Amylosome able to direct starch saccharification by starch-degrading and waste food treatment methods using the same

KR103003576B1Active Publication Date: 2026-08-12KOREA UNIV RES & BUSINESS FOUND
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
KR1020230105675
Authority / Receiving Office
KR · KR
Patent Type
Patents
Current Assignee / Owner
Filing Date
2023-08-11
Publication Date
2026-08-12
Estimated Expiration
2043-08-11

Smart Images

  • Figure 112023088880843-PAT00001_ABST
    Figure 112023088880843-PAT00001_ABST
Patent Text Reader

Abstract

The present invention relates to an amylosomes capable of starch saccharification and a method for treating waste food using the same. The amylosomes capable of starch saccharification according to the present invention enable direct starch saccharification at medium temperature in a single step, and by additionally introducing fungal degrading enzymes in addition to starch degrading enzymes, they have the effect of effectively degrading waste food contaminated with mold.
Need to check novelty before this filing date? Find Prior Art

Description

Technology Field

[0001] The present invention relates to an amylosomes capable of starch saccharification and a method for treating waste food using the same. Background Technology

[0002] Large quantities of food waste are discarded worldwide, and much of it contains starch or sugars. Recycling these food wastes is difficult due to mold contamination, and saccharification efficiency is low because mold inhibits the saccharification process (hindering access to internal starch substrates).

[0003] Cellulosomes are known to be enzyme complexes involved in cellulose degradation, found in the outer cell walls of anaerobic microorganisms that decompose biomass. The cellulose scaffold structure contains a domain called cohesin, while the exocrine enzyme portion connected to the scaffold is linked to a domain called Dockerin. Cohesin and Dockerin possess the ability to bind to each other via calcium ions, allowing various Dockerin-linked exocrine enzymes to attach to the cohesin on the scaffold to form enzyme complexes. Strains possessing cellulose express and attach various related enzymes depending on the type of external substrate available, and efficiently obtain and utilize nutrients by leveraging the synergy among these attached enzymes. By applying the cohesin-Dockerin interaction, enzymes can be attached to the cellulose, thereby inducing enzymatic reactions with enhanced synergistic action.

[0004] Amyloses are enzyme complexes with starch-degrading functions and are known to be found in large numbers in anaerobic gut microorganisms. Their structure is similar to that of cellulosomes, consisting of cohesin and dockerin, and is diversely composed of starch-binding proteins and starch-degrading enzymes. However, there have not been many studies reported on amylosomes created in an artificial form.

[0005] Accordingly, the inventors prepared an amylosome capable of directly saccharifying starch by modifying a cellulose, which is a protein complex that decomposes cellulose, and confirmed that when a fungal decomposition enzyme is added to the amylosome, the fungus can directly saccharify waste food contaminated with mold, thereby completing the present invention. Prior art literature

[0006] M. A. Goldstein et al. “Characterization of the cellulose-binding domain of the Clostridium cellulovorans cellulose-binding protein A.” J Bacteriol. Sep 1993; 175(18): 5762-5768. The problem to be solved

[0007] The object of the present invention is to provide a starch binding scaffold protein prepared by modifying a mini cellulose binding protein A comprising a carbohydrate binding module family 3 and two type 1 cohesins.

[0008] In addition, another objective of the present invention is to provide an amylosome capable of starch saccharification comprising a starch-degrading enzyme and a starch-binding scaffold protein.

[0009] In addition, another objective of the present invention is to provide a composition for treating waste food waste comprising amylosomes capable of starch saccharification.

[0010] In addition, another objective of the present invention is to provide a waste food processing method comprising the step of treating the waste food with the amylosomes capable of starch saccharification. means of solving the problem

[0011] To achieve the above objectives, the present invention provides a starch-saccharifying amylosomes in which a starch-saccharifying scaffold protein prepared by modifying a mini cellulose binding protein A comprising a carbohydrate binding module family 3 and two type 1 cohesins is modified, wherein the modification is characterized by a) the carbohydrate binding module family 3 being substituted with a starch binding protein, b) being modified to further include two type 1 cohesins, or c) the carbohydrate binding module family 3 being substituted with a starch binding protein and further modified to include two type 1 cohesins.

[0012] Next, the present invention provides an amylosomes capable of starch saccharification comprising a starch-degrading enzyme and a starch-binding scaffold protein.

[0013] In addition, the amylosomes capable of starch saccharification may further contain fungal degrading enzymes.

[0014] Furthermore, the present invention provides a composition for treating waste food comprising an amylosome capable of starch saccharification.

[0015] In addition, the present invention provides a waste food processing method comprising the step of treating the waste food with amylosomes capable of starch saccharification. Effects of the invention

[0016] The amylosomes capable of starch saccharification according to the present invention enable direct starch saccharification at medium temperature in a single step, and by additionally introducing fungal degrading enzymes in addition to starch degrading enzymes, they have the effect of effectively degrading mold-contaminated waste food. Brief explanation of the drawing

[0017] FIG. 1 is a schematic diagram showing the process of developing an amylosome capable of direct starch saccharification according to one embodiment of the present invention. FIG. 2 is a figure showing the SDS-PAGE results of four types of starch-degrading enzymes and starch-binding proteins in one embodiment of the present invention. Figure 3 is a figure showing the measurement results of the optimal temperature conditions of starch-degrading enzymes and enzyme mixture in one embodiment of the present invention. Figure 4 is a figure showing the results of measuring the optimal pH conditions of starch-degrading enzymes and an enzyme mixture in one embodiment of the present invention. FIG. 5 is a figure showing the measurement results of glucose or reducing sugar-based specific activity of starch-degrading enzymes on starch-related substrates in one embodiment of the present invention. Figure 6 is a figure showing the results of an evaluation of the adhesion ability of a starch-binding scaffold protein to a waste food substrate rich in starch contaminated with water-soluble starch and mold in one embodiment of the present invention. FIG. 7 is a figure showing the results of evaluating the degradation ability of a starch-degrading enzyme, an enzyme mixture, and starch-related substrates of an amylosomes in one embodiment of the present invention. FIG. 8 is a figure showing the starch saccharification efficiency of amylosomes combined with various ratios of starch-degrading enzymes in one embodiment of the present invention. FIG. 9 is a figure showing the results of evaluating the thermal stability of an amylosome capable of starch saccharification in one embodiment of the present invention. FIG. 10 is a figure showing the results of a comparison of saccharification efficiency for mold-contaminated waste food in an embodiment of the present invention, wherein an amylosome containing a starch-degrading enzyme and an amylosome additionally bound to a mold-degrading enzyme in addition to the starch-degrading enzyme are combined. Specific details for implementing the invention

[0018] Hereinafter, the present invention will be described in detail with reference to the attached drawings for embodiments of the present invention. However, the following embodiments are presented as examples of the present invention, and if it is determined that a detailed description of a technology or configuration well known to those skilled in the art may unnecessarily obscure the essence of the present invention, such detailed description may be omitted, and the present invention is not limited by this. The present invention is capable of various modifications and applications within the scope of the claims set forth below and the equivalent scope interpreted therefrom.

[0019] Furthermore, the terminology used in this specification is used to appropriately describe preferred embodiments of the present invention, and may vary depending on the intent of the user or operator, or the conventions of the field to which the present invention belongs. Accordingly, the definitions of these terms should be based on the content throughout this specification. Throughout the specification, when a part is described as “comprising” a certain component, unless specifically stated otherwise, this means that it does not exclude other components but may include additional components.

[0020] Throughout this specification, '%' used to indicate the concentration of a particular substance is (w / w) % for solid / solid, (w / v) % for solid / liquid, and (v / v) % for liquid / liquid, unless otherwise noted.

[0021] The term “medium temperature” used in the present invention means 25℃ to 40℃.

[0022] The present invention will be described in more detail below.

[0024] In one aspect, the present invention relates to a starch binding scaffold protein prepared by modifying a mini cellulose binding protein A comprising a carbohydrate binding module family 3 and two type 1 cohesins.

[0025] In one embodiment of the present invention, the modification is

[0026] a) The above carbohydrate binding module family 3 is replaced with a starch binding protein, or

[0027] b) Modified to include two additional Type 1 cohesins, or

[0028] c) The carbohydrate binding module family 3 may be modified to be substituted with a starch binding protein and to include two additional type 1 cohesins, but is not limited thereto.

[0029] In one embodiment of the present invention, the Type 1 cohesin may be a starch-degrading enzyme to which a Type 1 dockerin is linked, but is not limited thereto.

[0030] The term “Mini cellulose binding protein A” used in the present invention refers to Clostridium celluloseborans ( Clostridium cellulovoransIt refers to a cellulosome derived from Cellulose-binding protein A (CbpA) and containing Carbohydrate binding module family 3 and two Type 1 cohesins.

[0031] In one embodiment of the present invention, the starch-degrading enzyme may be one or more enzymes selected from the group consisting of alpha-amylase, alpha-glucosidase, oligo-1,6-glucosidase, trehalase, glucoamylase, 4-alpha-glucanotransferase, amylopullulanase, amylomaltase, beta-amylase, and isoamylase, and preferably alpha-amylase, alpha-glucosidase, oligo-1,6-glucosidase, and It may be one or more enzymes selected from trehalase, and more preferably may be alpha amylase (α-Amylase), alpha glucosidase (α-Glucosidase), oligo 1,6 glucosidase (Oligo 1,6 glucosidase) and trehalase.

[0032] The term “alpha amylase (α-Amylase)” used in the present invention is an enzyme that breaks down α-1,4 linkages in starch to produce maltose and maltooligosaccharide.

[0033] The term “alpha-glucosidase (α-Glucosidase)” used in the present invention is an exo-type hydrolytic enzyme that breaks down the terminals of disaccharides and oligosaccharides of α-1,4 linkage to produce glucose.

[0034] The term “Oligo 1,6-glucosidase” used in the present invention is an enzyme that decomposes isomaltose, a disaccharide having an α-1,6 linkage in the branch structure of starch.

[0035] The term “Trehalase” used in the present invention is an enzyme that decomposes trihalose having an α-1,1 linkage.

[0036] In one embodiment of the present invention, the carbohydrate binding module family 3 may be represented by the amino acid sequence of SEQ ID NO. 1, but is not limited thereto.

[0037] In one embodiment of the present invention, the Type 1 cohesin may be represented by the amino acid sequence of SEQ ID NO. 2 or SEQ ID NO. 3, but is not limited thereto.

[0038] In one embodiment of the present invention, the starch binding protein may be represented by the amino acid sequence of SEQ ID NO. 4, but is not limited thereto.

[0039] In one embodiment of the present invention, the starch-binding scaffold protein in which the carbohydrate binding module family 3 is substituted with a starch-binding protein may be represented by the amino acid sequence of SEQ ID NO. 5, but is not limited thereto.

[0040] In one embodiment of the present invention, the starch-binding scaffold protein modified to further include b) two Type 1 cohesins may be represented by the amino acid sequence of SEQ ID NO. 6, but is not limited thereto.

[0041] In one embodiment of the present invention, the starch binding scaffold protein modified such that c) the carbohydrate binding module family 3 is substituted with a starch binding protein and further includes two type 1 cohesins may be represented by the amino acid sequence of SEQ ID NO. 7, but is not limited thereto.

[0043] In one aspect, the present invention relates to an amylosomes capable of starch saccharification comprising a starch-degrading enzyme and a starch-binding scaffold protein.

[0044] Since the amylosomes capable of starch saccharification according to the present invention include the starch-binding scaffold protein described above, any content that overlaps with the starch-binding scaffold protein described above according to the present invention is omitted to avoid excessive complexity in this specification caused by the description of such overlapping content.

[0045] In one embodiment of the present invention, the starch-degrading enzyme may be one or more enzymes selected from the group consisting of alpha-amylase, alpha-glucosidase, oligo-1,6-glucosidase, trehalase, glucoamylase, 4-alpha-glucanotransferase, amylopullulanase, amylomaltase, beta-amylase, and isoamylase, and preferably alpha-amylase, alpha-glucosidase, oligo-1,6-glucosidase, and It may be one or more enzymes selected from trehalase, and more preferably may be alpha amylase (α-Amylase), alpha glucosidase (α-Glucosidase), oligo 1,6 glucosidase (Oligo 1,6 glucosidase) and trehalase.

[0046] In one embodiment of the present invention, the starch-degrading enzyme may have a Type 1 dockerin connected to the C-terminal, but is not limited thereto.

[0047] In one embodiment of the present invention, the starch-degrading enzyme and Type 1 dockerin may be connected by a linker, but are not limited thereto.

[0048] In addition, the above linker may consist of 3 to 60 nucleotide sequences, and preferably may be a linker represented by the nucleotide sequence of SEQ ID NO. 17, but any linker known in the industry may be used without limitation.

[0049] In one embodiment of the present invention, the Type 1 dockerin may be represented by the nucleotide sequence of SEQ ID NO. 18, but is not limited thereto.

[0050] In one embodiment of the present invention, the gene encoding alpha-amylase with Type 1 dockerin linked to the C-terminal may be represented by the nucleotide sequence of SEQ ID NO. 19, but is not limited thereto.

[0051] In one embodiment of the present invention, the gene encoding alpha-glucosidase, in which a type 1 dockerin is linked to the C-terminal, may be represented by the nucleotide sequence of SEQ ID NO. 20, but is not limited thereto.

[0052] In one embodiment of the present invention, the gene encoding an oligo 1,6 glucosidase having a type 1 dockerin linked to the C-terminal may be represented by the nucleotide sequence of SEQ ID NO. 21, but is not limited thereto.

[0053] In one embodiment of the present invention, the gene encoding a trehalase having a Type 1 dockerin linked to the C-terminal may be represented by the nucleotide sequence of SEQ ID NO. 22, but is not limited thereto.

[0054] In one embodiment of the present invention, the amylosomes capable of starch saccharification may further include fungal degrading enzymes, but are not limited thereto.

[0055] In one embodiment of the present invention, the fungal degrading enzyme may be one or more enzymes selected from the group consisting of N-acetylglucosaminodase (GlcNACase), beta-1,3-glucanase (β-1,3 Glucanase), and chitin hydrolyzing enzyme (Chitinase), and preferably N-acetylglucosaminodase ( Cc It may be (GlcNACase), but is not limited thereto.

[0056] In one embodiment of the present invention, the N-acetylglucosaminidase (GlcNACase) is Clostridium cellulose ( Clostridium cellulovorans It may be N-acetylglucosaminidase derived from ) but is not limited thereto.

[0057] In one embodiment of the present invention, the fungal degrading enzyme may have a Type 1 dockerin connected to the C-terminal, but is not limited thereto.

[0058] In one embodiment of the present invention, the Clostridium cellulose ( Clostridium cellulovorans ) derived N-acetylglucosaminidase( Cc The gene encoding GlcNACase may be represented by the nucleotide sequence of sequence number 23.

[0059] The term used in the present invention, “Clostridium cellulose ( Clostridium cellulovorans ) derived N-acetylglucosaminidase( Cc“GlcNACase” is a chitinase based on high homology with a discoidin domain-containing protein and a chitobiase / β-hexosaminidase C-terminal domain, which produces N-acetyl-D-glucosamine from N-acetyl-D-glucosamine of various lengths and contains a Type 1 dockerin domain within the enzyme (Myeong-Eun Lee et al. 2021. Bioresource Technology ).

[0061] In one aspect, the present invention relates to a composition for treating waste food containing amylosomes capable of starch saccharification.

[0062] In one embodiment of the present invention, one or more enzymes selected from the group consisting of amylase, cellulase, lipase, and protease may be further included, but are not limited thereto.

[0063] In one embodiment of the present invention, the composition for treating waste food may further include microorganisms having a waste food decomposition function that are generally included therein, but is not limited thereto.

[0065] In one aspect, the present invention relates to a waste food treatment method comprising the step of treating waste food with amylosomes capable of starch saccharification.

[0066] Since the waste food processing method of the present invention includes the amylosomes capable of starch saccharification described above, any content overlapping with the amylosomes capable of starch saccharification described above is omitted to avoid excessive complexity in this specification caused by the description of such overlapping content.

[0068] The above-mentioned amylosomes capable of starch saccharification have high decomposition activity on starch-related substrates such as amylose, amylopectin, isomaltose, and trehalose, and can decompose waste food in a single step and exhibit excellent starch saccharification efficiency at medium temperatures. Therefore, when the above-mentioned amylosomes are applied to waste food, the waste food can be converted into useful products, making it economical and environmentally friendly to utilize.

[0070] Hereinafter, embodiments of the present invention will be described in more detail with reference to the attached drawings. However, the following embodiments are intended only to embody the content of the present invention and are not to limit the present invention.

[0072] <Example 1> Preparation of an amylosome capable of direct starch saccharification

[0073] 1-1. Gene Amplification and Cloning of Various Forms of Starch-Binding Scaffold Proteins for Amylosemes

[0074] Referring to FIG. 1, a starch-binding scaffold protein was prepared by modifying a mini cellulose binding protein A (hereinafter mCbpA) containing a carbohydrate binding module family 3 and two type 1 cohesins. By binding a starch-degrading enzyme to the starch-binding scaffold protein, an amylosome capable of direct starch saccharification can be prepared.

[0075] To design and express various starch-binding scaffold proteins for use in amylosomes, we proceeded with the gene acquisition process for cellulose mCbpA, a foundational structural protein. Clostridium celluloseborans ( Clostridium cellulovoransThe nucleotide sequence of mCbpA (Sequence No. 16) containing carbohydrate binding module family 3 (Sequence No. 9) and type 1 cohesin (Sequence No. 10 or Sequence No. 11) was amplified from the genomic DNA of ). To modify the carbohydrate binding module family 3 (hereinafter CBM3) contained in the existing mCbpA into a starch binding protein (hereinafter Sbp), the nucleotide sequence encoding Sbp (Sequence No. 12) was synthesized. The primers and plasmids for each starch binding scaffold protein used in the present invention are shown in Table 1 below.

[0077] primer Sequence (5'→3') mCbpA-F(EcoRI) accctGAATTCgcagcgacatcatcaatg mCbpA-R(PstI) cccCTGCAGtcatataggatctccaatattattattgtaacg CCmCbpA-F(SacI) cccGAGCTCccagatgtaccatcttcaataattaa CCmCbpA-R(XhoI) ccccCTCGAGtataggatctccaatatttattgtaacgc Sbp-F(EcoRI) cccaaGAATTCTCTCGCAATCGTTACCTG Sbp_CbpA-R(ov) tgaagatggtacatctggGAACGTGCCGACACTC Sbp_CbpA-F(ov) GTGTCGGCACGTTCccagatgtaccatcttcaataatt Plasmid characteristic pColdII_mCbpA pColdII carrying mCbpA gene pColdII_CCmCbpA pColdII carrying CCmCbpA gene pColdII_SbpCbpA pColdII carrying SbpCbpA gene pColdII_CCSbpCbpA pColdII carrying CCSbpCbpA gene

[0079] A starch-binding scaffold protein in which CBM3 in mCbpA is substituted with Sbp was named SbpCbpA, and a starch-binding scaffold protein recombined to include two type 1 cohesins at the N-terminus of CBM3 in mCbpA was named CCmCbpA by adding the designation CC, and a starch-binding scaffold protein containing both of the above modifications was named CCSbpCbpA. Information on the starch-binding scaffold proteins prepared in the present invention is shown in Table 2 below.

[0081] designation characteristic Sequence number amino acids base SbpCbpA Sbp(sequence number 12); type 1 cohesin(sequence number 10); type 1 cohesin(sequence number 11) 5 13 CCmCbpA type 1 cohesin(sequence number 10);type 1 cohesin(sequence number 11);CBM3(sequence number 9);type 1 cohesin(sequence number 10);type 1 cohesin(sequence number 11) 6 14 CCSbpCbpA type 1 cohesin(sequence number 10);type 1 cohesin(sequence number 11);Sbp(sequence number 12);type 1 cohesin(sequence number 10);type 1 cohesin(sequence number 11) 7 15

[0083] 1-2. Gene Amplification and Cloning of Starch-Degrading Enzymes

[0084] Alpha-amylase, alpha-glucosidase, oligo-1,6-glucosidase, and trehalase were selected as enzymes that constitute amylosomes capable of directly saccharifying starch.

[0085] Alpha amylase (α-Amylase) is Bacillus subtilis ( Bacillus subtilis It was obtained from the genomic DNA of ), and alpha-glucosidase, oligo-1,6-glucosidase, and trehalase were obtained from E. coli ( Escherichia coli It originated from the genomic DNA of k12).

[0086] For each enzyme, a recombinant enzyme was prepared by adding a linker (Sequence No. 17, GGATCCGCTGGCTCCGCTGCTGGTTCTGGGGAATTC) and a Type 1 dockerin (Sequence No. 18) to the downstream sequence of the gene encoding each enzyme, thereby creating a Type 1 dockerin linked to the C-terminus of the enzyme. These genes were cloned into the pColdII vector for heterologous expression in E. coli. Finally, the genes were constructed in the form of each enzyme gene-linker-Type 1 dockerin and inserted into the pColdII vector. The primers and plasmids for each enzyme used in the present invention are shown in Table 3 below.

[0088] primer Sequence (5'→3') α-Amylase-F(SacI) to GAGCTC GAAACGGCGAACAAATCG α-Amylase-R(XhoI) cccc CTCGAG TTGAAAGAATGTGTTACACCTGATT α-Glucosidase-F(SacI) aaa GAGCTC ATGTTAAATGCATGGCACCTGC α-Glucosidase-R(XhoI) aatt CTCGAG GTTCATCCATACCGTAGCCGA Oligo1,6 glucosidase-F(SacI) ate GAGCTC AGTGAATGGTGGAAAGAAGCT Oligo1,6 glucosidase-R(Xho1) aatt CTCGAG TATACTAATGCCCATCACAGCTTCA TreA-F(SacI) aat GAGCTCG AAGAAACACCGGTAACACCaca TreA-R(HindIII) aat AAGCTTA GGTGTGGGTTGTGCCTC Plasmid characteristic pColdII PcspA, lacI, AmpR, ColE1 ori ; E. coli vector for regulating gene expression pColdII_α-Amylase pColdII carrying α-amylase doc gene pColdII_α-Glucosidase pColdII carrying α-glucosidase doc gene pColdII_Oligo1,6 glucosidase pColdII carrying oligo1,6 glucosidase doc gene pColdII_Trehalase pColdII carrying trehalase doc gene

[0090] 1-3. Expression and Purification of Starch-Degrading Enzymes and Various Starch-Binding Scaffold Proteins in E. coli

[0091] The genes obtained in Examples 1-1 and 1-2 above and the plasmids cloned from them were transformed into E. coli. The recombinant strains thus produced were named as shown in Table 4 below. Cultures were performed to express enzymes and proteins from these recombinant strains. The recombinant strains were inoculated into 5 ml LB medium containing ampicillin and cultured at 37°C for 20 hours. The initial culture medium was transferred to 500 ml LB medium containing ampicillin for the main culture. The main culture was started at 37°C, and when the OD600 reached 1, IPTG was added to achieve a final concentration of 1 mM to induce gene expression. After adding IPTG, the culture was carried out at 16°C for 24 hours. The supernatant was removed using a centrifuge, and the cells were finally collected. The collected recombinant strain cells were lysed using ultrasound and centrifuged to obtain the supernatant. The protein was purified using a His-tag connected to the N-terminal of the protein via an affinity chromatography method based on differences in imidazole concentration. Electrophoresis was performed on a 10% SDS-PAGE gel, and the results are shown in Figure 2 (Lane M: protein marker, Lane 1: α-Amylase (59.07 kDa), Lane 2: α-Glucosidase (76.78 kDa), Lane 3: Oligo 1,6-glucosidase (71.94 kDa), Lane 4: Trehalase (68.53 kDa), Lane 5: mCbpA (62.92 kDa), Lane 6: CCmCbpA (104.5 kDa), Lane 7: SbpCbpA (59.07 kDa), Lane 8: CCSbpCbpA (101.64 kDa)).

[0092] As shown in Figure 2, it was confirmed that the results of staining with Comassie blue dye appeared at the same location as the expected protein sizes [α-Amylase (59.07 kDa), α-Glucosidase (76.78 kDa), Oligo 1,6-glucosidase (71.94 kDa), Trehalase (68.53 kDa), mCbpA (62.92 kDa), CCmCbpA (104.5 kDa), SbpCbpA (59.07 kDa), CCSbpCbpA (101.64 kDa)].

[0094] Recombinant strain name characteristic α-Amylase E. coli BL21(DE3) harboring pColdII_α-Amylase α-Glucosidase E. coli BL21(DE3) Rosetta harboring pColdII_α-Glucosidase Oligo1,6 glucosidase E. coli BL21(DE3) harboring pColdII_Oligo1,6 glucosidase Trehalase E. coli BL21(DE3) harboring pColdII_TreA mCbpA E. coli BL21(DE3) harboring pColdII_mCbpA CCmCbpA E. coli BL21(DE3) harboring pColdII_CCmCbpA SbpCbpA E. coli BL21(DE3) harboring pColdII_SbpCbpA CCSbpCbpA E. coli BL21(DE3) harboring pColdII_CCSbpCbpA

[0096] 1-4. Preparation of Amyloses Conjugated with Starch-Degrading Enzymes and Starch-Binding Scaffold Proteins

[0097] An amylosomes capable of direct starch saccharification were prepared by combining alpha amylase, alpha glucosidase, oligo 1,6 glucosidase, and trehalase with the starch-binding scaffold protein described in Example 1-1 above.

[0098] Specifically, the ligation reaction between the corresponding starch-degrading enzymes and the starch-binding scaffold protein was carried out by adjusting the concentration to a 1:1 ratio based on the number of cohesins in the starch-binding scaffold protein. The reaction conditions for ligation were set to be carried out at 4°C for 18 hours in a buffer solution mixed with 25 mM sodium citrate (pH 6.0) and 15 mM calcium chloride (CaCl2).

[0100] <Example 2> Optimal conditions for starch-degrading enzymes and enzyme mixture

[0101] To determine the optimal reaction conditions for the starch-degrading enzymes and enzyme mixtures obtained from the recombinant strains in Example 1 above, reactions were performed with the optimal substrates for each enzyme. The reactions were carried out using 0.15% soluble starch for alpha-amylase, 1 mM 4-nitrophenyl α-D-glucopyranoside (pNPGlc) for alpha-glucosidase, 1 mM isomaltose for oligo-1,6-glucosidase, and 1 mM trihalose for trihalase as substrates. The reaction was conducted at an optimal temperature of 25–60 °C, and the optimal pH was determined using an appropriate 10 mM buffer that buffers the pH range of 4–9. After the reaction, the reaction using pNPGlc was terminated with 0.1 N NaOH. The 4-nitrophenol released as a reaction product was measured at 400 nm. The reaction with water-soluble starch was measured at 540 nm using the DNS method. The reaction with isomaltose and trihalose was measured at 340 nm using a glucose oxidase kit. The results were calculated as relative values, and alpha-amylase showed the best enzyme activity at 40 °C and sodium citrate pH 6; alpha-glucosidase at 45 °C and sodium citrate pH 5; oligo-1,6-glucosidase at 35 °C and sodium phosphate pH 6; and trihalase at 35 °C and Tris HCl pH 7. Finally, it was confirmed that the enzyme mixture showed the best enzyme activity at 35 °C and sodium citrate pH 6. These results are illustrated in Figures 3 and 4.

[0103] <Example 3> Measurement of specific activity of starch-degrading enzymes

[0104] To confirm the specific activity of the starch-degrading enzymes obtained in Example 1 above on starch-related substrates, a reaction was performed. 0.15% water-soluble starch, 0.15% amylose, 0.15% amylopectin, 1 mM isomaltose, and 1 mM trihalose were used as substrates, and the reaction was carried out for 18 hours at 35 °C in sodium citrate pH 6 buffer. The amount of glucose produced in these reactions was measured using a glucose oxidase kit, and the amount of reducing sugar was measured using the DNS method; based on this, the specific activity (nmole / min mg or μmole / min mg) was calculated.

[0105] As a result, as shown in Figure 5, in terms of glucose production, the endo-type alpha-amylase exhibited the highest enzymatic activity in water-soluble starch, amylose, and amylopectin. For water-soluble starch and amylose, the exo-type alpha-glucosidase showed the next highest enzymatic activity. For the branched substrate amylopectin, it was confirmed that oligo-1,6-glucosidase, which effectively breaks down the branched structure, showed the next highest enzymatic activity. For isomaltose, a disaccharide composed of α-1,6 linkages, oligo-1,6-glucosidase showed the highest enzymatic activity. For trihaloses composed of α-1,1 linkages, several enzymes showed relatively high activity, but among them, trihalase exhibited the highest enzymatic activity. In terms of reducing sugar production, the endo-type alpha-amylase showed the highest enzymatic activity in water-soluble starch, amylose, and amylopectin. For amylose, the exo-type alpha-glucosidase showed the next highest activity. For amylopectin, the branched structure-degradable oligo-1,6-glucosidase showed the next highest activity.

[0106] These results indicate that the four selected enzymes will serve as the enzymes that best break down the target substrate, and that these enzymes were appropriately selected.

[0108] <Example 4> Adhesion ability of various starch-binding scaffold proteins to water-soluble starch and starch-rich waste food contaminated with mold

[0109] To verify the adhesion ability of the starch-binding scaffold proteins mCbpA, CCmCbpA, SbpCbpA, and CCSbpCbpA prepared in Example 1-1 to water-soluble starch and mold-contaminated starch-rich waste food, an adhesion reaction was performed. Bread was selected as the mold-contaminated waste food and was purchased from a local bakery. To create a substrate in the form of mold-contaminated waste food, the bread was autoclaved and dried in a drying oven. The dried bread was ground into a powder, 15 g of bread powder was placed in a flask, and Aspergillus nidurans ( Aspergillus nidulrans ...was inoculated. Breadcrumbs inoculated with Aspergillus nidurans were cultured at 37 °C for one week. After culture, the mold-contaminated breadcrumb substrate was recovered by centrifugation and washed three times with sterile water. The washed waste food substrate was dried in a drying oven and finally ground into powder. The Aspergillus nidurans used in the inoculation process was cultured at 37 °C for one week using potato dextrose agar and broth. The cultured mold was recovered and washed three times with sterile water. After being homogenized evenly using a homogenizer, it was inoculated into the breadcrumbs described above.

[0110] mCbpA, CCmCbpA, SbpCbpA, or CCSbpCbpA were added to 60 mg of waste food contaminated with the thus produced mold and water-soluble starch at a concentration of approximately 200 µg / mL, and an attachment reaction was performed in 100 mM sodium phosphate pH 7.0 buffer with a final volume of 700 µl. The reaction was carried out at 15 °C for 45 minutes at 300 rpm. After the attachment reaction, the mixture was centrifuged at 13,000 rpm for 1 minute, and the amount of unbound protein was analyzed at 595 nm using Bradford reagent. Bovine serum albumin (BSA) was used as the reference standard. The attachment ability (%) was calculated by quantifying the amount of added protein versus the amount of unbound protein.

[0111] As a result, as shown in Figure 6, it was confirmed that high adhesion ability was observed for waste food contaminated with water-soluble starch and mold, and in particular, SbpCbpA and CCSbpCbpA, which are amylosomes in which CBM3 is substituted with Sbp, showed the highest adhesion ability.

[0113] <Example 5> Comparison of Enzyme Reactions of Single Enzyme, Enzyme Mixture, and Amylosome

[0114] To compare the enzymatic activities of various amylosomes bound to four types of starch-degrading enzymes, the binding reaction between the amylosomes and enzymes was carried out so that a total of four starch-degrading enzymes were linked in a 1:1:1:1 ratio according to the number of cohesin sites within the starch-binding scaffold protein of the amylosomes, as described in Examples 1-4. The binding reaction between the four types of starch-degrading enzymes and the amylosomes was carried out at 4 °C for 18 hours in a buffer solution mixed with 25 mM sodium citrate pH 6.0 and 15 mM CaCl2. The linked amylosomes, a simple enzyme mixture, and a single enzyme were reacted with 0.15% water-soluble starch, 0.15% amylose, 0.15% amylopectin, 1 mM isomaltose, and 1 mM trihalose at 35 °C for 18 hours.

[0115] As a result, as shown in Figure 7, it was confirmed that the amylosomes combined with starch-degrading enzymes showed higher glucose production capacity than the single enzyme but similar glucose production to the simple enzyme mixture. Regarding reducing sugar production, it was confirmed that the amylosomes produced a larger amount of water-soluble starch and amylose than the single enzyme and the simple enzyme mixture, indicating that they produce oligosaccharides more effectively.

[0117] <Example 6> Amylosome Modification and Optimization for Enhancing Saccharification Ability of Starch

[0118] The aim was to improve the saccharification ability of starch by adjusting the ratios of four types of starch-degrading enzymes and binding them to mCbpA, CCmCbpA, SbpCbpA, and CCSbpCbpA. First, four amylosomes containing twice the amount of each enzyme were prepared, and the ratio of the amylosomes was adjusted so that each enzyme could be linked to the amylosomes in a 1:1 ratio. Finally, amylosomes with modified ratios were prepared through the binding reaction between the starch-degrading enzymes and amylosomes as described in Example 4. The amylosomes prepared with different enzyme ratios were reacted with water-soluble starch, amylose, amylopectin, isomaltose, and trihalose at 35 °C for 18 hours. The amount of reducing equivalents produced was analyzed as a relative value by measuring at 540 nm via the DNS reaction of the reaction solution.

[0119] As a result, as shown in Figure 8, regarding the saccharification ability for starch, there was no significant difference compared to amylosomes containing four types of enzymes in equal proportions even if a specific enzyme was included in larger quantities; however, regarding the saccharification ability for amylose, amylosomes containing twice as much alpha-amylase as other enzymes showed significantly improved hydrolytic ability compared to other amylosomes, and regarding the saccharification ability for amylopectin, it was confirmed that four amylosomes containing one enzyme in twice the amount of another enzyme showed slightly higher hydrolytic ability compared to amylosomes containing four types of enzymes in equal proportions.

[0121] <Example 7> Confirmation of Thermal Stability of Various Amyloses

[0122] To confirm the high-temperature thermal stability of amylosomes bound to the starch-degrading enzymes described in Example 5, thermal stability reaction analysis experiments were performed on mCbpA, CCmCbpA, SbpCbpA, CCSbpCbpA, and a simple enzyme mixture. Since the general starch saccharification process takes place at 55–65 °C, thermal stability was tested at a slightly higher temperature of 70 °C. The amylosomes were heat-treated at 70 °C for 0, 0.5, 1, 3, and 6 hours, centrifuged, and the supernatant was reacted with 0.15% water-soluble starch. The reaction with the water-soluble starch was carried out under the optimal reaction conditions described in Example 4, with a reaction time of 18 hours. After the reaction, the produced reducing sugars were finally measured at 540 nm using the DNS method. The measured values ​​were calculated as relative values.

[0123] As a result, as shown in Figure 9, all amylosomes exhibited high thermal stability compared to the simple enzyme mixture, and in particular, after 6 hours of heat treatment, it was confirmed that Sbp-based amylosomes (SbpCbpA, CCSbpCbpA) maintained significantly high enzyme activity.

[0125] <Example 8> Direct saccharification ability of amylosomes on mold-contaminated waste food

[0126] In order to produce starch saccharifying amylosomes that can be degraded by fungi, in addition to the four types of starch-degrading enzymes (alpha-amylase, alpha-glucosidase, oligo-1,6-glucosidase, and trihalase) with type 1 dockerin linked to the C-terminus, NAG enzyme ( CcGlcNACase (SEQ No. 23) was additionally added and bound to mCbpA, CCmCbpA, SbpCbpA, and CCSbpCbpA by the method described in Examples 1-4, and the mixture was inoculated into starch-rich waste food contaminated with mold to confirm its applicability to said waste food. The reaction was applied to 0.06 g of mold-contaminated waste food and carried out at 35 °C for 18 hours. The amounts of reducing sugars and glucose produced were analyzed by the DNS method (measured at 540 nm) and high-performance liquid chromatography (HPLC) (Detector: refractive index detector / Column: Hi-plex H column), respectively.

[0127] As a result, as shown in Figure 10, it was found that amylosomes with additional fungal enzymes attached produced more reducing sugars and glucose compared to amylosomes without fungal enzymes attached. In particular, CCSbpCbpA showed the highest glucose production compared to other amylosomes regardless of whether fungal enzymes were attached, and produced up to 62.44 ± 0.03 mM of glucose when fungal enzymes were added, indicating significantly superior glucose productivity compared to other amylosomes with additional fungal enzymes attached.

[0129] As described above, specific embodiments of the present invention have been described in detail; however, those skilled in the art who understand the spirit of the present invention will be able to easily propose other inventions that are inferior or other embodiments included within the scope of the spirit of the present invention by adding, changing, or deleting other components within the same spirit. Therefore, the embodiments described above should be understood as illustrative in all respects and not restrictive. The scope of the present invention is defined by the claims set forth below rather than by the detailed description above, and all modifications or variations derived from the meaning and scope of the claims and equivalent concepts should be interpreted as being included within the scope of the present invention.

Claims

Claim 1 A plasmid for preparing a starch-binding scaffold protein prepared by modifying a mini cellulose binding protein A comprising a carbohydrate binding module family 3 and two type 1 cohesins, wherein the plasmid comprises a nucleic acid sequence composed of SEQ ID NO. 12 for substituting the carbohydrate binding module family 3 with the starch-binding protein. Claim 2 The plasmid of claim 1, wherein the plasmid further comprises a nucleic acid sequence consisting of SEQ ID NO. 10 or SEQ ID NO. 11 for modifying the starch-binding scaffold protein to further include two Type 1 cohesins. Claim 3 A starch-binding scaffold protein prepared using a plasmid according to claim 1, wherein the starch-binding scaffold protein comprises: a starch-binding protein transcribed and translated from a nucleic acid sequence composed of SEQ ID NO. 12; and two type 1 cohesins contained in the small cellulose-binding protein A. Claim 4 A starch-binding scaffold protein according to claim 3, wherein the starch-binding protein transcribed and translated from the nucleic acid sequence composed of SEQ ID NO. 12 is composed of the amino acid sequence of SEQ ID NO. 4, and the two type 1 cohesins included in the small cellulose-binding protein A are composed of the amino acid sequence of SEQ ID NO. 2 or SEQ ID NO.

3. Claim 5 A starch-binding scaffold protein according to claim 4, wherein the two type 1 cohesins included in the small cellulose-binding protein A are characterized by being bound to a starch-degrading enzyme linked to a type 1 dockerin, and the starch-degrading enzyme is one or more enzymes selected from the group consisting of alpha-amylase, alpha-glucosidase, oligo-1,6-glucosidase, and trehalase. Claim 6 A starch-binding scaffold protein prepared using a plasmid according to claim 2, wherein the starch-binding scaffold protein comprises: a starch-binding protein transcribed and translated from a nucleic acid sequence composed of SEQ ID NO. 12; two type 1 cohesins contained in the small cellulose-binding protein A; and two type 1 cohesins transcribed and translated from a nucleic acid sequence composed of SEQ ID NO. 10 or 11. Claim 7 A starch-binding scaffold protein according to claim 6, wherein the starch-binding protein transcribed and translated from the nucleic acid sequence composed of SEQ ID NO. 12 is composed of the amino acid sequence of SEQ ID NO. 4, and the two type 1 cohesins included in the small cellulose-binding protein A and the two type 1 cohesins transcribed and translated from the nucleic acid sequence composed of SEQ ID NO. 10 or 11 are composed of the amino acid sequence of SEQ ID NO. 2 or SEQ ID NO.

3. Claim 8 A starch-binding scaffold protein according to claim 7, wherein the two type 1 cohesins included in the small cellulose-binding protein A and the two type 1 cohesins transcribed and translated from the nucleic acid sequence composed of SEQ ID NO. 10 or 11 are characterized by having a starch-degrading enzyme linked to a type 1 dockerin, and wherein the starch-degrading enzyme is one or more enzymes selected from the group consisting of alpha-amylase, alpha-glucosidase, oligo-1,6-glucosidase, and trehalase. Claim 9 delete Claim 10 A starch-binding scaffold protein according to any one of claims 3 to 8; and one or more starch-degrading enzymes selected from the group consisting of alpha-amylase, alpha-glucosidase, oligo-1,6-glucosidase, and trehalase, comprising a starch-saccharifying amylosome. Claim 11 delete Claim 12 In claim 10, the starch-degrading enzyme is characterized by having a Type 1 dockerin linked to the C-terminal, an amylosome capable of starch saccharification. Claim 13 In claim 10, the starch-saccharifying amylosomes are characterized by further including fungal degrading enzymes. Claim 14 In claim 13, the starch-saccharifying amylosomes are characterized in that the fungal degrading enzyme is one or more enzymes selected from the group consisting of N-acetylglucosaminidase (GlcNACase), beta-1,3-glucanase (β-1,3 Glucanase), and chitin hydrolyzing enzyme (Chitinase). Claim 15 A composition for treating waste food containing amylosomes capable of starch saccharification according to claim 10. Claim 16 A method for treating waste food, comprising the step of treating waste food with amylosomes capable of starch saccharification according to claim 10.

Citation Information

Patent Citations

  • Method for producing ethanol by using kitchen refuse

    KR1020090001116A

  • Artificial cellulosomes comprising multiple scaffolds and uses thereof in biomass degradation

    WO2015019346A1