Bacteriophage CRES7 and bacteriophage CRES9 that can distinguish Cronobacter sakazakii Ｏ3 serotype

Abstract

The present invention relates to bacteriophage CRES7, which is susceptible to O1 serotype Cronobacter sakazakii, and bacteriophage CRES9, which is susceptible to O1 serotype Cronobacter sakazakii and O3 serotype Cronobacter sakazakii. Specifically, the present invention provides a kit for detecting O3 serotype Cronobacter sakazakii comprising bacteriophage CRES7 composed of the nucleic acid sequence described in SEQ ID NO. 1 and bacteriophage CRES9 composed of the nucleic acid sequence described in SEQ ID NO. 2, and provides a method for distinguishing O3 serotype Cronobacter sakazakii characterized by infecting a sample containing O1 serotype Cronobacter sakazakii and O3 serotype Cronobacter sakazakii with bacteriophage CRES7 and bacteriophage CRES9 to confirm whether they have been killed. Through this, the bacteriophage CRES7 and bacteriophage CRES9 of the present invention can be utilized as a technology to specifically detect the presence of O1 serotype Cronobacter sakazakii and O3 serotype Cronobacter sakazakii in Cronobacter sakazakii-contaminated foods such as milk powder.

Description

Technology Field

[0001] The present invention is based on Chronobacter sakazaki ( Cronobacter sakazakii The invention relates to bacteriophages CRES7 and CRES9 capable of distinguishing O3 serotypes, and more specifically, to a detection kit that enables the specific detection of the presence of O3 serotype Cronobacter sakazakii using bacteriophages CRES7 and CRES9, and to a method capable of distinguishing O3 serotype Cronobacter sakazakii. Background Technology

[0003] Cronobacter sakazakii is a Gram-negative bacterium, and previously, Enterobacter sakazakii It was called, but through genetic research in 2007 " Cronobacter It was classified as a genus. Cronobacter sakazakii is an opportunistic foodborne pathogen widely distributed in the environment and is frequently isolated from various foods. These include infant formula, dried seafood, grains, and dairy products. This pathogen can cause severe infections, including neonatal meningitis and necrotizing colitis, and is a significant public health issue with reported mortality rates reaching up to 80%. Furthermore, Cronobacter sakazakii poses a threat to the elderly and immunocompromised patients, highlighting the need for effective control methods. While antibiotics have traditionally been used as antimicrobial agents, the emergence of antibiotic-resistant bacteria has increased the need for alternative antimicrobial strategies, such as bacteriophages.

[0004] Bacteriophages are emerging as promising biological control agents due to their ability to specifically target and lyse bacterial cells. Unlike common viruses, bacteriophages infect only bacteria. With their rapid bactericidal effects and high specificity for bacterial hosts, bacteriophages are attracting attention in various fields, such as therapeutic applications (e.g., bacteriophage therapy) and food safety.

[0005] Bacteriophages consist of a head, a tail, and tail fibers. The head is a protein shell (capsid) that protects the DNA or RNA genome, while the tail serves to penetrate the bacterial cell wall and inject the genome, with a tail fiber located at its tip. The tail fiber performs the crucial function of recognizing and attaching to specific receptors on the surface of host bacteria. Bacteriophage infection begins with the recognition of host bacterial receptors via the tail fiber. In various tailed bacteriophages, receptor binding proteins (RBPs) located at the distal end of the tail protein mediate binding to specific receptors on the bacterial surface. Even minor mutations in RBPs can significantly affect the recognition of specific bacterial surface receptors, such as lipopolysaccharides (LPS), outer membrane proteins, and teichoic acid, which can lead to changes in infectivity or the expansion of the host range.

[0006] LPS is a major structure present in the outer membrane of Gram-negative bacteria; it serves as an important protective barrier for the bacterial cell wall and often acts as a receptor for bacteriophages. LPS is composed of three components: lipid A, a core region, and O-antigens. Lipid A, the innermost part of LPS, is a lipid component embedded in the bacterial outer membrane and is the primary cause of endotoxins. The core region is an intermediate structure connecting lipid A and the O-antigen. The O-antigen, located on the outermost part of LPS, has a composition that varies among specific bacteria, contributing to immune evasion and resistance to bacteriophage infection. The high variability of O-antigens helps pathogens evade the host (human) immune system. To date, Cronobacter ( CronobacterSeventeen O-antigen serotypes were identified, seven of which are specific to Cronobacter sakazakii. Since bacteriophages that recognize O-antigens as receptors are generally limited by serotype specificity, the high variability in the O-antigens of Cronobacter sakazakii strains can hinder the effectiveness of bacteriophage-based biological control strategies. To overcome these limitations, a comprehensive understanding of the molecular interactions between Cronobacter bacteriophages and bacterial hosts is crucial; however, as this has not yet been sufficiently elucidated, further research is required. Prior art literature

[0009] Korean Published Patent No. 10-2024-0058627 (Publication Date: May 3, 2024), 'Novel bacteriophage having killing ability against Cronobacter sakazakii and antimicrobial composition containing the same, food preservative additive and food' is described. Korean Published Patent No. 10-2024-0066942 (Publication Date: May 16, 2024), 'Genome-redesigned bioluminescent bacteriophage infecting live Cronobacter sakazakii and the use thereof' is described. The problem to be solved

[0010] Cronobacter sakazakii serotype O3 is a very dangerous bacterium that is commonly isolated from food, particularly infant formula, and can cause food poisoning. Cronobacter sakazakii is particularly dangerous to newborns and infants with immature immune systems and can cause neurological infections, sepsis, and meningitis.

[0011] Therefore, there is a need for a technology to specifically detect Cronobacter sakazakii O3 serotype strains, which pose a very high risk of infection in infant formula and in equipment or water used for manufacturing formula. However, there is a problem in that false positives frequently occur between O3 serotype strains and O1 serotype strains.

[0012] Accordingly, the present invention aims to develop and provide a method capable of specifically detecting only Cronobacter sakazakii strains of serotype O3. In particular, the invention aims to develop and provide a method that does not result in false positives with serotype O1 strains. means of solving the problem

[0014] The present invention provides a kit for detecting O3 serotype Cronobacter sakazakii comprising bacteriophage CRES7 composed of the nucleic acid sequence described in SEQ ID NO. 1 and bacteriophage CRES9 composed of the nucleic acid sequence described in SEQ ID NO. 2.

[0015] In the kit for detecting O3 serotype Cronobacter sakazakii according to the present invention, the bacteriophage CRES7 of the present invention is preferably susceptible to O1 serotype Cronobacter sakazakii, and the bacteriophage CRES9 of the present invention is preferably susceptible to O1 serotype Cronobacter sakazakii and O3 serotype Cronobacter sakazakii.

[0016] The present invention provides a method for distinguishing O3 serotype Cronobacter sakazakii, characterized by infecting a sample containing a mixture of O1 serotype Cronobacter sakazakii and O3 serotype Cronobacter sakazakii with bacteriophage CRES7 composed of the nucleic acid sequence described in SEQ ID NO. 1 and bacteriophage CRES9 composed of the nucleic acid sequence described in SEQ ID NO. 2, and confirming whether the virus is killed.

[0017] In the method for distinguishing O3 serotype Cronobacter sakazakii according to the present invention, the bacteriophage CRES7 is preferably susceptible to O1 serotype Cronobacter sakazakii, and the bacteriophage CRES9 is preferably susceptible to O1 serotype Cronobacter sakazakii and O3 serotype Cronobacter sakazakii. Effects of the invention

[0019] By using the bacteriophage CRES7 of the present invention, which is susceptible to O1 serotype Cronobacter sakazakii, and the bacteriophage CRES9, which is susceptible to O1 serotype Cronobacter sakazakii and O3 serotype Cronobacter sakazakii, O3 serotype Cronobacter sakazakii can be selectively distinguished. Specifically, by using the bacteriophage CRES7 composed of the nucleic acid sequence described in SEQ ID NO. 1 and the bacteriophage CRES9 composed of the nucleic acid sequence described in SEQ ID NO. 2, O3 serotype Cronobacter sakazakii can be selectively distinguished from a sample in which O1 serotype Cronobacter sakazakii and O3 serotype Cronobacter sakazakii are mixed.

[0020] Through this, Cronobacter sakazakii serotype O3 can be rapidly detected from Cronobacter sakazakii-contaminated foods such as infant formula without false positive detection of serotype O1. Brief explanation of the drawing

[0022] Figure 1 shows the results of morphological analysis of Cronobacter sakazakii bacteriophages CRES7 and CRES9. Figure 1A shows the transmission electron microscope (TEM) analysis results of bacteriophages CRES7 and CRES9, where the arrows indicate the tail fibers of each phage and the scale bar represents 100 nm. Figure 1B shows the plaque morphology of bacteriophage CRES7 (left) and bacteriophage CRES9 (right). Figure 2 shows the genomic maps of bacteriophages CRES7 and CRES9, visualized using GeneScene. The colors of the genes in the genomic maps represent their functions: yellow indicates bacteriophage packaging, green indicates phage structure, indigo indicates DNA replication and manipulation, blue indicates host lysis, red indicates additional functions, and gray indicates functions that are unclear. Figure 3 shows the phylogenetic tree of bacteriophages CRES7 and CRES9, Drexlerviridae It includes 60 reference sequences of the system. Figures 4 to 6 relate to the tail fiber gp28 of bacteriophage CRES7 and bacteriophage CRES9. Figure 4 shows the gp28 amino acid sequences of bacteriophage CRES7 and bacteriophage CRES9, the multiple sequences of the gp28 tail fibers of bacteriophage CRES7 and bacteriophage CRES9, and residues 400 and 550 of bacteriophage CRES7 and bacteriophage CRES9 are highlighted with red asterisks. Figure 5A is a schematic domain structure of gp28 highlighting the tail fiber trimerization region (TR, green, InterProScan No.: IPR048388) and the intramolecular chaperone self-processing domain (ICA, orange, InterProScan No.: IPR030392) of bacteriophage CRES7 and bacteriophage CRES9. Figure 5B shows the gp28 structure after ICA cleavage predicted by Alphafold2, with each monomer indicated in a different color. The gp28 structure represents a trimeric protein characterized by coiled coils, entangled β-sheets of the C-terminal, and a triple β-helix. Amino acid residue 400 is shown in red and 550 in orange, while residues of bacteriophage CRES7 are shown in green and residues of bacteriophage CRES9 are shown in blue. Figures 6A and 6B show the predicted structure of gp28 by AlphaFold2-Multimer. Figure 6A is bacteriophage CRES7 and Figure 6B is bacteriophage CRES9, with amino acid residue 400 highlighted in red and 550 in orange. Figure 6C shows the Local Distance Difference Test (pLDDT) score of the gp28 structure prediction generated by AlphaFold2-Multimer. Figure 7 shows the LPS profile analysis of Cronobacter sakazakii strains, where Lanes 1-5 are serotype O1, Lanes 6-8 are serotype O3, and Lane 9 is serotype O2, and more specifically, Lane 1, C. sakazakii ATCC 29544; Lane 2, C. sakazakii isolate 22-3; Lane 3, isolate 31-3; Lane 4, isolate 15-2; Lane 5, isolate 15-1; Lane 6, isolate 5-2; Lane 7, isolate 4-1; Lane 8, isolate 22-1; Lane 9, This is the electrophoresis result of isolate 31-2. Fig. 8 is Chronobacter Sakazaki The infectivity and replicative characteristics of bacteriophages CRES7 and CRES9 in ATCC 29544 are shown in Fig. 8, where the data represent the mean including the standard deviations of three independent experiments. Fig. 8A represents the phage adsorption rate, and Fig. 8B represents the adsorption kinetics. Fig. 8C is the first-order growth curve of bacteriophage CRES7, Fig. 8D is the first-order growth curve of bacteriophage CRES9, E is the eclipse period, L is the latent period, and B is the burst size. Figure 9 shows the lytic activity of bacteriophage CRES7 and bacteriophage CRES9 in Cronobacter sakazakii ATCC 29544, where green is the challenge assay of bacteriophage CRES7 and blue is the challenge assay of bacteriophage CRES9, and black is the negative control. Figure 10 shows the thermal and pH stability of bacteriophages CRES7 and CRES9 in Cronobacter sakazakii ATCC 29544. Figure 10A shows the results of the thermal stability experiment of the phages, and Figure 10B shows the results of the pH stability experiment. The data represent the mean including the standard deviations of three independent experiments. Specific details for implementing the invention

[0023] The present invention provides a kit for detecting O3 serotype Cronobacter sakazakii comprising bacteriophage CRES7 composed of the nucleic acid sequence described in SEQ ID NO. 1 and bacteriophage CRES9 composed of the nucleic acid sequence described in SEQ ID NO. 2.

[0024] Meanwhile, the bacteriophages CRES7 and CRES9 of the present invention were deposited with the National Institute of Agricultural Sciences, Rural Development Administration (KACC) Microbiome. Bacteriophage CRES7 was submitted for deposit on December 23, 2024, and was assigned deposit number KACC 97048P, and bacteriophage CRES9 was submitted for deposit on January 9, 2025, and was assigned deposit number KACC 97049P.

[0025] The bacteriophage CRES7 of the present invention is susceptible to O1 serotype Cronobacter sakazakii. In addition, the bacteriophage CRES9 of the present invention is susceptible to O1 serotype Cronobacter sakazakii and O3 serotype Cronobacter sakazakii.

[0026] When bacteriophage CRES9 is used to infect a sample containing a mixture of O1 serotype Cronobacter sakazakii and O3 serotype Cronobacter sakazakii, the O1 and O3 serotype Cronobacter sakazakii in the sample become susceptible. However, since bacteriophage CRES9 cannot distinguish between O1 and O3 serotype Cronobacter sakazakii, O1 serotype Cronobacter sakazakii may be detected as a false positive. In this case, when the bacteriophage CRES7 of the present invention is used to infect the sample, susceptibility is exhibited only when O1 serotype Cronobacter sakazakii is present. In other words, if susceptibility is shown upon infection with bacteriophage CRES7, O1 serotype Cronobacter sakazakii is present in the sample, and if susceptibility is not shown, O3 serotype Cronobacter sakazakii is present. Through this, the present invention is able to distinguish whether the Cronobacter sakazakii present in the sample is O1 serotype or O3 serotype.

[0027] The difference in sensitivity between the bacteriophage CRES7 and bacteriophage CRES9 of the present invention is found in the tail fiber protein, which is likely involved in receptor binding. As a result of genomic analysis of the bacteriophages in the following experiment of the present invention, bacteriophage CRES7 and bacteriophage CRES9 differed by two nucleotides in the gene encoding the tail fiber protein. Despite exhibiting high genomic homology excluding this difference, the two bacteriophages showed differences in host range because they differed in the way they recognized specific O-antigen serotypes of Cronobacter sakazakii. Specifically, two naturally occurring amino acid variations were identified in the tail fiber gp28 of Cronobacter sakazakii bacteriophage CRES7 and bacteriophage CRES9, and the following experiment confirmed that these variations affect host recognition through differential binding of the LPS O-antigen.

[0028] Meanwhile, the present invention provides a kit for detecting O3 serotype Cronobacter sakazakii, which may contain bacteriophage CRES7 and bacteriophage CRES9 and other auxiliary components (e.g., buffer, smear medium, etc.). Since the main components of the kit of the present invention are bacteriophage CRES7 and bacteriophage CRES9, other auxiliary components may be those widely known in the art. Therefore, description of other auxiliary components is omitted.

[0029] Meanwhile, the present invention provides a method for distinguishing O3 serotype Cronobacter sakazakii, characterized by infecting a sample containing O1 serotype Cronobacter sakazakii and O3 serotype Cronobacter sakazakii with bacteriophage CRES7 composed of the nucleic acid sequence described in SEQ ID NO. 1 and bacteriophage CRES9 composed of the nucleic acid sequence described in SEQ ID NO. 2, and confirming whether they die.

[0030] In the method for distinguishing O3 serotype Cronobacter sakazakii according to the present invention, the bacteriophage CRES7 is susceptible to O1 serotype Cronobacter sakazakii, and the bacteriophage CRES9 is susceptible to O1 serotype Cronobacter sakazakii and O3 serotype Cronobacter sakazakii.

[0031] It is possible to effectively distinguish O3 serotype Cronobacter sakazakii from O1 serotype Cronobacter sakazakii through the selective susceptibility of bacteriophage CRES7, which has the characteristic of infecting O1 serotype, and bacteriophage CRES9, which has the characteristic of infecting O1 and O3 serotypes.

[0032] The O3 serotype Cronobacter sakazakii detection kit and differentiation method of the present invention are applicable to the food industry, and more specifically, can be used to test the safety of food, and in particular, can be used to determine whether infant food, such as infant formula, is contaminated with Cronobacter sakazakii.

[0034] Hereinafter, the contents of the present invention will be explained in more detail through the following manufacturing examples, embodiments, and experimental examples. However, the scope of the present invention is not limited to the following manufacturing examples, embodiments, and experimental examples, but includes variations of equivalent technical concepts.

[0037] [Example 1: Bacterial strain and culture conditions]

[0038] In the present invention, Cronobacter sakazakii ATCC 29544 was used as a host bacterium for phage isolation and proliferation. All bacterial strains were cultured in Luria-Bertani (LB) medium (BD Difco, NJ, USA) at 37°C while shaking in a shaking incubator. When culturing bacteria containing a plasmid, ampicillin (50 μg / ml) was added to the medium.

[0040] [Example 2: Bacteriophage Isolation and Storage Solution Preparation]

[0041] Bacteriophages are based on previously reported protocols (Kim M, Ryu S. 2011. Characterization of a T5-like coliphage, SPC35, and differential development of resistance to SPC35 in Salmonella enterica serovar Typhimurium and Escherichia coli It was isolated according to Applied and Environmental Microbiology 77:2042-2050).

[0042] The following samples were collected from the Jungnang Water Reclamation Center (sewage treatment plant) in Seoul, South Korea, and filtered using a 0.22 μm filter (Sartorius, Goettingen, Germany). The filtrate was cultured in LB medium containing Cronobacter sakazakii ATCC 29544. After centrifugation (10,000 xg, 4°C, 10 min) and filtration, the filtrate was plated onto LB agar medium, and 0.4% LB soft agar containing the host bacteria was poured over it. After incubation overnight at 37°C, single plaques were collected, suspended in SM buffer (100 mM NaCl, 8 mM MgSO4·7H2O, 50 mM Tris-HCl, pH 7.5), and filtered. This process was repeated 5 times for the isolation of single bacteriophages.

[0043] Meanwhile, to proliferate bacteriophages, a bacteriophage solution was inoculated into a host bacterial culture in the logarithmic growth phase and incubated at 37°C for 4 hours. The bacteriophage solution was collected by centrifugation and filtration, and a concentrated bacteriophage stock solution was prepared by CsCl density gradient ultracentrifugation and used in the following experiments. The bacteriophage stock solution was stored in a glass vial at 4°C.

[0045] [Experimental Example 1: Phage Morphological Analysis of Bacteriophage CRES7 and Bacteriophage CRES9]

[0046] 1. TEM Analysis

[0047] Bacteriophage morphology is based on existing reports (Kim M, Ryu S. 2011. Characterization of a T5-like coliphage, SPC35, and differential development of resistance to SPC35 in Salmonella enterica serovar Typhimurium and Escherichia coli It was analyzed by TEM according to Applied and Environmental Microbiology 77:2042-2050. Bacteriophage samples (10 10PFU) were placed on a glow discharge-treated foambar / copper grid and stained with 2% uranyl acetate (pH 4.0). Bacteriophage sample images were acquired using an energy-filtered TEM (LIBRA 120, Carl Zeiss, Germany) at the Environmental Management Instrumentation Center in Seoul, Korea. Head and tail sizes were measured using ImageJ (n=5).

[0048] According to transmission electron microscopy (TEM) analysis, both bacteriophages CRES7 and CRES9 exhibited typical siphovirus morphology and similar sizes (Fig. 1A). The icosahedral head sizes of bacteriophages CRES7 and CRES9 were 78.2 ± 3.1 nm and 75.5 ± 1.6 nm, respectively, and the non-contractile tail lengths were 167.9 ± 4.3 nm and 171.0 ± 3.5 nm, respectively (Fig. 1A, Table 1). Bacteriophage CRES7 formed small plaques measuring 1.7 ± 0.1 mm, whereas bacteriophage CRES9 formed plaques measuring 2.8 ± 0.1 mm (Fig. 1B, Table 1).

[0049] Figure 1 shows the results of morphological analysis of Cronobacter sakazakii bacteriophages CRES7 and CRES9. Figure 1A shows the results of transmission electron microscopy (TEM) analysis of bacteriophages CRES7 and CRES9. The arrows indicate the tail fibers of each phage, and the scale bar represents 100 nm. Figure 1B shows the plaque morphology of bacteriophage CRES7 (left) and bacteriophage CRES9 (right).

[0050] Morphological analysis of bacteriophages CRES7 and CRES9 Phage Head size (nm) Tail length (nm) Plaque size (mm) CRES7 78.2 ± 3.1 167.9 ± 4.3 1.7 ± 0.1 CRES9 75.5 ± 1.6 171.0 ± 3.5 2.8 ± 0.1

[0052] [Experimental Example 2: Analysis of the Genetic and Evolutionary Relationship between Bacteriophage CRES7 and Bacteriophage CRES9]

[0053] 1. Whole Genome Sequencing (WGS) of Phage Genome DNA

[0054] Phage genomic DNA was extracted using the previously reported phenol-chloroform extraction method (Kim M, Ryu S. 2011. Characterization of a T5-like coliphage, SPC35, and differential development of resistance to SPC35 in Salmonella enterica serovar Typhimurium and Escherichia coli ORFs were extracted using Applied and Environmental Microbiology 77:2042-2050. Whole-genome sequencing was performed with Illumina Miseq and assembled using SPAdes v3.15.2. ORFs and their functions were predicted using the GeneMarkS, RAST, BLASTp, and InterProScan databases and manually annotated. Genome maps were visualized using GeneScene v0.99.8.0 (DNAstar, Madison, WI). ORF analysis plays an important role in identifying protein-coding genes in the genome, studying biological functions, and elucidating evolutionary relationships.

[0055] Illumina Miseq results showed that the genomes of bacteriophages CRES7 and CRES9 consisted of 49,065 bp of circular double-stranded DNA, with a GC content of 50.04% (Table 2, Fig. 2).

[0056] Genomic analysis of bacteriophages CRES7 and CRES9 Phage Genomic size (bp) GC contents (%) 0RF number Accession number CRES7 49,065 50.04 78 ON979384 CRES9 49,065 50.04 78 ON979385

[0058] As a result of ORF predictions, 61 of the total 78 predicted open decoding frames (ORFs) were annotated as encoding hypothetical proteins. The remaining ORFs were classified into phage functions such as phage packaging (terminase), phage structure (tape measuring protein, small tail protein, tail assembly protein, tail fiber), DNA replication and manipulation (exodeoxyribonuclease, recombinase, DNA primase, DNA helicase, DNA methylase, polynucleotide kinase), host lysis (endolysin), and additional functions (EaA protein) (Fig. 2).

[0059] Figure 2 shows the genomic maps of bacteriophages CRES7 and CRES9, visualized using GeneScene. The colors of the genes represent their functions: yellow indicates bacteriophage packaging, green indicates phage structure, indigo indicates DNA replication and manipulation, blue indicates host lysis, red indicates additional functions, and gray indicates functions that are unclear.

[0061] 2. Phylogenetic Tree Analysis of Bacteriophages CRES7 and CRES9

[0062] The protein phylogeny of bacteriophages was analyzed using ViPTree (https: / / www.genome.jp / viptree) and VICTOR (https: / / victor.dsmz.de). Drexlerviridae All 60 viral genomes of the lineage were selected to generate a full-length protein phylogenetic tree including CRES7 and CRES9 (Table 3). Additionally, the Genome-BLAST Distance Phylogeny (GBDP) method was applied to compare amino acid sequence pairs with settings specific to prokaryotic viruses. The GBDP method is a technique that analyzes the phylogenetic classification and evolutionary relationships of viruses or microorganisms through BLAST-based distance calculations between genomes, and is typically used in parallel with other phylogenetic analysis methods (e.g., gene alignment-based analysis).

[0063] Used in generating phylogenetic trees Drexlerviridae The NCBI GenBank accession number of complete phage genome sequences of Drexlerviridae used in generating phylogenetic tree) Accession number Description OP120783 Cronobacter phage SG01 NC_019509 Cronobacter phage ESP2949-1 NC_048088 Cronobacter phage CS01 NC_049823 Escherichia phage herni NC_021331 Shigella phage pSf-1 NC_049822 Escherichia phage vB_EcoS_G29-2 NC_049821 Salmonella phage rogue NC_049825 Escherichia phage grams NC_049827 Escherichia phage damhaus NC_049852 Escherichia phage then NC_054893 Escherichia phage vB_EcoS_W011D NC_049830 Escherichia phage PGN590 NC_049853 Escherichia phage Henu8 NC_054892 Escherichia phage vB_EcoS_PHB17 NC_049826 Escherichia phage aaroes NC_049824 Escherichia phage wars NC_048132 Escherichia phage vB_EcoS-95 NC_048202 Escherichia phage vB_EcoS_swan01 NC_049815 Escherichia phage tonn NC_047938 Escherichia phage SECphi27 NC_049829 Escherichia phage eels NC_049819 Escherichia phage atuna NC_049818 Escherichia Phage tuna NC_054896 Escherichia tuna phage NC_049817 Escherichia phage tuna NC_049816 Escherichia phage tunisia NC_049814 Shigella phage JK16 NC_049828 Escherichia phage hair NC_054895 Escherichia phage vB_Eco_SLUR29 NC_048206 Escherichia phage vB_Eco_mar001J1 NC_048204 Escherichia phage vB_Eco_mar001J1 NC_047898 Salmonella phage YSP2 NC_054894 Escherichia phage Henu7 NC_027350 Citrobacter phage Stevie NC_047947 Salmonella phage vB_SenS_PHB07 NC_048065 Citrobacter phage Sazh NC_009540 Escherichia phage Tls NC_047823 Citrobacter phage CF1 DK-2017 NC_047985 Escherichia phage LL5 NC_031026 Salmonella phage phSE-2 NC_042043 Escherichia phage SRT8 NC_042066 Salmonella phage FSL SP-126 NC_054898 Vibrio virus 2019VC1 NC_047960 Escherichia phage vB_EcoS_IME347 NC_031050 Escherichia phage vB_EcoS_NBD2 NC_047828 Escherichia phage vB_EcoS_SH2 NC_015456 Shigella phage Shfl1 NC_026010 Shigella phage pSf-2 NC_047785 Shigella phage SH6 NC_041995 Shigella phage vB_SsoS-ISF002 NC_041873 Escherichia phage JMPW2 NC_047998 Shigella Phage Sfin-1 NC_019725 Escherichia phage ADB-2 NC_047959 Enterobacteria phage vB_EcoS_IME18 NC_049832 Escherichia phage vB_EcoS-DELF2 NC_041874 Escherichia phage JMPW1 MN296515 Shigella Phage Sfin-3 NC_047996 Escherichia phage Eco_BIFF NC_005833 Escherichia phage T1 NC_029071 Salmonella phage 36

[0065] According to the phylogenetic analysis of the whole genome, the two bacteriophages are Drexlerviridae It belongs to the family and shows a close association with Cronobacter bacteriophage CS01 at the amino acid level (Fig. 3, Table 3). No genes related to tRNA, lysogenic conversion, toxicity factors, or antibiotic resistance were identified.

[0066] Figure 3 shows the phylogenetic tree of bacteriophages CRES7 and CRES9, Drexlerviridae It includes 60 reference sequences of the system.

[0067] The results of the phylogenetic tree analysis suggest the possibility that one of the two bacteriophages originated from the other. Subsequent analysis focused on gp28.

[0069] [Experimental Example 3: Tail fiber gp28 in silico analyze]

[0070] 1. BLASTp

[0071] BLASTp was performed to identify the function of gp28 and related proteins. Multiple sequence alignment was performed using Clustal X2 and visualized using Jalview software v2.11.0.

[0072] BLASTp analysis revealed that the two bacteriophages shared very high homology in their DNA and differed by only two nucleotides. The two nucleotides were found in the gene encoding the tail fiber (gene 28), resulting in mutations at amino acid residues 400 (K400→N400) and 550 (S550→R550).

[0073] gp28 (gene product 28) showed high similarity to the tail fibers of CS01 (identity: CRES7 83.48%, CRES9 83.33%; access number YP_009814969.1), SG01 (identity: CRES7 83.33%, CRES9 83.19%; access number WDS30446.1), and Esp2949-1 (identity: CRES7 82.89%, CRES9 82.75%; access number YP_007005418.1) (Fig. 4).

[0074] Figure 4 shows the gp28 amino acid sequences of bacteriophage CRES7 and bacteriophage CRES9, the multiple sequences of the gp28 tail fibers of bacteriophage CRES7 and bacteriophage CRES9, and residues 400 and 550 of bacteriophage CRES7 and bacteriophage CRES9 are highlighted with red asterisks.

[0076] 2. Analysis of RBP (Receptor Binding Protein) Potential

[0077] RBP (receptor binding protein) potential was analyzed using PhageRBPdetection v2. Conserved domains were analyzed as basic parameters using the InterProScan and HHpred online servers. RBPs are receptor binding proteins, and RBP potential refers to the probability that a viral tail fiber will function as a receptor binding protein that binds to a host cell.

[0078] Predictions using the PhageRBPdetection tool indicated that gp28 in bacteriophages CRES7 and CRES9 likely functions as a receptor-binding protein (RBP). Conserved domain analysis revealed that gp28 contains a tail fiber trimerization region (InterProScan No.: IPR048388), commonly identified in the tail fibers of T4-series phages, and a self-processing domain (ICA; InterProScan No.: IPR030392) that promotes tail fiber protein folding and trimerization (Fig. 5A). These structural motifs Salmonella It is also commonly observed in the tail fibers of phage S16, E. coli phage T5, K1F, etc.

[0079] Figure 5A is a schematic domain structure of gp28 highlighting the tail fiber trimerization region (TR, green, InterProScan No.: IPR048388) and the intramolecular chaperone self-processing domain (ICA, orange, InterProScan No.: IPR030392) of bacteriophage CRES7 and bacteriophage CRES9.

[0081] 3. Trimeric structure of tail fiber gp28

[0082] Trimeric proteins are stable protein complexes composed of three subunits. Bacteriophage tail fiber proteins primarily form a trimer structure and play an important role in recognizing and attaching to specific receptors on the bacterial surface.

[0083] The predicted trimer structure of tail fiber gp28 was generated with AlphaFold2 v2.1.2, with parameters set to model_preset = multimer and db_preset = full_dbs. The structure was visualized using PyML 2.5.2.

[0084] According to predictions using Alphafold2, the tail fiber gp28 forms a trimer-elongated structure consisting of a coiled coil, a C-terminal entangled β-sheet, and a triple β-helix (Fig. 5B), which is similar to the structure observed in the tail fibers of other phages. The amino acid variant sites 400 and 550 of bacteriophages CRES7 and CRES9 are located within the C-terminal β-helix repeat and are exposed on the surface (Fig. 5B, Fig. 6), which may cause differences in receptor binding (Fig. 6). These structural predictions suggest that bacteriophages CRES7 and CRES9 may exhibit different host bindings due to the difference in two amino acid residues of the tail fiber gp28.

[0085] Figure 5B shows the gp28 structure after ICA cleavage predicted by Alphafold2, with each monomer indicated in a different color. The gp28 structure represents a trimeric protein characterized by coiled coils, entangled β-sheets of the C-terminal, and a triple β-helix. Amino acid residue 400 is shown in red, 550 in orange, CRES7 residue in green, and CRES9 residue in blue.

[0086] Figures 6A and 6B show the predicted structure of gp28 by AlphaFold2-Multimer. Figure 6A is bacteriophage CRES7 and Figure 6B is bacteriophage CRES9, with amino acid residue 400 highlighted in red and 550 in orange.

[0087] Figure 6C shows the Local Distance Difference Test (pLDDT) score of the gp28 structure prediction generated by AlphaFold2-Multimer.

[0089] [Experimental Example 4: Host Cell Preparation and Analysis]

[0090] 1. Confirmation of host receptors

[0091] Confirmation of the bacteriophage host receptor was performed using Cronobacter sakazakii ATCC 29544 (wild type, WT) and its mutant strains.

[0092] Drexlerviridae The phage tail module consists of lateral tail fibers and a central tail fiber. Additionally, it is known that lateral tail fibers are likely to bind to LPS, while central tail fibers generally attach to outer membrane proteins, including FhuA, BtuB, and TolC. To identify the receptors of bacteriophages CRES7 and CRES9, spotting experiments were performed on Cronobacter sakazakii mutants lacking genes encoding known phage receptors, such as LPS, flagella, and outer membrane proteins.

[0093] Each phage solution was dropped onto a medium prepared with WT or mutant strains and incubated at 37°C for 6 hours. EOP was calculated, and complementary experiments were performed simultaneously (Table 4).

[0094] EOP (efficiency of plating) is an indicator that evaluates how effectively bacteriophages infect and multiply in different host strains.

[0095]

[0096] In this context, PFU represents the number of plaques formed by infection by bacteriophages. The interpretation of infection can vary depending on the EOP value; an EOP value close to 1 indicates high infectivity, while an EOP > 0.1 suggests a possibility of infection. An EOP < 0.001 indicates minimal infection of the test strain, which may limit the host range. Additionally, an EOP of 0 signifies no infection of the test strain. In other words, it is used to determine whether bacteriophages infect only specific bacteria or infect a wide range.

[0097] Phage susceptibility of mutant strains for identifying host receptor Bacterial strain and genotype Descriptions Phage a Reference or source CRES7 CRES9 C. sakazakii ATCC 29544 Wild type Wild type +++ +++ ATCC b D waaL O-antigen of LPS defective strain - - Laboratory collection Δ waaL +pwaaL c O-antigen of LPS complemented in Δ waaL mutant strain +++ +++ D flgK Flagella-defected strain +++ +++ (1) D lamB Outer membrane protein LamB- defective strain +++ +++ D ompC Outer membrane protein OmpC- defective strain +++ +++ D fhuA Outer membrane protein FhuA- defective strain +++ +++ D tolC Outer membrane protein TolC- defective strain +++ +++ Laboratory collection D lamB Outer membrane protein LamB- defective strain +++ +++ D ompX Outer membrane protein OmpX- defective strain +++ +++ D ompA Outer membrane protein OmpA- defective strain +++ +++ D btuB Outer membrane protein BtuB- defective strain +++ +++

[0098] a +++, The Efficiency of Plating (EOP) 0.1-1; -, no infection

[0099] b ATCC, American Type Culture Collection

[0100] c pwaaL, pBAD18:: waaL

[0101] Reference (1): Lee JH, Bai J, Shin H, Kim Y, Park B, Heu S, Ryu S. 2016. A novel bacteriophage targeting Cronobacter sakazakii is a potential biocontrol agent in foods. Applied and environmental microbiology 82:192-201.

[0103] Experimental results showed that O-antigen-free waaL Only the deletion mutants exhibited resistance to bacteriophages CRES7 and CRES9 (Table 4). In addition, waaL Complementary repair of the mutation restored phage sensitivity, confirming that bacteriophage CRES7 and bacteriophage CRES9 use the O-antigen as a host receptor (Table 4).

[0105] 2. 숙주 범위 결정

[0106] To evaluate whether specific amino acid differences (variations) found in the tail fibers of bacteriophages CRES7 and CRES9 could affect host specificity, the host range of the two bacteriophages was tested in 24 Cronobacter sakazakii strains (including 3 standard strains and 21 strains isolated from food samples). A total of 24 Cronobacter sakazakii strains (3 standard strains, 21 strains isolated from Korea), 6 Gram-negative strains, and 2 Gram-positive strains were used to determine the host range (Tables 5 and 6).

[0107] 0.4% LB soft agar prepared with each bacterial culture was poured into LB medium to prepare a culture layer. Bacteriophage solutions were dropped onto the culture layer after serial dilution and incubated at 37°C for 6 hours. EOP (efficiency of plating) was calculated based on phage susceptibility compared to a proliferating host.

[0108] Experimental results showed that bacteriophage CRES9 was able to infect 19 out of 24 strains (79%), whereas bacteriophage CRES7 only infected 11 (46%) (Table 5). Neither bacteriophage was able to infect bacteria of a different genus, indicating specificity for Cronobacter sakazakii (Table 6). Furthermore, these results demonstrate that a difference in two amino acid residues of gp28 can significantly affect the host range of bacteriophages CRES7 and CRES9.

[0109] Host range of bacteriophages CRES7 and CRES9 (Host range of bacteriophages CRES7 and CRES9) Bacterial strains Phage a Reference or source CRES7 CRES9 C. sakazakii type strains ATCC 29544 + + ATCC b ATCC BAA-894 I I ATCC 29004 - - C. sakazakii isolates (sample origin) 4-1 (dried fish) - + (2) 4-2 (dried fish) - + 4-3 (dried fish) - + 5-2 (dried fish) - + 5-3 (dried fish) - + 5-4 (dried fish) - + 15-1 (research) + + 15-2 (research) + + 17-1 (research) - - 17-2 (research) - - 17-3 (research) + + 18-1 (research) + + 18-2 (research) + + 18-3 (research) + + 19-2 (research) + + 19-3 (research) + + 22-1 (insert) - + 22-2 (injection) - + 22-3 (insert) + + 31-2 (insert) - - 31-3 (insert) + +

[0110] a +, plaque formation; I, Formation of Inhibition zone; -, no infection

[0111] b ATCC, American Type Culture Collection

[0112] Reference (2): Kim K, Jang SS, Kim SK, Park JH, Heu S, Ryu S. 2008. Prevalence and genetic diversity of Enterobacter sakazakii in ingredients of infant foods. International journal of food microbiology 122:196-203.

[0114] Host range of bacteriophages CRES7 and CRES9 (Host range of bacteriophages CRES7 and CRES9) Bacterial strain Phage a References and sources CRES7 CRES9 Gram-negative bacteria Escherichia coli K-12 substrain MG1655 - - ATCC b Escherichia coli ATCC 43888 - - Salmonella enterica serovar Typhimurium LT2 - - Laboratory collection Salmonella enterica serovar Typhimurium UK-1 - - ATCC Salmonella enterica serovar Enteritidis ATCC 13076 - - Pseudomonas aeruginosa ATCC 27853 - - Gram-positive bacteria Staphylococcus aureus ATCC 29213 - - ATCC Bacillus cereus ATCC 14579 - -

[0115] a -, no infection

[0116] b ATCC, American Type Culture Collection

[0118] 3. O Serotyping Analysis

[0119] As it was revealed that bacteriophages CRES7 and CRES9 use O-antigens as receptors and that two amino acid residues in the predicted structure are located on the surface of the tail fiber, a hypothesis was established that specific residues of gp28 could differentially recognize various structures of O-antigens and affect the host range of the phages. To verify this, PCR-based O serotyping analysis was performed on nine representative Cronobacter sakazakii strains (Table 7) that exhibited different susceptibility to bacteriophages CRES7 and CRES9.

[0120] Determination of serotype O of Cronobacter sakazakii strain was Yan (Yan Q, Jarvis KG, Chase HR, Hebert K, Trach LH, Lee C, Sadowski J, Lee B, Hwang S, Sathyamoorthy V. 2015. A proposed harmonized LPS molecular-subtyping scheme for CronobacterPCR analysis was performed according to the methods of species. Food microbiology 50:38-43. The sequences of the five pairs of primers used for O serotype analysis are listed in Table 7. PCR analysis was performed under conditions of 30 cycles at 98°C for 10 seconds, 55°C for 15 seconds, 68°C for 1 minute, and a final extension at 68°C for 5 minutes. Cronobacter sakazakii ATCC 29544 and ATCC 29004 were used as control strains for O1 and O2 serotypes, respectively.

[0121] PCR primers used for O serotype analysis serotype analysis) C. sakazakii O serotype Primer name Sequence (5'-3') Target gene Product size (bp) Reference O1 wzyF-O1 CCCGCTTGTATGGATGTT wzy 364 (3) wzyR-O1 CTTTGGGAGCGTTAGGTT O2 EsLPS2F TCCTGCATTTGTGGATTTTGC wehI 329 (4) EsLPS2R AACGCATTGCGCTTGAGAAA O3 wzyF-O3 CTCTGTTACTCTCCATAGTGTTC wzy 704 (3) wzyR-O3 GATTAGACCACCATAGCCA O4 wzyF-O4 ACTATGGTTTGGCTATACTCCT wzy 890 wzyR-O4 ATTCATATCCTGCGTGGC O7 wzyF-O7 CATTTCCAGATTATTACCTTTC wzy 615 wzyR-O7 ACACTGGCGATTCTACCC

[0122] Reference (3): Sun Y, Wang M, Wang Q, Cao B, He X, Li K, Feng L, Wang L. 2012. Genetic analysis of the Cronobacter sakazakii O4 to O7 O-antigen gene clusters and development of a PCR assay for identification of all C. sakazakii O serotypes. Applied and environmental microbiology 78:3966-3974.

[0123] Reference (4): Jarvis K, Grim C, Franco A, Gopinath G, Sathyamoorthy V, Hu L, Sadowski J, Lee C, Tall B. 2011. Molecular characterization of Cronobacter lipopolysaccharide O-antigen gene clusters and development of serotype-specific PCR assays. Applied and Environmental Microbiology 77:4017-4026.

[0124] As a result of the analysis, nine Cronobacter sakazakii strains were classified into three serotypes. Four strains, including 22-3, 31-3, 15-2, and 15-1, were identified as Type O1; three strains, including 5-2, 4-1, and 22-1, as Type O3; and 31-2 as Type O2 (Table 8). Consequently, a strong correlation between serotype O and phage infectivity was revealed. All Cronobacter sakazakii strains susceptible to both bacteriophages CRES7 and CRES9 were Type O1, while strains susceptible only to bacteriophage CRES9 were Type O3. Strains resistant to both bacteriophages were Type O2 (Table 8).

[0125] LPS O serotypes of Cronobacter sakazakii strains C. sakazakii strains) C. sakazakii strains Phage a O serotype CRES7 CRES9 ATCC 29544 +++ +++ O1 Isolate 22-3 +++ +++ O1 Isolate 31-3 ++ ++ O1 Isolate 15-2 + + O1 Isolate 15-1 + +++ O1 Isolate 5-2 - +++ O3 Isolate 4-1 - ++ O3 Isolate 22-1 - + O3 Isolate 31-2 - - O2

[0126] a +++, The efficiency of plating (EOP) 0.1-1; ++, EOP 0.001-0.01; +,

[0127] EOP < 0.001; -, no infection

[0129] 5. LPS Extraction and Analysis

[0130] LPS was extracted using the high-temperature phenol-water extraction method from an overnight culture of Cronobacter sakazakii strains (Kim M, Ryu S. 2012. Spontaneous and transient defense against bacteriophage by phase-variable glucosylation of O-antigen in Salmonella entericaExtraction was performed using serovar Typhimurium (Molecular Microbiology 86:411-425). Specifically, bacteria cultured overnight were washed with DPBS (Dulbecco's PBS, containing 0.15 mM CaCl2 and 0.5 mM MgCl2) and then resuspended in water and a preheated phenol solution. After incubation at 68°C for 15 minutes, LPS was extracted using the aqueous layer collected by centrifugation (10,000 xg, 4°C, 5 min). LPS was precipitated using sodium acetate and 95% ethanol, and the pellet was dissolved in distilled water and stored at -20°C.

[0131] The extracted LPS was analyzed by DOC-PAGE (deoxycholate-polyacrylamide gel electrophoresis) on a 15% acrylamide gel. LPS staining was performed using Pro-Q ® The procedure was performed using the Emerald 300 Lipopolysaccharide Gel Stain Kit (Invitrogen, MA, USA) according to the manufacturer's protocol. The gel was visualized using a GelDoc instrument (Bio-Rad, CA, USA).

[0132] Figure 7 shows the LPS profile analysis of Cronobacter sakazakii strains, where Lanes 1-5 are serotype O1, Lanes 6-8 are serotype O3, and Lane 9 is serotype O2, and more specifically, Lane 1, C. sakazakii ATCC 29544; Lane 2, C. sakazakii isolate 22-3; Lane 3, isolate 31-3; Lane 4, isolate 15-2; Lane 5, isolate 15-1; Lane 6, isolate 5-2; Lane 7, isolate 4-1; Lane 8, isolate 22-1; Lane 9, This is the electrophoresis result of isolate 31-2.

[0133] The two bacteriophages showed the same efficiency of plating (EOP) in O-type Cronobacter sakazakii strains, but strain 15-1 was an exception. Analysis of the distribution of O-antigen chain lengths revealed that three O-type strains—22-3, 31-3, and 15-2—showed O-antigen profiles similar to ATCC 29544, which was used as a reference strain (Lane 1-4 in Fig. 7), and these strains exhibited similar EOPs for bacteriophages CRES7 and CRES9. However, strain 15-1 had a longer O-antigen chain than the other O-type strains (Lane 5 in Fig. 7), and bacteriophage CRES9 showed a higher EOP than bacteriophage CRES7 (Table 7). Three strains of type O3 (5-2, 4-1, 22-1) showed susceptibility to bacteriophage CRES9 but resistance to bacteriophage CRES7, and exhibited longer chain lengths than type O1 strains (Lane 6-8 in Fig. 7). Type O2 strain 31-2, which showed resistance to both bacteriophages CRES7 and CRES9, exhibited an intermediate length between types O1 and O3 (Lane 9 in Fig. 7).

[0134] The above results suggest that amino acid residues 400 and 550 of gp28 can recognize and distinguish specific O-antigen structures within the same serotype. That is, bacteriophages CRES7 and CRES9 showed susceptibility to O-1, while only bacteriophage CRES9 showed susceptibility to O-3 strains.

[0136] [Experimental Example 5: Differences in Adsorption Rate and Explosion Size between Bacteriophage CRES7 and Bacteriophage CRES9]

[0137] 1. Phage Adsorption Experiment

[0138] Phage adsorption experiments are based on previous reports (Choi HJ, Kim M. 2021. Improved bactericidal efficacy and thermostability of Staphylococcus aureus-It was performed according to specific bacteriophage SA3821 by repeated sodium pyrophosphate challenges. Scientific Reports 11:22951.)

[0139] Bacterial cultures in the logarithmic growth phase were infected with phages at a concentration of MI71 and incubated at 37°C for 8 minutes. Samples were collected at 2-minute intervals, followed by centrifugation (16,000 xg, 1 min, 4°C) and filtration. The filtrate was serially diluted in SM buffer and dropwise applied to the culture layer. Adsorption constant ( k ) calculated using the following equation: k = -ln (P t / P0) / N t

[0140] Here, P t Is t Phage concentration at time point (PFU / ml), P0 is initial phage concentration (PFU / ml), N is bacterial cell count (CFU / ml), t is the adsorption time (minutes).

[0141] As a result of the experiment, bacteriophages CRES7 and CRES9 exhibited different adsorption rates. Considering that variations in receptor recognition can affect the adsorption efficiency of phages, the adsorption rates of bacteriophages CRES7 and CRES9 were compared. Bacteriophage CRES7 showed a higher adsorption rate than bacteriophage CRES9 against Cronobacter sakazakii ATCC 29544 (Fig. 8A, B). Within 8 minutes of infection, bacteriophage CRES7 was 93% adsorbed to the host cell, whereas bacteriophage CRES9 was 83% adsorbed (Fig. 8A). In addition, the adsorption constant of bacteriophage CRES7 ( k ) is 162% higher than bacteriophage CRES9, showing that bacteriophage CRES7 exhibits higher adsorption efficiency to the host receptor (Fig. 8B).

[0142] Fig. 8 is Chronobacter Sakazaki Infectivity and replicative characteristics of bacteriophages CRES7 and CRES9 in ATCC 29544. The data in Fig. 8 represent the mean including the standard deviations of three independent experiments. Fig. 8A represents the phage adsorption rate, and Fig. 8B represents the adsorption kinetics.

[0144] 2. One-step growth curve experiment

[0145] One-step growth curve experiments are based on previous reports (Choi HJ, Kim M. 2021. Improved bactericidal efficacy and thermostability of Staphylococcus aureus -It was performed according to specific bacteriophage SA3821 by repeated sodium pyrophosphate challenges. Scientific Reports 11:22951.)

[0146] Bacterial cells in the logarithmic growth phase were infected with 0.01 M0O1 phages and cultured for 4 minutes. After washing the bacterial cells by centrifugation, they were resuspended in fresh LB medium and cultured at 37°C while shaking. Two samples were collected at 4-minute intervals over 28 minutes, one of which was treated with chloroform at a final concentration of 2% (w / v) to artificially release phage progeny. The PFU per infected cell was calculated by dividing the number of untreated samples (0 min) at each time point.

[0147] Experimental results showed that bacteriophages CRES7 and CRES9 exhibited different burst sizes. To evaluate the effect of differences in adsorption rates on phage proliferation, the primary growth curves of the two bacteriophages were compared. Both bacteriophages showed identical latent periods of 8 minutes and eclipse periods of 4 minutes; however, the burst size of bacteriophage CRES7 was 57.6 PFU per infected cell, which was approximately twice as large as that of bacteriophage CRES9 (30.3 PFU) (Fig. 8). Since the burst size represents the number of phages replicated within the host, a larger burst size implies higher phage proliferation efficiency. Therefore, bacteriophage CRES7 has higher proliferation efficiency than bacteriophage CRES9.

[0148] Figure 8C is the primary growth curve of bacteriophage CRES7, Figure 8D is the primary growth curve of bacteriophage CRES9, E is the eclipse period, L is the latent period, and B is the burst size.

[0149] The results of the two experiments mentioned above suggest that differences in tail fiber gp28 can have a significant impact on phage adsorption efficiency and explosion size.

[0151] [Experimental Example 6: Safety and Stability Test of Bacteriophage]

[0152] 1. Bacterial challenge assay

[0153] A bacterial challenge assay was performed to analyze the effect of gp28 differences (mutations) on antimicrobial activity. Cronobacter sakazakii bacterial cells in the logarithmic growth phase were infected with bacteriophages at a concentration of 0.1 MI7I and cultured at 37°C for 24 hours with shaking. Absorbance at a wavelength of 600 nm (optical density at 600 nm, OD 600) was measured at 30-minute intervals using a SpectraMax i3x device (Molecular Devices, CA, USA). SM buffer was used as a negative control.

[0154] As a result of the experiment, the two bacteriophages reduced bacterial growth within 1 hour after infection at an M0 (multiplicity of infection) of 0.1 and inhibited the growth of Cronobacter sakazakii ATCC 29544 up to 5 hours after infection (Fig. 9). Bacteriophages CRES7 and CRES9 showed similar patterns of bacterial growth inhibition in Cronobacter sakazakii ATCC 29544, indicating that the gp28 mutation did not affect overall lytic activity.

[0155] Figure 9 shows the lytic activity of bacteriophage CRES7 and bacteriophage CRES9 in Cronobacter sakazakii ATCC 29544, where green is the challenge assay of bacteriophage CRES7 and blue is the challenge assay of bacteriophage CRES9, and black is the negative control.

[0157] 2. Thermal and pH stability tests

[0158] Since some mutations in receptor binding proteins (RBPs) can impair the structural stability of proteins and affect thermodynamic stability, the thermal and acid-base stability of bacteriophages CRES7 and CRES9 was evaluated. To evaluate thermal and pH stability, phage solutions (10 prepared in SM buffer) 8 PFU / ml) was incubated for 1 hour at each temperature condition (4, 25, 37, 45, 50, 60, 70℃) and incubated for 1 hour at 37℃ in SM buffer adjusted to each pH (pH 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12). The number of plaques was calculated through drop tests, and thermal and pH stability were evaluated.

[0159] As a result of the thermal stability test, both bacteriophages maintained infectivity up to 60°C but lost infectivity at 70°C (Fig. 10A). Similarly, both bacteriophages maintained stability in the pH range of 3 to 11 but were inactivated within 1 hour at extreme pH values ​​(pH 2 and pH 12) (Fig. 10B). These results show that the gp28 mutation does not affect the thermal and acid-base stability of bacteriophages CRES7 and CRES9.

[0160] Figure 10 shows the thermal and pH stability of bacteriophages CRES7 and CRES9 in Cronobacter sakazakii ATCC 29544. Figure 10A shows the results of the thermal stability experiment of the phages, and Figure 10B shows the results of the pH stability experiment. The data represent the mean including the standard deviations of three independent experiments.

[0162] Depository Name: National Institute of Agricultural Sciences, Rural Development Administration, Microbial Bank (KACC) Accession Number: KACC97048P Date of Deposit: 2024-12-23 Depository Name: National Institute of Agricultural Sciences, Rural Development Administration, Microbial Bank (KACC) Accession Number: KACC97049P Date of Deposit: 2025-01-09

Claims

Claim 1 A kit for detecting O3 serotype Cronobacter sakazakii comprising bacteriophage CRES7 composed of the nucleic acid sequence described in SEQ ID NO. 1 and bacteriophage CRES9 composed of the nucleic acid sequence described in SEQ ID NO.

2. Claim 2 A kit for detecting Cronobacter sakazakii according to claim 1, wherein the bacteriophage CRES7 is susceptible to O1 serotype Cronobacter sakazakii. Claim 3 A kit for detecting Cronobacter sakazaki according to claim 1, wherein the bacteriophage CRES9 is susceptible to O1 serotype Cronobacter sakazaki and O3 serotype Cronobacter sakazaki. Claim 4 A method for distinguishing O3 serotype Cronobacter sakazakii, characterized by infecting a sample containing a mixture of O1 serotype Cronobacter sakazakii and O3 serotype Cronobacter sakazakii with bacteriophage CRES7 composed of the nucleic acid sequence described in SEQ ID NO. 1 and bacteriophage CRES9 composed of the nucleic acid sequence described in SEQ ID NO. 2, and confirming whether the bacteria are killed. Claim 5 A method for distinguishing O3 serotype Cronobacter sakazaki according to claim 4, characterized in that the bacteriophage CRES7 is susceptible to O1 serotype Cronobacter sakazaki, and the bacteriophage CRES9 is susceptible to O1 serotype Cronobacter sakazaki and O3 serotype Cronobacter sakazaki. Claim 6 In claim 4, the method for distinguishing O3 serotype Cronobacter sakazakii is characterized by distinguishing the sample as O3 serotype Cronobacter sakazakii when the sample does not show susceptibility to bacteriophage CRES7 but shows susceptibility to bacteriophage CRES9.

Images