 mL). The mixture was stirred at 25°C for 2 hours. The resulting mixture was filtered to recover the solid, and the solid was washed with water (5 mL) and ground with ACN (10 mL) to obtain Example 21 (12.5 mg) as a white solid.
[0413] MS (m / z): 328.0 [M+H] + .
[0414] 1 HNMR (DMSO-d6, 400 MHz): δ 9.19 (d, J = 7.0 Hz, 1H), 8.68 (s, 1H), 7.77 - 7.68 (m, 2H), 7.63 (d, J = 8.5 Hz, 1H), 7.43 - 7.31 (m, 1H), 7.26 (d, J = 7.1 Hz, 1H), 2.49 (s, 3H).
[0415] [Example 22] 6-chloro-3-(8-methoxyimidazo[1,2-a]pyridin-3-carbonyl)benzo[d]oxazole-2(3H)-one
[0416] Summary of the synthesis scheme of Example 22:
[0417]
[0418] Intermediate 1: Ethyl 8-methoxyimidazo[1,2-a]pyridine-3-carboxylate
[0419] K2CO3 (334 mg, 4.84 mmol) and MeI (375 mg, 2.66 mmol) were added to a solution of methyl 8-hydroxyimidazo[1,2-a]pyridine-3-carboxylate (500 mg, 2.42 mmol) dissolved in MeCN (10 mL). The reaction mixture was stirred at 25°C for 16 hours. The resulting mixture was diluted with water (30 mL) and extracted with EtOAc (2 × 15 mL). The organic layer was collected and concentrated to obtain methyl 8-methoxyimidazo[1,2-a]pyridine-3-carboxylate (350 mg, yield 68%) as a yellow solid.
[0420] LC / MS: 207.1 [M+H] + .
[0421] Intermediate 2: 8-Methoxyimidazo[1,2-a]pyridine-3-carboxylic acid
[0422] NaOH (272 mg, 6.81 mmol) was added to a solution of methyl 8-methoxyimidazo[1,2-a]pyridine-3-carboxylate (350 mg, 1.59 mmol) dissolved in THF:H2O=2:1 (10 mL). The reaction mixture was stirred at 25°C for 16 hours. After adjusting the pH of the mixture to 3-4 and filtering, the filter cake was vacuum dried to obtain intermediate 2 (120 mg, yield 39.2%) as a white solid.
[0423] LC / MS: 193.1 [M+H] + .
[0424] Example 22: 6-chloro-3-(8-methoxyimidazo[1,2-a]pyridin-3-carbonyl)benzo[d]oxazole-2(3H)-one
[0425] DMF (2 mg, 0.026 mmol) was added to a solution of 8-methoxyimidazo[1,2-a]pyridine-3-carboxylic acid (50 mg, 0.26 mmol) dissolved in SOCl2 (2 mL). The reaction mixture was stirred at 50°C for 2 hours. The resulting mixture was concentrated. 6-chloro-3H-1,3-benzoxazole-2-one (44 mg, 0.26 mmol) and TEA (52 mg, 0.52 mmol) were added to a solution of the concentrated mixture dissolved in THF (5 mL). The mixture was stirred at 25°C for 2 hours. The resulting mixture was filtered to recover the solid, and the solid was washed with water (10 mL) and ground with ACN (20 mL) to obtain Example 22 (17.1 mg) as a white solid.
[0426] LC / MS: 344.0 [M+H] + .
[0427] 1 HNMR (DMSO- d 6, 400 MHz): δ 8.88 (d, J = 6.7 Hz, 1H), 8.63 (s, 1H), 7.73 (s, 1H), 7.64 (d, J = 8.5 Hz, 1H), 7.37 (d, J = 8.5 Hz, 1H), 7.30 (t, J = 7.3 Hz, 1H), 7.21 (d, J = 7.9 Hz, 1H), 4.02 (s, 3H).
[0428] [Example 23] 3-(2-chloroquinoline-3-carbonyl)-6-fluorobenzo[d]oxazole-2(3H)-one
[0429]
[0430] Example 23 (13.2 mg) was obtained in the same manner as Example 4 using 2-chloroquinoline-3-carboxylic acid, 6-fluorobenzo[d]oxazole-2(3H)-one, and PREP-PLC separation methods.
[0431] LC / MS: 342.0 [M+H] + .
[0432] 1 HNMR (400 MHz, DMSO_d6) δ 8.82 (s, 1H), 8.16 (d, J = 7.7 Hz, 1H), 8.13 - 8.05 (m, 2H), 8.01 - 7.95 (m, 1H), 7.82 - 7.75 (m, 1H), 7.64 (dd, J = 8.3, 2.6 Hz, 1H), 7.33 - 7.24 (m, 1H).
[0433] [Example 24] 3-(3-chloroquinoxalin-2-carbonyl)-5-fluorobenzo[d]oxazole-2(3H)-one
[0434]
[0435] Example 24 (15.6 mg) was obtained in the same manner as Example 4 using 3-chloroquinoxalin-2-carboxylic acid, 5-fluorobenzo[d]oxazole-2(3H)-one and PREP-HPLC separation method.
[0436] LC / MS: 344.0 [M+H] + / 365.9 [M+Na] +
[0437] 1 HNMR (400 MHz, CDCl3) δ 8.20 (dd, J = 4.8 Hz, J = 8.8 Hz, 1H), 8.14 - 8.11 (m, 2H), 7.94 - 7.84 (m, 2H), 7.13 - 7.07 (m, 2H).
[0438] [Example 25] 6-chloro-3-(3-chloroquinoxalin-2-carbonyl)benzo[d]oxazole-2(3H)-one
[0439]
[0440] Example 25 (8 mg) was obtained using 3-chloroquinoxalin-2-carboxylic acid and the PREP-HPLC separation method in the same manner as described for Example 4.
[0441] LC / MS: 360.0 [M+H] +
[0442] 1HNMR (CDCl3, 400 MHz): δ 8.10 - 8.04 (m, 3H), 7.87 - 7.77 (m, 2H), 7.32 - 7.26 (m, 2H).
[0443] [Example 26] 1-(imidazo[1,2-a]pyridin-3-carbonyl)oxazolo[5,4-c]pyridin-2(1H)-one
[0444]
[0445] Phosphoryl trichloride (142 mg, 0.93 mmol) was added to a solution of imidazole [1,2-a]pyridin-3-carboxylic acid (100 mg, 0.62 mmol), 1H-[1,3]oxazolo[5,4-c]pyridin-2-one (100 mg, 0.74 mmol), and DIEA (239 mg, 1.85 mmol) dissolved in DCM (5 mL) while stirring under a nitrogen atmosphere at 25°C. The reaction mixture was stirred at 25°C for 2 hours. The reaction mixture was added to silicone rubber and purified by a silica gel column (eluted with EA) to obtain a crude product. The crude product was placed in MeOH and stirred, after which the solid was filtered and dried to obtain Example 26 (10 mg) as a grayish-white solid.
[0446] LC / MS: 281.1 [M+H] +
[0447] 1 H NMR (400 MHz, CDCl3) δ 9.33 (d, J = 6.8 Hz, 1H), 8.76 (d, J = 9.6 Hz, 2H), 8.50 (d, J = 5.2 Hz, 1H), 7.97 (d, J = 8.9 Hz, 1H), 7.79 (m, 1H), 7.66 (d, J = 5.1 Hz, 1H), 7.43 (t, J = 6.9 Hz, 1H).
[0448] [Example 27] 6-chloro-3-(8-methylimidazo[1,2-a]pyridin-3-carbonyl)benzo[d]oxazole-2(3H)-one
[0449]
[0450] DMF (12.45 mg, 0.17 mmol) was added to a solution of 8-methylimidazo[1,2-a]pyridine-3-carboxylic acid (300 mg, 1.70 mmol) dissolved in SOCl2 (2 mL). The reaction mixture was stirred at 50°C for 2 hours. The mixture was concentrated. 6-chloro-3H-1,3-benzoxazole-2-one (235.24 mg, 1.39 mmol) and TEA (280.76 mg, 2.77 mmol) were added to a solution of the mixture dissolved in THF (5 mL). The mixture was stirred at 25°C for 2 hours. The resulting mixture was filtered to recover the solid, and the solid was washed with water (50 mL) and ground with ACN (100 mL) to obtain Example 27 (7.6 mg) as a white solid.
[0451] LC / MS: 328.0 [M+H] + .
[0452] 1 HNMR (DMSO- d 6, 400 MHz): δ 9.16 (d, J = 6.4 Hz, 1H), 8.71 (s, 1H), 7.73 (s, 1H), 7.64 (d, J = 8.8 Hz, 1H), 7.59 (d, J = 6.8 Hz, 1H), 7.37 (d, J = 6.8 Hz, 1H), 7.30 (t, J = 6.8 Hz, 1H), 2.62 (s, 3H)
[0453] [Example 28] 6-chloro-3-(7-methoxyimidazo[1,2-a]pyridin-3-carbonyl)benzo[d]oxazole-2(3H)-one
[0454] Summary of the synthesis scheme of Example 28:
[0455]
[0456] Intermediate 1: 7-Methoxyimidazo[1,2-a]pyridine-3-carboxylic acid
[0457] NaOH (272.43 mg, 6.81 mmol) was added to a solution of ethyl 7-methoxyimidazo[1,2-a]pyridine-3-carboxylate (500 mg, 2.27 mmol) dissolved in THF:H2O=2:1 (10 mL). The reaction mixture was stirred at 25°C for 16 hours. The pH of the mixture was adjusted to 3-4 and filtered; the filter cake was then vacuum dried to obtain intermediate 1 (300 mg, yield 68.42%) as a yellow solid.
[0458] LC / MS: 193.1 [M+H] + .
[0459] Example 28: 6-chloro-3-(7-methoxyimidazo[1,2-a]pyridin-3-carbonyl)benzo[d]oxazole-2(3H)-one
[0460] DMF (11.41 mg, 0.16 mmol) was added to a solution of 7-methoxyimidazo[1,2-a]pyridine-3-carboxylic acid (300 mg, 1.56 mmol) dissolved in SOCl2 (2 mL). The reaction mixture was stirred at 50°C for 2 hours. The mixture was concentrated. 6-chloro-3H-1,3-benzoxazole-2-one (264.71 mg, 1.56 mmol) and TEA (315.94 mg, 3.12 mmol) were added to a solution of the mixture dissolved in THF (5 mL). The mixture was stirred at 25°C for 2 hours. The resulting mixture was filtered to recover the solid, and the solid was washed with water (50 mL) and ground with ACN (100 mL) to obtain Example 28 (28.5 mg) as a white solid.
[0461] LC / MS: 344.0 [M+H] + .
[0462] 1 HNMR (DMSO- d 6, 400 MHz): δ 9.17 (d, J = 7.6 Hz, 1H), 8.59 (s, 1H), 7.61 (d, J = 9.6 Hz, 2H), 7.34 (d, J = 10.0 Hz, 2H), 7.08 (d, J= 7.6 Hz, 1H), 3.99 (s, 3H).
[0463] [Example 29] 3-(3-chloroquinoline-2-carbonyl)-6-fluorobenzo[d]oxazole-2(3H)-one
[0464]
[0465] Phosphoryl trichloride (221 mg, 1.44 mmol) was added to a solution of 3-chloroquinoline-2-carboxylic acid (200 mg, 0.96 mmol), 6-fluoro-3H-1,3-benzoxazole-2-one (162 mg, 1.06 mmol), and DIEA (373 mg, 2.89 mmol) dissolved in DCM (10 mL) while stirring at 25°C under a nitrogen atmosphere. The reaction mixture was stirred at 25°C for 2 hours. The resulting mixture was added to silicone rubber and purified through a silica gel column using PE:EA (3:1) as the eluent to obtain a crude product. The crude product was placed in MeOH and stirred, after which the solid was filtered and dried to obtain Example 29 (10 mg) as a white solid.
[0466] LC / MS: 343.0 [M+H] +
[0467] 1 H NMR (400 MHz, CDCl3) δ 8.31 (s, 1H), 8.20 (dd, J = 8.7, 4.8 Hz, 1H), 8.10 (d, J = 8.5 Hz, 1H), 7.85 (d, J = 8.2 Hz, 1H), 7.79 (ddd, J = 8.4, 7.0, 1.4 Hz, 1H), 7.68 (m, 1H), 7.08 (m, 2H).
[0468] [Example 30] 3-(3-chloroquinoxalin-2-carbonyl)-7-fluorobenzo[d]oxazole-2(3H)-one
[0469]
[0470] Example 30 (12.8 mg) was obtained in the same manner as Example 4 using 3-chloroquinoxalin-2-carboxylic acid, 7-fluorobenzo[d]oxazole-2(3H)-one and PREP-HPLC separation method.
[0471] LC / MS: 344.0 [M+H] + .
[0472] 1 HNMR (400 MHz, CDCl3) δ 8.20 (dd, J = 4.8 Hz, J = 8.8 Hz, 1H), 8.14 - 8.11 (m, 2H), 7.94 - 7.84 (m, 2H), 7.13 - 7.07 (m, 2H).
[0473] [Example 31] (1R,2R)-2-((6-(4-chlorophenyl)-2-(pyridine-3-yl)pyrimidine-4-yl)amino)cyclopentan-1-ol 2,2,2-trifluoroacetate
[0474] Summary of the synthesis scheme of Example 31:
[0475]
[0476] Intermediate 1: 3-Methoxyquinoxalin-2-Carboxylic Acid
[0477] 3-chloroquinoxalin-2-carboxylic acid (500 mg, 2.4 mmol) was added to a solution of MeONa (1166 mg, 21.6 mmol) dissolved in MeOH (20 mL). The reaction mixture was stirred at 65°C for 3 hours. The reaction mixture was concentrated, and the crude product was placed in ice water. Then, the pH of the mixture was adjusted to 4 and filtered to obtain intermediate 1 (300 mg, 61.2%) as a yellow solid.
[0478] LC / MS: 205.2 [M+H] + .
[0479] Intermediate 2: 3-Methoxyquinoxalin-2-Carbonyl Chloride
[0480] (COCl)2 (280 mg, 2.20 mmol) was added dropwise at 0°C to a solution of 3-methoxyquinoxalin-2-carboxylic acid (150 mg, 0.74 mmol) dissolved in DCM (5 mL). The reaction mixture was stirred at 25°C for 2 hours. The resulting mixture was vacuum concentrated to obtain intermediate 2 as the crude product.
[0481] Example 31: 6-fluoro-3-(3-methoxyquinoxalin-2-carbonyl)benzo[d]oxazole-2(3H)-one
[0482] Intermediate 2 was added at 0°C to a solution of 6-fluorobenzo[d]oxazole-2(3H)-one (112 mg, 0.74 mmol) and DIEA (286 mg, 2.22 mmol) dissolved in DCM (5 mL). The reaction mixture was stirred at 25°C for 16 hours. The resulting mixture was purified by silica gel chromatography (PE / EA=5 / 1) to obtain Example 31 (11 mg) as a white solid.
[0483] LC / MS: 340.2 [M+H] + .
[0484] 1 HNMR (400 MHz, CDCl3) δ 8.19 (dd, J = 4.8 Hz, J = 8.8 Hz, 1H), 8.04 (dd, J = 1.1 Hz, J =8.4 Hz, 1H), 7.93 (dd, J = 1.2 Hz, J =8.4 Hz, 1H), 7.79 - 7.74 (m, 1H), 7.65 - 7.61 (m, 1H), 7.11 - 7.05 (m, 2H), 4.13 (s, 3H).
[0485] [Example 32] 6-chloro-3-(2-methylimidazo[1,2-a]pyridine-3-carbonyl)benzo[d]oxazole-2(3H)-one
[0486] Summary of the synthesis scheme of Example 32:
[0487]
[0488] Intermediate 1: 2-methylimidazo[1,2-a]pyridine-3-carbonyl chloride
[0489] 2-methylimidazo[1,2-a]pyridine-3-carboxylic acid (100 mg, 0.57 mmol) was added to DCM (5 mL) and stirred. To the stirred solution, 1 mL of oxalyl dichloride and one drop of DMF were added at room temperature. The mixture was stirred at room temperature for 1 hour. The resulting solution was concentrated to obtain intermediate 1 (100 mg, 0.57 mmol, 100%) as a yellow solid as the crude product.
[0490] Example 32: 6-chloro-3-(2-methylimidazo[1,2-a]pyridine-3-carbonyl)benzo[d]oxazole-2(3H)-one
[0491] Pidylin (1 mL) and 2-methylimidazo[1,2-a]pyridine-3-carbonyl chloride (intermediate 1, 100 mg, 0.57 mmol) were added at room temperature to a stirred solution of 6-chlorobenzo[d]oxazole-2(3H)-one (100 mg, 0.59 mmol) in DCM (3 mL). The mixture was stirred at room temperature for 1 hour. The resulting mixture was purified by PREP-HPLC (A: water (containing 10 mM TFA), B: ACN, 10% B for 2.5 minutes, then 50-80% B for 11 minutes, then 95% B for 5 minutes, then 10% B for 3 minutes, stopped at 18 minutes) to obtain Example 32 (10 mg) as a white solid.
[0492] LC / MS: 328.1 [M+H] + .
[0493] 1 H NMR (DMSO, 400 MHz): δ 9.16 (d, J = 4.0 Hz, 1H), 7.73 (d, J = 8.0 Hz, 1H), 7.58-7.51 (m, 2H), 7.29 (d, J = 2.0 Hz, 1H), 7.27 (s, 1H), 7.14-7.10 (m, 1H), 2.58 (s, 3H).
[0494] [Example 33] 3-(imidazo[1,2-a]pyridin-3-carbonyl)oxazolo[4,5-b]pyridin-2(3H)-one
[0495]
[0496] Example 33 (8.1 mg) was obtained in the same manner as Example 32 using imidazo[1,2-a]pyridin-3-carboxylic acid, oxazolo[4,5-b]pyridin-2(3H)-one, and PREP-HPLC separation method.
[0497] LC / MS: 281.1 [M+H] + .
[0498] 1 H NMR (DMSO, 400 MHz): δ 9.42 (d, J = 8.0 Hz, 1H), 8.74 (s, 1H), 8.13 (d, J = 4.0 Hz, 1H), 7.99 (d, J = 8.0 Hz, 1H), 7.91-7.84 (m, 2H), 7.48 (t, J = 16.0 Hz, 1H), 7.33(dd, J = 4.0, 4.0 Hz, 1H).
[0499] [Example 34] 3-(imidazo[1,2-a]pyridin-3-carbonyl)oxazolo[4,5-c]pyridin-2(3H)-one
[0500]
[0501] Example 34 (6.8 mg) was obtained in the same manner as Example 32 using imidazo[1,2-a]pyridin-3-carboxylic acid, oxazolo[4,5-c]pyridin-2(3H)-one, and PREP-HPLC separation method.
[0502] LC / MS: 281.1 [M+H] + .
[0503] 1 H NMR (DMSO, 400 MHz): δ 9.32 (d, J = 8.0 Hz, 1H), 8.87 (s, 1H), 8.75 (s, 1H), 8.54 (d, J = 8.0 Hz, 1H), 7.95 (d, J =8.0 Hz, 1H), 7.79-7.77 (m, 1H), 7.63 (d, J = 8.0 Hz, 1H), 7.42-7.40 (m, 1H).
[0504] [Example 35] 6-chloro-3-(2-chloroimidazo[1,2-a]pyridin-3-carbonyl)benzo[d]oxazole-2(3H)-one
[0505]
[0506] Example 35 (8.9 mg) was obtained in the same manner as Example 32 using 2-chloroimidazo[1,2-a]pyridine-3-carboxylic acid, 6-chlorobenzo[d]oxazole-2(3H)-one and PREP-HPLC separation method.
[0507] LC / MS: 348.0 [M+H] + .
[0508] 1 H NMR (CDCl3, 400 MHz): δ 7.22-7.20 (m, 1H), 7.34-7.26 (m, 2H), 7.54 (d, J = 4.0 Hz, 1H), 7.65-7.61 (m, 1H), 7.75 (d, J = 12.0 Hz, 1H), 9.11 (d, J = 4.0 Hz, 1H).
[0509] [Example 36] Trans-2-((6-(4-chlorophenyl)-2-(pyridine-3-yl)pyrimidine-4-yl)amino)cyclohexane-1-ol 2,2,2-trifluoroacetate
[0510]
[0511] Example 36 (8.3 mg) was obtained in the same manner as Example 32 using imidazo[1,2-a]pyridin-3-carboxylic acid, oxazolo[5,4-b]pyridin-2(1H)-one and PREP-HPLC separation method.
[0512] LC / MS: 281.1 [M+H] + .
[0513] 1 H NMR (DMSO, 400 MHz): δ 9.31 (d, J = 8.0 Hz, 1H), 8.75 (s, 1H), 8.17 (d, J = 4.0 Hz, 1H), 8.02 (d, J = 8.0 Hz, 1H), 7.95 (d, J= 8.0 Hz, 1H), 7.79-7.75 (m, 1H), 7.43-7.38 (m, 2H).
[0514] [Example 37] 3-(6-chloro-2-oxo-2,3-dihydrobenzo[d]oxazole-3-carbonyl)imidazo[1,2-a]pyridine-7-carbonitrile
[0515]
[0516] Example 37 (8.1 mg) was obtained in the same manner as Example 32 using 7-cyanomidazo[1,2-a]pyridine-3-carboxylic acid, 6-chlorobenzo[d]oxazole-2(3H)-one and PREP-HPLC separation method.
[0517] LC / MS: 339.1 [M+H] + .
[0518] 1 H-NMR (DMSO, 400 MHz): δ 9.30 (d, J = 0.8 Hz, 1H), 8.86 (s, 1H), 8.70 (s, 1H), 7.77 (s, 1H), 7.72 (d, J = 0.8 Hz, 1H), 7.66 (d, J = 0.4 Hz, 1H), 7.41 (d, J = 0.8 Hz, 1H).
[0519] [Example 38] 3-(3-chloroquinoxalin-2-carbonyl)-4-fluorobenzo[d]oxazole-2(3H)-one
[0520] Summary of the synthesis scheme of Example 38:
[0521]
[0522] Intermediate 1: 3-chloroquinoxalin-2-carbonyl chloride
[0523] 3-chloroquinoxalin-2-carboxylic acid (100 mg, 0.48 mmol) was added to DCM (5 mL) and stirred. To the stirred solution, oxalyl dichloride (1 mL) and one drop of DMF were added at room temperature. The mixture was stirred at room temperature for 1 hour. The resulting solution was concentrated to obtain the crude product, intermediate 1 (100 mg, 0.48 mmol, 100%), as a yellow solid.
[0524] Example 38: 3-(3-chloroquinoxalin-2-carbonyl)-4-fluorobenzo[d]oxazole-2(3H)-one
[0525] Pidylin (1 mL) and 3-chloroquinoxalin-2-carbonyl chloride (intermediate 1, 100 mg, 0.48 mmol) were added at room temperature to a stirred solution of 4-fluorobenzo[d]oxazole-2(3H)-one (100 mg, 0.65 mmol) in DCM (3 mL). The mixture was stirred at room temperature for 1 hour. The mixture was purified by PREP-HPLC (A: water (containing 10 mM TFA), B: ACN, 10% B for 2.5 minutes, then 50-80% B for 11 minutes, then 95% B for 5 minutes, then 10% B for 3 minutes, stopped at 18 minutes) to obtain Example 38 (30 mg) as a white solid.
[0526] LC / MS: 344.1 [M+H] + .
[0527] 1 H NMR (CDCl3, 400 MHz): δ 8.13 (dd, J = 8.5, 1.3 Hz, 2H), 7.89 (dd, J = 6.7, 7.0, 2H), 7.35 (td, J = 8.5, 4.6 Hz, 1H), 7.20 - 7.10 (m, 2H).
[0528] [Example 39] 6-fluoro-3-(3-hydroxyquinoxalin-2-carbonyl)benzo[d]oxazole-2(3H)-one
[0529] Summary of the synthesis scheme of Example 39:
[0530]
[0531] Intermediate 1: 3-hydroxyquinoxalin-2-carboxylic acid
[0532] LiOH·H2O (100 mg, 2.63 mol) was added at room temperature to a solution of ethyl 3-hydroxyquinoxalin-2-carboxylate (100 mg, 0.46 mmol) dissolved in ethanol (5 mL) and water (2 mL) and stirred. The mixture was stirred at room temperature for 2 hours. The resulting solution was concentrated and the pH was adjusted to 3 with 1N HCl. The solution was concentrated to obtain intermediate 1 (100 mg, 0.46 mmol, 100%) as a white solid.
[0533] LC / MS: 191.1 [M+H] + .
[0534] Intermediate 2: 3-hydroxyquinoxalin-2-carbonyl chloride
[0535] 3-hydroxyquinoxalin-2-carboxylic acid (100 mg, 0.46 mmol) was added to DCM (5 mL) and stirred, and oxalyl dichloride (1 mL) was added to the solution at room temperature. The mixture was stirred at room temperature for 10 minutes. The solution was concentrated to obtain intermediate 2 (100 mg, 0.46 mmol, 100%) as a yellow solid as a crude product.
[0536] Example 39: 6-fluoro-3-(3-hydroxyquinoxalin-2-carbonyl)benzo[d]oxazole-2(3H)-one
[0537] Pidylin (1 mL) and 3-hydroxyquinoxalin-2-carbonyl chloride (intermediate 2, 100 mg, 0.46 mmol) were added at room temperature to a stirred solution of 6-fluorobenzo[d]oxazole-2(3H)-one (100 mg, 0.65 mmol) in DCM (3 mL). The mixture was stirred at room temperature for 1 hour. The resulting mixture was purified by PREP-HPLC (A: water (containing 10 mM TFA), B: ACN, 10% B for 2.5 minutes, then 50-80% B for 11 minutes, then 95% B for 5 minutes, then 10% B for 3 minutes, stopped at 18 minutes) to obtain Example 39 (8 mg) as a white solid.
[0538] LC / MS: 344.1 [M+H] + .
[0539] 1 H NMR (CDCl3, 400 MHz): δ 8.13 (dd, J = 8.5, 1.3 Hz, 2H), 7.89 (dd, J = 6.7, 7.0, 2H), 7.35 (td, J = 8.5, 4.6 Hz, 1H), 7.20 - 7.10 (m, 2H).
[0540] [Example 40] 6-fluoro-3-(3-methylquinoxalin-2-carbonyl)benzo[d]oxazole-2(3H)-one
[0541]
[0542] Example 40 (8.3 mg) was obtained in the same manner as Example 32 using 3-methylquinoxalin-2-carboxylic acid, 6-fluorobenzo[d]oxazole-2(3H)-one and PREP-HPLC separation method.
[0543] LC / MS: 324.1 [M+H] + .
[0544] 1 H NMR (CDCl3, 400 MHz) δ 8.16 - 8.09 (m, 2H), 8.06 - 8.04 (m, 1H), 7.88 - 7.83 (m, 1H), 7.80 -7.76 (m, 1H), 7.12 -7.06 (m, 2H), 2.84 (s, 1H).
[0545] [Example 41] 6-chloro-3-(8-hydroxyimidazo[1,2-a]pyridin-3-carbonyl)benzo[d]oxazole-2(3H)-one
[0546] Summary of the synthesis scheme of Example 41:
[0547]
[0548] Intermediate 1: Ethyl 8-(benzyloxy)imidazo[1,2-a]pyridine-3-carboxylate
[0549] Ethyl 2-chloro-3-oxopropanoate (0.6 g, 4.0 mmol) was added to a solution of 3-(benzyloxy)pyridine-2-amine (0.5 g, 2.5 mmol) dissolved in ethanol (20 mL). The reaction mixture was refluxed for 20 hours. The mixture was concentrated to obtain intermediate 1 (0.6 g, 60%) as a grayish-white solid.
[0550] LC / MS: 297.1 [M+H] + .
[0551] Intermediate 2: 8-(benzyloxy)imidazo[1,2-a]pyridine-3-carboxylic acid
[0552] Water (5 mL) and LiOH·H2O (0.36 g, 9.0 mmol) were added to a solution of ethyl 8-(benzyloxy)imidazo[1,2-a]pyridine-3-carboxylate (0.6 g, 2.0 mmol) dissolved in ethanol (10 mL). The reaction mixture was stirred at room temperature for 20 hours. The resulting mixture was concentrated and acidified to pH 1 with concentrated HCl. The precipitate was filtered and air-dried to obtain intermediate 2 (0.3 g, 31%) as a grayish-white solid.
[0553] LC / MS: 269.1 [M+H] + .
[0554] Intermediate 3: 8-(benzyloxy)imidazo[1,2-a]pyridine-3-carbonyl chloride
[0555] Oxalyl chloride (0.28 g, 2.4 mmol) and 2 drops of DMF were added to a solution of 8-(benzyloxy)imidazo[1,2-a]pyridine-3-carboxylic acid (0.4 g, 1.5 mmol) suspended in DCM (20 mL). The reaction mixture was stirred at room temperature for 0.5 hours. The resulting mixture was concentrated to obtain intermediate 3 (0.5 g, 90%) as a grayish-white solid.
[0556] LC / MS: 283.1 [M-Cl+OMe+H] + .
[0557] Intermediate 4: 7-(benzyloxy)-3-(7-methoxyimidazo[1,2-a]pyridine-3-carbonyl)benzo[d]oxazole-2(3H)-one
[0558] A mixture of 8-(benzyloxy)imidazo[1,2-a]pyridine-3-carbonyl chloride (0.2 g, 0.7 mmol) and 6-chlorobenzo[d]oxazole-2(3H)-one (0.1 g, 0.6 mmol) dissolved in pyridine (4 mL) was stirred at room temperature for 3 hours. The resulting mixture was diluted with EtOAc (20 mL) and stirred at room temperature for 30 minutes. The resulting precipitate was filtered and air-dried to obtain intermediate 3 (200 mg, 70%) as a gray solid.
[0559] LC / MS: 420.1 [M+H] + .
[0560] Example 41: 6-chloro-3-(8-hydroxyimidazo[1,2-a]pyridine-3-carbonyl)benzo[d]oxazole-2(3H)-one
[0561] 5% Pd / C (0.1 g) and ZnBr2 (0.04 g, 0.18 mmol) were added to a solution of 7-(benzyloxy)-3-(7-methoxyimidazo[1,2-a]pyridine-3-carbonyl)benzo[d]oxazole-2(3H)-one (200 mg, 0.5 mmol) dissolved in THF (20 mL). The mixture was stirred at room temperature for 3 hours under a hydrogen atmosphere. The mixture was filtered and washed with THF (10 mL). The filtrate was concentrated, and the residue was purified by PREP-HPLC (ACN / water, 0.5% TFA) to obtain Example 41 (20 mg) as a white solid.
[0562] LC / MS: 330.0 [M+H] + .
[0563] 1 H-NMR (DMSO, 400 MHz): δ 11.04 (s, 1H), 8.83 (d, J = 0.8 Hz, 1H), 8.65 (s, 1H), 7.73 (d, J = 0.4 Hz, 1H), 7.63 (d, J = 0.8 Hz, 1H), 7.37 (d, J = 0.8 Hz, 1H), 7.21 (t, J = 0.8 Hz, 1H), 7.03 (d, J = 0.4 Hz, 1H).
[0564] [Example 42] 6-chloro-3-(7-hydroxyimidazo[1,2-a]pyridin-3-carbonyl)benzo[d]oxazole-2(3H)-one
[0565]
[0566] Example 42 (7.2 mg) was obtained in the same manner as Example 41 using 4-(benzyloxy)pyridine-2-amine and the PREP-HPLC separation method.
[0567] LC / MS: 330.0 [M+H] +
[0568] 1 H NMR (DMSO, 400 MHz): δ 11.29 (s,1H), 9.14 (d,J = 4.0 Hz, 1H), 8.59 (s, 1H), 7.71 (d, J = 4.0 Hz, 1H), 7.57 (d, J = 8.0 Hz, 1H), 7.35 (dd, J = 4.0, 8.0 Hz, 1H), 7.05-6.98 (m, 2H).
[0569] [Example 43] 3-(7-aminoimidazo[1,2-a]pyridine-3-carbonyl)-6-chlorobenzo[d]oxazole-2(3H)-one
[0570]
[0571] Example 43 (5.0 mg) was obtained using 4-nitropyridine-2-amine and the PREP-HPLC separation method in the same manner as Example 41.
[0572] LC / MS: 329.1 [M+H] + .
[0573] 1 H NMR (DMSO, 400 MHz): δ 8.94 (d, J = 7.4 Hz, 1H), 8.57 (s, 1H), 7.72 (d, J = 2.0 Hz, 1H), 7.56 (d, J = 8.5 Hz, 1H), 7.36 (dd, J = 8.5, 2.0 Hz, 1H), 6.92 (s, 2H), 6.83 (dd, J = 7.4, 2.1 Hz, 1H), 6.71 (d, J = 2.0 Hz, 1H).
[0574] [Example 44] 6-chloro-3-(2-hydroxyimidazo[1,2-a]pyridin-3-carbonyl)benzo[d]oxazole-2(3H)-one
[0575]
[0576] Example 44 (6.7 mg) was obtained in the same manner as Example 41 using ethyl 2-(benzyloxy)imidazo[1,2-a]pyridine-3-carboxylate and the PREP-HPLC separation method.
[0577] LC / MS: 330.1 [M+H] + .
[0578] 1 H NMR (DMSO, 400 MHz): δ 12.54 (s, 1H), 9.44 (d, J = 4.0 Hz, 1H), 7.92-7.87 (m, 1H), 7.64 (s, 1H), 7.42-7.41 (m, 2H), 7.39-7.26 (m, 2H).
[0579] [Example 45] 6-fluoro-3-(3-fluoroquinoxalin-2-carbonyl)benzo[d]oxazole-2(3H)-one
[0580] Summary of the synthesis scheme of Example 45:
[0581]
[0582] Intermediate 1: Ethyl 3-fluoroquinoxalin-2-carboxylate
[0583] KF (370 mg, 6.36 mol) and 18-Crown-6 (150 mg) were added at room temperature to a stirred solution of ethyl 3-chloroquinoxalin-2-carboxylate (500 mg, 2.12 mmol) dissolved in DMSO (5 mL). The mixture was stirred at 80°C for 3 hours. The solution was poured into water (20 mL) and filtered. The resulting filter cake was dried to obtain intermediate 1 (400 mg, 1.82 mmol, 85%) as a white solid.
[0584] LC / MS: 220.1 [M+H] + .
[0585] Intermediate 2: 3-fluoroquinoxalin-2-carboxylic acid
[0586] 3-fluoroquinoxalin-2-carboxylate (400 mg, 1.82 mmol) was added to THF (5 mL) and H2O (2 mL) and stirred, and K2CO3 (800 mg, 5.79 mol) was added to the mixture at room temperature. The mixture was stirred at room temperature for 16 hours. The resulting solution was concentrated to obtain intermediate 2 (400 mg, 1.82 mmol, 100%) as a white solid.
[0587] LC / MS: 193.1 [M+H] + .
[0588] Intermediate 3: 3-fluoroquinoxalin-2-carbonyl chloride
[0589] 3-fluoroquinoxalin-2-carboxylic acid (400 mg, 1.82 mmol) was added to DCM (5 mL) and stirred, and oxalyl dichloride (1 mL) was added to the solution at room temperature. The mixture was stirred at room temperature for 30 minutes. The resulting solution was concentrated to obtain intermediate 3 (400 mg, 1.82 mmol, 100%) as a yellow solid as a crude product.
[0590] Example 45: 6-fluoro-3-(3-fluoroquinoxalin-2-carbonyl)benzo[d]oxazole-2(3H)-one
[0591] Pidylin (1 mL) and 3-fluoroquinoxalin-2-carbonyl chloride (100 mg, 0.46 mmol) were added at room temperature to a stirred solution of 6-fluorobenzo[d]oxazole-2(3H)-one (100 mg, 0.65 mmol) in DCM (3 mL). The mixture was stirred at room temperature for 1 hour. The mixture was purified by PREP-HPLC (A: water (containing 10 mM TFA), B: ACN, 10% B for 2.5 minutes, then 50-80% B for 11 minutes, then 95% B for 5 minutes, then 10% B for 3 minutes, stopped at 18 minutes) to obtain Example 45 (30 mg) as a white solid.
[0592] LC / MS: 328.1 [M+H] +
[0593] 1 H NMR (CDCl3, 400 MHz): δ 8.21 -8.19 (m, 2H), 8.07 (dd, J = 8.4, 0.8 Hz, 1H), 7.95 - 7.91 (m, 1H), 7.87 -7.83 (m, 1H), 7.13 -7.08 (m, 2H).
[0594] [Example 46] 6-chloro-3-(3-fluoroquinoxalin-2-carbonyl)benzo[d]oxazole-2(3H)-one
[0595]
[0596] Example 46 (6.7 mg) was obtained in the same manner as Example 45 using 6-chlorobenzo[d]oxazole-2(3H)-one and the PREP-HPLC separation method.
[0597] LC / MS: 344.1 [M+H] + .
[0598] 1 H NMR (CDCl3, 400 MHz): δ 8.21-8.19 (m, 2H), 8.08-8.06 (m, 1H), 7.93-7.89 (m, 1H), 7.87-7.85 (m, 1H), 7.13-7.08 (m, 2H).
[0599] [Example 47] 5-fluoro-3-(1H-indole-3-carbonyl)benzo[d]oxazole-2(3H)-one
[0600] Summary of the synthesis scheme of Example 47:
[0601]
[0602] Intermediate 1: 1H-indole-3-carbonyl chloride
[0603] Oxalyl chloride (0.1 g, 0.79 mmol) and 1 drop of DMF were added to a solution of 1H-indole-3-carboxylic acid (0.1 g, 0.62 mmol) dissolved in DCM (10 mL). The mixture was stirred and concentrated at room temperature for 30 minutes to obtain 1H-indole-3-carbonyl chloride (intermediate 1, 0.1 g) as a yellow solid (crude product). The crude product was used in the next step without further purification.
[0604] Example 47: 5-fluoro-3-(1H-indole-3-carbonyl)benzo[d]oxazole-2(3H)-one
[0605] Pyridine (2 mL) was added to a mixture of 1H-indole-3-carbonyl chloride (intermediate 1, 0.1 g) and 5-fluorobenzo[d]oxazole-2(3H)-one (95 mg, 0.62 mol). The resulting mixture was stirred at room temperature for 2 hours. The resulting mixture was purified by PREP-HPLC (A: water (10 mM TFA), B: ACN) to obtain Example 47 (20 mg, 11%) as a white solid.
[0606] LC / MS: 319.0 [M+Na] + .
[0607] 1HNMR (DMSO, 400 MHz,): δ 12.39 (s, 1H), 8.54 (d, J = 3.2 Hz, 1H), 8.14 - 8.00 (m, 1H), 7.56 (dd, J = 6.0, 2.8 Hz, 1H), 7.50 (dd, J = 8.9, 4.4 Hz, 1H), 7.44 (dd, J = 8.6, 2.7 Hz, 1H), 7.33 - 7.26 (m, 2H), 7.17 - 7.09 (m, 1H).
[0608] [Example 48] 6-chloro-3-(7-fluoro-1H-indole-3-carbonyl)benzo[d]oxazole-2(3H)-one
[0609]
[0610] Example 48 (6.7 mg) was obtained in the same manner as Example 47 using 7-fluoro-1H-indole-3-carboxylic acid, 6-chlorobenzo[d]oxazole-2(3H)-one and PREP-HPLC separation method.
[0611] LC / MS: 353.1 [M+Na] + .
[0612] 1 HNMR (DMSO, 400 MHz,): δ 12.91 (s, 1H), 8.59 (d, J = 3.0 Hz, 1H), 7.87 (d, J = 7.9 Hz, 1H), 7.71 (d, J = 2.0 Hz, 1H), 7.61 (d, J = 8.5 Hz, 1H), 7.35 (dd, J = 8.5, 2.1 Hz, 1H), 7.27 (td, J = 8.0, 4.9 Hz, 1H), 7.16 (dd, J = 11.2, 7.8 Hz, 1H).
[0613] [Example 49] 6-chloro-3-(6-fluoro-1H-indole-3-carbonyl)benzo[d]oxazole-2(3H)-one
[0614]
[0615] Example 49 (5.2 mg) was obtained in the same manner as Example 47 using 6-fluoro-1H-indole-3-carboxylic acid, 6-chlorobenzo[d]oxazole-2(3H)-one and PREP-HPLC separation method.
[0616] LC / MS: 353.0 [M+Na] + .
[0617] 1 HNMR (DMSO, 400 MHz): δ 12.40 (s, 1H), 8.54 (d, J = 3.2 Hz, 1H), 8.05 (dd, J =8.7, 5.4 Hz, 1H), 7.70 (d, J = 2.0 Hz, 1H), 7.59 (d, J = 8.5 Hz, 1H), 7.36 (ddd, J = 10.6, 9.0, 2.2 Hz, 2H), 7.16 (td, J = 9.7, 2.4 Hz, 1H).
[0618] [Example 50] 6-chloro-3-(5-fluoro-1H-indole-3-carbonyl)benzo[d]oxazole-2(3H)-one
[0619]
[0620] Example 50 (6.2 mg) was obtained in the same manner as Example 47 using 5-fluoro-1H-indole-3-carboxylic acid, 6-chlorobenzo[d]oxazole-2(3H)-one and PREP-HPLC separation method.
[0621] LC / MS: 353.1 [M+Na] + .
[0622] 1 HNMR (DMSO, 400 MHz): δ 12.47 (s, 1H), 8.58 (s, 1H), 7.75 (dd, J = 9.7, 2.6 Hz, 1H), 7.70 (d, J = 2.0 Hz, 1H), 7.62 - 7.56 (m, 2H), 7.35 (dd, J = 8.5, 2.1 Hz, 1H), 7.16 (td, J= 9.2, 2.6 Hz, 1H).
[0623] [Example 51] 6-chloro-3-(4-fluoro-1H-indole-3-carbonyl)benzo[d]oxazole-2(3H)-one
[0624]
[0625] Example 51 (6.1 mg) was obtained in the same manner as Example 47 using 4-fluoro-1H-indole-3-carboxylic acid, 6-chlorobenzo[d]oxazole-2(3H)-one and PREP-HPLC separation method.
[0626] LC / MS: 353.0 [M+Na] + .
[0627] 1 HNMR (DMSO, 400 MHz,): δ 12.55 (s, 1H), 8.47 (d, J = 3.1 Hz, 1H), 7.70 (d, J = 1.9 Hz, 1H), 7.66 (d, J = 8.5 Hz, 1H), 7.41 - 7.34 (m, 2H), 7.26 (td, J = 8.0, 5.0 Hz, 1H), 6.99 (dd, J = 11.4, 7.9 Hz, 1H).
[0628] [Example 52] 3-(benzofuran-3-carbonyl)-6-chlorobenzo[d]oxazole-2(3H)-one
[0629]
[0630] Example 52 (6.1 mg) was obtained in the same manner as Example 47 using benzofuran-3-carboxylic acid, 6-chlorobenzo[d]oxazole-2(3H)-one and PREP-HPLC separation method.
[0631] LC / MS: 335.9 [M+Na] + .
[0632] 1 HNMR (DMSO, 400 MHz,): δ 9.00 (s, 1H), 8.01 - 7.94 (m, 1H), 7.80 (dd, J = 11.7, 7.9 Hz, 2H), 7.75 (d, J= 2.0 Hz, 1H), 7.52 - 7.43 (m, 2H), 7.41 (dd, J = 8.6, 2.1 Hz, 1H).
[0633] [Example 53] 6-chloro-3-(2-chlorobenzofuran-3-carbonyl)benzo[d]oxazole-2(3H)-one
[0634] Summary of the synthesis scheme of Example 53:
[0635]
[0636] Intermediate 1: 2-chlorobenzofuran-3-carbaldehydride
[0637] Phosphorus oxychloride (3.14 g, 20.5 mmol) was added dropwise at 0°C to a solution of dimethylformamide (2.1 g, 28.7 mmol) dissolved in chloroform (10 mL). After stirring at 0°C for 5 minutes, a solution of 3H-1-benzofuran-2-one (1.1 g, 8.2 mmol) dissolved in chloroform (7 mL) was added dropwise at 0°C. The resulting reaction mixture was refluxed and stirred for 16 hours. The solvent was removed under reduced pressure. The resulting residue was dissolved in water. Potassium acetate was added until the pH reached 5, followed by the addition of 2N sodium hydroxide until the pH reached 7. The mixture was extracted with dichloromethane. The combined organic phase was concentrated under vacuum. The concentrate was purified by flash chromatography with PE / EA = 10 / 1 to obtain intermediate 1 (0.3 g) as a white solid.
[0638] LC / MS: 180.0 [M+H] + .
[0639] Intermediate 2: 2-chlorobenzofuran-3-carboxylic acid
[0640] 2-methyl-2-butene (815 mg, 11.7 mmol) and KH2PO4 (226 mg, 1.6 mmol) were added to a solution of 2-chlorobenzofuran-3-carbaldehydride (intermediate 1, 300 mg, 1.6 mmol) dissolved in t-BuOH / water (5 mL, 4 / 1). The mixture was stirred for 30 minutes, and NaClO2 (450 mg, 4.9 mmol) was added. The reaction mixture was stirred at room temperature for 16 hours. The resulting mixture was diluted with a saturated NH4Cl solution and extracted with EA (10 mL * 3). The combined organic phase was washed with brine, dried with sodium sulfate, and vacuum concentrated to obtain intermediate 2 (0.3 g) as a white solid.
[0641] LC / MS: 197.0 [M+H] + .
[0642] Example 53: 6-chloro-3-(2-chlorobenzofuran-3-carbonyl)benzo[d]oxazole-2(3H)-one
[0643] 6-chlorobenzofuran-3-carboxylic acid (intermediate 2, 197 mg, 1.0 mmol) and DMAP (12 mg, 0.1 mmol) were added to a solution of 2-chlorobenzofuran-3-carboxylic acid (intermediate 2, 197 mg, 1.0 mmol) dissolved in DCM (4 mL). The reaction mixture was stirred at room temperature for 10 minutes, after which DIC (192 mg, 1.52 mmol) was added dropwise. The resulting reaction mixture was stirred at room temperature for 2 hours. The resulting mixture was vacuum concentrated to obtain a crude product. The crude product was ground with MTBE and DCM to obtain Example 53 (38 mg).
[0644] LC / MS: 347.8 [M+H] +
[0645] 1 HNMR (CDCl3, 400 MHz): δ 7.85 (d, J = 8.8 Hz, 1H), 7.71 - 7.65 (m, 1H), 7.53 (dd, J = 7.0, 1.8 Hz, 1H), 7.44 - 7.35 (m, 2H), 7.33 - 7.29 (m, 2H).
[0646] [Example 54] 6-chloro-5-fluoro-3-(imidazo[1,2-a]pyridin-3-carbonyl)benzo[d]oxazole-2(3H)-one
[0647] Summary of the synthesis scheme of Example 54:
[0648]
[0649] Intermediate 1: 2-amino-5-chloro-4-fluorophenol
[0650] Fe (1.46 g, 26.10 mmol) was added to a mixture of 5-chloro-4-fluoro-2-nitrophenol (500 mg, 2.61 mmol) and NH4Cl (698 mg, 13.05 mmol) dissolved in ethanol (4 mL) and water (1 mL). The reaction mixture was stirred at 90°C for 1 hour. Then, the resulting solid was separated by filtration and washed with ethyl acetate (EA). The combined organic phase was washed with brine, dried with Na2SO4, and then vacuum concentrated. The obtained concentrate was purified by flash chromatography with PE / EA = 3:1 to obtain intermediate 1 (300 mg) in the form of a brown oil.
[0651] LC / MS: 162.0 [M+H] + .
[0652] Intermediate 2: 6-chloro-5-fluorobenzo[d]oxazole-2(3H)-on
[0653] A solution of 2-amino-5-chloro-4-fluorophenol (intermediate 1, 270 mg, 1.67 mmol) and CDI (542 mg, 3.34 mmol) dissolved in THF (10 mL) was stirred at 60°C for 1 hour. The reaction mixture was quenched with water and extracted three times with EA. The combined organic phase was washed with brine, dried with Na2SO4, and then vacuum concentrated. The obtained concentrate was purified by flash chromatography using a solution of DCM (5 to 6%) with added MeOH to obtain intermediate 2 (110 mg) as a yellow solid.
[0654] LC / MS: 188.1 [M+H] + .
[0655] Example 54: 6-chloro-5-fluoro-3-(imidazo[1,2-a]pyridin-3-carbonyl)benzo[d]oxazole-2(3H)-one
[0656] Imidazō[1,2-a]pyridin-3-carbonyl chloride (35 mg, 0.19 mmol) was added to a solution of 6-chloro-5-fluorobenzo[d]oxazole-2(3H)-one (intermediate 2, 30 mg, 0.16 mmol) and TEA (32 mg, 0.32 mmol) dissolved in DCM (3 mL). The reaction mixture was stirred at room temperature for 1 hour. The solvent was removed under vacuum. The resulting residue was washed with cold DCM (3 x 2 mL) to obtain Example 54 (8.7 mg).
[0657] LC / MS: 332.0 [M+H] + .
[0658] 1H-NMR (CDCl3, 400 MHz,): ?9.45 (d, J = 6.9 Hz, 1H), 8.66 (s, 1H), 7.93 (d, J = 8.9 Hz, 1H), 7.71 - 7.60 (m, 2H), 7.37 (d, J = 6.0 Hz, 1H), 7.28 (d, J = 0.9 Hz, 1H).
[0659] [Example 55] 5-chloro-6-fluoro-3-(imidazo[1,2-a]pyridin-3-carbonyl)benzo[d]oxazole-2(3H)-one
[0660]
[0661] Example 55 (5.9 mg) was obtained using 4-chloro-5-fluoro-2-nitrophenol in the same manner as Example 54.
[0662] LC / MS: 332.0 [M+H] + .
[0663] 1 HNMR (CDCl3, 400 MHz,): δ 9.45 (d, J = 6.9 Hz, 1H), 8.66 (s, 1H), 7.92 (d, J = 8.9 Hz, 1H), 7.85 (d, J = 6.6 Hz, 1H), 7.66 (dd, J= 11.8, 4.1 Hz, 1H), 7.28 - 7.25 (m, 1H), 7.17 (d, J = 7.6 Hz, 1H).
[0664] [Example 56] 5-fluoro-3-(imidazo[1,2-a]pyridine-3-carbonyl)benzo[d]oxazole-2(3H)-one
[0665]
[0666] Example 56 (22.5 mg) was obtained in the same manner as Example 47 using imidazo[1,2-a]pyridine-3-carboxylic acid, 5-fluorobenzo[d]oxazole-2(3H)-one and PREP-HPLC separation method.
[0667] LC / MS: 298.0 [M+H] + .
[0668] 1 HNMR (CDCl3, 400 MHz,): δ 9.49 (d, J = 6.8 Hz, 1H), 8.71 (s, 1H), 8.05 (d, J = 8.8 Hz, 1H), 7.74 (t, J = 7.6 Hz, 1H), 7.55 (dd, J = 8.4, 2.6 Hz, 1H), 7.33 (t, J = 6.8 Hz, 1H), 7.24 (d, J = 4.4 Hz, 1H), 7.02 (td, J = 9.2, 2.7 Hz, 1H).
[0669] [Example 57] 3-(imidazo[1,2-a]pyridine-3-carbonyl)-6-(trifluoromethyl)benzo[d]oxazole-2(3H)-one
[0670] Summary of the synthesis scheme of Example 57:
[0671]
[0672] Intermediate 1: 6-(trifluoromethyl)benzo[d]oxazole-2(3H)-one
[0673] TEA (684 mg, 6.77 mmol) and CDI (660 mg, 4.06 mmol) were added to a solution of 2-amino-5-(trifluoromethyl)phenol (400 mg, 2.26 mmol) dissolved in THF (20 mL). The reaction mixture was stirred at 60°C for 16 hours. The resulting mixture was diluted with H2O (50 mL) and extracted with DCM (20 mL * 3). The combined organic layer was dried with anhydrous MgSO4 and filtered. The resulting filtrate was evaporated under reduced pressure to obtain the crude product. The crude product was purified by column chromatography (silica gel, 0–5% MeOH in DCM) to obtain intermediate 1 (300 mg) as a yellow solid.
[0674] LC / MS: 204.0 [M+H] + .
[0675] Example 57: 3-(imidazo[1,2-a]pyridine-3-carbonyl)-6-(trifluoromethyl)benzo[d]oxazole-2(3H)-one
[0676] TEA (75 mg, 0.74 mmol) and imidazo[1,2-a]pyridine-3-carbonyl chloride (67 mg, 0.37 mmol) were added to a solution of 6-(trifluoromethyl)-3H-1,3-benzoxazole-2-one (intermediate 1, 50 mg, 0.25 mmol) dissolved in DCM (5 mL). The reaction mixture was stirred at room temperature for 2 hours. The resulting mixture was diluted with H2O (50 mL) and extracted with DCM (20 mL * 3). The combined organic layer was dried with anhydrous MgSO4 and filtered. The resulting filtrate was evaporated under reduced pressure to obtain the crude product. The crude product was purified by column chromatography (silica gel, 0-5% MeOH in DCM) and then ground with CH3CN (2 mL) and H2O (2 mL). The ground solid was collected to obtain Example 57 (30 mg) as a yellow solid.
[0677] LC / MS: 348.0 [M+H] + .
[0678] 1 H-NMR (DMSO, 400 MHz,): δ 9.33 (d, J= 6.8 Hz, 1H), 8.77 (s, 1H), 8.01 - 7.94 (m, 2H), 7.83 - 7.76 (m, 2H), 7.73 - 7.68 (m, 1H), 7.43 (td, J = 6.9, 1.0 Hz, 1H).
[0679] [Example 58] 3-(imidazo[1,2-a]pyridine-3-carbonyl)-5-(trifluoromethyl)benzo[d]oxazole-2(3H)-one
[0680]
[0681] Example 58 (30 mg) was obtained in the same manner as Example 57 using 2-amino-4-(trifluoromethyl)phenol and the PREP-HPLC separation method.
[0682] LC / MS: 348.0 [M+H] + .
[0683] 1 HNMR (DMSO, 400 MHz,): δ 9.34 (d, J = 6.8 Hz, 1H), 8.76 (s, 1H), 7.98 - 7.92 (m, 2H), 7.81 - 7.70 (m, 3H), 7.42 (t, J = 6.9, 6.0 Hz, 1H).
[0684] [Example 59] 6-chloro-3-(8-(trifluoromethyl)imidazo[1,2-a]pyridine-3-carbonyl)benzo[d]oxazole-2(3H)-one
[0685] Summary of the synthesis scheme of Example 59:
[0686]
[0687] Intermediate 1: Ethyl 8-(trifluoromethyl)imidazo[1,2-a]pyridine-3-carboxylate
[0688] DMF-DMA (1.48 g, 12.4 mmol) was added to a solution of 3-(trifluoromethyl)pyridine-2-amine (1 g, 6.2 mmol) dissolved in DMF (10 mL). The resulting mixture was stirred at 65°C for 2 hours. NaHCO3 (0.78 g, 9.3 mmol), KI (0.21 g, 1.2 mmol), and ethyl bromoacetate (1.35 g, 8.1 mmol) were added. The reaction mixture was stirred at 85°C for 8 hours. The mixture was diluted with water and extracted with DCM. The combined organic phase was washed with brine, dried with Na2SO4, and then vacuum concentrated. The resulting concentrate was purified by flash chromatography with PE / EA = 9 / 1 to obtain intermediate 1 (0.8 g) in the form of a yellow oil.
[0689] LC / MS: 259.0 [M+H] + .
[0690] Intermediate 2: 8-(trifluoromethyl)imidazo[1,2-a]pyridine-3-carboxylic acid
[0691] LiOH·H2O (48 mg, 1.14 mmol) was added to a solution of ethyl 8-(trifluoromethyl)imidazo[1,2-a]pyridine-3-carboxylate (intermediate 1, 150 mg, 0.58 mmol) dissolved in MeOH (5 mL). The reaction mixture was stirred at room temperature for 2 hours. The resulting mixture was acidified with 1 M HCl until the pH reached 5 and extracted with EA. The combined organic layer was washed with brine, dried with Na2SO4, and then vacuum concentrated to obtain intermediate 2 (130 mg) as a white solid.
[0692] LC / MS: 231.0 [M+H] + .
[0693] Example 59: 6-chloro-3-(8-(trifluoromethyl)imidazo[1,2-a]pyridine-3-carbonyl)benzo[d]oxazole-2(3H)-one
[0694] 6-chlorobenzo[d]oxazole-2(3H)-one (81 mg, 0.48 mmol) and DMAP (6 mg, 0.048 mmol) were added to a solution of 8-(trifluoromethyl)imidazo[1,2-a]pyridine-3-carboxylic acid (intermediate 2, 110 mg, 0.48 mmol) dissolved in DCM (2 mL). The mixture was stirred at room temperature for 10 minutes, and then DIC (272 mg, 0.72 mmol) was added. The reaction mixture was stirred at room temperature for 2 hours. The resulting mixture was vacuum concentrated to obtain a crude product. The crude product was purified by PREP-TLC (EA:PE=1:1) to obtain Example 59 (12 mg).
[0695] LC / MS: 381.9 [M+H] + .
[0696] 1H-NMR (CDCl3, 400 MHz,): δ 9.57 (d, J = 6.8 Hz, 1H), 8.72 (s, 1H), 7.93 (d, J = 7.2 Hz, 1H), 7.70 (d, J = 8.5 Hz, 1H), 7.36 - 7.24 (m, 3H).
[0697] [Example 60] 3-(3-methylquinoxalin-2-carbonyl)benzo[d]oxazole-2(3H)-one
[0698] Summary of the synthesis scheme of Example 60:
[0699]
[0700] Intermediate 1: 3-methylquinoxalin-2-carbonyl chloride
[0701] Oxalyl dichloride (1 mL) and one drop of DMF were added at room temperature to a stirred solution in which 3-methylquinoxalin-2-carboxylic acid (100 mg, 0.53 mmol) was dissolved in DCM (5 mL). The mixture was stirred at room temperature for 1 hour. The solution was concentrated to obtain 3-methylquinoxalin-2-carbonyl chloride (intermediate 1,109 mg, 0.53 mmol) as a yellow solid.
[0702] LC / MS: 203.3 [Methanol Quenching, M-Cl+OCH3+H]+ .
[0703] Example 60: 3-(3-methylquinoxalin-2-carbonyl)benzo[d]oxazole-2(3H)-one
[0704] Pyridine (1 mL) and intermediate 1 (109 mg, 0.53 mmol) were added at room temperature to a stirred solution in which benzo[d]oxazole-2(3H)-one (71.5 mg, 0.53 mmol) was dissolved in DCM (3 mL). The mixture was stirred at room temperature for 1 hour. The resulting mixture was purified by PREP-HPLC (A: water (10 mM TFA), B: ACN, 40-70% B, stopped at 16 minutes after 10 minutes) to obtain Example 60 (8.0 mg, 0.026 mmol) as a purple solid.
[0705] LC / MS: 306.1 [M+H]+.
[0706] 1 H-NMR (DMSO, 400 MHz,): δ 8.19 - 8.06 (m, 3H), 8.01 - 7.94 (m, 1H), 7.93 - 7.87 (m, 1H), 7.56 - 7.49 (m, 1H), 7.47 - 7.41 (m, 2H), 2.81 (d, J = 21.2 Hz, 3H).
[0707] [Example 61] 3-(3-chloroquinoxalin-2-carbonyl)-5,6-difluorobenzo[d]oxazole-2(3H)-one
[0708] Summary of the synthesis scheme of Example 61:
[0709]
[0710] Intermediate 1: 5,6-difluorobenzo[d]oxazole-2(3H)-on
[0711] CDI (564 mg, 4.0 mmol) was added to a solution of 2-amino-4,5-difluorophenol (SM1, 290 mg, 2.0 mmol) dissolved in THF (20 mL). The reaction mixture was refluxed and stirred for 2 hours. The mixture obtained after the reaction was concentrated. The mixture was extracted with EA (100 mL x 3). The combined organic phase was washed with water (20 mL) and brine (20 mL) and dried with anhydrous sodium sulfate. The obtained mixture was concentrated and purified by column chromatography (EA in PE, 30%, v / v) to obtain intermediate 1 (286 mg) as a yellow solid.
[0712] LC / MS: 172 [M+H] + .
[0713] Intermediate 2: 3-chloroquinoxalin-2-carbonyl chloride
[0714] Oxalyl dichloride (126 mg, 1.0 mmol) and DMF (1 drop) were added to a solution of 3-chloroquinoxalin-2-carboxylic acid (SM2, 208 mg, 1.0 mmol) dissolved in DCM (10 mL). The reaction mixture was stirred at room temperature for 0.5 hours. The resulting mixture was concentrated to obtain intermediate 2 (226 mg) as a white solid.
[0715] LC / MS: 222 [Methanol Quenching, M-Cl+OCH3+H]+.
[0716] Example 61: 3-(3-chloroquinoxalin-2-carbonyl)-5,6-difluorobenzo[d]oxazole-2(3H)-one
[0717] Intermediate 1 (171 mg, 1.0 mmol) and Py (1.0 mL) were added to a solution in which Intermediate 2 (226 mg, 1.0 mmol) was dissolved in DCM (10 mL). The reaction mixture was stirred at room temperature for 1 hour. After the reaction, the mixture was concentrated. The mixture was extracted with EA (100 mL x 3). The combined organic phase was washed with water (20 mL) and brine (20 mL) and dried with anhydrous sodium sulfate. The obtained mixture was concentrated and purified by reverse-phase PREP-HPLC (MeCN in water, 90% v / v), then ground with MTBE (5.0 mL) and dried to obtain Example 61 (75 mg) as a white solid.
[0718] LC / MS: 362 [M+H] + .
[0719] 1 H-NMR (DMSO, 400 MHz,): δ 8.25-8.16 (m, 3H), 8.12-8.03 (m, 2H), 8.00-7.95 (m, 1H).
[0720] [Example 62] 6-chloro-3-(3-chloroquinoxalin-2-carbonyl)-5-fluorobenzo[d]oxazole-2(3H)-one
[0721] Summary of the synthesis scheme of Example 62:
[0722]
[0723] Intermediate 1: 2-amino-5-chloro-4-fluorophenol
[0724] ZnBr2 (116 mg, 0.52 mmol) and 10% Pd / C (120 mg) were added to a solution of 5-chloro-4-fluoro-2-nitrophenol (SM1, 500 mg, 2.62 mmol) dissolved in EA (50 mL). The reaction mixture was stirred under H2 at room temperature for 16 hours. After the reaction, the mixture was filtered in Celite and concentrated. The mixture was extracted with EA (100 mL x 3). The combined organic phase was washed with water (20 mL) and brine (20 mL) and dried with anhydrous sodium sulfate. The obtained mixture was concentrated and purified by column chromatography (MeOH dissolved in DCM, 10%, v / v) to obtain intermediate 1 (380 mg) as a yellow solid.
[0725] LC / MS: 162 [M+H] + .
[0726] Intermediate 2: 6-chloro-5-fluorobenzo[d]oxazole-2(3H)-on
[0727] CDI (386 mg, 2.74 mmol) was added to a solution of intermediate 1 (220 mg, 1.0 mmol) dissolved in THF (15 mL). The reaction mixture was refluxed and stirred for 2 hours. After the reaction, the mixture was concentrated. The mixture was extracted with EA (100 mL x 3). The combined organic phase was washed with water (20 mL) and brine (20 mL) and dried with anhydrous sodium sulfate. The resulting mixture was concentrated and purified by column chromatography (EA in PE, 30%, v / v) to obtain intermediate 2 (200 mg) as a yellow solid.
[0728] LC / MS: 188 [M+H] + .
[0729] Intermediate 3: 3-chloroquinoxalin-2-carbonyl chloride
[0730] Oxalyl dichloride (180 mg, 1.43 mmol) and DMF (2 drops) were added to a solution of 3-chloroquinoxalin-2-carboxylic acid (SM2, 270 mg, 1.3 mmol) dissolved in DCM (10 mL). The reaction mixture was stirred at room temperature for 0.5 hours. After the reaction, the mixture was concentrated to obtain intermediate 3 (293 mg) as a white solid.
[0731] LC / MS: 222 [Methanol Quenching, M-Cl+OCH3+H] + .
[0732] Example 62: 6-chloro-3-(3-chloroquinoxalin-2-carbonyl)-5-fluorobenzo[d]oxazole-2(3H)-one
[0733] Intermediate 2 (200 mg, 1.07 mmol) and Py (1.0 mL) were added to a solution in which Intermediate 3 (293 mg, 1.39 mmol) was dissolved in DCM (10 mL). The reaction mixture was stirred at room temperature for 1 hour. After the reaction, the mixture was concentrated. The mixture was extracted with EA (100 mL x 3). The combined organic phase was washed with water (20 mL) and brine (20 mL) and dried with anhydrous sodium sulfate. The obtained mixture was concentrated and purified by reverse-phase PREP-HPLC (MeCN in water, 90% v / v), then ground with MTBE (5.0 mL) and dried to obtain Example 62 (9 mg) as a white solid.
[0734] LC / MS: 358 [M+H] + .
[0735] 1 H-NMR (DMSO, 400 MHz,): δ 8.26-8.21 (m, 2H), 8.15-8.02 (m, 4H).
[0736] [Example 63] 3-(3-chloro-8-methylquinoxalin-2-carbonyl)-5-fluorobenzo[d]oxazole-2(3H)-one
[0737] Summary of the synthesis scheme of Example 63:
[0738]
[0739] Intermediate 1: Ethyl 3-hydroxy-8-methylquinoxalin-2-carboxylate
[0740] A mixture of 3-methylbenzene-1,2-diamine (SM1) (1.22 g, 10 mmol), diethyl 2-oxomalonate (1.74 g, 10 mmol), and citric acid (58 mg, 0.3 mmol) dissolved in ethanol (15 mL) was stirred at 40°C for 4 hours. The mixture was concentrated. The resulting concentrate was purified by silica gel flash column chromatography (ethyl acetate (EA) in petroleum ether (PE), 10% to 50% v / v) to obtain intermediate 1 (1.8 g) in the form of a yellow oil.
[0741] LC / MS: 233 [M+H] + .
[0742] Intermediate 2: Ethyl 3-chloro-8-methylquinoxalin-2-carboxylate
[0743] A mixture of intermediate 1 (1.7 g, 7.32 mmol) dissolved in POCl3 (5 mL) was stirred overnight at 110°C under a nitrogen atmosphere. The mixture was diluted with water (200 mL), adjusted with NaHCO3, and extracted with EA (500 mL). The resulting organic layer was dried with anhydrous sodium sulfate, filtered, and concentrated. The resulting concentrate was purified by silica gel flash column chromatography (ethyl acetate in petroleum ether, 10% to 30% v / v) to obtain intermediate 2 (700 mg) as a white solid.
[0744] LC / MS: 251 [M+H] + .
[0745] Intermediate 3: 3-chloro-8-methylquinoxalin-2-carboxylic acid
[0746] A mixture of intermediate 2 (600 mg, 2.39 mmol) and Na2CO3 (253 mg, 2.39 mmol) dissolved in MeOH (200 mL) and H2O (2 mL) was stirred at 60°C for 6 hours. The reaction product was concentrated. The obtained concentrate was purified by silica gel flash column chromatography (MeOH in DCM, 10% v / v) to obtain intermediate 3 (500 mg) as a white solid.
[0747] LC / MS: 223 [M +H]+ .
[0748] Example 63: 3-(3-chloro-8-methylquinoxalin-2-carbonyl)-5-fluorobenzo[d]oxazole-2(3H)-one
[0749] A mixture of intermediate 3 (410 mg, 1.84 mmol) and (COCl)2 (302 mg, 2.39 mmol) dissolved in DCM (20 mL) was mixed with DMF (1 drop) and stirred at room temperature for 30 minutes. The reaction mixture was concentrated. 5-fluorobenzo[d]oxazole-2(3H)-one (282 mg, 1.84 mmol), DCM (10 mL), and pyridine (1 mL) were added. The mixture was stirred at room temperature for 1 hour. The resulting reaction mixture was concentrated, and the concentrate was purified by reverse-phase chromatography using an eluent (MeCN in water, 10% to 100% v / v) to obtain Example 63 (300 mg) as a white solid.
[0750] LC / MS: 358 [M+H] + .
[0751] 1 H-NMR (DMSO, 400 MHz,): δ 8.02-8.05 (m, 1H), 7.94 (d, J = 8.4 Hz, 1H), 7.79 (d, J = 8.0 Hz, 1H), 7.68 (d, J = 6.8 Hz, 1H), 7.24-7.28 (m, 1H), 7.07-7.12 (m, 1H).
[0752] [Example 64] 3-(3-chloro-5-(trifluoromethyl)quinoxalin-2-carbonyl)-5-fluorobenzo[d]oxazole-2(3H)-one
[0753]
[0754] Example 64 (360 mg) was obtained using the PREP-HPLC separation method with 3-methylbenzene-1,2-diamine in the same manner as Example 63.
[0755] LC / MS: 358 [M+H] + .
[0756] 1 HNMR (DMSO, 400 MHz,): δ 8.32 (d, J= 7.6 Hz, 1H), 8.25 (d, J = 7.6 Hz, 1H), 8.01 (dd, J = 2.8 Hz, 8.0 Hz, 1H), 7.92 (t, J = 8.0 Hz, 1H), 7.26-7.29 (m, 1H), 7.08-7.13 (m, 1H).
[0757] [Experimental Example]
[0758] Experimental Example 1: hAhR Reporter Gene Analysis
[0759] HepG2-Luc TM AhR cell stock was thawed by dissolving it in growth medium (MEM with 10% FBS, 1% P / S). After thawing the stock, cells were cultured in growth medium without zeocin up to the second passage, and thereafter, zeocin (final concentration 100 μg / ml) was added to the growth medium for culture. The negative control (DMSO, final concentration 0.5%), the positive control (FICZ, final concentration 0.3 μM), and 64 test substances were diluted in the test medium and dispensed at 50 μl / well into 96-well white opaque plates. HepG2-Luc TM After washing AhR cells with DPBS and detaching them with Trypsin-EDTA solution, the cell count was calculated to reach a final of 5,000. 50 μl / well of the cells were then seeded into 96-well white opaque plates and cultured at 37°C in an O2 incubator for 24 hours. The next day, Quanti-Luc TM 4. Lucia working solution was prepared and added at a rate of 30 μl / well, and reacted at room temperature for 10 minutes. Luminescence was measured using an EnVision® 2105 plate reader.
[0760] The compound of the example was diluted from 1 mM in 1 / 10 increments to 10 concentrations, and the activity was calculated by dividing the measured luminescence value by the value of the FICZ treatment group. In this case, the value of the positive control FICZ treatment group was set to 100%, and the value of the DMSO treatment group was set to 0%.
[0761] EC of each of the example compounds 50 Values were calculated and classified into grades A, B, C, and D according to the calculated values: A: EC 50 ≤ 0.01 μM; B: 0.01 μM < EC 50 ≤ 0.1 μM; C: 0.1 μM < EC 50 ≤ 1.0 μM; D: EC 50 > 1.0 μM. Based on these classification results, the levels of AhR activity efficacy according to the AhR-Luc Human agonism analysis of the example compounds are shown in Table 1.
[0763] Example No. AhR-Luc Human agonism assay (EC 50 , nM range) Example No. AhR-Luc Human agonism assay (EC 50 , nM range) - - 33 D 2 C 34 D 3 D 35 C 4 A 36 D 5 D 37 D 6 D 38 D 7 B 39 D 8 A 40 A 9 A 41 C 10 D 42 D 11 C 43 D 12 D 44 C 13 D 45 D 14 D 46 D 15 B 47 C 16 D 48 A 17 C 49 A 18 D 50 A 19 C 51 A 20 B 52 A 21 D 53 B 22 B 54 C 23 A 55 D 24 A 56 D 25 A 57 C 26 D 58 D 27 B 59 C 28 D 60 A 29 A 61 A 30 B 62 A 31 C 63 C 32 D 64 D
[0764] For comparison, luminescence was measured for three comparative compounds with a benzoxazolone backbone structure using the same method, and EC 50 The values were calculated. As confirmed in Table 2, all comparative example compounds showed significant EC values. 50 It did not display a value.
[0765] Comparative Examples Agonism assay results EC 50 NA NA NA
[0766] Synthesizing the above results, all of the example compounds according to the present invention exhibit superior AhR agonistic activity compared to the comparative compounds, and in particular, Examples 4, 7, 8, 9, 15, 20, 22, 23, 24, 25, 27, 29, 30, 40, 48, 49, 50, 51, 52, 53, 60, 61, and 62 EC 50 It suggests that it will demonstrate excellent efficacy as an AhR agonist in light of its price.
[0767] Experimental Example 2: hAhR Nuclear Translocation (Movement) Analysis
[0768] When AhR binds to a ligand having agonist efficacy, it becomes activated, moves to the nucleus, and performs its original role as a transcription factor. The inventors intended to determine whether the heterocyclic compound according to the present invention activates AhR and promotes translocation to the nucleus.
[0769] To this end, a stable cell line was established using a lentiviral packaging system. An AhR-EGFP chimera was formed by cloning EGFP into the C-terminus of AHR. Human AhR-EGFP cDNA was cloned into the pLVX-TetO-CMV-rtTA-P2A-Puro vector. The psPAX2, pCMV-VSV-G, and pLVX-TetO-CMV-rtTA-P2A-Puro-AhR-EGFP plasmids were transfected into HEK293T cells using Lipofectamine™ 3000 Transfection Reagent. The viral supernatant was recovered and used to infect target cells (HEK293). Infected cells were treated with 2 μg / mL puromycin for 6 to 10 days to select polyclonal cells. Monoclonal cells were selected, expanded, and harvested to form 2 x 10⁶ cells. 6 After suspending cells in a freezing medium at a concentration of cells / mL, a certain amount was stored in liquid nitrogen.
[0770] Cells were digested and resuspended in DMEM (phenol red-free, containing 5% FBS, 1 μg / mL doxycycline). The cells were then plated in 40 μL of medium at a density of 8,000 cells per well in Poly-D-Lysine coated 384-well Black / Clear Flat Bottom Microplates (Corning) and incubated overnight at 37°C and 5% CO2. On the day of analysis, the compound was serially diluted to concentrations of 1:3 or 1:5 in 384-well plates supplemented with DMSO. The dose-response was represented by a 10-point curve. The compound was added via Echo at a rate of 40 nL per well to the 384-well plates containing the cells. The final DMSO concentration was 0.1%. Cells were incubated with the compound for 45 minutes at 37°C and 5% CO2. Cells were fixed with 4% PFA at room temperature for 20 minutes. The PFA was discarded, and the plates were washed twice with 50 μL of PBS per well. Then, 40 μL of DAPI (1:5000) was added to the cell plates, and the nuclei were stained with DAPI for 10 minutes at room temperature. The plates were washed twice with 50 μL of PBS per well and scanned using the Operetta CLS High Content Analysis System (Perkinelmer). The intensity of EGFP was quantified using the High Content Analysis System with 20x Objective and 9 fields per well.
[0771] EGFP values were measured for the selected example compounds at different concentrations, and the percentage of activation was calculated by dividing these values by the EGFP value of the positive control. The calculated values were subjected to 4-parameter non-linear logistic regression to determine the EC 50 Values were calculated. Based on the calculated values, they were classified into grades A, B, C, and D: A: EC 50 ≤ 0.01 μM; B: 0.01 μM < EC 50 ≤ 0.1 μM; C: 0.1 μM < EC 50 ≤ 1.0 μM; D: EC50 > 1.0 μM. Based on these classification results, EC according to hAHR nuclear translocation analysis of the example compound 50 The values are shown in Table 3.
[0772] Example No. hAhR-Nuclear Translocation (EC 50 , nM range) 4 A 8 C 9 A 20 B 24 C 25 C 27 A 29 C 40 C
[0773] According to the analysis results, all tested example compounds were found to activate AhR and promote its translocation (movement) to the nucleus. In particular, Examples 4, 9, 20, and 27 promoted the translocation of AhR to the nucleus even at very low concentrations, demonstrating excellent activity as AhR agonists.
[0774] Experimental Example 3: qRT-PCR analysis of CYP1A1 mRNA expression levels
[0775] AhR is an important transcriptional regulator in the pathways for maintaining the skin barrier and regulating skin immune homeostasis. Therefore, we intended to analyze the effect of the heterocyclic compound of the present invention on the expression of the CYP1A1 gene, which is closely related to AhR.
[0776] To this end, immortalized human keratinocytes (HaCaT cells), which are skin keratinocytes, were pre-cultured for 24 hours in an incubator at 37°C under 5% CO2 conditions. Subsequently, selected Examples 8, 9, 25, 27, 29, and 40 were diluted to concentrations of 0, 0.01, 0.1, 1, 10, 100, and 1000 nM, respectively, and treated with the cells, followed by incubation for 8 or 72 hours. After washing the cells with cold phosphate-buffered saline (PBS), total RNA was isolated using Qiagen’s RNA Mini Prep Kit (product number 74104) and quantified using a NanoDrop instrument. Then, 1 μg of RNA was used to synthesize complementary DNA (cDNA) using Thermo’s cDNA synthesis kit (K1622). Quantitative PCR (qPCR) was performed on the synthesized cDNA using the Applied Biosystems SYBR Green PCR Kit (A25742), and the gene-specific primers used are as follows: CYP1A1 (8-hour culture group): Forward; AGTGATTGGCAGGTCACGG, Reverse; GTCTCTTGTTGTGCTGTGGGG, GAPDH (housekeeping gene): Forward; GAGTCAACGGATTTGGTCGT, Reverse; TTGATTTTGGAGGGATCTCG.
[0777] For primer quality control, melting curve analysis was performed after amplification, and specific amplification was confirmed through the presence of a single peak. The appearance of multiple peaks or shoulders was determined to indicate non-specific amplification or primer dimer formation.
[0778] Gene expression levels were analyzed using the ΔΔCt method and normalized based on the endogenous gene GAPDH and the vehicle control group (0 nM treatment group). Specifically, ΔCt was calculated by correcting the Ct value of the CYP1A1 gene to the Ct value of GAPDH, and then the difference in ΔCt between the treatment group and the untreated group (treatment concentration 0) at each concentration was calculated as ΔΔCt. Subsequently, the relative expression amount was converted into a fold change value using the formula 2^(-ΔΔCt).
[0779] The relative expression amount (multiple change value) according to the concentration of the tested example compounds is shown as a graph in Figures 1 to 6.
[0780] Consequently, Examples 8, 9, 25, 27, 29, and 40, which represent the heterocyclic compounds of the present invention, all promoted the expression of the CYP1A1 gene in a concentration-dependent manner, and it was confirmed that they exhibited excellent effects, particularly even at very low concentrations. This suggests that the heterocyclic compounds of the present invention, as AhR agonists, can exhibit excellent therapeutic efficacy against skin diseases or disorders mediated by AhR, particularly autoimmune or inflammatory skin diseases including atopic dermatitis and psoriasis.
Claims
Claim 1 A heterocyclic compound represented by the following Chemical Formula 1 or a pharmaceutically acceptable salt thereof, wherein the heterocyclic compound or a pharmaceutically acceptable salt thereof has a structure represented by the following Chemical Formula 1-1 or 1-3: [Chemical Formula 1] In Chemical Formula 1, A is oxygen (O) or sulfur (S); Z1, Z2, Z3, and Z4 may be the same or different from one another and are each independently C-R1 or nitrogen (N), where R1 is hydrogen, deuterium, halogen (X), C1-C 10 Alkyl, hydroxy, C1-C 10 It is an alkoxy, -NH2, -CN, or -CX3, where the halogen (X) is fluorine (F), chloro (Cl), bromo (Br), or iodo (I); B is oxygen (O) or sulfur (S); W is a heterocyclic moiety in which the first ring (W1) and the second ring (W2) are fused, and at least one of the rings W1 and W2 has aromaticity, represented by the following chemical formula 1A; [Chemical Formula 1A] In Chemical Formula 1A, n is 0 or 1; m is 0 or 1; Y1 is carbon (C) or nitrogen (N); Y2 is carbon (C), provided that when n is 0, Y2 and Y6 are bonded to form a ring; Y3 is carbon (C), nitrogen (N), oxygen (O), or C-R2, where R2 is hydrogen, deuterium, halogen (X), or C1-C 10 Alkyl, hydroxy, C1-C 10 It is an alkoxy, -NH2, -CN, or -CX3, where halogen (X) is fluorine (F), chloro (Cl), bromo (Br), or iodo (I); Y4 is carbon (C), oxygen (O), nitrogen (N), NH, or N-CH3; Y5 is carbon (C); Y6 is carbon (C) or nitrogen (N); Y7, Y8, Y9, and Y 10 is a carbon (C) that forms an aromatic ring or a non-aromatic ring together with Y5 and Y6; represents the connecting position; R is a substituent bonded to the second ring (W2) of W, such as hydrogen, deuterium, halogen (X), or C1-C 10 Alkyl, hydroxy, C1-C 10 It is an alkoxy, -NH2, -CN, or -CX3, where the halogen (X) is fluorine (F), chloro (Cl), bromo (Br), or iodo (I); [Chemical Formula 1-1] ;[Chemical Formula 1-3] , in the above chemical formula 1-1 or 1-3, A; Z1, Z2, Z3, Z4; B; W1, W2; Y1, Y2, Y3, Y4, Y5, Y6, Y7, Y8, Y9, Y 10 ; and R are each the same as defined in Chemical Formula 1 and Chemical Formula 1A. Claim 2 A heterocyclic compound or a pharmaceutically acceptable salt thereof, wherein W represented by Formula 1A is selected from the group consisting of the following heterocyclic structures: Here, R2 is hydrogen, deuterium, halogen(X), C1-C 10 Alkyl, hydroxy, C1-C 10 It is an alkoxy, -NH2, -CN, or -CX3, where the halogen (X) is fluorine (F), chloro (Cl), bromo (Br), or iodo (I); means the location where it is connected. Claim 3 delete Claim 4 The heterocyclic compound or a pharmaceutically acceptable salt thereof, wherein the heterocyclic compound represented by Formula 1 is selected from the group consisting of the following compounds: 6-chloro-3-(indoleizine-3-carbonyl)benzo[d]oxazole-2(3H)-one; 6-chloro-3-(7-fluoroindoleizine-3-carbonyl)benzo[d]oxazole-2(3H)-one; 6-chloro-3-(imidazoo[1,2-a]pyridin-3-carbonyl)benzo[d]oxazole-2(3H)-one; 6-chloro-3-(6-fluoroimidazoo[1,2-a]pyridin-3-carbonyl)benzo[d]oxazole-2 (3H)-one; 6-chloro-3-(7-fluoroimidazo[1,2-a]pyridin-3-carbonyl)benzo[d]oxazole-2(3H)-one; 6-fluoro-3-(quinoxalin-2-carbonyl)benzo[d]oxazole-2(3H)-one; 3-(3-chloroquinoxalin-2-carbonyl)-6-fluorobenzo[d]oxazole-2(3H)-one; 6-chloro-3-(1H-indole-3-carbonyl)benzo[d]oxazole-2(3H) -one;6-chloro-3-(1H-indazole-3-carbonyl)benzo[d]oxazole-2(3H)-one;3-(3-chloroquinoxalin-2-carbonyl)-6-fluorobenzo[d]oxazole-2(3H)-one;3-(1-methyl-2-oxo-1,2-dihydroquinoline-3-carbonyl)benzo[d]oxazole-2(3H) -one;6-chloro-3-(1-methyl-2-oxo-1,2-dihydroquinoline-3-carbonyl)benzo[d]oxazole-2(3H)-one;6-chloro-3-(1,5-dimethyl-2-oxo-1,2,5,6,7,8-hexahydroquinoline-3-carbonyl)benzo[d]oxazole-2(3H)-one;3-(imidazo[1,2 -a]pyridin-3-carbonyl)benzo[d]oxazole-2(3H)-one; 6-hydroxy-3-(imidazo[1,2-a]pyridin-3-carbonyl)benzo[d]oxazole-2(3H)-one; 3-(3-chloroquinoxalin-2-carbonyl)-6-fluorobenzo[d]oxazole-2(3H)-one; 6-amino-3-(imidazo[ 1,2-a]pyridin-3-carbonyl)benzo[d]oxazole-2(3H)-one; 3-(imidazo[1,2-a]pyridin-3-carbonyl)-2-oxo-2,3-dihydrobenzo[d]oxazole-6-carbonitrile; 6-fluoro-3-(imidazo[1,2-a]pyridin-3-carbonyl)benzo[d]oxazole-2(3H)-one;6-chloro-3-(7-methylimidazo[1,2-a]pyridin-3-carbonyl)benzo[d]oxazole-2(3H)-one; 6-chloro-3-(8-methoxyimidazo[1,2-a]pyridin-3-carbonyl)benzo[d]oxazole-2(3H)-one; 3-(2-chloroquinoline-3-carbonyl)-6-fluorobenzo[d]oxazole-2(3H)-one; 3-(3-chloroquinoxaline-2-carbonyl)-5-fluorobenzo[d]oxazole-2(3H)-one; 6-chloro-3-(3-chloroquinoxaline-2-carbonyl)benzo[d]oxazole-2(3H)-one; 1-(imidazo[1,2-a]pyridin-3 -carbonyl)oxazolo[5,4-c]pyridin-2(1H)-one; 6-chloro-3-(8-methylimidazo[1,2-a]pyridin-3-carbonyl)benzo[d]oxazol-2(3H)-one; 6-chloro-3-(7-methoxyimidazo[1,2-a]pyridin-3-carbonyl)benzo[d]oxazol-2(3H)-one; 3-(3-chloroquinoline-2-carbonyl)-6-fluorobenzo[d]oxazol-2(3H)-one; 3-(3-chloroquinoxaline-2-carbonyl)-7-fluorobenzo[d]oxazol-2(3H)-one; 6-fluoro-3-(3-methoxyquinoxaline-2-carbonyl)benzo[d]oxazol sol-2(3H)-one; 6-chloro-3-(2-methylimidazo[1,2-a]pyridin-3-carbonyl)benzo[d]oxazole-2(3H)-one; 3-(imidazo[1,2-a]pyridin-3-carbonyl)oxazolo[4,5-b]pyridin-2(3H)-one; 3-(imidazo[1,2-a]pyridin-3-carbonyl)oxazolo[4,5-c]pyridin-2(3H)-one; 6-chloro-3-(2-chloroimidazo[1,2-a]pyridin-3-carbonyl)benzo[d]oxazole-2(3H)-one; 3-(imidazo[1,2-a]pyridin-3-carbonyl)oxazolo[4,5-b]pyridin-2(3 H)-one; 3-(6-chloro-2-oxo-2,3-dihydrobenzo[d]oxazole-3-carbonyl)imidazo[1,2-a]pyridin-7-carbonitrile; 3-(3-chloroquinoxalin-2-carbonyl)-4-fluorobenzo[d]oxazole-2(3H)-one; 6-fluoro-3-(3-hydroxyquinoxalin-2-carbonyl)benzo[d]oxazole-2(3H)-one; 6-fluoro-3-(3-methylquinoxalin-2-carbonyl)benzo[d]oxazole-2(3H)-one; 6-chloro-3-(8-hydroxyimidazo[1,2-a]pyridin-3-carbonyl)benzo[d]oxazole-2(3H)-one;6-chloro-3-(7-hydroxyimidazo[1,2-a]pyridin-3-carbonyl)benzo[d]oxazole-2(3H)-one; 3-(7-aminoimidazo[1,2-a]pyridin-3-carbonyl)-6-chlorobenzo[d]oxazole-2(3H)-one; 6-chloro-3-(2-hydroxyimidazo[1,2-a]pyridin-3-carbonyl)benzo[d]oxazole-2(3H)-one; 6-fluoro-3-(3-fluoroquinoxalin-2-car Bonyl)benzo[d]oxazole-2(3H)-one; 6-chloro-3-(3-fluoroquinoxalin-2-carbonyl)benzo[d]oxazole-2(3H)-one; 5-fluoro-3-(1H-indole-3-carbonyl)benzo[d]oxazole-2(3H)-one; 6-chloro-3-(7-fluoro-1H-indole-3-carbonyl)benzo[d]oxazole-2(3H)-one; 6-chloro-3-(6-fluoro-1H-indole-3-carbonyl)benzo[d]oxazole-2 (3H)-one; 6-chloro-3-(5-fluoro-1H-indole-3-carbonyl)benzo[d]oxazole-2(3H)-one; 6-chloro-3-(4-fluoro-1H-indole-3-carbonyl)benzo[d]oxazole-2(3H)-one; 3-(benzofuran-3-carbonyl)-6-chlorobenzo[d]oxazole-2(3H)-one; 6-chloro-3-(2-chlorobenzofuran-3-carbonyl)benzo[d]oxazole-2(3H)-one; 6-chloro-5- Fluoro-3-(imidazo[1,2-a]pyridin-3-carbonyl)benzo[d]oxazole-2(3H)-one; 5-chloro-6-fluoro-3-(imidazo[1,2-a]pyridin-3-carbonyl)benzo[d]oxazole-2(3H)-one; 5-fluoro-3-(imidazo[1,2-a]pyridin-3-carbonyl)benzo[d]oxazole-2(3H)-one; 3-(imidazo[1,2-a]pyridin-3-carbonyl)-6-(trifluoromethyl) Benzo[d]oxazole-2(3H)-one; 3-(imidazo[1,2-a]pyridin-3-carbonyl)-5-(trifluoromethyl)benzo[d]oxazole-2(3H)-one; 6-chloro-3-(8-(trifluoromethyl)imidazo[1,2-a]pyridin-3-carbonyl)benzo[d]oxazole-2(3H)-one; 3-(3-methylquinoxalin-2-carbonyl)benzo[d]oxazole-2(3H)-one; 3-(3-chloroquinoxalin-2-carbonyl)-5,6-difluorobenzo[d]oxazole-2(3H)-one; 6-chloro-3-(3-chloroquinoxalin-2-carbonyl)-5-fluorobenzo[d]oxazole-2(3H)-one;3-(3-chloro-5-methylquinoxalin-2-carbonyl)-5-fluorobenzo[d]oxazole-2(3H)-one; and 3-(3-chloro-5-(trifluoromethyl)quinoxalin-2-carbonyl)-5-fluorobenzo[d]oxazole-2(3H)-one.; Claim 5 A heterocyclic compound or a pharmaceutically acceptable salt thereof, wherein the heterocyclic compound represented by Formula 1 exhibits activity of binding to and activating an aryl hydrocarbon receptor (AhR). Claim 6 A pharmaceutical composition for use in preventing, improving, or treating an aryl hydrocarbon receptor (AhR)-mediated disease or disorder, comprising as an active ingredient a heterocyclic compound according to any one of claims 1, 2, 4, and 5 or a pharmaceutically acceptable salt thereof, wherein the AhR-mediated disease is one or more selected from the group consisting of autoimmune and inflammatory diseases, dermatological disorders, metabolic and cardiovascular diseases, cancer, and neurodegenerative diseases, wherein the autoimmune and inflammatory diseases include systemic lupus erythematosus, rheumatoid arthritis, multiple sclerosis, asthma, allergic reactions, or inflammatory bowel disease; wherein the dermatological disorders include psoriasis, atopic dermatitis, acne, or hidradenitis suppurativa; and wherein the metabolic and cardiovascular diseases include metabolic syndrome, obesity, dyslipidemia, fatty liver, insulin resistance syndrome, diabetes mellitus, atherosclerosis, diabetic nephropathy, or chronic kidney disease. A pharmaceutical composition comprising a disease, or coronary artery disease; wherein the cancer comprises breast cancer, prostate cancer, colorectal cancer, liver cancer, head and neck cancer, or pancreatic cancer; and wherein the neurodegenerative disease comprises brain inflammation, blood-brain barrier (BBB) impairment, cognitive decline, Alzheimer's disease, or multiple sclerosis. Claim 7 delete Claim 8 delete Claim 9 A pharmaceutical composition according to claim 6, wherein the pharmaceutical composition further comprises one or more selected from the group consisting of pharmaceutically acceptable carriers, adjuvants, and vehicles. Claim 10 A health functional food composition for use in preventing or improving aryl hydrocarbon receptor (AhR)-mediated diseases or disorders, comprising as an active ingredient a heterocyclic compound according to any one of claims 1, 2, 4, and 5 or a food-grade salt thereof, wherein the AhR-mediated disease is one or more selected from the group consisting of autoimmune and inflammatory diseases, dermatological disorders, metabolic and cardiovascular diseases, cancer, and neurodegenerative diseases, wherein the autoimmune and inflammatory diseases include systemic lupus erythematosus, rheumatoid arthritis, multiple sclerosis, asthma, allergic reactions, or inflammatory bowel disease; wherein the dermatological disorders include psoriasis, atopic dermatitis, acne, or hidradenitis suppurativa; and wherein the metabolic and cardiovascular diseases include metabolic syndrome, obesity, dyslipidemia, fatty liver, insulin resistance syndrome, diabetes mellitus, atherosclerosis, diabetic nephropathy, chronic kidney disease, A health functional food composition comprising or including coronary artery disease; wherein the cancer comprises breast cancer, prostate cancer, colorectal cancer, liver cancer, head and neck cancer, or pancreatic cancer; and wherein the neurodegenerative disease comprises brain inflammation, blood-brain barrier (BBB) damage, cognitive decline, Alzheimer's disease, or multiple sclerosis. Claim 11 A feed composition for use in preventing or improving aryl hydrocarbon receptor (AhR)-mediated diseases or disorders, comprising as an active ingredient a heterocyclic compound according to any one of claims 1, 2, 4, and 5 or a feed-acceptable salt thereof, wherein the AhR-mediated disease is one or more selected from the group consisting of autoimmune and inflammatory diseases, dermatological disorders, metabolic and cardiovascular diseases, cancer, and neurodegenerative diseases, wherein the autoimmune and inflammatory diseases include systemic lupus erythematosus, rheumatoid arthritis, multiple sclerosis, asthma, allergic reactions, or inflammatory bowel disease; wherein the dermatological disorders include psoriasis, atopic dermatitis, acne, or hidradenitis suppurativa; and wherein the metabolic and cardiovascular diseases include metabolic syndrome, obesity, dyslipidemia, fatty liver, insulin resistance syndrome, diabetes mellitus, atherosclerosis, diabetic nephropathy, chronic kidney disease, or A feed composition comprising coronary artery disease; wherein the cancer comprises breast cancer, prostate cancer, colorectal cancer, liver cancer, head and neck cancer, or pancreatic cancer; and wherein the neurodegenerative disease comprises brain inflammation, blood-brain barrier (BBB) damage, cognitive decline, Alzheimer's disease, or multiple sclerosis. Claim 12 A container containing a composition comprising, as an active ingredient, a heterocyclic compound according to any one of claims 1, 2, 4, and 5 or a pharmaceutically acceptable salt thereof; A kit for use to prevent, improve, or treat an aryl hydrocarbon receptor (AhR)-mediated disease or disorder, comprising an instruction manual, wherein the AhR-mediated disease is one or more selected from the group consisting of autoimmune and inflammatory diseases, dermatological disorders, metabolic and cardiovascular diseases, cancer, and neurodegenerative diseases, wherein the autoimmune and inflammatory diseases include systemic lupus erythematosus, rheumatoid arthritis, multiple sclerosis, asthma, allergic reactions, or inflammatory bowel disease; wherein the dermatological disorders include psoriasis, atopic dermatitis, acne, or hidradenitis suppurativa; wherein the metabolic and cardiovascular diseases include metabolic syndrome, obesity, dyslipidemia, fatty liver, insulin resistance syndrome, diabetes mellitus, atherosclerosis, diabetic nephropathy, chronic kidney disease, or coronary artery disease; and wherein the cancer includes breast cancer, prostate cancer, colorectal cancer, liver cancer, head and neck cancer, or pancreatic cancer. A kit comprising; wherein the neurodegenerative disease includes brain inflammation, blood-brain barrier (BBB) impairment, cognitive decline, Alzheimer's disease, or multiple sclerosis.