Method for detecting biomarker using cell-free transcription
A cell-free transcription reaction using substrate and sensor DNA with T7 RNA polymerase enables sensitive and efficient detection of Flap Endonuclease 1 (FEN1) and evaluation of inhibitors, addressing the limitations of existing biomarker detection methods.
Patent Information
- Application Number
- KR1020230157788
- Authority / Receiving Office
- KR · KR
- Patent Type
- Patents
- Current Assignee / Owner
- Filing Date
- 2023-11-15
- Publication Date
- 2026-07-15
- Estimated Expiration
- 2043-11-15
AI Technical Summary
Existing methods for detecting biomarkers, such as Western blot and ELISA, are limited by long analysis times, low sensitivity, and high costs, and there is a lack of methods utilizing cell-free transcription reactions for biomarker detection.
A method involving a cell-free transcription reaction using substrate DNA, sensor DNA, and T7 RNA polymerase to detect Flap Endonuclease 1 (FEN1) by generating a light-up aptamer through a fluorophore detection system.
The method allows for the confirmation of FEN1 content and evaluation of FEN1 inhibitors, providing a sensitive and efficient detection of FEN1 in tissues and evaluating inhibitor efficacy.
Smart Images

Figure 112023126151139-PAT00008_ABST
Abstract
Description
Technology Field
[0001] The present invention relates to a method for detecting biomarkers using a cell-free transcription reaction. Background Technology
[0002] The detection of tumor biomarkers in bodily fluids represents a significant advancement in cancer treatment, as it enables diagnosis without the need for invasive tissue biopsies. Nucleases have long been regarded as a class of potential biomarkers capable of indicating the onset and progression of cancer. For example, Flap Endonuclease 1 (FEN1) plays a crucial role in DNA replication and repair and is overexpressed, particularly in abnormally proliferating cells such as cancer cells. Therefore, FEN1 is considered not only a target for cancer treatment but also a potential biomarker. In particular, it has been actively utilized in the diagnosis and prognosis of various types of cancer, including testicular cancer, lung cancer, breast cancer, prostate cancer, gastric cancer, and brain cancer.
[0003] However, Western blot or ELISA (enzyme-linked immunosorbent assay) have mostly been used as analytical methods for the diagnosis or treatment of cancer, and these methods have several limitations, such as long analysis time, low sensitivity, and high cost.
[0004] On the other hand, the unique enzymatic activity of FEN1, which cleaves branched nucleic acids (flaps), can be utilized to generate amplified detection signals, thereby leading to the development of techniques that can overcome several limitations associated with conventional detection methods. For example, a method using a fluorescently labeled flap sequence as a substrate for FEN1 is known, in which the fluorescent dye is quenched by adsorbing a flap-containing DNA structure onto a graphene oxide surface. When the flap strand is cleaved by FEN1, the fluorescent dye escapes from the graphene oxide surface. This method has enabled the detection of picomolar concentrations of FEN1 within 120 minutes. Another technique disclosed involves the use of gold nanoparticles to quench the fluorescent dye turned on by FEN1-mediated cleavage. However, these methods have the problem of involving complex processes such as chemical modification of DNA, assembly of complex DNA structures, and the formation of DNA-nanoparticle complexes.
[0005] Meanwhile, regarding target substance detection technology using a transcription system, Korean Registered Patent No. 2513569 discloses technology relating to a high-sensitivity sensor based on a transcription system, and regarding flap DNA-related technology, Korean Registered Patent No. 1787817 discloses the determination of a nucleic acid cleavage enzyme protein complex and a method for manufacturing the same; however, there has not yet been any disclosure regarding a method for detecting biomarkers using the cell-free transcription reaction of the present invention. The problem to be solved
[0006] The present invention was derived from the above-mentioned requirements, and the present invention provides a method for detecting a biomarker using a cell-free transcription reaction, and the present invention was completed by confirming that, with the detection method according to the present invention, not only can the content of Flap Endonuclease 1 (FEN1) contained in a target tissue be confirmed, but the efficacy of FEN1 inhibitors can also be evaluated. means of solving the problem
[0007] To achieve the above objective, the present invention comprises the steps of: (1) adding to a single-pot a substrate DNA in which the oligonucleotides of SEQ ID NO. 1 and 2 bind complementarily to the oligonucleotide of SEQ ID NO. 3, wherein a flap sequence is additionally connected to the 5' end of the oligonucleotide of SEQ ID NO. 1; a sensor DNA comprising an antisense sequence complementary to the flap at the 3' end; and T7 RNA polymerase.
[0008] (2) A step of adding a lysate of tissue suspected of overexpressing Flap Endonuclease 1 (FEN1) to a container containing the substrate DNA, sensor DNA, and T7 RNA polymerase;
[0009] (3) After step (2) above, the temperature is adjusted to 30~37℃ so that FEN1 contained in the tissue lysate cleaves the flap sequence to generate trigger DNA, and the generated trigger DNA binds to the 3' end of the sensor DNA to form a partially double strand of sensor DNA, after which T7 RNA polymerase recognizes the double strand and initiates a cell-free transcription reaction;
[0010] (4) After step (3) above, a step of synthesizing a light-up aptamer by maintaining a cell-free transcription reaction for 30 minutes to 3 hours; and
[0011] (5) After step (4), a fluorophore is added to the reaction vessel in which the light-up aptamer is generated to detect the amount of the synthesized light-up aptamer; thereby providing a method for detecting flap endonuclease 1 (FEN1) using a cell-free transcription reaction.
[0012] In addition, the present invention comprises the step of adding (1) substrate DNA in which the oligonucleotides of SEQ ID NO. 1 and 2 bind complementarily to the oligonucleotide of SEQ ID NO. 3, wherein a flap sequence is additionally connected to the 5' end of the oligonucleotide of SEQ ID NO. 1; sensor DNA comprising an antisense sequence complementary to the flap at the 3' end; and T7 RNA polymerase to a single-pot container;
[0013] (2) A step of adding a lysate of tissue suspected of overexpressing Flap Endonuclease 1 (FEN1) and a FEN1 inhibitor to a container containing the substrate DNA, sensor DNA, and T7 RNA polymerase;
[0014] (3) After step (2) above, the temperature is adjusted to 30~37℃ so that FEN1 contained in the tissue lysate cleaves the flap sequence to generate trigger DNA, and the generated trigger DNA binds to the 3' end of the sensor DNA to form a partially double strand of sensor DNA, after which T7 RNA polymerase recognizes the double strand and initiates a cell-free transcription reaction;
[0015] (4) After step (3) above, a step of synthesizing a light-up aptamer by maintaining a cell-free transcription reaction for 30 minutes to 3 hours; and
[0016] (5) After step (4), a fluorophore is added to the reaction vessel in which the light-up aptamer is generated to detect the amount of the synthesized light-up aptamer; thereby providing a method for evaluating the efficacy of an FEN1 inhibitor.
[0017] In addition, the present invention comprises the step of adding (1) substrate DNA in which the oligonucleotides of SEQ ID NO. 1 and 2 bind complementarily to the oligonucleotide of SEQ ID NO. 3, wherein a flap sequence is additionally connected to the 5' end of the oligonucleotide of SEQ ID NO. 1; sensor DNA comprising an antisense sequence complementary to the flap at the 3' end; and T7 RNA polymerase to a single-pot container;
[0018] (2) A step of adding a lysate of tissue suspected of overexpressing Flap Endonuclease 1 (FEN1) and a candidate substance for inhibiting FEN1 to a container containing the substrate DNA, sensor DNA, and T7 RNA polymerase;
[0019] (3) After step (2) above, the temperature is adjusted to 30~37℃ so that FEN1 contained in the tissue lysate cleaves the flap sequence to generate trigger DNA, and the generated trigger DNA binds to the 3' end of the sensor DNA to form a partially double strand of sensor DNA, after which T7 RNA polymerase recognizes the double strand and initiates a cell-free transcription reaction;
[0020] (4) After step (3) above, a step of synthesizing a light-up aptamer by maintaining a cell-free transcription reaction for 30 minutes to 3 hours; and
[0021] (5) After step (4), a fluorophore is added to the reaction vessel in which the light-up aptamer is generated to detect the amount of the synthesized light-up aptamer; thereby providing a method for screening FEN1 inhibitors. Effects of the invention
[0022] The present invention relates to a method for detecting biomarkers using a cell-free transcription reaction. The detection method according to the present invention can not only confirm the content of Flap Endonuclease 1 (FEN1) contained in a target tissue, but also evaluate the efficacy of FEN1 inhibitors. Brief explanation of the drawing
[0023] Figure 1 shows the results of in vitro transcription from partially double-stranded template DNA. The antisense strand of DNA encoding the broccoli light-up aptamer at the T7 promoter was annealed to the sense strand of the T7 promoter, and the annealed DNA was incubated in an in vitro transcription reaction mixture at 37°C for 3 hours. Subsequently, the fluorescence values from the broccoli aptamer (white bars) and the entirely double-stranded template DNA (gray bars) were compared. Error bars represent the standard deviation for three independent experiments. Figure 2 is a schematic diagram illustrating the detection process of FEN1 combined with the enzymatic activity of FEN1 and the in vitro transcription of broccoli RNA aptamers. It shows that trigger DNA is released by the internal decomposition activity of FEN1, and the trigger DNA released after being cleaved by FEN1 binds to the T7 promoter region of the single-stranded sensor DNA and initiates the transcription of the broccoli aptamers encoded in the sensor DNA. Figure 3 shows the results of native polyacrylamide gel electrophoresis (PAGE) analysis following an in vitro transcription reaction by T7 RNA polymerase after the binding of trigger DNA released by FEN1 and sensor DNA. Lane M, DNA molecular weight marker; Lane 1, ON1; Lane 2, ON2; Lane 3, ON3; Lane 4, substrate DNA (ON1 + ON2 + ON3); Lane 5, sensor DNA; Lane 6, substrate DNA after incubation with FEN1; Lane 7, chemically synthesized trigger DNA (flap sequence); Lane 8, aptamer from an in vitro transcription reaction using a mixture of sensor DNA (lane 5) and FEN1-incubated substrate DNA (lane 6); Lane 9, broccoli aptamer purified from an in vitro transcription reaction using a complete double-stranded DNA template. Figure 4 shows the results of confirming the flap cleavage and in vitro transcription of substrate DNA. (A) Results of the FEN1-mediated flap cleavage reaction and in vitro transcription performed as a two-step reaction; the trigger DNA obtained from the FEN1-mediated flap cleavage reaction (Step 1) was added to the in vitro transcription reaction to perform the transcription reaction by T7 RNA polymerase (Step 2). (B) Results of combining the FEN1-mediated flap cleavage reaction and the in vitro transcription reaction in a single vessel by adjusting the buffer conditions required for the reaction. Error bars represent the standard deviation for three independent experiments. Figure 5 shows the results of combining the FEN1-mediated flap cleavage reaction and the in vitro transfer reaction in a single container. (A) shows the fluorescence intensity according to FEN1 concentrations of 0.1–100 nM, representing the results of the transfer reaction for 1 hour (gray bars), and the white bars represent the fluorescence values for the buffer in which no transfer reaction occurred. (B) shows the fluorescence intensity after performing the combined FEN1-mediated flap cleavage reaction and the in vitro transfer reaction in a single container for 30 minutes–3 hours. Error bars represent the standard deviation for three independent experiments. Figure 6 shows the results of optimizing substrate DNA for FEN1 detection. (A) The effect of varying trigger DNA length was confirmed by adjusting the length of the flap sequence detached from the substrate DNA by FEN1 from 20 nucleotides to 9 nucleotides. Gray bars represent signals obtained with different concentrations of FEN1, while empty bars represent the background signal in the absence of FEN1. (B) shows the results obtained using 12-nucleotide trigger DNA at various concentrations of FEN1. (C) The results of analysis for different types of endo- and exonucleases. The fluorescence change value represents the fluorescence change divided by the background value obtained by subtracting the background signal in the absence of FEN1 from each fluorescence signal. Error bars represent the standard deviation for three independent experiments. Figure 7 shows the results of confirming enhanced detection sensitivity using a malachite green light-up aptamer. Figure 8 shows the results of confirming FEN1 detection in cancer cells using cancer cell lines (MCF7, HepG2, HeLA, and A549) known to overexpress FEN1. Heat-inactivated MCF7 cell lysates were used as a negative control. FEN1 detection was performed in the absence of substrate DNA (white bars) or in the presence of substrate DNA (gray bars). Error bars represent the standard deviation for three independent experiments. Figure 9 shows the results confirming the effects of FEN1 inhibitors. (A) Results confirming the inhibition of FEN1 activity after pre-incubation at 37°C for 1 hour under conditions containing 100 nM purified human FEN1 and 100 nM of a FEN1 inhibitor, which is the same concentration as FEN1; and (B) Results confirming the change in FEN1 activity after incubating a mixture of FEN1-overexpressing cell line lysates and 100 nM ATA (Aurintricarboxylic acid). Compared to the control response performed in the absence of ATA (white bars), the cancer cell lysates treated with ATA showed significantly reduced FEN1 activity (gray bars). Error bars represent the standard deviation for three independent experiments. Specific details for implementing the invention
[0024] The present invention comprises the steps of: (1) adding a substrate DNA in which the oligonucleotides of SEQ ID NO. 1 and 2 bind complementarily to the oligonucleotide of SEQ ID NO. 3, wherein a flap sequence is additionally connected to the 5' end of the oligonucleotide of SEQ ID NO. 1; a sensor DNA comprising an antisense sequence complementary to the flap at the 3' end; and T7 RNA polymerase to a single-pot container;
[0025] (2) A step of adding a lysate of tissue suspected of overexpressing Flap Endonuclease 1 (FEN1) to a container containing the substrate DNA, sensor DNA, and T7 RNA polymerase;
[0026] (3) After step (2) above, the temperature is adjusted to 30~37℃ so that FEN1 contained in the tissue lysate cleaves the flap sequence to generate trigger DNA, and the generated trigger DNA binds to the 3' end of the sensor DNA to form a partially double strand of sensor DNA, after which T7 RNA polymerase recognizes the double strand and initiates a cell-free transcription reaction;
[0027] (4) After step (3) above, a step of synthesizing a light-up aptamer by maintaining a cell-free transcription reaction for 30 minutes to 3 hours; and
[0028] (5) After step (4), a fluorophore is added to the reaction vessel in which the light-up aptamer is generated to detect the amount of the synthesized light-up aptamer; the present invention relates to a method for detecting flap endonuclease 1 (FEN1) using a cell-free transcription reaction.
[0029] The sensor DNA is preferably DNA transcribed into any one of the light-up aptamers selected from broccoli aptamer, malachite green aptamer, spinach2 aptamer, baby spinach aptamer, mbaby spinach aptamer, mango aptamer, BFR (Blue Fluorescent RNA) aptamer, and sulforhodamine B aptamer; more preferably, the broccoli aptamer is a broccoli aptamer transcribed from the nucleotide sequence of SEQ ID NO. 5, and the malachite green aptamer is a malachite green aptamer transcribed from the nucleotide sequence of SEQ ID NO. 6, but is not limited thereto.
[0030] The above fluorescent dye is preferably selected from DFHBI (3,5-difluoro-4-hydroxybenzylidene imidazolinone), DFHBI-1T, thiazole orange T01, thiazole orange T03, sulforhodamine B, and Hoechst, but is not limited thereto.
[0031] The tissue suspected of having overexpressed Flap Endonuclease 1 (FEN1) may be a cancerous tissue, and the cancer is preferably, but not limited to, lung cancer, breast cancer, liver cancer, cervical cancer, testicular cancer, prostate cancer, stomach cancer, or brain cancer.
[0032] The length of the trigger DNA generated in step (3) above is preferably composed of 12 to 20 bases, and more preferably 12 bases, but is not limited thereto.
[0033] In addition, the present invention comprises the step of adding (1) substrate DNA in which the oligonucleotides of SEQ ID NO. 1 and 2 bind complementarily to the oligonucleotide of SEQ ID NO. 3, wherein a flap sequence is additionally connected to the 5' end of the oligonucleotide of SEQ ID NO. 1; sensor DNA comprising an antisense sequence complementary to the flap at the 3' end; and T7 RNA polymerase to a single-pot container;
[0034] (2) A step of adding a lysate of tissue suspected of overexpressing Flap Endonuclease 1 (FEN1) and a FEN1 inhibitor to a container containing the substrate DNA, sensor DNA, and T7 RNA polymerase;
[0035] (3) After step (2) above, the temperature is adjusted to 30~37℃ so that FEN1 contained in the tissue lysate cleaves the flap sequence to generate trigger DNA, and the generated trigger DNA binds to the 3' end of the sensor DNA to form a partially double strand of sensor DNA, after which T7 RNA polymerase recognizes the double strand and initiates a cell-free transcription reaction;
[0036] (4) After step (3) above, a step of synthesizing a light-up aptamer by maintaining a cell-free transcription reaction for 30 minutes to 3 hours; and
[0037] (5) After step (4), a fluorophore is added to the reaction vessel in which the light-up aptamer is generated to detect the amount of the synthesized light-up aptamer; the method for evaluating the efficacy of a FEN1 inhibitor comprises the step of adding a fluorophore to the reaction vessel in which the light-up aptamer is generated.
[0038] The method for evaluating the efficacy of the above FEN1 inhibitor is to compare the amount of synthesized light-up aptamers when the FEN1 inhibitor is added and when it is not added in step (2). If the amount of synthesized light-up aptamers is smaller when the FEN1 inhibitor is added compared to when it is not added, the efficacy of the FEN1 inhibitor can be evaluated as higher.
[0039] The above FEN1 inhibitor is preferably selected from ATA (Aurintricarboxylic acid), FEN1-IN-1 (1-[(2,3-Dihydro-1,4-benzodioxin-2-yl)methyl]-3-hydroxythieno[3,2-d]pyrimidine-2,4(1H,3H)-dione), FEN1-IN-4 (1-(Cyclopropylmethyl)-3-hydroxyquinazoline-2,4(1H,3H)-dione) and NSC-13755 (2-Nitro-4-stibonobenzoic acid), but is not limited thereto.
[0040] In the present invention, 'detection' means confirming the presence or absence of a target substance, including quantitative or semi-quantitative determination of the target substance.
[0041] The detection sensitivity of the target substance of the present invention can be expressed as a limit of detection (LOD) value, which means the minimum concentration of the target substance that can be detected and distinguished between cases where the target substance is present and cases where it is not present.
[0042] In addition, the present invention comprises the step of adding (1) substrate DNA in which the oligonucleotides of SEQ ID NO. 1 and 2 bind complementarily to the oligonucleotide of SEQ ID NO. 3, wherein a flap sequence is additionally connected to the 5' end of the oligonucleotide of SEQ ID NO. 1; sensor DNA comprising an antisense sequence complementary to the flap at the 3' end; and T7 RNA polymerase to a single-pot container;
[0043] (2) A step of adding a lysate of tissue suspected of overexpressing Flap Endonuclease 1 (FEN1) and a candidate substance for inhibiting FEN1 to a container containing the substrate DNA, sensor DNA, and T7 RNA polymerase;
[0044] (3) After step (2) above, the temperature is adjusted to 30~37℃ so that FEN1 contained in the tissue lysate cleaves the flap sequence to generate trigger DNA, and the generated trigger DNA binds to the 3' end of the sensor DNA to form a partially double strand of sensor DNA, after which T7 RNA polymerase recognizes the double strand and initiates a cell-free transcription reaction;
[0045] (4) After step (3) above, a step of synthesizing a light-up aptamer by maintaining a cell-free transcription reaction for 30 minutes to 3 hours; and
[0046] (5) After step (4), a fluorophore is added to the reaction vessel in which the light-up aptamer is generated to detect the amount of the synthesized light-up aptamer; the method for screening FEN1 inhibitors comprises the step of adding a fluorophore to the reaction vessel in which the light-up aptamer is generated.
[0047] The above method for screening FEN1 inhibitors is to compare the amount of synthesized light-up aptamers when a FEN1 inhibitor candidate substance is added and when it is not added in step (2), and if the amount of synthesized light-up aptamers when a FEN1 inhibitor candidate substance is added is less than when it is not added, it can be determined to be a FEN1 inhibitor.
[0048] The present invention will be described in more detail below using examples. These examples are solely for the purpose of explaining the present invention more specifically, and it is obvious to those skilled in the art that the scope of the present invention is not limited by them.
[0049] [Materials and Methods]
[0050] 1. Ingredients
[0051] T7 RNA polymerase, ribonucleoside triphosphate, RNase inhibitor, and 10× FEN1 reaction buffer were purchased from Engenomics (Daejeon, Korea). Oligonucleotides were synthesized at Macrogen (Daejeon, Korea). MCF-7, HepG2, and A549 cell lines were purchased from the Korea Cell Line Bank (Seoul, Korea). Recombinant human FEN1 was purchased from Abcam (Cambridge, UK). Trypsin-EDTA solution, antibiotic solution (100× antibiotic-antimycotic solution), DMEM (Dulbecco's Modified Eagle's Medium), and fetal bovine serum (FBS) were purchased from Thermo Fisher Scientific (Waltsam, MA, USA). 3,5-Difluoro-4-hydroxybenzylidene imidazolinone (DFHBI-1T) was purchased from Toqueris Biosciences (Bristol, UK). 1-[(2,3-Dihydro-1,4-benzodioxin-2-yl)methyl]-3-hydroxythieno[3,2-d]pyrimidine-2,4(1H,3H)-dione (FEN1-IN-1) was purchased from Exon Medchem (Groningen, Netherlands). 1-(Cyclopropylmethyl)-3-hydroxyquinazoline-2,4(1H,3H)-dione (FEN1-IN-4) was purchased from Selechem (Houston, TX, USA). 2-Nitro-4-stibonobenzoic acid (NSC-13755) was purchased from AOBIUS (Gloucester, MA, USA). All other reagents were purchased from Sigma-Aldrich (St. Louis, MO, USA).
[0052] 2. Detection of FEN1 activity by in vitro transfer
[0053] An assay sample containing FEN1 was added to a 20 µl reaction mixture composed of 40 mM Tris-HCl (pH 7.9); 10 mM MgCl2; 10 mM dithiothreitol; 2 mM spermidine; 100 U T7 RNA polymerase; 16 U RNase inhibitor; 1 mM each of ATP, GTP, CTP, and UTP; 250 nM substrate DNA; and 100 nM sensor DNA. After incubating at 37°C for 1 hour, 80 µl of a solution containing 40 mM Tris-HCl (pH 7.0), 5 mM MgCl2, 125 mM KCl, and 10 μM DFHBI-1T was added to the reaction mixture. Subsequently, after incubating at 37°C for 5 minutes, CLARIOstar (λ 흡수 , 472nm; λ 방출 The fluorescence of the mixture was measured using (507 nm).
[0054] 3. Measurement of FEN1 activity of cancer cell lysates
[0055] Human cervical cancer cell line HeLa, breast cancer cell line MCF-7, lung cancer cell line A549, and liver cancer cell line HepG2 were cultured in 90 mm cell culture dishes (SPL Life Sciences, Pocheon, Korea) containing DMEM supplemented with 10% FBS and antibiotic solution (1 × 10⁶ antibiotic-antimycotic solution). 1 × 10⁶ 5 Each cell was seeded into the medium at a density of cells / mL and cultured at 37°C under 5% CO2 conditions. To prepare cell lysates, 7×10⁶ harvested cells were placed in 2 mL of pre-cooled Dulbecco's phosphate-buffered saline. 6The cells were resuspended at a cell / mL density and ground by sonication over ice. Subsequently, the supernatant of the lysate was recovered by centrifugation at 12,300×g for 10 minutes. The total protein content of the recovered lysate was determined by the Bradford protein assay.
[0056] 4. Analysis of FEN1 Inhibitors
[0057] The above in vitro transcription assay was performed in the presence of ATA (Aurintricarboxylic acid), FEN1-IN-1 (1-[(2,3-Dihydro-1,4-benzodioxin-2-yl)methyl]-3-hydroxythieno[3,2-d]pyrimidine-2,4(1H,3H)-dione), FEN1-IN-4 (1-(Cyclopropylmethyl)-3-hydroxyquinazoline-2,4(1H,3H)-dione), and NSC-13755 (2-Nitro-4-stibonobenzoic acid), which are reported to inhibit human FEN1. Each FEN1 inhibitor was pre-incubated with FEN1 at 37°C for 30 minutes, and FEN1 activity was measured.
[0058] Example 1. Oligonucleotide-induced in vitro transcription as a signal generation module
[0059] In Example 1, protein synthesis was confirmed using a DNA molecule forming a partial double strand in the T7 promoter region as an in vitro transcription template mediated by T7 RNA polymerase.
[0060] As a result, the broccoli light-up RNA aptamer sequence encoded by single-stranded DNA was transcribed by T7 RNA polymerase by annealing the complementary oligonucleotide and the T7 promoter region, which produced an amount of broccoli aptamer equivalent to that produced when double-stranded DNA was used as a template (Fig. 1).
[0061] These results mean that short oligonucleotides can be used as effective switch molecules to turn on transcription reactions in vitro.
[0062] Example 2. Confirmation of FEN1 detection using the cut flap strand of probe DNA
[0063] A DNA structure (hereinafter referred to as 'substrate DNA') was prepared to generate a sense strand of a T7 promoter in response to FEN1 activity. As shown in FIG. 2, the substrate DNA was prepared using synthetic oligonucleotides of three annealing types (ON1, ON2, and ON3) designed to form a double flap structure upon structural assembly, and the respective DNA sequences used in the present invention are disclosed in Table 1.
[0064] DNA sequence used in the present invention gene Sequence(5'->3') Sequence number substrate DNA ON1-flap ATGGCTTTTAA 1 ON2 CGGGATCCCAATAAGCCG 2 ON3 TTAAAAGCCATCGGCTTATTGGGATCCCG 3 Trigger DNA TAATACGACTCACTATAGGG 4 Sensor DNA Broccoli aptamer GAGCCCACACTCTACTCGACAGATACGAATATCTGGACCCGACCGTCTCCCCTATAGTGAGTCGTATTA 5 malachite green aptamer GGATCCATTCGTTACCTGGCTCTCGCCAGTCGGGATCCTATAGTGAGTCGTATTA 6
[0065] - Flap sequence: TAATACGACTCACTATAGGG(Sequence No. 4)
[0066] - ON1 sequence: Flap sequence + Sequence No. 1
[0067] Before performing quantitative experiments using the designed experimental apparatus, gel electrophoresis analysis was performed to verify the reaction shown in Figure 2 step by step.
[0068] As a result, as disclosed in Fig. 3, the bands identified in lanes 1, 2, and 3 were oligonucleotides ON1, ON2, and ON3, respectively, and matched the predicted sizes. 'Substrate DNA' generated by the annealing process containing ON1, ON2, and ON3 was detected in lane 4. Visualization of single-stranded sensor DNA (the antisense strand of DNA encoding the broccoli aptamer as the T7 promoter) was confirmed in lane 5. When the substrate DNA was incubated with FEN1, two distinct bands were identified in lane 6. The size of the smaller band identified in lane 6 matched the chemically generated flap sequence, namely the sense strand of the T7 promoter presented in lane 7. This means that FEN1 effectively removed (detached) the flap sequence DNA (trigger DNA) from the substrate DNA, as disclosed in Fig. 2.
[0069] After incubating substrate DNA with recombinant human FEN1, the mixture produced by the incubation was transferred to an in vitro transcription reaction vessel containing sensor DNA to perform the transcription reaction. As a result, it was confirmed that RNA products accumulated in lane 8. In particular, these RNA products were the same size as broccoli aptamers generated independently from double-stranded DNA, as confirmed by their presence in lane 9. When fluorescence was measured by supplying DFHBI-1T, it was confirmed that the broccoli aptamers were proportional to the amount of FEN1 used in the initial reaction (Fig. 4A). These results indicate that flap cleavage activity can be used to detect FEN1 by creating a trigger that initiates in vitro transcription of fluorescent RNA aptamers.
[0070] Such initial experiments were performed in two stages: generation of trigger DNA (a cleaved flap sequence coding for the sensor strand of the T7 promoter) by FEN1 (Stage 1); and an in vitro transcription reaction by T7 RNA polymerase using a template of partial double-stranded sensor DNA, in which the trigger DNA cleaved by FEN1 is bound to single-stranded sensor DNA (Stage 2). It took more than 4 hours to complete the analysis (testing) of this two-stage configuration.
[0071] The present invention confirmed that the salt conditions of in vitro transcription are compatible with the salt conditions of flap cleavage, allowing for testing in a simple single-port reaction (Fig. 5A). The single-port reaction not only improved the convenience of testing but also significantly reduced the time required to obtain the maximum fluorescence signal (Fig. 5B). This reduction in time may be attributed to the increased availability of trigger DNA generated by FEN1. Nevertheless, the detection sensitivity of FEN1 was unsatisfactory, and FEN1 present at concentrations below 10 nM could not be detected when the test was performed in a two-step or one-pot reaction (Fig. 4).
[0072] Example 3. Optimization of substrate DNA sequence for improved detection sensitivity
[0073] FEN1 detection capability was verified by controlling the number of ON1 flap sequences in substrate DNA. Specifically, FEN1 detection capability was verified by decreasing the number of nucleotides one by one from the 3' end of the flap sequence (5'-TAATACGACTCACTATAGGG-3'). As a result, when the ON1 flap sequence (20 nucleotides) in the substrate DNA was gradually decreased from the 3' end, there was an optimal length that provided lower background and higher signal, as shown in Fig. 6A. For example, due to the reduced background and enhanced signal intensity, analysis using ON1 containing 12 nucleotides increased the signal-to-background ratio from 2.1 to 18.3.
[0074] As a result, 0.1 nM of FEN1 could be detected (Fig. 6B). Detection sensitivity was further improved by replacing the sensor DNA with sensor DNA encoding a malachite green light-up RNA aptamer, and fluorescence analysis was performed on different types of endo- and exonucleases other than the FEN1 enzyme; when endo- and exonucleases other than FEN1 were used, no fluorescence was detected (Fig. 6C). In experiments using sensor DNA encoding a malachite green aptamer, the estimated limit of detection (LOD) for FEN1 was approximately 40 pM (Fig. 7).
[0075] In addition, it was confirmed that the method of the present invention can detect FEN1 in a biological matrix. A series of cancer cell lines known to overexpress FEN1 were lysed by sonication, and FEN1 activity was tested in the cell lysates. The tested cell lysates exhibited varying levels of FEN1 activity (Fig. 8). The heat-treated cell lysates did not produce broccoli fluorescence, which indicates that the signal was generated by biologically activated FEN1.
[0076] Example 4. Confirmation of potential for evaluating the activity of FEN1 inhibitors
[0077] It was determined whether the method of the present invention could be used to evaluate FEN1 inhibitors. As a result of confirming the FEN1 activity inhibitory effect of four types of FEN1 inhibitors (ATA, FEN1-IN-1, FEN1-IN-4, and NSC-13755) using the method of the present invention, the tested inhibitors reduced the assay signal (Fig. 9A).
[0078] In addition, it was confirmed that when FEN1 detection was performed after pre-culturing the biological sample and the inhibitor, the signal was reduced to the same level as the negative control (Fig. 9B). These results indicate that the transcription-based FEN1 detection method can be extended to screen and evaluate new FEN1 inhibitors.
Claims
Claim 1 (1) A substrate DNA in which the oligonucleotides of SEQ ID NO. 1 and 2 bind complementarily to the oligonucleotide of SEQ ID NO. 3, wherein a flap sequence is additionally connected to the 5' end of the oligonucleotide of SEQ ID NO. 1; and a sensor DNA that is transcribed into any one of the following light-up aptamers selected from broccoli aptamer, malachite green aptamer, spinach2 aptamer, baby spinach aptamer, mbaby spinach aptamer, mango aptamer, BFR (Blue Fluorescent RNA) aptamer, and sulforhodamine B aptamer, which includes an antisense sequence complementary to the flap at the 3' end; (1) a step of adding T7 RNA polymerase to a single-pot; (2) a step of adding a lysate of tissue suspected of overexpressing Flap Endonuclease 1 (FEN1) to a pot containing the substrate DNA, sensor DNA, and T7 RNA polymerase; (3) a step after step (2), in which the temperature is controlled to 30–37°C so that FEN1 contained in the tissue lysate cleaves the flap sequence to generate trigger DNA, and the generated trigger DNA binds to the 3' end of the sensor DNA to form a partial double strand of sensor DNA, after which the T7 RNA polymerase recognizes the double strand and initiates a cell-free transcription reaction; (4) a step after step (3), in which the cell-free transcription reaction is maintained for 30 minutes to 3 hours to synthesize a light-up aptamer;and (5) after step (4), adding a fluorophore selected from DFHBI (3,5-difluoro-4-hydroxybenzylidene imidazolinone), DFHBI-1T, thiazole orange T01, thiazole orange T03, sulforhodamine B, and Hoechst to the reaction vessel in which the light-up aptamer was generated, and detecting the amount of the synthesized light-up aptamer; a method for detecting flap endonuclease 1 (FEN1) using a cell-free transcription reaction; Claim 2 delete Claim 3 A method for detecting flap endonuclease 1 (FEN1) using a cell-free transcription reaction, characterized in that, in claim 1, the broccoli aptamer is a broccoli aptamer transcribed from the nucleotide sequence of SEQ ID NO. 5, and the malachite green aptamer is a malachite green aptamer transcribed from the nucleotide sequence of SEQ ID NO.
6. Claim 4 delete Claim 5 A method for detecting Flap Endonuclease 1 (FEN1) using a cell-free transcription reaction, characterized in that, in claim 1, the tissue suspected of overexpressing Flap Endonuclease 1 (FEN1) is cancer tissue. Claim 6 A method for detecting flap endonuclease 1 (FEN1) using a cell-free transcription reaction, characterized in that, in claim 5, the cancer is lung cancer, breast cancer, liver cancer, cervical cancer, testicular cancer, prostate cancer, stomach cancer, or brain cancer. Claim 7 A method for detecting flap endonuclease 1 (FEN1) using a cell-free transcription reaction, characterized in that, in claim 1, the length of the trigger DNA generated in step (3) consists of 12 to 20 bases. Claim 8 (1) A substrate DNA in which the oligonucleotides of SEQ ID NO. 1 and 2 bind complementarily to the oligonucleotide of SEQ ID NO. 3, wherein a flap sequence is additionally connected to the 5' end of the oligonucleotide of SEQ ID NO. 1; and a sensor DNA that is transcribed into any one of the following light-up aptamers selected from broccoli aptamer, malachite green aptamer, spinach2 aptamer, baby spinach aptamer, mbaby spinach aptamer, mango aptamer, BFR (Blue Fluorescent RNA) aptamer, and sulforhodamine B aptamer, which includes an antisense sequence complementary to the flap at the 3' end; (1) a step of adding T7 RNA polymerase to a single-pot; (2) a step of adding a lysate of tissue suspected of overexpressing Flap Endonuclease 1 (FEN1) and a FEN1 inhibitor to a pot containing the substrate DNA, sensor DNA, and T7 RNA polymerase; (3) a step after step (2), in which the temperature is controlled to 30–37°C so that FEN1 contained in the tissue lysate cleaves the flap sequence to generate trigger DNA, and the generated trigger DNA binds to the 3' end of the sensor DNA to form a partial double strand of sensor DNA, after which the T7 RNA polymerase recognizes the double strand and initiates a cell-free transcription reaction; (4) a step after step (3), in which the cell-free transcription reaction is maintained for 30 minutes to 3 hours to synthesize a light-up aptamer;and (5) after step (4), adding one fluorophore selected from DFHBI(3,5-difluoro-4-hydroxybenzylidene imidazolinone), DFHBI-1T, thiazole orange T01, thiazole orange T03, sulforhodamine B, and Hoechst to the reaction vessel where the light-up aptamer was generated, and detecting the amount of the synthesized light-up aptamer; comprising ATA(Aurintricarboxylic acid), FEN1-IN-1(1-[(2,3-Dihydro-1,4-benzodioxin-2-yl)methyl]-3-hydroxythieno[3,2-d]pyrimidine-2,4(1H,3H)-dione), FEN1-IN-4(1-(Cyclopropylmethyl)-3-hydroxyquinazoline-2,4 A method for evaluating the efficacy of any one of the FEN1 inhibitors selected from (1H,3H)-dione and NSC-13755 (2-Nitro-4-stibonobenzoic acid). Claim 9 delete Claim 10 (1) A substrate DNA in which the oligonucleotides of SEQ ID NO. 1 and 2 bind complementarily to the oligonucleotide of SEQ ID NO. 3, wherein a flap sequence is additionally connected to the 5' end of the oligonucleotide of SEQ ID NO. 1; and a sensor DNA that is transcribed into any one of the following light-up aptamers selected from broccoli aptamer, malachite green aptamer, spinach2 aptamer, baby spinach aptamer, mbaby spinach aptamer, mango aptamer, BFR (Blue Fluorescent RNA) aptamer, and sulforhodamine B aptamer, which includes an antisense sequence complementary to the flap at the 3' end; (1) a step of adding T7 RNA polymerase to a single-pot; (2) a step of adding a lysate of tissue suspected of overexpressing Flap Endonuclease 1 (FEN1) and a candidate substance for inhibiting FEN1 to a pot containing the substrate DNA, sensor DNA, and T7 RNA polymerase; (3) a step after step (2), in which the temperature is controlled to 30–37°C so that FEN1 contained in the tissue lysate cleaves the flap sequence to generate trigger DNA, and the generated trigger DNA binds to the 3' end of the sensor DNA to form a partial double strand of sensor DNA, after which the T7 RNA polymerase recognizes the double strand and initiates a cell-free transcription reaction; (4) a step after step (3), in which the cell-free transcription reaction is maintained for 30 minutes to 3 hours to synthesize a light-up aptamer;and (5) after step (4), adding a fluorophore selected from DFHBI (3,5-difluoro-4-hydroxybenzylidene imidazolinone), DFHBI-1T, thiazole orange T01, thiazole orange T03, sulforhodamine B, and Hoechst to the reaction vessel in which the light-up aptamer was generated, and detecting the amount of the synthesized light-up aptamer; a method for screening FEN1 inhibitors comprising;