Infectious clone of fraxinus symptomless virus and uses thereof

KR103001147B1Active Publication Date: 2026-08-11KYUNGPOOK NAT UNIV IND ACADEMIC COOP FOUND +1
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
KR1020220109553
Authority / Receiving Office
KR · KR
Patent Type
Patents
Current Assignee / Owner
Priority Date
2021-10-26
Filing Date
2022-08-31
Publication Date
2026-08-11
Estimated Expiration
2042-08-31

Smart Images

  • Figure 112022091328315-PAT00001_ABST
    Figure 112022091328315-PAT00001_ABST
Patent Text Reader

Abstract

The present invention produced an infectious clone of Fraxinus symptomless virus (FSMV), which was reported for the first time in Korea, and confirmed that it causes asymptomatic systemic infection when inoculated into tobacco (Nicotiana benthamiana; N. benthamiana). This infectious clone can be utilized in research to investigate the host range of FSMV and to characterize the virus.
Need to check novelty before this filing date? Find Prior Art

Description

Technology Field

[0001] The present invention relates to an infectious clone capable of inoculating with ash tree disease-free virus and its uses. Background Technology

[0002] Fraxinus rhynchophyll (F. rhynchophylla) is a plant primarily found in China, Korea, North America, the Indian subcontinent, and eastern Russia. Due to its chemical composition, it has been used as a traditional herbal medicine in Korea and various parts of the world. During a field survey in March 2019, almost negligible swelling symptoms were observed on several Fraxinus rhynchophyll trees. Subsequently, Fraxinus symptomless virus (FSMV) was identified from the trees through next-generation sequencing, rolling circle amplification (RPA), and polymerase chain reaction (PCR). This virus has only five open reading frames, is approximately 2.7 kb in size, and has nonanucleotide and stem-loop structures identical to those of begomovirus. It was confirmed that this virus is very similar to begomovirus in terms of size and structure, but does not exhibit significant sequence identity.

[0003] Accordingly, the present invention produced an infectious clone capable of inoculating the newly identified ash tree disease-free virus, and confirmed the infectivity of the clone by inoculating it into tobacco (Nicotiana benthamiana; N. benthamiana) and verifying replication in the plant.

[0004] In other words, the present invention produced an infectious clone of Fraxinus symptomless virus (FSMV), which was reported for the first time in Korea, and confirmed that it causes asymptomatic systemic infection when inoculated into tobacco (Nicotiana benthamiana; N. benthamiana). This infectious clone can be utilized in research to investigate the host range of Fraxinus symptomless virus (FSMV) and to characterize the virus. Prior art literature

[0005] 10-2008-0052553 The problem to be solved

[0006] The present invention aims to provide an infectious clone of Fraxinus symptomless virus (FSMV).

[0007] In addition, the present invention aims to provide a composition for diagnosing Fraxinus symptomless virus (FSMV).

[0008] Finally, the present invention aims to provide a diagnostic kit for Fraxinus symptomless virus (FSMV). means of solving the problem

[0009] To achieve the technical objectives described above, the present invention provides an infectious clone of Fraxinus symptomless virus (FSMV) comprising nucleotide sequences represented by SEQ ID NO. 4 and SEQ ID NO. 5.

[0010] In one embodiment of the present invention, the clone may be one in which the nucleotide sequences represented by SEQ ID NO. 4 and SEQ ID NO. 5 are introduced into the pCAMBIA1303 vector, but is not limited thereto.

[0011] In one embodiment of the present invention, the clone may be used to determine the host range and viral characteristics of the ash tree disease virus, but is not limited thereto.

[0012] In one embodiment of the present invention, the ash tree disease virus may be represented by accession number MZ054403 or MZ054404, but is not limited thereto.

[0013] In addition, the present invention provides a composition for diagnosing Fraxinus symptomless virus (FSMV) comprising nucleotide sequences represented by SEQ ID NO. 7 and SEQ ID NO. 8.

[0014] In one embodiment of the present invention, the ash tree disease virus may be represented by accession number MZ054403 or MZ054404, but is not limited thereto.

[0015] Finally, the present invention provides a diagnostic kit for ash tree disease-free virus comprising a composition for diagnosing ash tree disease-free virus. Effects of the invention

[0016] The present invention produced an infectious clone of Fraxinus symptomless virus (FSMV), which was reported for the first time in Korea, and confirmed that it causes asymptomatic systemic infection when inoculated into tobacco (Nicotiana benthamiana; N. benthamiana). This infectious clone can be utilized in research to investigate the host range of FSMV and to characterize the virus. Brief explanation of the drawing

[0017] FIG. 1 is a schematic diagram showing the production of an infectious clone of Fraxinus symptomless virus (FSMV) in one embodiment of the present invention. FIG. 2 is a figure showing the confirmation of inoculation with Fraxinus symptomless virus (FSMV) in tobacco (Nicotiana benthamiana; N. benthamiana) in one embodiment of the present invention. Specific details for implementing the invention

[0018] Hereinafter, the present invention will be described in detail with reference to the attached drawings and embodiments thereof. However, the following embodiments are presented as examples of the present invention, and if it is determined that a detailed description of a technology or configuration well known to those skilled in the art may unnecessarily obscure the essence of the present invention, such detailed description may be omitted, and the present invention is not limited by this. The present invention is capable of various modifications and applications within the scope of the claims set forth below and the equivalent scope interpreted therefrom.

[0019] Furthermore, the terminology used in this specification is used to appropriately describe preferred embodiments of the present invention, and may vary depending on the intent of the user or operator, or the conventions of the field to which the present invention belongs. Accordingly, the definitions of these terms should be based on the content throughout this specification. Throughout the specification, when a part is described as “comprising” a certain component, unless specifically stated otherwise, this means that it does not exclude other components but may include additional components.

[0020] In the present invention, "primer" refers to a single-stranded oligonucleotide sequence complementary to the nucleic acid strand to be copied, and may serve as a starting point for the synthesis of a primer extension product. The length and sequence of the primer must allow the synthesis of the extension product to begin. The specific length and sequence of the primer may depend on the complexity of the required DNA or RNA target, as well as primer usage conditions such as temperature and ionic strength. The oligonucleotide used as a primer may also include a nucleotide analogue, for example, a phosphorothioate, an alkylphosphorothioate, or a peptide nucleic acid, or may include an intercalating agent.

[0021] In the present invention, the "kit" may include not only a primer set consisting of the nucleotide sequences represented by SEQ ID NOs. 7 and SEQ ID NOs. 8, but also one or more other component compositions, solutions, or devices suitable for the analysis method. For example, the kit of the present invention may be a kit containing essential elements necessary to perform PCR. In addition to the primer set, the PCR kit may include test tubes or other suitable containers, reaction buffers (varying pH and magnesium concentration), deoxynucleotides (dNTPs), enzymes such as Taq-polymerase and reverse transcriptase, DNase, RNAse inhibitors, DEPC-water, and sterile water. Furthermore, the kit may include a guide. The guide is a printed document explaining the use of the kit, for example, the method of preparing the PCR buffer, the presented reaction conditions, etc. The guide may include instructions in the form of a pamphlet or leaflet, a label attached to the kit, and on the surface of a package containing the kit. Additionally, the guide may include information disclosed or provided through electronic media, such as the Internet.

[0022] Throughout this specification, '%' used to indicate the concentration of a particular substance is (w / w) % for solid / solid, (w / v) % for solid / liquid, and (v / v) % for liquid / liquid, unless otherwise noted.

[0024] <Example 1> Securing a Sample

[0025] A total of 41 plant samples of Fraxinus rhynchophyll (F. rhynchophylla) were collected from various regions of Korea during 2019 and 2020. Collections were performed in Jinju, Busan, Pocheon, Jeonnam, Yeongdong, and Daegu, and all samples were stored at -20°C until processing. Total DNA was extracted from leaf tissue samples using the Viral Gene-Spin Viral DNA / RNA Extraction Kit (iNtRON Biotechnology) or a cetyl trimethylammonium bromide (CTAB)-based extraction protocol. The total DNA from each sample was used in a Rolling-Circle Amplification (RCA) reaction using the TempliPhi™ kit (GE Healthcare, Chicago, IL, USA).

[0027] <Example 2> Confirmation of Virus Sequence

[0028] The RCA products of two samples collected in Jinju in March 2019 were sequenced on the Illumina HiSeq 4000 platform (paired end 2×100 bp) of Macrogen Inc. (Seoul, Korea), yielding 74,391,351 reads. Each read was reassembled using SPAdes v. 3.12.0, generating 54,465 contigs. The generated contigs were analyzed using BLASTx against the GenBank Virus RefSeq protein database, confirming the presence of virus-derived DNA identical to existing Geminiviridae members. Polymerase chain reaction (PCR) was performed using primers (TF2 5'-AGTGTTGGACTCGAATCCAGAA-3'; SEQ ID NO. 1 and TR2 5'-CTGGACAGACGACGAATCCA-3'; SEQ ID NO. 2). When the PCR product was sequenced after gel electrophoresis, it showed a target size band of approximately 700 bp. Analysis using the NCBI Basic Local Alignment Search Tool (BLASTn) showed 34% sequence identity with MW316657 and 8% with MH678590. To analyze the entire sequence of this virus suspected to be novel, an amplicon with a target size of approximately 2.7 kb (the expected size range of the Gemini virus genome) amplified via the RCA method was cloned into the pGEM-3Zf(+) vector (Promega, Madison, WI) and then sequenced. The confirmed sequences were deposited in the NCBI GenBank, with accession numbers MZ054403 and MZ054404. The sequences of the virus detected in samples identified from various regions were similar to MZ054403, and therefore, in this invention, the RCA products of two samples collected in Jinju in March 2019 are Macrogen Inc.Sequencing was performed on the Illumina HiSeq 4000 platform (paired end 2×100 bp) in Seoul, Korea, yielding 74,391,351 reads. Each read was reassembled using SPAdes v. 3.12.0, generating 54,465 contigs. The generated contigs were analyzed against the GenBank Viral RefSeq Protein Database using BLASTx, confirming the presence of virus-derived DNA identical to existing Geminiviridae members. Polymerase Chain Reaction (PCR) was performed using primers (TF2 5'-AGT GTT GGA CTC GAA TCC AGA A-3'; SEQ ID NO. 1 and TR2 5'-CTG GAC AGA CGA CGA ATC CA-3'; SEQ ID NO. 2). The PCR products exhibited a target size band of approximately 700 bp upon sequencing after gel electrophoresis. Analysis using the NCBI Basic Local Alignment Search Tool (BLASTn) showed 34% sequence identity with MW316657 and 8% with MH678590. To analyze the entire sequence of the virus suspected to be novel, an amplicon with a target size of approximately 2.7 kb (the expected size range of the Gemini virus genome) amplified via the RCA method was cloned into the pGEM-3Zf(+) vector (Promega, Madison, WI) and then sequenced. The identified nucleotide sequences were deposited in the NCBI GenBank, with accession numbers MZ054403 and MZ054404. The sequences of the virus detected in samples from various regions were similar to MZ054403; therefore, the sequence corresponding to MZ054403 was used in this invention.

[0030] Sequence No. 1 (TF2 primer sequence): AGTGTTGGACTCGAATCCAGAA

[0031] Sequence No. 2 (TR2 Primer Sequence): CTGGACAGACGACGAATCCA

[0032]

[0034] <Example 3> Production of an Infectious Clone

[0035] To confirm infectivity in host plants, infectious clones of Fraxinus symptomless virus (FSMV) were constructed. Two partial genomes (SEQ No. 4 and SEQ No. 5) containing restriction sites at the margins were amplified using a primer set designed based on the sequence of Fraxinus symptomless virus (FSMV) and ligated to the pGEM-T Easy vector (Promega, USA) according to the manufacturer's instructions using TA cloning technology. These two partial genomes were introduced into the pCAMBIA1303 vector (SEQ No. 6), first transformed into the E. coli strain DH5α and then into the GV3101 Agrobacterium strain using the heat shock method, and the transformants containing recombinant DNA were confirmed by colony PCR using an enzymatic degradation and detection primer set.

[0037]

[0038]

[0039]

[0041] <Example 4> Inoculation of an infectious clone using Agrobacterium

[0042] Four-week-old tobacco (Nicotiana benthamiana; N. benthamiana) plants of similar size were selected for the inoculation experiment. Transformed Agrobacterium GV3101 strains (transformed and non-transformed) were cultured in LB medium containing the pCAMBIA1303 selective antibiotic, kanamycin (50 mg / L), and strain-specific selective antibiotics, gentamycin and rifampicin (50 mg / L), with stirring at 28°C for 30 hours until the OD value at 600 nm reached 0.8–1.0. Inoculation was performed by puncturing the apical end of the plant with a pin. To confirm infectivity, leaves were collected from infected plants 28 days (dpi) after inoculation. The plants did not show symptoms in either the control group or the Fraxinus symptomless virus (FSMV) inoculation group. No differences were observed among all inoculated plants.

[0044] <Example 5> Preparation of primers for virus diagnosis and virus diagnosis

[0045] Specific primers (Ash_Gemini_2F 5'-CCACGTGTCATCATCTTA GG-3'; SEQ ID NO. 7 and Ash_Gemini_2R 5'-TAGTCCCGGTCAATTTCTTG-3'; SEQ ID NO. 8) that amplify a 737 bp product based on the full-length nucleotide sequence were designed and used for diagnosis. Polymerase chain reaction (PCR) for detection in all samples was performed according to standard amplification conditions: denaturation at 94°C (3 min), followed by 35 cycles of 30 seconds at 94°C, 30 seconds at 58°C, and 1 min at 72°C, and final elongation at 72°C (5 min). Diagnosis was performed on plants inoculated with infectious clones using this primer set, and it was confirmed that the virus was present.

[0047] Sequence No. 7 (Ash_Gemini_2F): CCACGTGTCATCATCTTAGG

[0048] Sequence No. 8 (Ash_Gemini_2R): TAGTCCCGGTCAATTTCTTG

[0050] <Example 6> Confirmation of Virus Replication in Plant Body

[0051] Strand-specific amplification was performed to confirm viral replication within the plant. In the first step, an extension reaction was conducted using a single-stranded viral template, T4 DNA polymerase (TaKaRa, Japan), and virus-specific primers OCS-TAG or OVS-TAG to perform strand-specific amplification, followed by purification using the QIA Quick PCR Purification Kit. In the second step, 2 μl of the product from the first strand reaction was mixed with 10 μl of 2X AccuPower PCR Master Mix (Bioneer), 1 μl of 10 pM specific primers (TAG, OVS, or OCS), and 6 μl of nuclease. Following the manufacturer's protocol, the reaction was carried out at 95°C for 30 seconds, followed by 10 seconds at 95°C, 15 seconds at 60°C, and 20 seconds at 72°C. Through this reaction, the double-stranded virus-specific DNA produced during replication was identified. This allowed for the confirmation of viral replication in the inoculated plant, thereby verifying the utility of the produced infectious clone.

[0053] As described above, although the present invention has been explained as a preferred embodiment mentioned above, those skilled in the art will be able to readily propose other inventions that are inferior or other embodiments included within the scope of the inventive concept by adding, changing, or deleting other components within the same technical scope. Therefore, the embodiments described above are illustrative in all respects and do not limit the scope of the present invention.

Claims

Claim 1 An infectious clone of Fraxinus symptomless virus (FSMV) comprising the nucleotide sequences represented by SEQ ID NO. 4 and SEQ ID NO. 5, wherein the nucleotide sequences represented by SEQ ID NO. 4 and SEQ ID NO. 5 are introduced into a pCAMBIA1303 vector. Claim 2 delete Claim 3 delete Claim 4 delete Claim 5 A diagnostic composition for specifically detecting Fraxinus symptomless virus (FSMV) from a plant sample infected with said virus, comprising a primer pair consisting of nucleotide sequences represented by SEQ ID NO. 7 and SEQ ID NO.

8. Claim 6 A composition for diagnosing ash tree disease-free virus according to claim 5, wherein the ash tree disease-free virus is represented by accession number MZ054403 or MZ054404. Claim 7 A diagnostic kit for Fraxinus symptomless virus (FSMV) comprising the composition of claim 5 or 6.

Citation Information

Patent Citations

  • A transformation method for viviparous plant

    KR1020050076332A

  • Infectious clone of Croton yellow vein mosaic alpha-satellite DNA and uses thereof

    KR1020180077590A

  • Infectious clone of Tomato leaf curl Joydebpur virus and uses thereof

    KR1020200126651A

  • Infectious clone of Faba bean necrotic yellows virus DNA-R and DNA-S and uses thereof

    KR1020210070687A