Composition for immunostimulation comprising polysaccharide derived from fermentation of Astragalus membranaceus extract with lactic acid bacteria
Patent Information
- Application Number
- KR1020240012161
- Authority / Receiving Office
- KR · KR
- Patent Type
- Patents
- Current Assignee / Owner
- Filing Date
- 2024-01-26
- Publication Date
- 2026-08-12
- Estimated Expiration
- 2044-01-26
Smart Images

Figure 112024010421356-PAT00001_ABST
Abstract
Description
Technology Field
[0001] The present invention relates to an immune-enhancing composition containing a polysaccharide fraction derived from a fermented Astragalus membranaceus extract as an active ingredient, and more specifically, to a food composition and a pharmaceutical composition for immune enhancement containing a polysaccharide fraction obtained from a fermented Astragalus membranaceus extract as an active ingredient. Background Technology
[0002] With the recent spread of infectious diseases such as COVID-19 and monkeypox virus (MPOX), the trend of self-medication—where people spare no expense in taking care of their own health—is continuing, leading to a surge in interest in immunity.
[0003] Immunity is the most important and powerful weapon protecting the body from external threats. Since a weakened immune system increases the risk of exposure to various diseases, it is the foundation and essential of health management. Immunity can be enhanced not only through deep sleep, rest, exercise, and personal hygiene, but also through health functional foods that have immune-boosting effects.
[0004] As of last year, there were a total of 28 health functional food ingredients recognized by the Ministry of Food and Drug Safety for their ability to improve immune function, ranking third after ingredients for liver health, blood sugar, and cholesterol improvement. Among them, red ginseng is the most representative ingredient. Red ginseng binds to receptors present on macrophages, which are responsible for innate immunity, sending activation signals into the cells. These activated macrophages then produce substances capable of eliminating viruses or bacteria that have invaded the body and secrete cytokines, which are immunomodulatory substances, to protect the body. Additionally, propolis, formed by mixing plant secretions such as pollen with honeybee secretions, is known to improve overall bodily immunity.
[0005] However, red ginseng requires caution in consumption as it can cause allergic reactions, and its intake is restricted for those taking blood pressure medication as it can raise blood pressure. Additionally, red ginseng has the disadvantage of being expensive due to the long cultivation period of over five years and the complex processes involved. Propolis contains components from specific types of trees and plants, requiring extreme caution regarding allergic reactions. Furthermore, because it is composed of high-molecular polymers, its digestive absorption rate in the small intestine is less than 5%, resulting in very low efficacy relative to the dosage. Additionally, propolis has very low solubility, causing it to stick to the walls of containers and making it very difficult to consume, and its low yield contributes to its high price.
[0006] In addition, astragalus is used as a medicinal ingredient ( Astragalus membranaceus It is a perennial herbaceous plant belonging to the Leguminosae family listed in the Korean Pharmacopoeia, and its roots are mainly used as medicinal ingredients. It contains many active ingredients that have immune-boosting functions, but there is a limitation in that its intake is restricted due to the disadvantage that the active ingredients are not effectively absorbed through digestive mechanisms when taken orally.
[0007] Therefore, there is a growing need to develop an extract capable of effectively delivering pharmacological components into the body while stably preserving the active ingredients related to immune enhancement contained in Astragalus membranaceus. Prior art literature
[0008] Republic of Korea Published Patent Application No. 10-2022-0017738 The problem to be solved
[0009] The objective of the present invention is to provide a food composition capable of improving or preventing immune activity, containing as an active ingredient a polysaccharide fraction derived from fermented Astragalus membranaceus that is harmless to the human body and has a significantly enhanced immune-boosting effect.
[0010] In addition, another objective of the present invention is to provide a pharmaceutical composition capable of preventing or treating immune diseases, containing a polysaccharide fraction derived from fermented Astragalus membranaceus as an active ingredient. means of solving the problem
[0011] According to one aspect of the present invention, an immune-boosting food composition is provided that contains a polysaccharide fraction derived from fermented Astragalus membranaceus as an active ingredient.
[0012] The polysaccharide fraction derived from the fermented Astragalus membranaceus above comprises (a) Lactobacillus sakei (in a hot water extract of Astragalus membranaceus Lactobacillus sakei ) and Leuconostoc mesenteroides ( Leuconostoc mesenteroides It may be produced by a manufacturing method comprising: a step of producing a fermented Astragalus product by treating with a mixed strain of ) and a step of recovering a polysaccharide fraction by precipitating the fermented Astragalus product with a C1 to C4 alcohol.
[0013] (c) a step of recovering a fraction with a molecular weight of 10 kDa or more from the polysaccharide fraction of step (b) above; may be produced by a manufacturing method further comprising: (c) a step of recovering a fraction with a molecular weight of 10 kDa or more.
[0014] The above polysaccharide fraction derived from the fermented Astragalus may have a neutral sugar content of 70 to 80 weight%, a uronic acid content of 15 to 25 weight%, a protein content of 1 to 5 weight%, and a polyphenol content of 1 to 5 weight% relative to the total polysaccharide fraction.
[0015] The above polysaccharide fraction derived from the fermented Astragalus may comprise constituent sugars consisting of mannose 40 to 50 mol%, rhamnose 1 to 5 mol%, glucuronic acid 1 to 5 mol%, galacturonic acid 5 to 15 mol%, glucose 15 to 20 mol%, galactose 10 to 15 mol%, xylose 0.1 to 1.5 mol%, arabinose 5 to 10 mol%, and fucose 1 to 2 mol%.
[0016] The polysaccharide fraction derived from the fermented Astragalus membranaceus may increase the production of one or more immune biomarkers selected from the group consisting of cytokines TNF-α, IL-6, MCP-1, iNOS, COX2, NF-kB, and MAPK.
[0017] The above food composition may improve one or more immune diseases selected from the group consisting of the common cold, asthma, pneumonia, allergic rhinitis, allergic conjunctivitis, atopic dermatitis, allergy, rheumatoid arthritis, Alzheimer's disease, autoimmune thyroid disease, inflammatory bowel disease, aplastic anemia, lupus erythematosus, and psoriasis.
[0018] According to another aspect of the present invention, a pharmaceutical composition for boosting immunity is provided, which prevents or treats immune diseases and contains a polysaccharide fraction derived from fermented Astragalus membranaceus as an active ingredient.
[0019] The polysaccharide fraction derived from the above fermented Astragalus is (a) Lactobacillus sakei (in hot water extract of Astragalus) L. sakei ) and Leuconostoc mesenteroides ( Leu. mesenteroides It may be produced by a manufacturing method comprising: a step of producing a fermented Astragalus product by treating with a mixed strain of ) and a step of recovering a polysaccharide fraction by precipitating the fermented Astragalus product with a C1 to C4 alcohol.
[0020] (c) a step of recovering a fraction with a molecular weight of 10 kDa or more from the polysaccharide fraction of step (b) above; may be produced by a manufacturing method further comprising: (c) a step of recovering a fraction with a molecular weight of 10 kDa or more.
[0021] The above polysaccharide fraction derived from the fermented Astragalus extract may contain 70 to 80 weight% neutral sugar, 15 to 25 weight% uronic acid, 1 to 5 weight% protein, and 1 to 5 weight% polyphenol relative to the total polysaccharide fraction.
[0022] The above polysaccharide fraction derived from the fermented Astragalus may comprise constituent sugars consisting of mannose 40 to 50 mol%, rhamnose 1 to 5 mol%, glucuronic acid 1 to 5 mol%, galacturonic acid 5 to 15 mol%, glucose 15 to 20 mol%, galactose 10 to 15 mol%, xylose 0.1 to 1.5 mol%, arabinose 5 to 10 mol%, and fucose 1 to 2 mol%.
[0023] The above immune diseases may be one or more selected from the group consisting of the common cold, asthma, pneumonia, allergic rhinitis, allergic conjunctivitis, atopic dermatitis, allergy, rheumatoid arthritis, Alzheimer's disease, autoimmune thyroid disease, inflammatory bowel disease, aplastic anemia, lupus erythematosus, and psoriasis. Effects of the invention
[0024] The present invention relates to an immune-enhancing composition containing a polysaccharide fraction derived from a fermented Astragalus extract as an active ingredient. The polysaccharide fraction is obtained by fermenting the hot water extract of Astragalus using lactic acid bacteria derived from kimchi, and then isolating the resulting product. Since it is harmless to the human body and exhibits significantly enhanced immune-enhancing efficacy compared to general fermented Astragalus extract or hot water extract of Astragalus, it can be used in the manufacture of immune-enhancing pharmaceuticals or foods. Brief explanation of the drawing
[0025] FIG. 1 is a schematic diagram illustrating the process of manufacturing a polysaccharide fraction derived from fermented Astragalus membranaceus according to the present invention. Figure 2 is a graph showing the molecular weight distribution of the polysaccharide fraction derived from the fermented Astragalus membranaceus product prepared from Example 1 (FAME-CP) and the polysaccharide fraction derived from the Astragalus membranaceus extract prepared from Comparative Example 3 (AME-CP). Figures 3 to 7 show the results of analyzing the viability of RAW 264.7 cells and macrophage activation-related factors (NO, TNF-α, MCP-1, and IL-6 production capacity) treated with the hot water extract of Astragalus membranaceus of Comparative Example 1 (AME), the fermented Astragalus membranaceus of Comparative Example 2 (FAME), the polysaccharide fraction derived from the hot water extract of Astragalus membranaceus of Comparative Example 3 (AME-CP), and the polysaccharide fraction derived from the fermented Astragalus membranaceus of Example 1 (FAME-CP) at various concentrations. Figure 8 is a graph showing the expression levels of mRNA genes (iNOS, TNF-α, MCP-1, IL-6, COX-2), which are macrophage stimulating factors, analyzed by qRT-PCR when the polysaccharide fraction (FAME-CP) derived from the fermented Astragalus extract of Example 1 was treated to RAW 264.7 cells. Figure 9 shows the results of analyzing NF-κB and MAPK (mitogen-activated protein kinase), which are macrophage activation mechanisms, in RAW 264.7 cells treated with the polysaccharide fraction (FAME-CP) derived from the fermented Astragalus extract prepared from Example 1 using immunofluorescence. Figures 10 and 11 are the 16S rRNA identification results of Preparation Example 1. Specific details for implementing the invention
[0026] The present invention is capable of various modifications and may have various embodiments; specific embodiments are illustrated in the drawings and described in detail in the detailed description. However, this is not intended to limit the present invention to specific embodiments, and it should be understood that it includes all modifications, equivalents, and substitutions that fall within the spirit and scope of the present invention. In describing the present invention, detailed descriptions of related prior art are omitted if it is determined that such detailed descriptions may obscure the essence of the present invention.
[0027] The terms used in this application are used merely to describe specific embodiments and are not intended to limit the invention. The singular expression includes the plural expression unless the context clearly indicates otherwise. In this application, terms such as "comprising" or "having" are intended to specify the presence of the features, numbers, steps, components, or combinations thereof described in the specification, and should be understood as not precluding the existence or addition of one or more other features, numbers, steps, components, or combinations thereof.
[0028] The present invention relates to an immune-enhancing composition containing a polysaccharide fraction derived from a fermented Astragalus root as an active ingredient. The polysaccharide fraction derived from a fermented Astragalus root according to the present invention exhibited superior immune-enhancing effects compared to a general hot water extract of Astragalus root or a fermented Astragalus root.
[0029] The present invention will be described in more detail below.
[0030] The polysaccharide fraction derived from the fermented Astragalus of the present invention comprises, relative to the total polysaccharide fraction, 70 to 80 weight% of neutral sugar, 15 to 25 weight% of uronic acid, 1 to 5 weight% of protein content, and 1 to 5 weight% of polyphenol content.
[0031] The polysaccharide fraction derived from the fermented Astragalus membranaceus above may include, but is not limited to, mannose, rhamnose, glucuronic acid, galacturonic acid, glucose, galactose, xylose, arabinose, and fucose as constituent sugars; more preferably, it may comprise a constituent sugar composed of 40 to 50 mol% mannose, 1 to 5 mol% rhamnose, 1 to 5 mol% glucuronic acid, 5 to 15 mol% galacturonic acid, 15 to 20 mol% glucose, 10 to 15 mol% galactose, 0.1 to 1.5 mol% xylose, 5 to 10 mol% arabinose, and 1 to 2 mol% fucose; and most preferably, it may comprise 44-45 mol% mannose, 2-3 mol% rhamnose, and glucuronic acid. It may contain a constituent sugar composed of 2-3 mol% of aicd, 9-11 mol% of galacturonic acid, 19-20 mol% of glucose, 10-12 mol% of galactose, 1-2 mol% of xylose, 7-8 mol% of arabinose, and 1-2 mol% of fucose.
[0032] The polysaccharide fraction derived from the fermented Astragalus membranaceus above comprises (a) Lactobacillus sakei (in a hot water extract of Astragalus membranaceus L. sakei ) and Leuconostoc mesenteroides ( Leu. mesenteroides It is manufactured by a manufacturing method comprising: (a) a step of preparing a fermented Astragalus product by treating with a mixed strain of ) and (b) a step of recovering a polysaccharide fraction by precipitating the fermented Astragalus product with a C1 to C4 alcohol.
[0033] First, in step (a) above, Lactobacillus sakei ( L. sakei ) and Leuconostoc mesenteroides ( Leu. mesenteroides Treat a mixed strain of )
[0034] The above Lactobacillus sakei ( L. sakei ) and Leuconostoc mesenteroides ( Leu. mesenteroidesThe mixed strain of ) can be added at 1 to 10 weight% relative to the weight of the hot water extract of Astragalus membranaceus, preferably at 2 to 8 weight%, and more preferably at 3.5 to 6.5 weight%.
[0035] The above mixed strain is Lactobacillus sakei ( L. sakei ) and Leuconostoc mesenteroides ( Leu. mesenteroides It may be a mixture of ) in a 1:1 weight ratio.
[0036] The above Lactobacillus sakei ( L. sakei ) and Leuconostoc mesenteroides ( Leu. mesenteroides ) are each 1 × 10 6 CFU / ml to 1 × 10⁻⁶ 9 CFU / ml, more preferably 1 × 10⁻⁶ 6 CFU / ml to 1 × 10⁻⁶ 8 CFU / ml, more preferably 1.0 × 10⁻⁶ 6 CFU / ml to 1.0 × 10⁻⁶ 7 It can be included in CFU / ml.
[0037] In the present invention, the hot water extract of Astragalus membranaceus may be used in powdered form.
[0038] The above hot water extract of Astragalus may be an extract obtained by extracting Astragalus roots with hot water. Specifically, after completely drying the Astragalus roots and mixing them with water, hot water extraction may be performed at 90 to 110°C, preferably 100°C, until the water volume is reduced by half. At this time, the Astragalus roots may be prepared by adding water in an amount of 5 to 20 times (w / v). The Astragalus roots may be used in a crushed or powdered form.
[0039] The above fermentation process can be carried out for 0.5 to 5 days, and more preferably for 0.5 to 2 days.
[0040] Step (a) above may additionally perform a process of inactivating the remaining lactic acid bacteria after fermentation by heating at 100 to 130°C for 10 to 60 minutes. The heating increases the elution of soluble polysaccharide components and denatures and precipitates high molecular weight proteins contained as some impurities, thereby improving the purity and obtaining of polysaccharide extracts by centrifugation.
[0041] Although the fermented Astragalus obtained through step (a) above underwent a fermentation process using lactic acid bacteria, its immune-enhancing effect was significantly lower compared to the extract obtained by hot water extraction of Astragalus directly; however, the polysaccharide fraction of the fermented Astragalus extracted according to the above method showed significantly superior immune-enhancing activity compared to the polysaccharide fraction of the hot water extract.
[0042] In addition, after step (a) above, a step of removing residue from the fermented Astragalus product may be additionally performed. The method of removing residue may be by a known method of removing solids from a mixture, such as centrifugation or filtration, and preferably by centrifugation.
[0043] Next, in step (b) above, an organic solvent is added to the fermented Astragalus product to obtain a precipitated polysaccharide. The organic solvent may be a C1 to C4 alcohol. The alcohol precipitation may be carried out by a known ethanol precipitation method, and the ethanol used for the ethanol precipitation is preferably ethanol having a concentration of 70% to 95% (v / v) when mixed with water.
[0044] The above manufacturing method may further include (c) a step of recovering a fraction with a molecular weight of 10 kDa or more using ultrafiltration or gel filtration chromatography after step (b).
[0045] The method for obtaining the above fraction is not particularly limited as long as it is a purification method based on molecular weight, but preferably it may be ultrafiltration or gel filtration chromatography, and more preferably ultrafiltration. In addition, the final polysaccharide fraction may be in the form of an extract, concentrate, powder, etc.
[0046] As a result of analyzing the composition of the crude polysaccharide fraction (FAME-CP) derived from the fermented Astragalus membranaceus obtained above, it was confirmed that the polysaccharide fraction derived from the fermented Astragalus membranaceus of the present invention contains 74.4% by weight of neutral sugar, 18.6% by weight of uronic acid, 4.7% by weight of protein, and 2.3% by weight of polyphenol relative to the total polysaccharide fraction.
[0047] In addition, as a result of analyzing the constituent sugars of the polysaccharide fraction derived from the fermented Astragalus plant using HPLC-UV, it was confirmed that the fraction contains constituent sugars consisting of mannose 44-45 mol%, rhamnose 2-3 mol%, glucuronic acid 2-3 mol%, galacturonic acid 9-11 mol%, glucose 19-20 mol%, galactose 10-12 mol%, xylose 1-2 mol%, arabinose 7-8 mol%, and fucose 1-2 mol%.
[0048] A step of purifying the polysaccharide by removing low molecular weight substances and impurities can be further performed by adding 50 to 100% of an alcohol having 1 to 4 carbon atoms to the final polysaccharide fraction above.
[0049] Specifically, the present invention obtained a fraction derived from fermented Astragalus with a molecular weight of 10 kDa or more by treating the above-mentioned hot water extract of Astragalus with lactic acid bacteria and precipitating it with an alcohol having 1 to 4 carbon atoms, and using the above-mentioned method to obtain a crude polysaccharide fraction derived from fermented Astragalus.
[0050] In the present invention, the polysaccharide fraction derived from the fermented Astragalus membranaceus may increase the production of one or more immune biomarkers selected from the group consisting of cytokines TNF-α, IL-1β, IL-6, MCP-1, iNOS, COX2, NF-kB, and MAPK.
[0051] The above composition may prevent, treat, or improve any one or more immune diseases selected from the group consisting of the common cold, asthma, pneumonia, allergic rhinitis, allergic conjunctivitis, atopic dermatitis, allergy, rheumatoid arthritis, Alzheimer's disease, autoimmune thyroid disease, inflammatory bowel disease, aplastic anemia, lupus erythematosus, and psoriasis.
[0052] The term 'fraction' used in this specification when referring to Astragalus includes not only fractions obtained by treating with an extraction solvent but also processed products of polysaccharide fractions derived from fermented Astragalus. For example, polysaccharide fractions derived from fermented Astragalus can be prepared in a powder state by additional processes such as vacuum distillation and freeze-drying or spray-drying.
[0053] In addition, the polysaccharide fraction derived from the fermented Astragalus of the present invention has a broader meaning that includes processed polysaccharides derived from the fermented Astragalus of the present invention, such as polysaccharide powder derived from the fermented Astragalus of the present invention, which is formulated to allow Astragalus of the present invention to be administered to animals. Although experiments were conducted using the polysaccharide fraction derived from the fermented Astragalus of the present invention, those skilled in the art would expect that the desired effect can also be achieved in the form of processed polysaccharides derived from the fermented Astragalus of the present invention.
[0054] Meanwhile, in this specification, the term "containing as an active ingredient" means containing an amount sufficient to achieve the efficacy or activity of the polysaccharide fraction derived from fermented Astragalus. For example, the polysaccharide fraction derived from fermented Astragalus is used at a concentration of 10 to 1500 μg / ml, preferably 50 to 1000 μg / ml. Since the polysaccharide fraction derived from fermented Astragalus is a natural product and does not cause adverse effects on the human body even when administered in excess, the quantitative upper limit of the polysaccharide fraction derived from fermented Astragalus included in the composition of the present invention may be selected and implemented by a person skilled in the art within an appropriate range.
[0055] In addition, the present invention provides an immune-enhancing food composition containing a polysaccharide fraction derived from fermented Astragalus membranaceus as an active ingredient.
[0056] In this invention, the term "immunity" refers to a self-defense system existing within the body, meaning the process by which the human body recognizes various substances or living organisms invading from the outside as foreign substances, eliminates them, and metabolizes them; and "immunity improvement" refers to enhancing immune function.
[0057] The food composition of the present invention is effective in preventing, improving, and treating immune diseases caused by a decline in immune function. The immune diseases include, but are not limited to, infectious diseases such as the common cold, inflammatory diseases, allergic diseases such as atopic dermatitis, AIDS, and cancer. It may include all diseases caused by a decline in immune function known to those skilled in the art. As an example, the immune diseases may improve one or more selected from the group consisting of the common cold, asthma, pneumonia, allergic rhinitis, allergic conjunctivitis, atopic dermatitis, allergy, rheumatoid arthritis, Alzheimer's disease, autoimmune thyroid disease, inflammatory bowel disease, aplastic anemia, lupus erythematosus, and psoriasis.
[0058] In the present invention, the food composition may be for companion animals, and the companion animal may be a dog or a cat, but is not limited thereto.
[0059] The food composition of the present invention may be prepared using an auxiliary agent that is food-suitable and physiologically acceptable in addition to the active ingredient, and the auxiliary agent may include excipients, disintegrants, sweeteners, binders, coating agents, leavening agents, lubricants, lubricants, or flavoring agents.
[0060] The above food composition may preferably be formulated as a food composition by including one or more pharmaceutically or food-acceptable carriers in addition to the active ingredients described above for administration.
[0061] The formulation form of the above food composition may be granules, powders, tablets, coated tablets, capsules, suppositories, liquids, syrups, juices, suspensions, emulsions, drops, or injectable liquids. For example, for formulation into the form of tablets or capsules, the active ingredient may be combined with an oral, non-toxic, pharmaceutically acceptable inert carrier such as ethanol, glycerol, or water. Additionally, if desired or necessary, suitable binders, lubricants, disintegrants, and colorants may also be included in the mixture. Suitable binders include, but are not limited to, natural sugars such as starch, gelatin, glucose, or beta-lactose; corn sweeteners; natural and synthetic gums such as acacia, trackercanth, or sodium oleate; sodium stearate; magnesium stearate; sodium benzoate; sodium acetate; sodium chloride; etc. Disintegrants include, but are not limited to, starch, methylcellulose, agar, bentonite, xanthan gum, etc.
[0062] Acceptable carriers for compositions formulated as liquid solutions include saline solution, sterile water, Ringer's solution, buffered saline solution, albumin injection solution, dextrose solution, maltodextrin solution, glycerol, ethanol, and a mixture of one or more of these components, provided that they are sterile and biocompatible. Additionally, other conventional additives such as antioxidants, buffers, and bacteriostatic agents may be added as needed. Furthermore, diluents, dispersants, surfactants, binders, and lubricants may be additionally added to formulate the composition into injectable formulations such as aqueous solutions, suspensions, and emulsions, as well as pills, capsules, granules, or tablets.
[0063] Furthermore, it can be preferably formulated according to each disease or component by using the method disclosed in Remington's Pharmaceutical Science, Mack Publishing Company, Easton PA as an appropriate method in the field.
[0064] The food composition according to the present invention can be formulated in the above manner and used as a functional food or added to various foods. Foods to which the composition of the present invention can be added include, for example, beverages, alcoholic beverages, confectionery, diet bars, dairy products, meat, chocolate, pizza, ramen, other noodles, chewing gum, ice cream, vitamin complexes, health supplements, etc.
[0065] The food composition of the present invention may include, as an active ingredient, a polysaccharide fraction derived from fermented Astragalus membranaceus, as well as ingredients that are typically added during food manufacturing, such as, for example, proteins, carbohydrates, fats, nutrients, seasonings, and flavorings. Examples of the carbohydrates mentioned above include monosaccharides, e.g., glucose, fructose, etc.; disaccharides, e.g., maltose, sucrose, oligosaccharides, etc.; and polysaccharides, such as conventional sugars like dextrin, cyclodextrin, etc., and sugar alcohols such as xylitol, sorbitol, erythritol, etc. As flavorings, natural flavorings [taumatin, stevia extract (e.g., rebaudioside A, glycyrrhizin, etc.)] and synthetic flavorings (saccharin, aspartame, etc.) may be used. For example, when the food composition of the present invention is manufactured into a drink or beverage, in addition to the polysaccharide fraction derived from the fermented Astragalus of the present invention, citric acid, liquid fructose, sugar, glucose, acetic acid, malic acid, fruit juice, and various plant extracts may be additionally included.
[0066] The present invention provides a health functional food comprising a food composition for immune enhancement that includes the above-mentioned polysaccharide fraction derived from the fermented Astragalus membranaceus extract as an active ingredient. This provides a health functional food comprising a food composition for improving, preventing, or treating immunity. A health functional food refers to a food prepared by adding a polysaccharide fraction derived from the fermented Astragalus membranaceus extract to food materials such as beverages, teas, spices, chewing gum, or confectionery, or by encapsulating, powdering, or suspension thereof, which brings about specific health effects when consumed. Unlike general pharmaceuticals, it has the advantage of being made from food ingredients and thus avoiding side effects that may occur with long-term use of pharmaceuticals. The health functional food of the present invention obtained in this manner is very useful because it can be consumed on a daily basis. The amount of polysaccharide fraction derived from fermented Astragalus membranaceus added to such health functional foods varies depending on the type of health functional food to be added and cannot be uniformly specified, but it may be added within a range that does not impair the original taste of the food, and is typically in the range of 0.01 to 50 weight%, preferably 0.1 to 20 weight% with respect to the food to be added. In addition, in the case of health functional foods in the form of pills, granules, tablets, or capsules, it may be added in the range of typically 0.1 to 100 weight%, preferably 0.5 to 80 weight%. In one embodiment, the health functional food of the present invention may be in the form of pills, tablets, capsules, or beverages.
[0067] In addition, the present invention provides a use for a polysaccharide fraction derived from fermented Astragalus membranaceus for the manufacture of medicines or foods for immune enhancement, improvement of immunity, prevention, or treatment. As described above, the polysaccharide fraction derived from fermented Astragalus membranaceus can be used for the improvement, prevention, or treatment of immune diseases.
[0068] In addition, the present invention provides a pharmaceutical composition for preventing or treating immune diseases, containing the polysaccharide fraction derived from the fermented Astragalus membranaceus as an active ingredient.
[0069] The pharmaceutical composition of the present invention is effective in preventing, improving, and treating immune diseases caused by a decline in immune function. The immune diseases include, but are not limited to, infectious diseases such as the common cold, inflammatory diseases, allergic diseases such as atopic dermatitis, AIDS, and cancer. It may include all diseases caused by a decline in immune function known to those skilled in the art. As an example, the immune diseases may improve one or more selected from the group consisting of the common cold, asthma, pneumonia, allergic rhinitis, allergic conjunctivitis, atopic dermatitis, allergy, rheumatoid arthritis, Alzheimer's disease, autoimmune thyroid disease, inflammatory bowel disease, aplastic anemia, lupus erythematosus, and psoriasis.
[0070] The pharmaceutical composition of the present invention may be prepared using pharmaceutically suitable and physiologically acceptable adjuvants in addition to the active ingredient, and the adjuvants may include excipients, disintegrants, sweeteners, binders, coatings, leavening agents, lubricants, lubricants, or flavoring agents.
[0071] The above pharmaceutical composition may preferably be formulated into a pharmaceutical composition by including one or more pharmaceutically acceptable carriers in addition to the active ingredients described above for administration.
[0072] The formulation form of the above pharmaceutical composition may be granules, powders, tablets, coated tablets, capsules, suppositories, liquids, syrups, juices, suspensions, emulsions, drops, or injectable liquids. For example, for formulation into the form of tablets or capsules, the active ingredient may be combined with an oral, non-toxic, pharmaceutically acceptable inert carrier such as ethanol, glycerol, or water. Additionally, if desired or necessary, suitable binders, lubricants, disintegrants, and colorants may also be included in the mixture. Suitable binders include, but are not limited to, natural sugars such as starch, gelatin, glucose, or beta-lactose; corn sweeteners; natural and synthetic gums such as acacia, trackercanth, or sodium oleate; sodium stearate; magnesium stearate; sodium benzoate; sodium acetate; sodium chloride; etc. Disintegrants include, but are not limited to, starch, methylcellulose, agar, bentonite, xanthan gum, etc.
[0073] Acceptable pharmaceutical carriers for compositions formulated as liquid solutions may include saline solution, sterile water, Ringer's solution, buffered saline solution, albumin injection solution, dextrose solution, maltodextrin solution, glycerol, ethanol, and mixtures of one or more of these components, provided that they are sterile and biocompatible. Additionally, other conventional additives such as antioxidants, buffers, and bacteriostatic agents may be added as needed. Furthermore, diluents, dispersants, surfactants, binders, and lubricants may be additionally added to formulate the composition into injectable formulations such as aqueous solutions, suspensions, and emulsions, as well as pills, capsules, granules, or tablets.
[0074] Furthermore, it can be preferably formulated according to each disease or component by using the method disclosed in Remington's Pharmaceutical Science, Mack Publishing Company, Easton PA as an appropriate method in the field.
[0075] The pharmaceutical composition of the present invention may be administered orally or parenterally. In the case of parenteral administration, it may be administered via intravenous injection, subcutaneous injection, intramuscular injection, intraperitoneal injection, transdermal administration, etc., and preferably orally.
[0076] Suitable dosages of the pharmaceutical composition of the present invention vary depending on factors such as the formulation method, mode of administration, patient's age, body weight, sex, pathological condition, food, time of administration, route of administration, excretion rate, and response sensitivity, and a physician of ordinary skill can easily determine and prescribe a dosage effective for the desired treatment or prevention. According to a preferred embodiment of the present invention, the daily dosage of the pharmaceutical composition of the present invention is 0.001-10 g / kg.
[0077] The pharmaceutical composition of the present invention may be prepared in a unit dose form or contained in a multi-dose container by formulation using pharmaceutically acceptable carriers and / or excipients. The formulation may be in the form of a solution, suspension, or emulsion in an oil or aqueous medium, or in the form of an extract, powder, granule, tablet, or capsule, and may additionally include a dispersant or a stabilizer.
[0078] In addition, the present invention provides a method for promoting immunity or improving, preventing, or treating immune diseases, comprising administering an effective amount of a polysaccharide fraction derived from fermented Astragalus membranaceus to a mammal.
[0079] As used herein, the term "mammal" refers to a mammal that is the subject of treatment, observation, or experiment, preferably a human.
[0080] As used herein, the term "effective dose" refers to the amount of an active ingredient or pharmaceutical composition that induces a biological or medical response in a tissue system, animal, or human as conceived by a researcher, veterinarian, physician, or other clinician, and includes an amount that induces the alleviation of symptoms of the relevant disease or disorder. The effective dose and frequency of administration for the active ingredient of the present invention may vary depending on the desired effect. Therefore, the optimal dosage to be administered can be easily determined by a person skilled in the art and may be adjusted according to various factors including the type of disease, the severity of the disease, the content of the active ingredient and other ingredients contained in the composition, the type of formulation, and the patient's age, body weight, general health status, gender and diet, time of administration, route of administration and secretion rate of the composition, duration of treatment, and concurrently used drugs. In the method for prevention, treatment, or improvement of the present invention, for adults, it is preferable to administer the polysaccharide fraction derived from fermented Astragalus membranaceus at a dose of 0.001 g / kg to 10 g / kg when administered once to several times a day.
[0081] In the therapeutic method of the present invention, a composition comprising a polysaccharide fraction derived from fermented Astragalus membranaceus as an active ingredient can be administered in a conventional manner via oral, rectal, intravenous, arterial, abdominal, intramuscular, sternal, transdermal, topical, ocular, or intradermal routes.
[0082] Hereinafter, preferred embodiments are presented to aid in understanding the present invention; however, the following embodiments are merely illustrative of the invention, and it is obvious to those skilled in the art that various changes and modifications are possible within the scope and spirit of the invention, and that such variations and modifications fall within the scope of the appended claims.
[0083] <Preparation Example 1> Lactic acid bacteria culture
[0084] 10 after filtering 2022 household Kimjang kimchi 5It was diluted and dispensed onto MRS solid medium. After incubation at 35°C for 48 hours, two colonies with excellent intestinal adhesion, acid resistance, and bile resistance were identified and isolated, and the strain was identified by Macrongen. As a result, Lactobacillus sakei ( L. sakei ) 1 species and Leuconostoc mesenteroides ( Leu. mesenteroides It was confirmed to be 1 type. The results of the 16S rRNA identification based on this are shown in Figures 10 to 11.
[0085] 100 ml of the filtered liquid obtained by diluting the isolated strains 100-fold was added to 1 L of MRS broth medium and cultured at 35 ℃ for 48 hours to obtain the culture solution of each strain.
[0086] <Example 1> Polysaccharide fraction derived from fermented Astragalus membranaceus (FAME-CP)
[0087] Astragalus grown in Gyeonggi-do ( A. membranaceus Astragalus membranaceus (AM) was purchased from H-Food Co., Ltd. (Pocheon, Korea), completely dried, and stored at -70 ℃. It was taken out and used when needed for the experiment. Distilled water equivalent to 20 times the weight (w / v) of the Astragalus membranaceus was added, and a decoction process was performed at a high temperature (100 ℃). The process was terminated when the volume of the solvent was reduced by half. Subsequently, the supernatant was recovered using filtration through a 200 mesh screen, centrifugation (8,000 rpm, 4 ℃, 20 min, Gyrogen Co., Ltd., Daejeon, Korea), and filter paper (Adantec No.2, 110 mm, Tokyo, Japan). The above hot water extract of Astragalus membranaceus was concentrated using a vacuum concentrator (Eyela, Tokyo, Japan) and freeze-dried to produce a powdered hot water extract of Astragalus membranaceus (AME).
[0088] In 500 g of the above Astragalus hot water extract (AME) powder, lactic acid bacteria from Preparation Example 1 ( L. sakei and Leu. mesenteroides ) is 1.0×10 7A total of 25 ml (5% w / v) of culture solution diluted to a concentration of CFU / mL (strain weight ratio 1:1) was inoculated and cultured at 35°C for 24 hours, followed by sterilization at 121°C for 15 minutes. The sterilized solution was centrifuged (8,000 rpm, 4°C, 20 min), and the supernatant was recovered to obtain the Astragalus fermented product. The Astragalus fermented product (FAME) was concentrated and freeze-dried to produce a powder.
[0089] Distilled water was added to the above Astragalus fermented product (FAME) powder, and 95% ethanol was added at a 5-fold (w / v) ratio and thoroughly stirred. The precipitate was recovered by centrifugation, and dialysis was performed for 4 days (MWCO 12-14 kDa, Spectra / PorTM, Spectrum Lab. Inc., Rancho Dominguez, CA, USA). The dialyzed solution was concentrated using a vacuum concentrator. The concentrate was freeze-dried to obtain a powdered polysaccharide fraction (FAME-CP) derived from the Astragalus fermented product, from which all moisture had been removed (Fig. 1).
[0090] <Comparative Example 1> Astragalus hot water extract (AME)
[0091] Astragalus grown in Gyeonggi-do ( A. membranaceusAstragalus membranaceus (AM) was purchased from H-Food Co., Ltd. (Pocheon, Korea), completely dried, and stored at -70 ℃. It was taken out and used when needed for the experiment. Water equivalent to 20 times the weight (w / v) of the Astragalus membranaceus was added, and a decoction process was performed at a high temperature (100 ℃). The process was terminated when the volume was reduced by half. Subsequently, the supernatant was recovered using filtration through a 200 mesh screen, centrifugation (8,000 rpm, 4 ℃, 20 min, Gyrogen Co., Ltd., Daejeon, Korea), and filter paper (Adantec No.2, 110 mm, Tokyo, Japan). The above hot water extract of Astragalus membranaceus was concentrated using a vacuum concentrator (Eyela, Tokyo, Japan) and freeze-dried to produce a powdered hot water extract of Astragalus membranaceus (AME).
[0092] <Comparative Example 2> Fermented Astragalus (FAME)
[0093] In 500 g of Astragalus hot water extract (AME) powder prepared from Comparative Example 1, lactic acid bacteria from Preparation Example 1 ( L. sakei and Leu. mesenteroides ) is 1.0×10 7 A total of 25 ml (5% w / v) of culture solution diluted to a concentration of CFU / mL (strain weight ratio 1:1) was inoculated and cultured at 35°C for 24 hours, followed by sterilization at 121°C for 15 minutes. The sterilized solution was centrifuged (8,000 rpm, 4°C, 20 min), and the supernatant was recovered to obtain the Astragalus fermented product. The Astragalus fermented product (FAME) was concentrated and freeze-dried to produce a powder.
[0094] <Comparative Example 3> Polysaccharide fraction derived from Astragalus membranaceus hot water extract (AME-CP)
[0095] Distilled water was added to the hot water extract (AME) powder prepared from Comparative Example 1, and 95% ethanol was added at a 5-fold (w / v) ratio and stirred thoroughly. Then, the precipitate was recovered by centrifugation, and polysaccharide fractions derived from Astragalus extract (AME-CP) were obtained by dialysis (MWCO 12-14 kDa, Spectra / PorTM, Spectrum Lab. Inc., Rancho Dominguez, CA, USA), concentration, and freeze-drying (Fig. 1).
[0096] <Comparative Example 4> Polysaccharide fraction of fermented mixed herbal medicine (FBW-CP)
[0097] A polysaccharide fraction (FBW-CP) of a mixed herbal medicine fermentation product in powder form was prepared by making all the same as in Example 1, except that a mixed herbal medicine (BW) powder prepared as shown in Table 1 below was used as the raw material instead of Astragalus membranaceus.
[0098] Serial number Ingredients Area of use Mixing ratio (weight%) 1 Angelica root 25 2 Heavenly Palace rhizome 15 3 Polygonum multiflorum tuberous root 10 4 kudzu root root 10 5 Codonopsis pilosula (Crania japonica) tuberous root 10 6 Dioscorea root 10 7 licorice Roots and stems 5 8 Poria Sclerotia 5 9 rowan tree bark 5 10 Ginger (health) root 5 total 100
[0099] <Comparative Example 5> Polysaccharide fraction of fermented mixed herbal medicine (FBM-CP)
[0100] A polysaccharide fraction (FBM-CP) of a mixed herbal medicine fermentation product in powder form was prepared by making all the same as in Example 1, except that a mixed herbal medicine (BM) powder prepared as shown in Table 2 below was used as the raw material instead of Astragalus membranaceus.
[0101] Serial number Ingredients Area of use Mixing ratio (weight%) 1 Angelica root 25 2 Heavenly Palace rhizome 15 3 Cornelian cherry fruit 10 4 kudzu root root 10 5 Atractylodes rhizome 10 6 licorice Roots and stems 5 7 White peony root 5 8 Poria Sclerotia 5 9 Dioscorea root 5 10 cinnamon stem bark 5 11 Ginger (health) root 5 total 100
[0102] <Experimental Example 1> Analysis of Components and Constituent Sugars
[0103] Neutral sugars, acidic sugars, proteins, molecular weight distribution, and constituent sugars of the polysaccharide fraction derived from the fermented Astragalus membranaceus product prepared from Example 1 (FAME-CP) and the polysaccharide fraction derived from the Astragalus membranaceus extract prepared from Comparative Example 3 (AME-CP) were analyzed.
[0104] Neutral sugar analysis was performed using the phenol-sulfuric acid method. 200 µl of the sample was added to a test tube, an equal amount of 5% phenol was added and stirred, then 1 mL of 95% sulfuric acid was added and reacted for 20 minutes, and measured at 492 nm. The neutral sugar content of the sample was expressed as w / w (%) content by comparing it with a calibration curve prepared using glucose (glc) as a standard.
[0105] Acid sugar analysis is m-hydroxybiphenyl ( m Using the -hydroxybiphenyl method, 200 µl of the sample was added to a test tube, 1.2 mL of 0.0125 M sodium tetraborate / concentrated sulfuric acid was added, and 0.5% NaOH (containing 0.15% m-hydroxybiphenyl) was added and measured at 520 nm. The acidic sugar content of the sample was expressed as % content by comparing it with a calibration curve prepared using galacturonic acid as a standard.
[0106] Protein analysis was performed using the Bradford method. 50 μL of protein staining reagent was mixed with 200 μL of the sample and reacted in the dark for 5 minutes, after which the results were measured at 595 nm. The protein content of the sample was expressed as % content by comparing it with a calibration curve prepared using BSA (bovine serum albumin) as a standard.
[0107] For the analysis of polyphenol content, 10 µl of the sample was mixed sequentially with 2% Na2CO3 200 µl and 10 µl of 50% Folin-ciocateu reagent, and after 30 minutes, the absorbance was measured at 750 nm and compared with the standard curve of the standard substance to express the polyphenol content of the sample as % content.
[0108] HPLC-UV analysis was performed to determine the distribution of constituent sugars. Since monosaccharides are not detected by UV, they were analyzed after derivatization. First, the sample was treated with 2 M TFA (trifurooacetic acid), followed by derivatization with the addition of 0.3 M NaOH and PMP (1-phenyl-3-methyl-5-pyrazoline). Next, the derivative was neutralized by adding 0.3 M HCl, and the mixture was separated and extracted using water and chloroform (two-phase solvent system). The water layer was then separated, filtered through a PVDF membrane filter (0.45 μm, Jaema Trade Inc., Gwangwon-do, Korea), and analyzed by HPLC. The conditions used for HPLC analysis are as follows. HPLC was performed using a Dionex Ultimate 3000 (Dionex, Idstein, Germany). A YMC-triart C18 column (250×4.6 mm, 5 μm; YMC Co., Ltd., Kyoto, Japan) was installed, and 0.1 M sodium phosphate buffer (pH 6.7) and acetonitrile were used as the mobile phase. The mobile phase ratio was 82:18, the column temperature was 30 ℃, and the flow rate was 1.0 mL / min. UV measurements were taken at 254 nm, and the data were analyzed using a Chromeleon 7. The analysis results were calculated as mole% using peak area and response factor.
[0109] The molecular weight distribution was analyzed using HPSEC (high performance size exclusion chromatography). The samples were filtered through a PVDF membrane filter, and the analysis was performed using an HPSEC system equipped with a Superdex-75 column. Standard curves were constructed based on retention time (RT) using galactose (Gal) and pullulan of various molecular weights as standards. The kDa was expressed by comparing these curves with the RT of the samples.
[0110] Analysis Component sugar (A) Molecular weight (B) HPLC system Dionex Ultimate 3000 Agilent 1260 Infinity series (Dionex, Idstein, Germany) (Agilent Technologies Co., Ltd., Palo Alto, CA, USA) Column YMC-Triart C18 Superdex 75 Increase 10 / 300 GL (YMC Co., Ltd., Kyoto, Japan) (Cytiva, Marlborough, MA) Column size 250 x 4.6 mm, 5 μm 300 x 10 mm, 8.6 μm Column temperature 30℃ Room temperature (RT) Flow rate 1.0 mL / min 0.5 mL / min Eluent 0.1 M sodium phosphate buffer (pH 6.7): Acetonitrile 50 mM Ammonium formate 82:18 Injection volume 20 μL 20 μL Detector UV / Vis Detector Refractive Index Detector (RID) (Dionex, Idstein, Germany) (Agilent Technologies, Palo Alto, CA, USA) Integrator Chromeleon 7 Agilent Chemstation
[0111] Figure 2 is a graph showing the molecular weight distribution of the polysaccharide fraction derived from the fermented Astragalus product prepared from Example 1 (FAME-CP) and the polysaccharide fraction derived from the Astragalus extract prepared from Comparative Example 3 (AME-CP), and Table 4 shows the analysis of the neutral sugar, acid sugar, protein, and constituent sugar content of the polysaccharide fraction derived from the fermented Astragalus product prepared from Example 1 (FAME-CP) and the polysaccharide fraction derived from the Astragalus extract prepared from Comparative Example 3 (AME-CP).
[0112] Chemical properties Crude polysaccharide fraction Comparative Example 3AME-CP Example 1 FAME-CP Neutral sugar (%) 87.8±1.3 74.4±0.6 Uronic acid (%) 11.4±0.3 18.6±0.3 Protein (%) 0.5±0.1 4.7±0.4 polyphenol (%) 0.3±0.1 2.3±0.3 Monosaccharide Component sugar (mol %) Mannose 0.8±0.0 44.2±0.1 Rhamnose 1.2±0.0 2.3±0.0 Glucuronic acid 1.4±0.0 2.5±0.1 Galacturonic acid 7.1±0.0 10.2±0.3 Glucose 83.0±0.0 19.2±0.1 Galactose 3.2±0.0 11.6±0.1 Xylose 0.2±0.0 1.1±0.1 Arabinose 3.0±0.0 7.4±0.0 Fucose 0.1±0.0 1.5±0.0
[0113] As shown in Table 4, the results of the neutral sugar analysis confirmed that the polysaccharide fraction derived from the Astragalus extract of Comparative Example 3 had the highest neutral sugar content. In contrast, the polysaccharide fraction derived from the fermented Astragalus extract of Example 1 was found to have a uronic acid (acidic sugar) content that was 1.6 times higher than that of Comparative Example 3, a protein content that was more than 4 times higher, and a polyphenol content that was 7 times higher.
[0114] As shown in Table 4, an analysis of the constituent sugars revealed that the polysaccharide fraction derived from the fermented Astragalus extract of Example 1 was found to mainly contain mannose (44.2%), galacturonic acid (10.2%), glucose (19.2%), galactose (11.6%), and arabinose (7.4%), and was a polysaccharide containing trace amounts of rhamnose, glucuronic acid, xylose, and fucose. This was completely different from the polysaccharide fraction derived from the hot water extract of Astragalus in Comparative Example 3.
[0115] As shown in Figure 2, it can be confirmed that the polysaccharide fraction derived from the fermented Astragalus extract (FAME-CP) prepared from Example 1 has a completely different molecular weight distribution value compared to the polysaccharide fraction derived from the Astragalus extract (AME-CP) prepared from Comparative Example 3. Distilled water was used as a control.
[0116] Specifically, it can be confirmed that the polysaccharide fraction (FAME-CP) derived from the fermented Astragalus membranaceus prepared from Example 1 contains a high molecular weight substance of 113.4 kDa and trace amounts of low molecular weight substances of 0.2 kDa and 0.4 kDa.
[0117] On the other hand, it can be confirmed that the polysaccharide fraction (AME-CP) derived from Astragalus extract prepared from Comparative Example 3 contains a trace amount of a high molecular weight substance of 113.4 kDa and a large amount of low molecular weight substances of 0.2 kDa and 0.4 kDa.
[0118] <Experimental Example 2> Analysis of Immunostimulatory Activity Using Macrophages
[0119] Mouse-derived RAW 264.7 macrophages play a pivotal role in the innate immune system, acting as a defense barrier against the invasion of foreign substances. Activated macrophages protect the host from foreign substances and regulate the immune system through phagocytosis and the secretion of various cytokines and chemokines. In this experiment, the macrophage-stimulating activity of each sample was compared and evaluated.
[0120] RAW 264.7 macrophage cell line was obtained from the Korean Cell Line Bank (KCLB, Seoul, Korea). The cells were cultured at 37°C and 5% CO2 conditions using a medium supplemented with 10% FBS (fatal bovine serum) (Gibco, Waltham, MA, USA) and 1% penicillin / streptomycin (GenDEPOT, Katy, TX, USA) in DMEM (Dulbecco's Modified Eagle Medium) (Hyclone, San Angelo, TX, USA).
[0121] First, 2×10⁻⁶ in each well of the 96-well plate 6RAW 264.7 cells at a concentration of cells / mL were dispensed in 200 µL aliquots and cultured at 37°C and 5% CO2 until a monolayer was formed. The culture medium excluding attached cells was removed, and serum-free DMEM (SFM) containing samples at concentrations of 5 µg / mL, 10 µg / mL, 50 µg / mL, and 100 µg / mL was treated and re-cultured for 24 hours. Cell viability and nitric oxide were measured and are shown in Figures 3 to 7.
[0122] At this time, the samples used were the hot water extract of Astragalus membranaceus (AME) of Comparative Example 1, the fermented Astragalus membranaceus (FAME) of Comparative Example 2, the polysaccharide fraction derived from the hot water extract of Astragalus membranaceus (AME-CP) of Comparative Example 3, and the polysaccharide fraction derived from the fermented Astragalus membranaceus (FAME-CP) of Example 1, each at different concentrations.
[0123] Nitric oxide (NO) production capacity was measured by taking 50 µl of cell culture supernatant and using the Griess reagent reaction method (Fox JB 1979) (Griess, P. (1879) Chem. Ber. 12, 426-8.), and tumor necrosis factor (TNF)-α, monocyte chemoattractant protein (MCP)-1, and interleukin (IL)-6 were analyzed by taking 50 µl of cell culture supernatant and using the sandwich ELISA method according to the instruction manual of BD Bioscience. Since the toxicity of the sample itself to RAW 264.7 cells had to be confirmed first, the toxicity of the sample to RAW 264.7 cells was analyzed by measuring the absorbance at 550 nm using 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenlytetrazolium bromide (MTT; Invitrogen), and expressed as cell viability (%) relative to the negative control (NC). As a positive control (LPS) in which macrophage stimulation was activated through inflammation induction, cells re-cultured for 24 hours after adding 1 μg / ml (20 μl) of lipopolysaccharide instead of the sample were used.
[0124] Figures 3 to 7 show the results of analyzing the viability and macrophage activation-related factors (NO, TNF-α, MCP-1, and IL-6 production capacity) of RAW 264.7 cells treated with the Astragalus membranaceus hot water extract (AME) of Comparative Example 1, the Astragalus membranaceus fermented product (FAME) of Comparative Example 2, the polysaccharide fraction derived from the Astragalus membranaceus hot water extract (AME-CP) of Comparative Example 3, and the polysaccharide fraction derived from the Astragalus membranaceus fermented product (FAME-CP) of Example 1 at various concentrations. The experiment was repeated a total of three times, and the results are expressed as mean ± standard deviation. The significance for each group was verified using Student's t-test. Significant differences in crosshatch patterns between samples within the same concentration are indicated by * and #. p<0.05; ** and ##, p<0.01; *** and ###, p<0.001.
[0125] As shown in Figure 3, the extracts of Comparative Examples 1 and 2 (AME, FAME), as well as the polysaccharide fractions of Comparative Example 3 and Example 1 (-CP), were found to have a cell viability of 90% or more compared to the NC control group at a concentration of 5 to 100 μg / mL, indicating that they were not cytotoxic.
[0126] As shown in Figure 4, when examining the NO production capacity, the positive control (LPS) increased by approximately 13.3 times (74.6 μM) compared to the NC control (5.6 μM). Among the extracts, a significant effect of approximately 2 times was observed when the hot water extract of Astragalus membranaceus (AME) of Comparative Example 1 was treated at 50 μg / mL and 100 μg / mL (14.7 μM and 33.7 μM, respectively). In contrast, the polysaccharide fractions (-CP) of Comparative Example 3 and Example 1 were confirmed to be 32.9–39.5 μM (1.1–1.3 times increase) and 35.2–43.5 μM (approximately 1.2–1.5 times increase), respectively, compared to the NC control.
[0127] As shown in Figures 5 to 7, among the extracts, a twofold increase in effect was observed only when 50 μg / mL and 100 μg / mL of the Astragalus hot water extract (AME) of Comparative Example 1 were treated, while the Astragalus fermented product (Comparative Example 2) was at a level similar to the NC control group, and even this was confirmed to be lower than the positive control group.
[0128] On the other hand, all polysaccharide fractions (-CP) of Example 1 showed a significant increase in effect of 1.5 to 14 times or more compared to the NC control group. In particular, the polysaccharide fraction derived from the fermented Astragalus of Example 1 (FAME-CP) was found to have TNF-α, MCP-1, and IL-6 production capabilities that were 4.7 to 14 times (478.4 to 1412.0 pg / ml), 1.4 to 4.0 times (677.4 to 1988.9 pg / mL), and 1.11 times (100.0 pg / mL) higher than the NC control group. In particular, the polysaccharide fraction derived from the fermented Astragalus of Example 1 (FAME-CP) at a high concentration of 50 μg / ml was found to have significantly increased production capabilities of TNF-α, MCP-1, and IL-6 (284.1 pg / mL, 3.15 times higher) compared to the positive control group.
[0129] In other words, in the case of simple extracts, no macrophage-stimulating activity was observed in the fermented product, and it was confirmed that the macrophage-stimulating activity was most excellent only in the hot water extract. However, when the crude polysaccharide fractionation process was performed, it was confirmed that the polysaccharide fraction of the fermented product showed the most superior macrophage-activating effect compared to the polysaccharide fraction of the hot water extract. That is, it was confirmed that when Astragalus is extracted with simple hot water, low-molecular-weight substances such as polyphenols, flavonoids, and free sugars are extracted in a mixed form with high-molecular-weight substances, providing only the general level of immune effects known for Astragalus; furthermore, even if it is fermented with lactic acid bacteria, friction between the low-molecular-weight substances decomposed by the bacteria and other components negatively affects immune activation, thereby actually lowering the immune effect of Astragalus.
[0130] In particular, even when the concentration of the hot water extract of Astragalus membranaceus and its fermented product was increased to 1000 μg / ml, it was not possible to obtain a macrophage activation effect greater than that of the positive control group.
[0131] In other words, although the immune-enhancing activity of Astragalus membranaceus is known, only a slight effect was obtained in the case of hot water extraction, and no macrophage activation effect greater than that of the positive control group was obtained, and when fermented with lactic acid bacteria, only a lower effect was shown. Accordingly, in order to obtain the maximum immune-enhancing activity of Astragalus membranaceus in the present invention, crude polysaccharide fractions were prepared by isolating only high-molecular substances from each extract and their efficacy was compared, and as a result, it was confirmed that the polysaccharide fraction of the fermented Astragalus membranaceus (Example 1) had a significantly superior immune-enhancing effect compared to the polysaccharide fraction of the hot water extract.
[0132] <Experimental Example 3> Analysis of Immunostimulating Activity of Polysaccharide Fractions of Fermented Mixed Herbal Medicines Excluding Astragalus
[0133] In order to analyze the immune-enhancing activity of the polysaccharide fraction derived from the fermented Astragalus of Example 1 (FAME-CP), which showed a significant effect of more than three times when the active ingredients of Astragalus were extracted by various methods in the previous experiment, the activity was compared with the polysaccharide fraction of the fermented mixed herbal medicine containing Astragalus, which was found to have immune-enhancing activity. The procedure was identical to Experimental Example 2, except that the polysaccharide fractions of the fermented mixed herbal medicine containing Astragalus of Comparative Examples 4 and 5 were used as samples, as shown in Table 5.
[0134] division NC control group LPS1 µg / ml Example 1 FAME-CP Comparative Example 4FBW-CP Comparative Example 5FBM-CP 50 ㎍ / ㎖ 50 ㎍ / ㎖ 500 ㎍ / ㎖ 50 ㎍ / ㎖ 500 ㎍ / ㎖ NO generation capacity μM 5.6 74.6 43.5 4.8 24.3 4.3 34.4 TNF-αpg / ml 100.8 1123.1 1412.0 112.1 950.1 154.2 715.8 MCP-1pg / ml 497.2 956.1 1988.9 455.6 914.3 483.0 912.5 IL-6pg / ml 90.2 115.4 284.1 98.4 184.2 102.2 198.3
[0135] As shown in Table 5, the polysaccharide fractions of the mixed herbal medicine fermentation products not containing Astragalus membranaceus in Comparative Examples 4 and 5 showed a cell viability of over 80% as a result of cell viability analysis, and no cytotoxicity was confirmed (not shown).
[0136] When examining the results regarding NO production capacity, TNF-α, MCP-1, and IL-6 production amounts, it was confirmed that the polysaccharide fraction derived from the fermented Astragalus of Example 1 according to the present invention exhibited significantly superior immune activity at a concentration 10 times lower than that of the polysaccharide fraction derived from the mixed herbal medicine of Comparative Examples 4 and 5.
[0137] That is, even if the same lactic acid bacteria were used, when raw materials completely different from those of the present invention were used (Comparative Examples 4 and 5), the fractionated crude polysaccharides actually showed reduced immune activity, and a high concentration of more than 10 times was required to obtain sufficient immune activity, whereas it was confirmed that the polysaccharide fraction derived from the fermented Astragalus of Example 1 according to the present invention showed high immune activity at a low concentration (50 μg / ml).
[0138] <Experimental Example 4> Analysis of Macrophage Activator mRNA Gene Expression Levels Using qRT-PCR
[0139] 8×10 55 mL of RAW 264.7 cells at a cell / mL concentration were dispensed into a 60 mm dish and cultured until a monolayer was formed. All culture supernatant was removed, and the cells were re-cultured for 24 hours with serum-free DMEM and the polysaccharide fraction of Example 1 (FAME-CP) at concentrations of 1 µg / mL, 5 µg / mL, 10 µg / mL, or 50 µg / mL, respectively. After harvesting the cells, they were washed with PBS (phosphate-buffered saline), and total RNA was extracted using the RNeasy Mini Kit (Qiagen, Valencia, CA, USA). The absorbance of the isolated RNA was measured at 260 and 280 nm using the Nanoquant Infinite M200 Pro (Tecan, Mannedorf, Switzerland). cDNA synthesis was performed using the ReverTraAce qPCR RT Master Mix kit (Toyobo Co., Ltd., Osaka, Japan). To measure mRNA expression from the synthesized cDNA, real-time PCR analysis was performed using the SYBR green PCR kit (Toyobo Co., Ltd.) according to the manufacturer's instructions. PCR was performed using the Quant Studio 3 real-time PCR system (Applied Biosystems, Waltham, MA, USA), and the expression of each gene was corrected using the expression levels of GAPDH (glyceraldehyde-3-phosphate dehydrogenase) treated with the same sample. The primer sequences are shown in Table 6 below, and the mRNA gene expression levels of macrophage activator factors using qRT-PCR are shown in Figure 8. A total of three replicate experiments were performed.
[0140] Cells that were not treated with anything were used as the NC control, and cells treated with an equal amount of LPS (1 μg / ml) instead of the polysaccharide fraction (FAME-CP) of Example 1 were used as the positive control.
[0141] Genes Primer Primer sequence (5'→3') Accession number iNOS Forward sequence 1 GGTGAAGGGACTGAGCTGTT NM_010927.4 Reverse sequence 2 ACGTTCTCCGTTCTCTTGCAG TNF-α Forward sequence 3 CCCACGTCGTAGCAAACCA NM_013693.3 Reverse sequence 4 CTTTGAGATCCATGCCGTTGG MCP-1 Forward sequence 5 CTGCATCTGCCCTAAGGTCT NM_011333.3 Reverse sequence 6 AGTGCTTGAGGTGGTTGTGG IL-6 Forward sequence 7 TCACAGAGGATACCACTCCC NM_031168.2 Reverse sequence 8 GAATTGCCATTGCACAACTCTT COX-2 Forward sequence 9 TGAGTACCGCAAACGCTTCT NM_011198.4 Reverse sequence 10 CAGCCATTTCCTTCTCTCCTGT GAPDH Forward sequence 11 GGGTCCCAGCTTAGGTTCATC NM_001289726.1 Reverse sequence 12 CCAATACGGCCAAATCCGTTC
[0142] Figure 8 is a graph showing the expression levels of mRNA genes (iNOS, TNF-α, MCP-1, IL-6, COX-2), which are macrophage-stimulating factors, analyzed by qRT-PCR when the polysaccharide fraction (FAME-CP) derived from the fermented Astragalus membranaceus of Example 1 was treated to RAW 264.7 cells. The significance between each group compared to the NC control group was verified. Student's t-test was used to determine the significance. *p<0.05, **p<0.01, ***p<0.001.
[0143] iNOS is known to be one of the NOS that generates NO when triggered by cytokines, oxidative stress, and inflammatory responses, and in macrophages, in addition to factors such as NO, cytokines and chemokines are essential for immune responses. As shown in Figure 8, it was confirmed that the polysaccharide fraction (FAME-CP) derived from the fermented Astragalus of Example 1 significantly increased the gene expression levels of macrophage activating factors iNOS (inducible nitric oxide synthase), TNF-α, MCP-1, and IL-6 compared to the NC control group.
[0144] Specifically, looking at the iNOS expression results, the polysaccharide fraction derived from the fermented Astragalus of Example 1 (FAME-CP) showed a concentration-dependent increase of 119.4 to 1209.5 times compared to the NC control group at low concentrations of 1 to 50 μg / mL.
[0145] In the case of TNF-α, the polysaccharide fraction derived from the fermented Astragalus extract of Example 1 (FAME-CP) showed a concentration-dependent increase in mRNA expression of 7.9 to 45.1 times compared to the NC control group at concentrations of 1 to 50 μg / mL. The mRNA expression levels of MCP-1 and IL-6 also showed concentration-dependent increases of 1.3 to 33.5 times and 602.2 to 1787.2 times, respectively, compared to the NC control group at low concentrations of 1 to 50 μg / mL.
[0146] Finally, in the case of COX-2 (cyclooxygenase-2), which induces immune activity by producing immune mediators such as prostaglandin E2, the polysaccharide fraction derived from the fermented Astragalus extract of Example 1 (FAME-CP) showed statistically significant gene expression levels of 645.7 to 1046.3 times compared to the NC control group in the concentration range of 1 to 50 μg / ml.
[0147] In addition, it was confirmed that when the polysaccharide fraction derived from the fermented Astragalus of Example 1 (FAME-CP) was used at 50 μg / ml, it induced a significant increase in mRNA expression compared to the positive control. Therefore, it was confirmed that the polysaccharide fraction derived from the fermented Astragalus of Example 1 (FAME-CP) induces an increase in the gene expression of macrophage activator and promotes the production of macrophage activator secreted extracellularly, indicating that it will exhibit an immune-enhancing effect.
[0148] <Experimental Example 5> Nucleus Transduction of Macrophage Activation-Related Transcription Factors Using Immunofluorescence
[0149] We intended to verify the mechanism of action of the polysaccharide fraction (FAME-CP) derived from the fermented Astragalus membranaceus of Example 1 according to the present invention and macrophage activation-related factors. To this end, immunofluorescence was used to analyze whether cJun, one of the transcription factors of AP-1 and NF-κB (p65), a representative signaling transcription factor in macrophages, moved into the nucleus.
[0150] First, a 12 mm cover slip (Paul Marienfeld GmbH & Co. KG, Germany) was placed in each 24-well plate, and 500 μL of 0.1% gelatin was dispensed into each well. The plates were left to stand for 30 minutes, and the excess supernatant was removed to prepare 24-well plates equipped with cover slips. RAW 264.7 cell lines were planted at a rate of 2.2 × 10⁶ on the cover slips of the 24-well plates. 5 Cells were dispensed into each well at a density of cells / mL. After stabilizing the cells by incubating for 3 hours, 100 μL of FAME-CP (50 μg / mL) from Example 1 was added, followed by incubation in an incubator for another 3 hours and washing. Subsequently, the cells were fixed by treating them with 4% formaldehyde (500 μL) and leaving them for 15 minutes; after washing, they were blocked in the dark by treating them with 300 μL of 5% BSA (in 0.1% Trion X-100 / 1×PBS) for 1 hour. A primary antibody against p65 or cJun (Cell Signaling, Denvers, MA, USA) was diluted with 5% BSA at a ratio of 1:500 and reacted for 12 hours to attach to the cells. Then, the cells were washed with PBS, treated with a secondary antibody (Alexa Fluor 488 anti-rabbit IgG; Cell Signaling), and reacted in the dark for 70 minutes. After washing, the cover slip was removed, and DAPI (4,6-diamidino-2-phenylindole; Thermo Fisher Scientific, Waltham, MA, USA) was applied to the slide glass, and then images were taken using an optical microscope (IX73; Olympus, Waltham, MA, USA).
[0151] Cells that were not treated with anything were used as the NC control, and cells treated with 1 μg / ml of LPS were used as the positive control instead of FAME-CP of Example 1.
[0152] Figure 9 shows the results of analyzing NF-κB and MAPK (mitogen-activated protein kinase), which are macrophage activation mechanisms, in RAW 264.7 cells treated with the polysaccharide fraction (FAME-CP) derived from the fermented Astragalus extract prepared from Example 1 using immunofluorescence.
[0153] The NF-κB signaling pathway induces the phosphorylation of p65, an NF-κB subunit, which induces the phosphorylation and degradation of IκBα, and the phosphorylated p65 moves into the nucleus. Additionally, cJun, a MAPK transcription factor of activator protein-1 (AP-1), is phosphorylated by stimulation when macrophages are stimulated and activated, moves into the nucleus, and participates in the activation of macrophages.
[0154] As shown in Figure 9, when 50 μg / ml of the polysaccharide fraction derived from the fermented Astragalus extract (FAME-CP) prepared in Example 1 was applied to the RAW 264.7 cell line, it was confirmed that p65 and cJun moved into the cell nucleus. Specifically, in the NC control group (normal cells), FITC-labeled p65 and cJun were present only in the cytoplasm, while in the positive control group, it was confirmed that p65 or cJun moved into the nucleus, making the boundary between the nucleus and cytoplasm indistinct. It was also confirmed that the FAME-CP of Example 1 effectively moved p65 and cJun into the nucleus, similar to the positive control group.
[0155] Through the experiment described above, it was found that FAME-CP of Example 1 induces the activation of macrophages, thereby inducing the secretion of cytokines and chemokines, which protects the host from external substances and strengthens the immune system. Specifically, it was confirmed that cells treated with FAME-CP of Example 1 induce immune activity through a series of processes in which p65 and cJun move into the nucleus via the upstream NF-κB and MAPK pathways, thereby increasing the expression of macrophage-activating mRNA and secreting it extracellularly.
[0156] Although embodiments of the present invention have been described above, those skilled in the art may modify and change the present invention in various ways by adding, changing, deleting, or adding components, etc., without departing from the spirit of the invention as described in the claims, and such modifications and changes are also to be included within the scope of the rights of the present invention.
[0157] This patent is the result of the Local Government-University Cooperation-based Regional Innovation Project conducted in 2023 with funding from the Ministry of Education and support from the National Research Foundation of Korea (2021RIS-001; Project Lab).
Claims
Claim 1 Contains a polysaccharide fraction derived from fermented Astragalus astragalus as an active ingredient, and the polysaccharide fraction derived from fermented Astragalus astragalus comprises: (a) Lactobacillus sakei (in hot water extract of Astragalus astragalus) Lactobacillus sakei ) and Leuconostoc mesenteroides ( Leuconostoc mesenteroides An immune-enhancing food composition characterized by being produced by a manufacturing method comprising: (a) a step of preparing a fermented Astragalus product by treating with a mixed strain of ) and (b) a step of recovering a polysaccharide fraction by precipitating the fermented Astragalus product with a C1 to C4 alcohol. Claim 2 delete Claim 3 An immune-enhancing food composition characterized by being manufactured by a manufacturing method comprising, in addition to the step of (c) recovering a fraction with a molecular weight of 10 kDa or more from the polysaccharide fraction of step (b) according to claim 1. Claim 4 An immune-enhancing food composition according to claim 1, characterized in that the polysaccharide fraction derived from the fermented Astragalus membranaceus contains 70 to 80 weight% neutral sugar, 15 to 25 weight% uronic acid, 1 to 5 weight% protein, and 1 to 5 weight% polyphenol relative to the total polysaccharide fraction. Claim 5 The immune-enhancing food composition according to claim 1, wherein the polysaccharide fraction derived from the fermented Astragalus membranaceus comprises constituent sugars consisting of 40 to 50 mol% mannose, 1 to 5 mol% rhamnose, 1 to 5 mol% glucuronic acid, 5 to 15 mol% galacturonic acid, 15 to 20 mol% glucose, 10 to 15 mol% galactose, 0.1 to 1.5 mol% xylose, 5 to 10 mol% arabinose, and 1 to 2 mol% fucose. Claim 6 An immune-enhancing food composition according to claim 1, characterized in that the polysaccharide fraction derived from the fermented Astragalus membranaceus increases the production of one or more immune biomarkers selected from the group consisting of cytokines TNF-α, IL-6, MCP-1, iNOS, COX2, NF-kB, and MAPK. Claim 7 An immune-enhancing food composition according to claim 1, characterized in that the food composition improves one or more immune diseases selected from the group consisting of the common cold, asthma, pneumonia, allergic rhinitis, allergic conjunctivitis, atopic dermatitis, allergy, rheumatoid arthritis, Alzheimer's disease, autoimmune thyroid disease, inflammatory bowel disease, aplastic anemia, lupus erythematosus, and psoriasis. Claim 8 Preventing or treating immune diseases containing a polysaccharide fraction derived from fermented Astragalus astragalus as an active ingredient, wherein the polysaccharide fraction derived from fermented Astragalus astragalus comprises: (a) Lactobacillus sakei (in a hot water extract of Astragalus astragalus) Lactobacillus sakei ) and Leuconostoc mesenteroides ( Leuconostoc mesenteroides A pharmaceutical composition for immune enhancement characterized by being produced by a manufacturing method comprising: (a) a step of preparing a fermented Astragalus product by treating with a mixed strain of ) and (b) a step of recovering a polysaccharide fraction by precipitating the fermented Astragalus product with a C1 to C4 alcohol. Claim 9 delete Claim 10 An immune-enhancing pharmaceutical composition characterized by being manufactured by a manufacturing method further comprising, in claim 8, (c) a step of recovering a fraction with a molecular weight of 10 kDa or more from the polysaccharide fraction of step (b). Claim 11 A pharmaceutical composition for immune enhancement according to claim 8, characterized in that the polysaccharide fraction derived from the fermented Astragalus membranaceus contains 70 to 80 weight% neutral sugar, 15 to 25 weight% uronic acid, 1 to 5 weight% protein content, and 1 to 5 weight% polyphenol content relative to the total polysaccharide fraction. Claim 12 A pharmaceutical composition for immune enhancement according to claim 8, wherein the polysaccharide fraction derived from the fermented Astragalus membranaceus comprises constituent sugars consisting of 40 to 50 mol% mannose, 1 to 5 mol% rhamnose, 1 to 5 mol% glucuronic acid, 5 to 15 mol% galacturonic acid, 15 to 20 mol% glucose, 10 to 15 mol% galactose, 0.1 to 1.5 mol% xylose, 5 to 10 mol% arabinose, and 1 to 2 mol% fucose. Claim 13 A pharmaceutical composition for immune enhancement according to claim 8, characterized in that the immune disease is one or more selected from the group consisting of the common cold, asthma, pneumonia, allergic rhinitis, allergic conjunctivitis, atopic dermatitis, allergy, rheumatoid arthritis, Alzheimer's disease, autoimmune thyroid disease, inflammatory bowel disease, aplastic anemia, lupus erythematosus, and psoriasis.
Citation Information
Patent Citations
Extraction method of high-purity low-molecular-weight astragalus membranaceus polysaccharide as well as product and application of astragalus membranaceus polysaccharide
CN113637091A
Composion of fermented oriental herb, method of manufacturing the same and use of the same
KR1020230010167A