Recombinant microorganism with improved production capacity of hydrophobic compounds and membrane engineering method for the production thereof

Abstract

The present invention relates to a recombinant microorganism with improved production capacity of hydrophobic substances and a cell membrane engineering method for producing the same, and more specifically, to a recombinant microorganism for producing hydrophobic substances that is cell membrane engineered to have one or more of the following features: increased cell membrane area; increased formation and secretion of outer membrane vesicles; and increased formation of inner membrane vesicles, and a cell membrane engineering method for producing the same. The present invention is useful for producing hydrophobic insoluble substances with high efficiency. The recombinant microorganisms developed through the manufacturing method according to the present invention for the high-efficiency production of carotenoids or violacein analogs are useful as microorganisms for the production of natural pigments, antioxidants, antibiotics, cosmetic additives, anticancer agents, food additives, or nutritional supplements. Furthermore, the natural pigment production technology developed in the present invention has confirmed a significant increase in production capacity. Therefore, the present invention is useful as it can be used to construct recombinant strains and establish efficient manufacturing methods for the efficient production of various metabolic products that are industrially and medically useful.

Description

Technology Field

[0001] The present invention relates to a recombinant microorganism with improved production capacity of hydrophobic substances and a cell membrane engineering method for producing the same, and more specifically, to a recombinant microorganism for producing hydrophobic substances in which the cell membrane is engineered to have one or more of the following features: increased cell membrane area; increased formation and secretion of outer membrane vesicles; and increased formation of inner membrane vesicles, and a cell membrane engineering method for producing the same. Background Technology

[0002] Due to global environmental issues, the depletion of limited resources, and the demand for eco-friendly energy sources, interest in establishing renewable, biologically-based cell factories is increasing. These cell factories can optimize intracellular metabolic networks for the production of target metabolites (bioenergy, eco-friendly chemicals, new drug formulations, etc.), and this process requires various molecular biology techniques. Various substances produced based on petrochemicals can be classified into several categories, one of the representative classification criteria being hydrophilicity and hydrophobicity. Representative groups of hydrophobic substances include hydrophobic pigments (such as carotenoids and violaceins). Pigments are widely used in industries including food additives, dyes, cosmetics, and paints, and are deeply involved in our lives. Since pigments, whether ingested or applied to the skin, have a direct impact on the body, interest and demand for natural pigments—considered safer than potentially problematic petroleum-based synthetic pigments—are surging as health concerns rise in modern society. It is also known that petroleum-based synthetic pigments cause serious environmental problems during textile dyeing. Natural pigments derived from nature often possess not only color but also various pharmacological properties, such as anticancer, antibiotic, antibacterial, and immunosuppressive effects, making them highly useful in daily life. Currently, many pigments are produced based on petrochemicals, and the use of natural pigments is low. This leads to health and environmental issues, and is particularly problematic given the widespread use of petrochemical-based pigments in products intended for children. Furthermore, petrochemical-based pigments cause serious water pollution during the textile dyeing process.

[0004] Therefore, efforts have been made to mass-produce these natural pigments using microbial cell factories in an environmentally friendly manner. Representative examples include attempts to increase the production of hydrophobic pigments accumulated on the cell membrane by expanding the surface area of ​​the cell membrane (T. Wu et al., Membrane engineering - A novel strategy to enhance the production and accumulation of beta-carotene in Escherichia coli. Metab Eng 43, 85-91 (2017).) and attempts to increase production by dissolving hydrophobic pigments into intracellular lipids (T. Ma et al., Lipid engineering combined with systematic metabolic engineering of Saccharomyces cerevisiae for high-yield production of lycopene. Metab Eng 52, 134-142 (2019).).

[0006] Under the background technology described above, the inventors have made diligent efforts to improve the production capacity of hydrophobic substances by modifying the inherent characteristics of microorganisms used for producing hydrophobic substances through cell membrane engineering. As a result, they confirmed that when the cell membrane is engineered through the inhibition, introduction, or overexpression of genes related to cell shape, outer membrane vesicles, or inner membrane vesicles in Escherichia coli that produce natural pigments such as carotenoids and violacein analogs, the cell membrane area increases, the formation and secretion of outer membrane vesicles increase, and the formation of inner membrane vesicles increases, thereby expanding the space where lipophilic natural pigment substances can accumulate and consequently significantly increasing production yield. They also completed the present invention by testing and verifying the synergistic effects of each element.

[0008] The information described above in the background section is intended solely to enhance understanding of the background of the present invention and may not include information that constitutes prior art already known to those skilled in the art to which the present invention belongs. The problem to be solved

[0009] The objective of the present invention is to provide a recombinant microorganism in which the cell membrane is engineered to enhance the production capacity of hydrophobic substances, and a method for producing the same.

[0010] Another objective of the present invention is to provide a method for producing a hydrophobic substance by culturing the recombinant microorganism.

[0011] Another objective of the present invention is to provide a screening method for recombinant microorganisms with excellent production capacity of specific hydrophobic substances using a library of recombinant microorganisms with engineered cell membranes. means of solving the problem

[0012] To achieve the above objective, the present invention provides a recombinant microorganism for producing hydrophobic substances, wherein the cell membrane is engineered to have one or more of the following features: increased cell membrane area; increased formation and secretion of extracellular membrane vesicles; and increased formation of extracellular membrane vesicles.

[0013] The present invention also provides a method for producing a recombinant microorganism for producing hydrophobic substances, comprising the step of suppressing the expression of one or more genes among a cell shape-related gene and a cell outer membrane vesicle-related gene in the recombinant microorganism for producing hydrophobic substances, and / or introducing or overexpressing a cell inner membrane vesicle-related gene in the recombinant microorganism for producing hydrophobic substances.

[0014] The present invention also provides a method for producing a hydrophobic material, comprising the steps of: culturing a recombinant microorganism for producing a hydrophobic material in which the cell membrane is engineered to produce the hydrophobic material; and obtaining the produced hydrophobic material.

[0015] The present invention also comprises the steps of: (a) generating a library of microorganisms for producing hydrophobic substances by performing cell membrane engineering through one or more means of inhibiting the expression of a cell morphology-related gene in a microorganism for producing hydrophobic substances; inhibiting the expression of a cell outer membrane vesicle-related gene; and introducing or overexpressing a cell inner membrane vesicle-related gene; and

[0016] (b) A screening method for cell membrane-engineered recombinant microorganisms with increased production capacity of a specific hydrophobic substance is provided, comprising the step of culturing the microorganisms for producing the hydrophobic substance to select recombinant microorganisms with excellent production capacity of a specific hydrophobic substance. Effects of the invention

[0017] The cell membrane engineering method of the present invention is composed of three main elements: first, modifying the shape of the cell by inhibiting the expression of genes related to cell division; second, expanding the cell membrane structure by introducing or overexpressing genes that express cell membrane vesicles; and third, overproducing cell membrane vesicles by inhibiting the expression of target genes related to cell membrane metabolism in order to express cell membrane vesicles.

[0018] These three methods, whether used individually or in combination, produce synergistic effects and are useful for producing hydrophobic insoluble substances with high efficiency. The recombinant microorganisms for the high-efficiency production of carotenoids or violacein analogs, developed through the screening method of recombinant microorganisms with excellent hydrophobic substance production capabilities according to the present invention, are useful as microorganisms for producing natural pigments. Furthermore, the natural pigment production technology developed in the present invention has achieved a significant increase in production capacity. Therefore, the present invention is useful for establishing efficient manufacturing methods and producing recombinant strains for the efficient production of various metabolites that are industrially and medically useful. Brief explanation of the drawing

[0020] Figure 1 shows a schematic diagram of cell membrane engineering strategies for expanding cell membrane space and the biosynthetic pathways for carotenoid and violacein analogs. Cell morphology can be modified through the repression of related gene expression using synthetic sRNA systems, and extracellular membrane vesicles can also be formed in the same manner. On the other hand, intracellular membrane vesicles can be formed through the expression of foreign genes such as cav1. Curved arrows and T-shaped symbols represent promoters and transcription terminators, respectively, while solid and dotted lines represent single and multiple reactions, respectively. The abbreviations are as follows: G3P, glyceraldehyde 3-phosphate; E4P, erythrose 4-phosphate; PEP, phosphenolpyruvate; PYR, pyruvate; DXP, 1-deoxy-D-xylulose 5-phosphate; SKM, shikimate; FPP, farnesyl diphosphate; GGPP, geranylgeranyl pyrophosphate; TRP, tryptophan; IPA, indole pyruvate; Sp., spontaneous. Figure 2 shows the construction of carotenoid-producing strains and the culture results of the constructed strains. (A) shows the plasmid schematics of the pLYC, pBTC, pZEA, and pATX libraries. The curved arrow, hemisphere, and T-shape represent the promoter, 5'UTR, and transcription terminator, respectively. (B) shows the initial screening results of the LYC strains. Conspicuous red colonies were selected and cultured in test tubes, and (C) superior strains were cultured again in flasks. (D)–(F) correspond to the test tube culture results of the BTC, ZEA, and ATX strains, respectively. (G) shows the HPLC analysis results for 50 samples of superior strains from (F). For each sample, the area value of the peak corresponding to astaxanthin is shown on the y-axis.(H), (I), and (J) represent the flask culture results of the BTC, ZEA, and ATX strains selected from test tube cultures, respectively. Error bars represent the mean ± standard deviation (n=3), and **P < 0.01, ***P < 0.001, NS (not significant) P ≥ 0.05 were determined by a two-tailed Student's t-test. Figure 3 shows the construction of violacein analog-producing strains and the culture results of the constructed strains. (A) is a schematic diagram of the plasmid constructed for the production of violacein analogs. (B) shows the results of comparing violacein production when glucose and glycerol were used as single carbon sources, (C) shows the production results of prodeoxyviolacein and proviolacein from PDVIO and PVIO strains using glycerol, and (D) shows the production results of deoxyviolacein and violacein from DVIO and VIO strains using glycerol. Below are the LC-MS chromatograms and spectra of (E) prodeoxyviolacein and (F) proviolacein produced from E. coli strains, and (G) the absorption spectra of carotenoid and violacein analogs in the wavelength range of 350–750 nm. Each data point in graph (G) represents the average value obtained from three individual samples, and a curve graph was formed by connecting these points. Figure 4 shows the results of increased production of carotenoid and violacein analogs through cell morphology modification and endometrial vesicle formation. (A) illustrates the mechanism of cell membrane space expansion through cell morphology modification in E. coli, and shows the results of (B) β and (C) deoxyviolacein production through the introduction of sRNA that inhibits the expression of genes related to cell morphology modification. (D) illustrates the mechanism of endometrial vesicle formation in E. coli, and shows the resulting production results of (E) β and (F) deoxyviolacein.Below are TEM (top panel) and SEM (bottom panel) images of (G) the β-producing control strain BTC1, (H) the β-producing strain expressing cav1, (I) the deoxyviolacein-producing control strain DVIO, and (J) the deoxyviolacein-producing strain expressing cav1. The error bars in the production graph represent the mean ± standard deviation (n=3), and *P < 0.05, **P < 0.01, ***P < 0.001, NS (not significant) P ≥ 0.05 were determined by a two-tailed Student's t-test. Figure 5 shows micrographs of the BTC1 and DVIO strains with modified cell morphology. (A) is a micrograph of the BTC1 strain and the BTC1 strain into which sRNA inhibiting gene expression related to cell morphology modification has been introduced, and (B) is a micrograph of the DVIO strain and the DVIO strain into which sRNA inhibiting gene expression related to cell morphology modification has been introduced. In strains into which sRNA inhibiting gene expression related to cell morphology modification was introduced, longer or shorter cell morphologies were observed compared to the control group. The corresponding target gene for inhibition is labeled for each micrograph. Figure 6 shows the results of increased production of carotenoids and violacein analogs through increased formation and secretion of extracellular membrane vesicles. (A) shows the mechanism of extracellular membrane vesicle formation in E. coli, and the resulting (B) β and (C) deoxyviolacein production results. Below are TEM (top panel) and SEM (bottom panel) images of (D) the BTC1 strain into which rffD and rfaD expression-inhibiting sRNA was introduced and (E) the DVIO strain into which rfaI expression-inhibiting sRNA was introduced, and (F) SEM images of extracellular membrane vesicles formed in the BTC1 strain into which rffD and rfaD expression-inhibiting sRNA was introduced (top panel) and extracellular membrane vesicles formed in the DVIO strain into which rfaI expression-inhibiting sRNA was introduced (bottom panel) after purification and analysis.(G) shows the results of β-carotene production when inner and outer membrane vesicles were formed simultaneously, and (H) shows the results of deoxyviolacein production when a combination of cell morphology modification and the production of inner and outer membrane vesicles was applied. Below are TEM (top panel) and SEM (bottom panel) images of (I) the BTC1 strain introduced with rffD and rfaD expression-inhibiting sRNA and cav1-plsBC, and (J) the DVIO strain introduced with rfaI expression-inhibiting sRNA and cav1. Figure 7 shows the quantitative results of carotenoids and violacein analogs secreted into the medium due to outer membrane vesicles. (A) shows β extracted from the supernatant of the BTC1 strain culture medium into which sRNA was introduced for outer membrane vesicle expression, and (B) shows β extracted from purified outer membrane vesicles. Here, OMV refers to the BTC1 strain introduced with sRNA that inhibits the expression of rffD and rfaD, and IMV refers to the BTC1 strain introduced with cav1 and plsBC. (C) shows deoxyviolacein extracted from the supernatant of the culture medium of the DVIO strain introduced with sRNA for extracellular membrane vesicle expression, and (D) shows deoxyviolacein extracted from purified extracellular membrane vesicles. Here, OMV refers to the DVIO strain introduced with sRNA that inhibits rfaI expression, and IMV refers to the DVIO strain introduced with cav1. (E) is a micrograph of the deoxyviolacein crystals remaining after water washing and the aggregates consisting of cells and extracellular membrane vesicles during flask culture of DVIO introduced with rfaI-inhibiting sRNA. Below are the results of flask culture in which the plsBC gene was overexpressed in (F) β and (G) deoxyviolacein-producing strains expressing extracellular membrane vesicles.Next, the total production (indicated as Tot) and secretory production (indicated as Sec) of (H) zeaxanthin, (I) astaxanthin, (J) proviolacein, (K) prodeoxyviolacein, and (L) violacein when extracellular or endocrine membrane vesicles were expressed are shown in the corresponding graphs. Error bars represent the mean ± standard deviation (n=3), and values ​​*P < 0.05, **P < 0.01, ***P < 0.001, NS (not significant) P ≥ 0.05 were determined by a two-tailed Student's t-test. Figure 8 shows the production of each hydrophobic substance over time when fed-batch fermentation is performed using the recombinant microorganism of the present invention: (a) Astaxanthin, (b) beta-carotene, (c) Zeaxanthin, (d) Proviolacein, (e) Prodeoxyviolacein, (f) Violacein, (g) Deoxyviolacein. Specific details for implementing the invention

[0021] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by a skilled expert in the art to which this invention pertains. In general, the nomenclature used herein is well known and commonly used in the art.

[0022] Unless otherwise indicated, nucleic acids are written in a 5'→ orientation from left to right, and amino acids are written in an N-terminal → terminal orientation from left to right. Numerical ranges listed in the specification include a number defining the range and each integer or any non-integer fraction within the defined range.

[0024] To date, many attempts have been made to increase the production of colored natural substances by manipulating the metabolic circuits of microorganisms, but this has certain limitations due to the characteristics of substances that accumulate within the cell. In this invention, the production of hydrophobic pigments has been dramatically increased by engineering the cell membrane in various ways to increase the surface area of ​​the cell membrane, creating structures within the cell to expand the cell membrane, or trapping the substances in vesicles to release them outside the cell.

[0025] In one embodiment of the present invention, natural pigments, namely carotenoids and violacein analogs, were produced in E. coli. As carotenoids and violacein analogs are lipophilic substances, when produced in E. coli, they accumulate in the cell membrane rather than in the cytoplasm or outside the cell. Based on this, the cell membrane area was increased, and vesicles were formed inside and outside the cell to expand the space available for the accumulation of lipophilic natural pigment substances. First, E. coli strains were established to produce three types of carotenoids and four types of violacein analogs, respectively, and changes in production volume were observed based on the increase in cell membrane area and the formation of vesicles. Additionally, the synergistic effects of each element of the present invention were tested and verified in the production of all substances. The strategy used in this study can be usefully applied to research on producing various other lipophilic substances in E. coli, such as antioxidants, antibiotics, cosmetic additives, anticancer agents, food additives, and nutritional supplements, in addition to natural pigments.

[0026] In one embodiment of the present invention, a strain producing natural pigments, carotenoids, and violacein, which are among the most widely used hydrophobic substances in industry, was constructed. To increase the production capacity of hydrophobic substances, cell membrane engineering was performed so that the hydrophobic substance-producing strain exhibits the characteristics of i) increased cell membrane area, ii) increased formation and secretion of extracellular membrane vesicles, or iii) increased formation of extracellular membrane vesicles. To engineer the cell membrane so that the production strain has the above characteristics, cell morphology-related genes and extracellular membrane vesicle-related genes were screened. It was confirmed that the production capacity of the natural pigment of the production strain significantly increased when the expression of the said gene was suppressed by treating with sRNA targeting the said cell morphology-related gene or extracellular membrane vesicle-related gene, or when the gene related to the extracellular membrane vesicle was overexpressed. It was also confirmed that a synergistic effect was exhibited when the suppression or overexpression of said genes was combined.

[0027] In the embodiments of the present invention, it was confirmed that an increase in cell membrane area through the inhibition of genes related to cell morphology in Escherichia coli, an increase in the formation and secretion of extracellular membrane vesicles through the inhibition of genes related to extracellular membrane vesicles, and an increase in the formation of endcellular membrane vesicles through the overexpression of genes related to endcellular membrane vesicles resulted in a significant improvement in the production capacity of natural pigments, which are representative hydrophobic substances accumulated in cell membranes. Generally, since hydrophobic substances accumulate in the cell membrane or the end and end membranes of vesicles that exhibit hydrophobicity, it is self-evident that not only natural pigments but also various hydrophobic substances that can be produced through microorganisms can exhibit an improvement in production capacity equivalent to that of natural pigments.

[0029] Accordingly, the present invention relates to a recombinant microorganism for producing hydrophobic materials that is membrane-engineered to have one or more of the following features: increased cell membrane area; increased formation and secretion of extracellular membrane vesicles; and increased formation of extracellular membrane vesicles.

[0030] The term “cell membrane engineering” in the present invention refers to a technology that enhances or reduces existing characteristics or imparts new characteristics to the cell membrane of a conventional cell using genetic recombination technology or the like. In the present invention, cell membrane engineering was performed using the inhibition, overexpression, and / or introduction of genes, and was intended to impart characteristics such as an increase in the cell membrane area and / or an increase in the formation and secretion of extracellular membrane vesicles and an increase in the formation of extracellular membrane vesicles.

[0031] In one embodiment of the present invention, the above-described features were imparted by performing cell membrane engineering on a recombinant microorganism for producing hydrophobic materials through inhibition, introduction, or overexpression of gene expression.

[0032] Accordingly, in one aspect, the present invention is such that one or more of the genes related to cell morphology and the genes related to outer membrane vesicles are suppressed; and / or

[0033] The present invention relates to a recombinant microorganism for producing hydrophobic substances characterized by the overexpression or introduction of a gene related to an inner membrane vesicle.

[0034] In the present invention, the combination microorganism has one or more genes among a cell morphology-related gene and a cell outer membrane vesicle-related gene repressed; and / or

[0035] Inner membrane vesicle-related genes are overexpressed or introduced,

[0036] It may be characterized by having one or more of the following features:

[0037] i) Increase in cell membrane area;

[0038] ii) increased formation and secretion of outer membrane vesicles; and

[0039] iii) Increased formation of inner membrane vesicles

[0040] In the present invention, the hydrophobic substance may be characterized by accumulating in the cell membrane. For example, the hydrophobic substance may be a natural pigment, an antioxidant, an antibiotic, a cosmetic additive, an anticancer agent, a food additive, and a nutritional supplement, but is not limited thereto.

[0041] In the present invention, the natural pigment refers to a pigment that can be obtained from nature without being artificially synthesized or an analogue thereof, such as carotenoids, violacein, etc., and more specific examples include lycopene, β-zeaxanthin, astaxanthin, proviolacein (PVIO), prodeoxyviolacein (PDVIO), deoxyviolacein (DVIO), violacein (VIO), etc., but are not limited thereto.

[0042] The above antioxidant substances include, for example, quercetin, dihydroquercetin, kaempferol, dihydrokaempferol, astaxanthin, resveratrol, tocopherol, tocotrienol, coenzyme Q10, apigenin, etc., but are not limited thereto.

[0043] The above cosmetic additives include, for example, aloesin, vitamin A, ceramide, pantothenate, panthenol, lupeol, squalene, eucalyptol, valencene, etc., but are not limited thereto.

[0044] The above food additives include, for example, carminic acid, β-lycopene, etc., but are not limited thereto.

[0045] The above nutritional supplements include, for example, silymarin, lutein, vitamins, coenzyme-Q10, resveratrol, omega-3 polyunsaturated fatty acids, ubiquinone, glucosamine, luteolin, etc., but are not limited thereto.

[0046] In the present invention, preferably, the hydrophobic material may be characterized as being selected from the group consisting of astaxanthin, beta-carotene, zeaxanthin, proviolacein, prodeoxyviolacein, deoxyviolacein, and violacein.

[0047] In the present invention, “cell shape-related genes” refer to genes involved in maintaining the shape of a cell. In one embodiment of the present invention, the expression of said cell shape-related genes was suppressed to increase the surface area of ​​the cell membrane where hydrophobic substances accumulate, thereby making the shape of the filamentous recombinant cell more irregular or spherical. In the present invention, said cell shape-related genes may include any gene that causes the cell shape to change and the cell area to increase when its expression is suppressed. They can be easily selected by a person skilled in the art depending on the recombinant microorganism used. Preferably, they are selected from among the genes necessary for forming, maintaining, or changing the cell shape that the recombinant microorganism innately possesses, but are not limited thereto.

[0048] In the present invention, the cell morphology-related gene may be, for example, a gene involved in cell division, or a gene involved in the synthesis or maintenance of the cytoskeleton / cell wall, but is not limited thereto.

[0049] In the present invention, the gene involved in cell division may be, for example, a gene encoding a group of enzymes of prokaryotic origin involved in cell division composed of cell division proteins (e.g., Fts proteins, etc.) and cell division inhibitor proteins (e.g., MinC, MinD, etc.), but is not limited thereto.

[0050] In the present invention, the gene involved in the synthesis or maintenance of the cytoskeleton / cell wall may be a gene encoding a group of prokaryotic enzymes, such as, for example, penicillin-binding protein (PBP), cell shape-determining protein (MreB, MreC, etc.), peptidoglycan D,D-transpeptidase (MrdA, PbpA, etc.), peptidoglycan glycosyltransferase (MrdB, etc.), cytoskeleton protein (RodZ, etc.), but is not limited thereto.

[0051] In one embodiment of the present invention, recombinant E. coli was prepared to express natural pigments, and then cell membrane engineering was performed by suppressing the expression of 16 screened cell morphology-related genes (Table 4). For example, when the recombinant microorganism is Escherichia coli, the cell shape-related genes include rodZ (Cytoskeleton protein), ftsA (Cell division protein), ftsB (Cell division protein), ftsI (Peptidoglycan D,D-transpeptidase), ftsL (Cell division protein), ftsQ (Cell division protein), ftsW (Probable peptidoglycan glycosyltransferase), ftsZ (Cell division protein), minD (Septum site-determining protein), mrdA (Peptidoglycan D,D-transpeptidase), mrdB (Peptidoglycan glycosyltransferase), mreB (Cell shape-determining protein), mreC (Cell shape-determining protein), zipA (Cell division protein), murE (UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate It may be selected from the group consisting of ligase), pbpC (Penicillin-binding protein 1C) and combinations thereof, but is not limited thereto.

[0052] In a more desirable example, for instance, in the case of recombinant E. coli that produces deoxyviolacein, the expression of the mrdB gene, which is a cell morphology-related gene, can be suppressed.

[0053] In the present invention, the cell morphology-related gene may be appropriately modified or selected to a gene corresponding to the cell morphology-related gene of E. coli inhibited in the embodiments of the present invention or a gene performing substantially the same function, depending on the microorganism used and the hydrophobic substance to be produced.

[0054] In the present invention, “extracellular membrane vesicle-related genes” refer to genes involved in the formation or secretion of extracellular membrane vesicles. In the present invention, the extracellular membrane vesicle-related genes may be characterized as being endogenous genes of microorganisms. In one embodiment of the present invention, by suppressing the expression of extracellular membrane vesicle-related genes that play a role in maintaining the cell’s peptidoglycan layer or the connection between the extracellular membrane and the inner membrane, and thereby releasing hydrophobic substances accumulated within the cell through extracellular membrane vesicles, it was confirmed that the production capacity of hydrophobic substances is significantly improved. In the present invention, the extracellular membrane vesicle-related genes may include any genes capable of enhancing the formation and secretion of extracellular membrane vesicles when suppressed, and may be easily selected according to the recombinant microorganism used; preferably, they may be genes involved in maintaining the cell’s peptidoglycan layer or the connection between the extracellular membrane and the inner membrane, but are not limited thereto.

[0055] In the present invention, the gene related to the outer membrane vesicle may be a gene related to maintaining the outer membrane / peptidoglycan structure, a gene related to expressing outer membrane proteins, or a gene related to the cell membrane metabolic pathway, but is not limited thereto.

[0056] In the present invention, the gene related to the maintenance of the extracellular membrane / peptidoglycan structure may be, for example, a gene encoding a group of prokaryotic enzymes that contribute to the maintenance of the extracellular membrane / peptidoglycan structure, such as lipoprotein (Lpp), Tol-Pal system protein (TolB, Pal, TolA, TolR, etc.), lipopolysaccharide core biosynthesis protein, lipopolysaccharide core heptosyltransferase, lipid A biosynthesis lauroyltransferase, but is not limited thereto.

[0057] In the present invention, the cell outer membrane protein expression gene may be, for example, a gene encoding a group of prokaryotic enzymes that contribute to the expression of cell outer membrane proteins such as outer-membrane protein A (OmpA), outer-membrane protein C (OmpC), outer-membrane protein F (OmpF), OprF (OmpA homologue), envelope protein (RagA, RagB, etc.), but is not limited thereto.

[0058] In the present invention, the genes related to cell membrane metabolic pathways may be, for example, genes encoding a group of prokaryotic cell membrane metabolic pathway enzymes such as quinolone signal (PQS), anti-sigma-E factor, sigma factor H (AlgU), and chaperone-protease (DegP), but are not limited thereto.

[0059] In one embodiment of the present invention, recombinant E. coli was prepared to express natural pigments, and then cell membrane engineering was performed by inhibiting the expression of 26 screened extracellular membrane vesicle-related genes (Table 7). For example, if the recombinant microorganism is Escherichia coli, the extracellular membrane vesicle-related genes are rseA (Anti-sigma-E factor), rseB (Sigma-E factor regulatory protein), rffD (UDP-N-acetyl-D-mannosamine dehydrogenase), rffC (dTDP-fucosamine acetyltransferase), rffA (dTDP-4-amino-4,6-dideoxygalactose transaminase), ompR (DNA-binding dual transcriptional regulator), gmhB (D-glycero-beta-D-manno-heptose-1,7-bisphosphate 7-phosphatase), lpxL (Lipid A biosynthesis lauroyltransferase), lpxM (Lipid A biosynthesis myristoyltransferase), ompA (Outer membrane protein), ompC (Outer membrane protein), rfaB (Lipopolysaccharide 1,6-galactosyltransferase), rfaC (Lipopolysaccharide heptosyltransferase 1), rfaD (ADP-L-glycero-D-manno-heptose-6-epimerase), rfaE (Bifunctional protein HldE), rfaG (Lipopolysaccharide core biosynthesis protein), rfaI (Lipopolysaccharide 1,3-galactosyltransferase), rfaJ (Lipopolysaccharide 1,2-glucosyltransferase),rfaK (Lipopolysaccharide 1,2-N-acetylglucosaminetransferase), rfaP (Lipopolysaccharide core heptose(I) kinase), rfaQ (Lipopolysaccharide core heptosyltransferase), rfaY (Lipopolysaccharide core heptose(II) kinase), rfbA (Glucose-1-phosphate thymidyltransferase 1), rffH (Glucose-1-phosphate thymidyltransferase 2), wzxE (ECA polysaccharide chain length modulation) protein), and pnp (Polyribonucleotide nucleotidyltransferase), tolA (colicin import membrane protein), tolB (Tol-Pal system periplasmic protein), tolC (outer membrane protein), tolR (biopolymer transport protein), nlpI (lipoprotein), nlpD (murein hydrolase activator), ompF (outer membrane pore protein), pal (peptidoglycan-associated outer membrane lipoprotein), degS (serine endoprotease), degP (serine endoprotease), tatC (sec-independent protein translocase protein), lpp (murein lipoprotein) and combinations thereof may be selected from the group consisting of, but are not limited to,

[0060] For example, in the case of recombinant E. coli that produces the carotenoid pigments Astaxanthin, β, or zeaxanthin, the expression of one or more genes selected from rfaD, rffD, and rfaQ may be inhibited, more preferably the expression of rffD and rfaD genes.

[0061] As another example, in the case of recombinant E. coli that produces violacein and analogs thereof, such as violacein, prodeoxyviolacein, proviolacein and deoxyviolacein, the expression of the rfaI or rfaQ gene may be inhibited, more preferably the expression of the rfaI gene.

[0062] In the present invention, the extracellular membrane vesicle-related gene may be appropriately modified or selected to a gene corresponding to the extracellular membrane vesicle-related gene inhibited in the embodiments of the present invention or a gene performing substantially the same function, depending on the microorganism used and the hydrophobic substance to be produced.

[0064] In the present invention, “inner membrane vesicle-related genes” refer to genes involved in the formation of inner membrane vesicles. In one embodiment of the present invention, since Escherichia coli, a prokaryotic organism lacking an inner membrane vesicle system, was used, cell membrane engineering was performed to enable the formation of inner membrane cells by introducing a human-derived caveola gene among the inner membrane vesicle systems derived from eukaryotic cells. In the present invention, any gene that enhances the formation of inner membrane vesicles can be selected and used without limitation. In the present invention, if the recombinant microorganism for producing hydrophobic substances is a microorganism lacking an inner membrane vesicle system, it may be characterized by the introduction of another inner membrane vesicle system gene derived from a different eukaryotic or prokaryotic organism that forms the inner membrane. In the present invention, if the recombinant cell for producing hydrophobic substances innately possesses an inner membrane vesicle system, it may be characterized by the overexpression of the inner membrane vesicle gene of the cell itself, or the introduction of another inner membrane vesicle system gene derived from a different eukaryotic or prokaryotic organism together with it.

[0065] In the present invention, the endomembrane vesicle-related gene may be a gene of the caveola system or the clathrin-epsin system derived from eukaryotic cells, or may be a gene of the mgs-dgs system derived from prokaryotic cells, and more specific examples may be selected from the group consisting of cav1 (Caveolin-1), cav2 (Caveolin-2), cav3 (Caveolin-3), EPN1 (Epsin1), CLINT1 (EpsinR), CLTC (clathrin heavy chain 1), CLTCL1 (clathrin heavy chain 2), CLTA (clathrin light chain A), CLTB (clathrin light chain B), AP180, AP2, almgs (1,2-diacylglycerol 3-glucosyltransferase), aldgs (1,2-diacylglycerol-3-glucose (1-2)-glucosyltransferase producing diglucosyldiacylglycerol), and combinations thereof, but are not limited thereto. It is not.

[0066] In the present invention, in the case of recombinant E. coli that produce carotenoid pigments such as Astaxanthin, β and Zeaxanthin, the cav1 gene may be introduced or overexpressed.

[0067] In the present invention, in the case of recombinant E. coli that produces violacein or an analog thereof (Proviolacein, prodeoxyviolacein, deoxyviolacein), the cav1 gene may be introduced or overexpressed.

[0068] In the present invention, the genes related to the inner membrane vesicles can be appropriately modified or selected depending on the microorganism used and the hydrophobic substance to be produced.

[0070] In one embodiment of the present invention, it was confirmed that combining the inhibition of cell morphology-related gene expression, inhibition of cell outer membrane vesicle-related gene expression, and introduction of cell inner membrane gene exhibits a synergistic effect, resulting in a more significant increase in yield.

[0071] In the present invention, the characteristics of increased cell membrane area; increased formation and secretion of extracellular membrane vesicles; and increased formation of extracellular membrane vesicles may be combined according to the type of recombinant microorganism, the type and amount of hydrophobic substance to be produced, expression conditions, etc., to be characterized as cell membrane engineering.

[0072] In the present invention, the inhibition of expression of genes related to cell shape, inhibition of expression of genes related to extracellular membrane vesicles, and introduction or overexpression of genes related to extracellular membrane vesicles can be combined depending on the type of recombinant microorganism, the type and amount of hydrophobic material to be produced, expression conditions, etc., and can be combined among genes belonging to each related gene.

[0073] In the present invention, the recombinant microorganism is

[0074] i) any one or more genes selected from the group consisting of mrdB, rffD, rfaD, and rfaI are repressed or knocked down; and / or

[0075] ii) It may be characterized by the introduction or overexpression of the cav1 gene.

[0076] The combinations of inhibition and introduction / introduction of genes that exhibited the most superior yield in each recombinant microorganism for hydrophobic substance production identified in one embodiment of the present invention are as follows:

[0077] Astaxanthin: rffD & rfaD knockdown (OMV)

[0078] Beta-carotene: rffD & rfaD Knockdown (OMV)

[0079] Zeaxanthin: rffD & rfaD knockdown (OMV)

[0080] Proviolacein: rfaI knockdown & cav1 overexpression (OMV & IMV)

[0081] Prodeoxyviolacein: rfaI knockdown (OMV)

[0082] Violacein: rfaI knockdown & cav1 overexpression (OMV & IMV)

[0083] Deoxyviolacein: rfaI knockdown & cav1 overexpression (OMV & IMV).

[0084] Accordingly, in the present invention, for recombinant microorganisms that produce carotenoid pigment groups, it is most preferable to simultaneously inhibit the expression of rfaD and rffD, but is not limited thereto.

[0085] In the present invention, for recombinant microorganisms that produce violacein and analogs thereof, it is most preferable to suppress the expression of rfaI and simultaneously introduce or induce overexpression of the cav1 gene, but is not limited thereto.

[0086] The recombinant strain for producing hydrophobic substances according to the present invention may be characterized by having one or more of the following features: increased cell membrane area; increased formation and secretion of extracellular membrane vesicles; and increased formation of extracellular membrane vesicles.

[0087] In one embodiment of the present invention, the expression of the lipid synthase gene plsBC was amplified to facilitate the supply of lipids in accordance with the increase in cell membrane area, the increase in extracellular membrane vesicle formation and secretion, and the increase in intracellular membrane vesicle formation, and a significant increase in the production capacity of carotenoid pigments was confirmed in particular.

[0088] In the present invention, the recombinant microorganism for producing the hydrophobic material may be additionally characterized by overexpressing a lipid synthase gene.

[0089] For example, if the microorganism is E. coli, the overexpression of the lipid synthase gene may be characterized as the overexpression of the plsBC gene.

[0091] The term “gene expression inhibition” as used in the present invention refers to causing the loss of function of a gene by inhibiting or regulating the transcription or translation of a target gene, thereby reducing or blocking the expression of the coding protein or causing the protein to malfunction. In the present invention, the inhibition may be used interchangeably with knockdown. In the present invention, the expression of genes related to cell morphology may be inhibited to increase cell membrane area, and the expression of genes related to maintaining the structure of the outer membrane / peptidoglycan, genes expressing outer membrane proteins, and genes related to cell membrane metabolic pathways may be inhibited to increase the formation and secretion of outer membrane vesicles. In the present invention, the inhibition of gene expression may be performed through various conventionally known methods. For example, gene editing using restriction enzymes, ZFNs, TALENs, or CRISPR / Cas; antisense oligonucleotides (Nature Reviews. Drug Discovery. 11 (2): 125-40). Gene expression can be suppressed through ribozymes (Ribozyme, Human Molecular Genetics. 7 (10): 1649-1653); RNA interference techniques using siRNA, miRNA, shRNA, etc., and synthetic regulatory sRNA (Na et al., Nat Biotechnol 2013, 31(2):170-174), but is not limited thereto.

[0092] The term “gene introduction” as used in the present invention refers to the new introduction of a target gene or a vector containing the same into a target cell or microorganism. In one embodiment of the present invention, the gene introduction involved introducing a natural pigment-coding gene into E. coli using a plasmid vector to construct a natural pigment-producing strain, and introducing a cell endometrium vesicle-related gene into a recombinant microorganism using a plasmid vector to promote endometrium vesicle formation. In the present invention, the gene may be introduced into the recombinant microorganism through various conventionally known methods. In the present invention, the introduction is preferably performed by introducing the gene into the microorganism using a vector, but is not limited thereto. In the present invention, the gene may be directly introduced into the genome of a host cell and exist as a chromosomal factor. It will be obvious to those skilled in the art to which the present invention pertains that inserting the gene into the genomic chromosome of a host cell will produce the same effect as introducing a recombinant vector into the host cell.

[0093] The term “overexpression” of a gene in the present invention means that the expression of a gene is increased compared to a non-modified microorganism, leading to an increase in the intracellular concentration of ribonucleic acid, protein, or enzyme compared to a non-modified microorganism. A person skilled in the art may select and perform various conventionally known methods for gene overexpression without limitation.

[0094] Conventionally known techniques for overexpression include, for example,

[0095] - Increasing the copy number of a gene in microorganisms; the gene is coded either chromosomally or extrachromosomally. If the gene is located on a chromosome, multiple copies of the gene can be introduced onto the chromosome by recombination methods (including gene replacement) known to experts in the relevant art. If the gene is located extrachromosomally, it can be retained in the cell by different types of plasmids with different replication origins and consequently different copy numbers. These plasmids exist in microorganisms in amounts ranging from 1 to 5 copies, or about 20 copies, or up to 500 copies, depending on the nature of the plasmid: low-copy number plasmids with dense replication (pSC101, RK2), low-copy number plasmids (pACYC, pRSF1010), or high-copy number plasmids (pSK bluescript II).

[0096] - Using promoters that lead to high levels of gene expression; for example, promoters Ptrc, Ptac, Plac, or lambda promoters PR and PL may be widely used, but are not limited thereto. These promoters may be "inducible" by specific compounds or by specific external conditions such as temperature or light. These promoters may be homologous or heterologous.

[0097] - Attenuating the activity or expression of specific or non-specific transcriptional repressors of genes;

[0098] - Using corresponding messenger RNA stabilizing elements (Carrier and Keasling, 1999) or protein stabilizing elements (e.g., GST tag, GE Healthcare);

[0099] - Changes to the sequence of the 5' untranslated region (5' UTR) may be made, but are not limited to this.

[0101] In the present invention, the term "vector" refers to a nucleic acid product containing a nucleic acid sequence operably linked to a suitable expression control sequence capable of expressing a gene within a suitable host. A vector may be a plasmid, a phage particle, or simply a potential genomic insert. Upon transformation into a suitable host, the vector may replicate and function independently of the host genome, or in some cases, be incorporated into the genome itself. Since plasmids are the most commonly used form of vector currently, "plasmid" and "vector" are sometimes used interchangeably in the specification of the present invention. However, the present invention includes other forms of vectors having functions equivalent to those known or to be known in the art. Protein expression vectors used in E. coli include the pET, pCDF, pRSF, pACYC, and pCOLA series of Novagen (USA); the pBAD series of Invitrogen (USA); pHCE or pCOLD of Takara (Japan); and the pACE series of Genofocus (South Korea). The pTac15K, pTrc99A, pTacCDFS, and pTrcCDFS series from KAIST (South Korea); and the pBBR1MCS series, which is applicable across a wide range of strains, can be used. In Bacillus subtilis, protein expression can be achieved by inserting a target gene into a specific part of the genome, or vectors from the pHT series from MoBiTech (Germany) can be used. Protein expression is also possible in fungi and yeasts using genome insertion or self-replication vectors. Protein expression vectors for plants can be used by utilizing T-DNA systems such as those of Agrobacterium tumefaciens or Agrobacterium rhizogenes. Typical expression vectors for mammalian cell culture expression are based, for example, on pRK5 (EP 307,247), pSV16B (WO 91 / 08291), and pVL1392 (Pharmingen).

[0102] The term "expression control sequence" refers to a DNA sequence essential for the expression of a coding sequence operably linked in a specific host organism. Such control sequences include a promoter for carrying out transcription, an optional operator sequence for regulating such transcription, a sequence coding for a suitable mRNA ribosome binding site, and a sequence regulating the termination of transcription and translation. For example, a control sequence suitable for prokaryotes includes a promoter, optionally an operator sequence, and a ribosome binding site. For eukaryotes, it includes a promoter, a polyadenylation signal, and an enhancer. The factor that most influences the amount of gene expression in a plasmid is the promoter. For high expression, SRα promoters and cytomegalovirus-derived promoters are preferably used.

[0103] To express the DNA sequence of the present invention, any of the very diverse expression regulatory sequences may be used in the vector. Examples of useful expression regulatory sequences include, in addition to the promoters described above, early and late promoters of SV40 or adenovirus, the lac system, the trp system, the TAC or TRC system, T3 and T7 promoters, the major operator and promoter regions of phage lambda, the regulatory regions of fd code proteins, promoters for 3-phosphoglycerate kinase or other glycolytic enzymes, promoters of said phosphatase, e.g., Pho5, promoters of the yeast alpha-mating system, and other sequences of configuration and induction known to regulate the expression of genes in prokaryotic or eukaryotic cells or viruses thereof, and various combinations thereof. The T7 RNA polymerase promoter Φ can be usefully used to express proteins in E. coli.

[0104] Of course, it must be understood that not all vectors and expression regulatory sequences function equally in expressing the DNA sequence of the present invention. Likewise, not all hosts function equally for the same expression system. However, those skilled in the art can make appropriate selections among various vectors, expression regulatory sequences, and hosts without departing from the scope of the present invention and without excessive experimental burden. For example, when selecting a vector, the host must be considered, as the vector must be replicated within it. The copy number of the vector, the ability to regulate the copy number, and the expression of other proteins encoded by said vector, such as antibiotic markers, must also be considered. When selecting an expression regulatory sequence, various factors must also be considered. For example, the relative strength of the sequence, its modulation capabilities, and compatibility with the DNA sequence of the present invention, particularly in relation to potential secondary structures, must be taken into account. A unicellular host must be selected by considering factors such as the selected vector, the toxicity and secretion characteristics of the product encoded by the DNA sequence of the present invention, the ability to accurately fold the protein, culture and fermentation requirements, and the ease of purifying the product encoded by the DNA sequence of the present invention from the host. Within the range of these variables, a person skilled in the art may select various vector / expression control sequence / host combinations capable of expressing the DNA sequence of the present invention in fermentation or large-scale animal culture. Binding methods, panning methods, film emulsion methods, etc., may be applied as screening methods when attempting to clone cDNA by expression cloning.

[0105] In the above vector, nucleic acids are "operably linked" when positioned in a functional relationship with other nucleic acid sequences. This may be a gene and regulatory sequence(s) linked in such a way that a suitable molecule (e.g., a transcription-activating protein) enables gene expression when it binds to the regulatory sequence(s). For example, DNA for a pre-sequence or secretion leader is operably linked to DNA for a polypeptide when expressed as a pre-sequence protein participating in the secretion of the polypeptide; a promoter or enhancer is operably linked to a coding sequence when it influences the transcription of the sequence; or a ribosome binding site is operably linked to a coding sequence when it influences the transcription of the sequence; or a ribosome binding site is operably linked to a coding sequence when positioned to facilitate translation. Generally, "operably linked" means that the linked DNA sequences are in contact, and in the case of a secretion leader, they are in contact and exist within the reading frame. However, an enhancer does not need to be in contact. The linkage of these sequences is performed by ligation at a convenient restriction enzyme site. If such a site is not present, a synthetic oligonucleotide adaptor or linker is used according to conventional methods.

[0106] The above-mentioned recombinant vector may be introduced into a host cell by means such as transformation or transfection. As used herein, the term "transformation" means the introduction of DNA into a host so that the DNA becomes replicable as an extrachromosomal factor or through the completion of chromosomal integration. As used herein, the term "transfection" means the acceptance of an expression vector by a host cell, regardless of whether any coding sequence is actually expressed.

[0107] As is well known in the art, in order to increase the expression level of a transfected gene in recombinant cells, the gene must be operably linked to transcriptional and translational expression regulatory sequences that function within a selected expression host. Preferably, the expression regulatory sequence and the gene are contained within a single expression vector that includes both a bacterial selection marker and a replication origin. If the expression host is a eukaryotic cell, the expression vector may further include expression markers useful within the eukaryotic expression host.

[0108] In the present invention, prokaryotic cells such as Escherichia coli and Bacillus subtilis have been widely used as microorganisms for the production of hydrophobic substances, as they allow for high-concentration cell culture within a short period of time, are easy to genetically modify, and have well-established genetic and physiological characteristics. In addition to the aforementioned prokaryotic cells, higher organisms such as yeast lineages (Pichia pastoris, Saccharomyces cerevisiae, Hansenula polymorpha, etc.), filamentous fungi, insect cells, plant cells, and mammalian cells have recently been utilized as host cells for the production of recombinant proteins to solve problems regarding post-translational modification of proteins, secretion processes, the three-dimensional structure of the active form, and the active state of proteins. Therefore, using other host cells in addition to the Escherichia coli or recombinant microorganisms exemplified in the examples is easily applicable to those skilled in the art. For example, CHO cell lines, HEK cell lines, etc., may be used as host cells for expression, but are not limited thereto.

[0109] In the present invention, a wide variety of microorganism / host cell and vector combinations may be used. Expression vectors suitable for eukaryotic hosts include, for example, expression regulatory sequences derived from SV40, bovine papillomavirus, adenovirus, adeno-associated virus, cytomegalovirus, and retrovirus. Expression vectors that can be used in bacterial hosts include bacterial plasmids that may be exemplified by those obtained from E. coli, such as pBluescript, pGEX2T, pUC vector, col E1, pCR1, pBR322, pMB9 and their derivatives; broad host range bacterial plasmids such as pBBR1MCS and their derivatives; bacterial plasmids such as pET, pCDF, pRSF, pACYC, pCOLA, pBAD, pHCE, pCOLD, pACE, pTac15K, pTrc99A, pTacCDFS, pTrcCDFS and their derivatives; plasmids with a broader host range such as RP4; phage DNA that may be exemplified by a wide variety of phage lambda derivatives such as λ and λ; and other DNA phages such as M13 and filamentous single-stranded DNA phages. The expression vector useful for yeast cells is the 2μ plasmid and its derivative. The vector useful for insect cells is pVL 941.

[0110] In the present invention, the recombinant microorganism for producing hydrophobic substances refers to a microorganism having the ability to express hydrophobic substances by including an endogenous or exogenous gene encoding a hydrophobic substance. In the case where the gene encoding the hydrophobic substance is an exogenous gene, the expression microorganism may be cell membrane engineered to be recombined to have production capability when introduced into an expression microorganism or expression cell. Various methods for introducing an exogenous gene into a microorganism are known in the past, with non-limiting examples such as "transformation" and "transduction," and a person skilled in the art may select an appropriate method to produce a microorganism that produces hydrophobic substances.

[0111] In the present invention, the recombinant microorganism is preferably Escherichia coli, Rhizobium, Bifidobacterium, Rhodococcus, Candida, Erwinia, Enterobacter, Pasteurella, Mannheimia, Actinobacillus, Aggregatibacter, Xanthomonas, Vibrio, Pseudomonas, Azotobacter, Acinetobacter, Ralstonia, Agrobacterium, Rhodobacter, Zymomonas, Bacillus, Staphylococcus, It may be characterized by being selected from the group consisting of Lactococcus, Streptococcus, Lactobacillus, Clostridium, Corynebacterium, Streptomyces, Bifidobacterium, Cyanobacterium, and Cyclobacterium, but is not limited thereto.

[0112] As used in the present invention, the term "endogenous gene" means that the gene was present in the microorganism prior to any genetic modification. Endogenous genes may be overexpressed by introducing a heterogeneous sequence to add to or replace an endogenous regulatory element, or by introducing one or more complementary copies of the gene into a chromosome or plasmid. Endogenous genes may also be modified to regulate the expression and activity of their corresponding coding proteins. For example, mutations may be introduced into the coding sequence to modify the gene product, or heterogeneous sequences may be introduced to add to or replace an endogenous regulatory element. Regulation of the endogenous gene may result in upregulation and / or enhancement of the activity of the gene product, or alternatively, downregulation and / or reduction of the activity of the endogenous gene product.

[0113] Another method of regulating expression is to replace the gene's endogenous promoter (e.g., a wild-type promoter) with a stronger or weaker promoter to upregulate or downregulate the expression of the endogenous gene. These promoters may be homologous or heterologous. Selecting an appropriate promoter is within the capability of a person skilled in the art.

[0114] Conversely, "exogenous gene" means that a gene has been introduced into a microorganism by means widely known to a person skilled in the art and that such gene does not occur naturally in the microorganism. Exogenous genes may be incorporated into the host chromosome or expressed extrachromosomally by a plasmid or vector. Various plasmids with different replication origins and copy numbers in cells are widely known in the art. These genes may be homologous.

[0115] In the present invention, the term “homologous gene” is not limited to referring to genes having a theoretically common genetic ancestor, but includes genes that have evolved to code for proteins that perform similar functions or have similar structures, even though they may be genetically unrelated. Accordingly, for the purposes of the present invention, the term “functional homologous” relates to the fact that specific enzymatic activity may be provided by a specific protein of an amino acid sequence, as well as by a protein of a similar sequence from another (un)related microorganism.

[0116] By using references provided in Genbanks for known genes, a person skilled in the art can determine equivalent genes in other organisms, bacterial strains, yeasts, fungi, mammals, plants, etc. Such commercial work is advantageously carried out using consensus sequences that can be determined by performing sequence alignment with genes derived from other microorganisms and designing axial neutrality probes for cloning the corresponding genes in other organisms. These commercial methods in molecular biology are widely known to a person skilled in the art.

[0118] In another aspect, the present invention relates to a method for producing a recombinant microorganism for the production of a hydrophobic material, comprising the step of inhibiting one or more genes among a cell shape-related gene and a cell outer membrane vesicle-related gene; and performing cell membrane engineering among the overexpression or introduction of a cell inner membrane vesicle-related gene.

[0119] In the present invention, the cell membrane engineering step may additionally feature increasing the expression of the lipid synthase gene.

[0120] For example, if the microorganism is E. coli, the increase in expression of the lipid synthase gene may be due to additional overexpression of the plsBC gene.

[0121] In the present invention, the recombinant microorganism produced by the above method may be characterized by having one or more of the following features: increased cell surface area; increased formation and secretion of extracellular membrane vesicles; and increased formation of extracellular membrane vesicles.

[0122] The recombinant microorganism produced by the method of the present invention has one or more of the following characteristics: increased cell surface area; increased formation and secretion of extracellular membrane vesicles; and increased formation of extracellular membrane vesicles, thereby significantly improving the production capacity of hydrophobic substances that accumulate on the cell membrane of the recombinant microorganism.

[0123] In the present invention, the cell morphology-related gene may be, for example, a gene involved in cell division or a gene involved in the synthesis or maintenance of the cytoskeleton / cell wall, but is not limited thereto.

[0124] In the present invention, the gene involved in cell division may be, for example, a gene encoding a group of enzymes of prokaryotic origin involved in cell division composed of cell division proteins (e.g., Fts proteins, etc.) and cell division inhibitor proteins (e.g., MinC, MinD, etc.), but is not limited thereto.

[0125] In the present invention, the gene involved in the synthesis or maintenance of the cytoskeleton / cell wall may be a gene encoding a group of prokaryotic enzymes, such as, for example, penicillin-binding protein (PBP), cell shape-determining protein (MreB, MreC, etc.), peptidoglycan D,D-transpeptidase (MrdA, PbpA, etc.), peptidoglycan glycosyltransferase (MrdB, etc.), cytoskeleton protein (RodZ, etc.), but is not limited thereto.

[0126] For example, when the recombinant microorganism is Escherichia coli, the cell shape-related genes include rodZ (Cytoskeleton protein), ftsA (Cell division protein), ftsB (Cell division protein), ftsI (Peptidoglycan D,D-transpeptidase), ftsL (Cell division protein), ftsQ (Cell division protein), ftsW (Probable peptidoglycan glycosyltransferase), ftsZ (Cell division protein), minD (Septum site-determining protein), mrdA (Peptidoglycan D,D-transpeptidase), mrdB (Peptidoglycan glycosyltransferase), mreB (Cell shape-determining protein), mreC (Cell shape-determining protein), zipA (Cell division protein), murE (UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate It may be selected from the group consisting of ligase), pbpC (Penicillin-binding protein 1C), and combinations thereof, but is not limited thereto. In the present invention, when producing deoxyviolacein, it is most preferable to suppress the expression of the mrdB gene.

[0127] In the present invention, the cell outer membrane vesicle-related gene may include any gene capable of enhancing the formation and secretion of cell outer membrane vesicles when inhibited, and may be easily selected according to the recombinant microorganism used.

[0128] In the present invention, the gene related to the outer membrane vesicle may be a gene related to maintaining the outer membrane / peptidoglycan structure, a gene related to expressing outer membrane proteins, or a gene related to the cell membrane metabolic pathway, but is not limited thereto.

[0129] In the present invention, the gene related to the maintenance of the extracellular membrane / peptidoglycan structure may be, for example, a gene encoding a group of prokaryotic enzymes that contribute to the maintenance of the extracellular membrane / peptidoglycan structure, such as lipoprotein (Lpp), Tol-Pal system protein (TolB, Pal, TolA, TolR, etc.), lipopolysaccharide core biosynthesis protein, lipopolysaccharide core heptosyltransferase, lipid A biosynthesis lauroyltransferase, but is not limited thereto.

[0130] In the present invention, the cell outer membrane protein expression gene may be, for example, a gene encoding a group of prokaryotic enzymes that contribute to the expression of cell outer membrane proteins such as outer-membrane protein A (OmpA), outer-membrane protein C (OmpC), outer-membrane protein F (OmpF), OprF (OmpA homologue), envelope protein (RagA, RagB, etc.), but is not limited thereto.

[0131] In the present invention, the genes related to cell membrane metabolic pathways may be, for example, genes encoding a group of prokaryotic cell membrane metabolic pathway enzymes such as quinolone signal (PQS), anti-sigma-E factor, sigma factor H (AlgU), and chaperone-protease (DegP), but are not limited thereto.

[0132] In one embodiment of the present invention, recombinant E. coli was prepared to express natural pigments, and then cell membrane engineering was performed by inhibiting the expression of 26 screened outer membrane vesicle-related genes (Table 7). In the present invention, when the recombinant microorganism is Escherichia coli, the outer membrane vesicle-related genes include rseA (Anti-sigma-E factor), rseB (Sigma-E factor regulatory protein), rffD (UDP-N-acetyl-D-mannosamine dehydrogenase), rffC (dTDP-fucosamine acetyltransferase), rffA (dTDP-4-amino-4,6-dideoxygalactose transaminase), ompR (DNA-binding dual transcriptional regulator), gmhB (D-glycero-beta-D-manno-heptose-1,7-bisphosphate 7-phosphatase), lpxL (Lipid A biosynthesis lauroyltransferase), lpxM (Lipid A biosynthesis myristoyltransferase), ompA (Outer membrane protein), ompC (Outer membrane protein), rfaB (Lipopolysaccharide 1,6-galactosyltransferase), rfaC (Lipopolysaccharide heptosyltransferase 1), rfaD (ADP-L-glycero-D-manno-heptose-6-epimerase), rfaE (Bifunctional protein HldE), rfaG (Lipopolysaccharide core biosynthesis protein), rfaI (Lipopolysaccharide 1,3-galactosyltransferase), rfaJ (Lipopolysaccharide 1,2-glucosyltransferase),rfaK (Lipopolysaccharide 1,2-N-acetylglucosaminetransferase), rfaP (Lipopolysaccharide core heptose(I) kinase), rfaQ (Lipopolysaccharide core heptosyltransferase), rfaY (Lipopolysaccharide core heptose(II) kinase), rfbA (Glucose-1-phosphate thymidyltransferase 1), rffH (Glucose-1-phosphate thymidyltransferase 2), wzxE (ECA polysaccharide chain length modulation) protein), and pnp (Polyribonucleotide nucleotidyltransferase), tolA (colicin import membrane protein), tolB (Tol-Pal system periplasmic protein), tolC (outer membrane protein), tolR (biopolymer transport protein), nlpI (lipoprotein), nlpD (murein hydrolase activator), ompF (outer membrane pore protein), pal (peptidoglycan-associated outer membrane lipoprotein), degS (serine endoprotease), degP (serine endoprotease), tatC (sec-independent protein translocase protein), lpp (murein lipoprotein) and combinations thereof may be selected from the group consisting of, but are not limited to,

[0134] In the present invention, if the recombinant microorganism for producing hydrophobic substances is a microorganism lacking an inner membrane vesicle system, it may be characterized by introducing an inner membrane vesicle system gene derived from another eukaryotic or prokaryotic organism that forms the inner membrane. In the present invention, if the recombinant cell for producing hydrophobic substances naturally possesses an inner membrane vesicle system, it may be characterized by overexpressing the inner membrane vesicle gene of the cell itself, or introducing an inner membrane vesicle system gene derived from another eukaryotic or prokaryotic organism together with it. In the present invention, the endomembrane vesicle-related gene may be a gene of the caveola system or the clathrin-epsin system derived from eukaryotic cells, or may be a gene of the mgs-dgs system derived from prokaryotic cells, and more specific examples may be selected from the group consisting of cav1 (Caveolin-1), cav2 (Caveolin-2), cav3 (Caveolin-3), EPN1 (Epsin1), CLINT1 (EpsinR), CLTC (clathrin heavy chain 1), CLTCL1 (clathrin heavy chain 2), CLTA (clathrin light chain A), CLTB (clathrin light chain B), AP180, AP2, almgs (1,2-diacylglycerol 3-glucosyltransferase), aldgs (1,2-diacylglycerol-3-glucose (1-2)-glucosyltransferase producing diglucosyldiacylglycerol), and combinations thereof, but are not limited thereto. It is not.

[0135] In the present invention, the recombinant microorganism is Escherichia coli, Rhizobium, Bifidobacterium, Rhodococcus, Candida, Erwinia, Enterobacter, Pasteurella, Mannheimia, Actinobacillus, Aggregatibacter, Xanthomonas, Vibrio, Pseudomonas, Azotobacter, Acinetobacter, Ralstonia, Agrobacterium, Rhodobacter, Zymomonas, Bacillus, Staphylococcus, It may be characterized by being selected from the group consisting of Lactococcus, Streptococcus, Lactobacillus, Clostridium, Corynebacterium, Streptomyces, Bifidobacterium, Cyanobacterium, and Cyclobacterium.

[0137] In another aspect, the present invention relates to a method for producing a hydrophobic substance comprising the steps of: culturing a recombinant microorganism for producing a hydrophobic substance according to the present invention or a recombinant microorganism for producing a hydrophobic substance prepared by the above method to produce a hydrophobic substance; and obtaining the produced hydrophobic substance.

[0138] In the present invention, the step of producing a hydrophobic substance by culturing a recombinant microorganism for producing a hydrophobic substance can be performed without limitation using various conventionally known microorganism culture methods, and the culture medium, culture conditions (temperature, time, physical conditions), etc., can be appropriately selected and performed depending on the strain, the substance to be produced, etc.

[0139] The term “culture” in the present invention refers to culturing microorganisms to produce an intended effect, and the intended effect in the present invention refers to the production of a hydrophobic substance. The culture can generally be carried out in a culture medium having a suitable culture medium adapted to the microorganisms used and containing at least one simple carbon source and, if necessary, a co-substrate.

[0140] In the present invention, the term “culture” can be used interchangeably with “fermentation” in the sense of the production of hydrophobic substances through microbial culture.

[0141] In the present invention, the step of culturing the recombinant microorganism to produce a hydrophobic substance may be characterized by being performed through fed-batch fermentation.

[0142] The terms “batch culture” or “batch fermentation” of the present invention refer to culturing / fermenting by controlling the concentration of the culture medium by intermittently supplying additional medium.

[0143] "Appropriate culture medium" may include a carbon source or carbon substrate, a nitrogen source, e.g., peptone, glucose, glycerol, yeast extract, meat extract, malt extract, urea, ammonium sulfate, ammonium chloride, ammonium nitrate, and ammonium phosphate; a phosphorus source, e.g., monopotassium phosphate or dipotassium phosphate; trace elements (e.g., metal salts), e.g., magnesium salts, cobalt salts, and / or manganese salts; as well as growth factors, such as amino acids and vitamins, nutrients essential or beneficial for the maintenance and / or growth of cells; yeast extracts, antibiotics, etc. In the present invention, the culture may be characterized by being cultured at a temperature within an appropriate range to produce a hydrophobic substance, e.g., 30 to 40°C, preferably 35 to 38°C, but is not limited thereto, and may be cultured under different conditions depending on the species of host microorganism, the substance to be expressed, etc.

[0144] The objective of the present invention is to increase the production capacity of hydrophobic substances accumulated in cell membranes by performing cell membrane engineering, thereby increasing the cell membrane area, the formation and secretion of extracellular membrane vesicles, or the formation of endcellular membrane vesicles. In the embodiments of the present invention, it was confirmed that increasing the cell membrane area through the inhibition of genes related to cell morphology in Escherichia coli, increasing the formation and secretion of extracellular membrane vesicles through the inhibition of genes related to extracellular membrane vesicles, and increasing the formation of endcellular membrane vesicles through the overexpression of genes related to endcellular membrane vesicles resulted in a significant improvement in the production capacity of natural pigments, which are representative hydrophobic substances accumulated in cell membranes. Generally, since hydrophobic substances accumulate in hydrophobic cell membranes or the inner and outer membranes of vesicles, it is evident that this invention can demonstrate an improvement in the production capacity of various hydrophobic substances that can be produced through microorganisms, as well as natural pigments.

[0145] Accordingly, the hydrophobic substance produced by the recombinant microorganism of the present invention may be characterized by accumulating on the cell membrane. For example, the hydrophobic substance may be natural pigments, antioxidants, antibiotics, cosmetic additives, anticancer agents, food additives, and nutritional supplements, but is not limited thereto.

[0146] In the present invention, the natural pigment refers to a pigment that can be obtained from nature without being artificially synthesized or an analogue thereof, such as carotenoids, violacein, etc., and more specific examples include lycopene, β-zeaxanthin, astaxanthin, proviolacein (PVIO), prodeoxyviolacein (PDVIO), deoxyviolacein (DVIO), violacein (VIO), etc., but are not limited thereto.

[0147] The above antioxidant substances include, for example, quercetin, dihydroquercetin, kaempferol, dihydrokaempferol, astaxanthin, resveratrol, tocopherol, tocotrienol, coenzyme Q10, apigenin, etc., but are not limited thereto.

[0148] The above cosmetic additives include, for example, aloesin, vitamin A, ceramide, pantothenate, panthenol, lupeol, squalene, eucalyptol, valencene, etc., but are not limited thereto.

[0149] The above food additives include, for example, carminic acid, β-lycopene, etc., but are not limited thereto.

[0150] The above nutritional supplements include, for example, silymarin, lutein, vitamins, coenzyme-Q10, resveratrol, omega-3 polyunsaturated fatty acids, ubiquinone, glucosamine, luteolin, etc., but are not limited thereto.

[0152] In one embodiment of the present invention, recombinant microorganisms for producing hydrophobic substances according to the present invention were prepared by performing inhibition, introduction, or overexpression of various genes as described above, and it was confirmed that the overall production capacity of hydrophobic substances was maintained or significantly improved, but it was confirmed that the cell membrane engineering of the gene combination exhibiting the most significant improvement in production capacity varied depending on the hydrophobic substance to be produced.

[0153] Since hydrophobic substances exhibit a phenomenon of accumulation in cell membranes exhibiting the same hydrophobicity, the recombinant microbial method with an engineered cell membrane according to the present invention, which is for improving cell membrane area, increasing the formation and secretion of extracellular membrane vesicles, and increasing the formation of extracellular membrane vesicles, can demonstrate improved production capacity of hydrophobic substances.

[0154] Accordingly, microorganisms for producing hydrophobic substances through cell membrane engineering of the present invention can be constructed into a library through the inhibition, introduction, or overexpression of various gene combinations, and screening strains exhibiting excellent production capacity for specific hydrophobic substances using said library can be useful in terms of cost, procedure, and time for the selection and development of recombinant strains with improved production capacity for hydrophobic substances.

[0155] Accordingly, in another aspect, the present invention relates to a library of microorganisms for producing hydrophobic substances by performing cell membrane engineering through one or more means of inhibiting the expression of a cell shape-related gene in a microorganism for producing hydrophobic substances; inhibiting the expression of a cell outer membrane vesicle-related gene; and introducing or overexpressing a cell inner membrane vesicle-related gene.

[0156] In another aspect, the present invention,

[0157] (a) generating a library of microorganisms for producing hydrophobic substances by performing cell membrane engineering through one or more means of inhibiting the expression of a cell morphology-related gene in a microorganism for producing hydrophobic substances; inhibiting the expression of an outer membrane vesicle-related gene; and introducing or overexpressing an inner membrane vesicle-related gene; and

[0158] (b) A screening method for cell membrane-engineered recombinant microorganisms with increased production capacity of a specific hydrophobic substance, comprising the step of culturing the microorganisms for producing the hydrophobic substance to select recombinant microorganisms with excellent production capacity of a specific hydrophobic substance.

[0159] The present invention is characterized by the ability to produce a library for producing hydrophobic substances having the characteristics of increased cell membrane area, increased formation and secretion of extracellular membrane vesicles, and / or increased formation of extracellular membrane vesicles through cell membrane engineering via the inhibition or overexpression of related gene groups by utilizing the property of hydrophobic substances accumulating in the cell membrane, and based on this, to screen recombinant strains with enhanced production capacity of specific hydrophobic substances.

[0160] In the present invention, the “library of microorganisms for producing hydrophobic substances” may be one in which the inhibition of expression of a cell shape-related gene; inhibition of expression of a cell outer membrane vesicle-related gene; and introduction or overexpression of a cell inner membrane vesicle-related gene are performed alone or optionally in combination.

[0161] In the present invention, the cell membrane engineering of step (a) may additionally feature that the microbial library for producing hydrophobic substances increases the expression of lipid synthase genes.

[0162] In the present invention, the library may include both the cell morphology-related gene alone and any combination of cell morphology-related genes in which recombinant microorganisms are suppressed.

[0163] In the present invention, the cell shape-related genes may include all genes involved in maintaining the shape of the cell.

[0164] In the present invention, the cell shape-related gene may include any gene that causes the cell shape to change and the cell area to increase when its expression is inhibited, and can be easily selected by a person skilled in the art depending on the recombinant microorganism used.

[0165] In the present invention, the cell morphology-related gene may be, for example, a gene involved in cell division, or a gene involved in the synthesis or maintenance of the cytoskeleton / cell wall, but is not limited thereto.

[0166] In the present invention, the gene involved in cell division may be, for example, an endogenous gene encoding a group of prokaryotic enzymes such as cell division proteins (e.g., Fts proteins, etc.) and cell division inhibitor proteins (e.g., MinC, MinD, etc.), but is not limited thereto.

[0167] In the present invention, the gene involved in the synthesis or maintenance of the cytoskeleton / cell wall may be an endogenous gene encoding a group of prokaryotic enzymes such as, for example, penicillin-binding protein (PBP), cell shape-determining protein (MreB, MreC, etc.), peptidoglycan D,D-transpeptidase (MrdA, PbpA, etc.), peptidoglycan glycosyltransferase (MrdB, etc.), and cytoskeleton protein (RodZ, etc.), but is not limited thereto.

[0168] In the present invention, for example, when the recombinant microorganism used to prepare the library is Escherichia coli, the cell shape-related genes are rodZ (Cytoskeleton protein), ftsA (Cell division protein), ftsB (Cell division protein), ftsI (Peptidoglycan D,D-transpeptidase), ftsL (Cell division protein), ftsQ (Cell division protein), ftsW (Probable peptidoglycan glycosyltransferase), ftsZ (Cell division protein), minD (Septum site-determining protein), mrdA (Peptidoglycan D,D-transpeptidase), mrdB (Peptidoglycan glycosyltransferase), mreB (Cell shape-determining protein), mreC (Cell shape-determining protein), zipA (Cell division protein), and murE It may be selected from the group consisting of (UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase), pbpC (Penicillin-binding protein 1C) and combinations thereof, but is not limited thereto.

[0170] In the present invention, the library may include both the outer membrane vesicle-related gene alone and any combination of outer membrane vesicle-related genes in which recombinant microorganisms are inhibited.

[0171] In the present invention, the extracellular membrane vesicle-related genes may include all genes involved in the formation or secretion of extracellular membrane vesicles.

[0172] In the present invention, the cell outer membrane vesicle-related gene may be characterized as a gene that plays a role in maintaining the peptidoglycan layer of the cell or the connection between the cell outer membrane and the inner membrane.

[0173] In the present invention, the gene related to the outer membrane vesicle may be a gene related to maintaining the outer membrane / peptidoglycan structure, a gene related to expressing outer membrane proteins, or a gene related to the cell membrane metabolic pathway, but is not limited thereto.

[0174] In the present invention, the gene related to the maintenance of the extracellular membrane / peptidoglycan structure may be, for example, a gene encoding a group of prokaryotic enzymes that contribute to the maintenance of the extracellular membrane / peptidoglycan structure, such as lipoprotein (Lpp), Tol-Pal system protein (TolB, Pal, TolA, TolR, etc.), lipopolysaccharide core biosynthesis protein, lipopolysaccharide core heptosyltransferase, lipid A biosynthesis lauroyltransferase, but is not limited thereto.

[0175] In the present invention, the cell outer membrane protein expression gene may be, for example, a gene encoding a group of prokaryotic enzymes that contribute to the expression of cell outer membrane proteins such as outer-membrane protein A (OmpA), outer-membrane protein C (OmpC), outer-membrane protein F (OmpF), OprF (OmpA homologue), envelope protein (RagA, RagB, etc.), but is not limited thereto.

[0176] In the present invention, the genes related to cell membrane metabolic pathways may be, for example, genes encoding a group of prokaryotic cell membrane metabolic pathway enzymes such as quinolone signal (PQS), anti-sigma-E factor, sigma factor H (AlgU), and chaperone-protease (DegP), but are not limited thereto.

[0177] In the present invention, for example, when the recombinant microorganism is Escherichia coli, the extracellular membrane vesicle-related genes are rseA (Anti-sigma-E factor), rseB (Sigma-E factor regulatory protein), rffD (UDP-N-acetyl-D-mannosamine dehydrogenase), rffC (dTDP-fucosamine acetyltransferase), rffA (dTDP-4-amino-4,6-dideoxygalactose transaminase), ompR (DNA-binding dual transcriptional regulator), gmhB (D-glycero-beta-D-manno-heptose-1,7-bisphosphate 7-phosphatase), lpxL (Lipid A biosynthesis lauroyltransferase), lpxM (Lipid A biosynthesis myristoyltransferase), ompA (Outer membrane protein), ompC (Outer membrane protein), rfaB (Lipopolysaccharide 1,6-galactosyltransferase), rfaC (Lipopolysaccharide heptosyltransferase 1), rfaD (ADP-L-glycero-D-manno-heptose-6-epimerase), rfaE (Bifunctional protein HldE), rfaG (Lipopolysaccharide core biosynthesis protein), rfaI (Lipopolysaccharide 1,3-galactosyltransferase), rfaJ (Lipopolysaccharide 1,2-glucosyltransferase), rfaK (Lipopolysaccharide 1,2-N-acetylglucosaminetransferase),rfaP (Lipopolysaccharide core heptose(I) kinase), rfaQ (Lipopolysaccharide core heptosyltransferase), rfaY (Lipopolysaccharide core heptose(II) kinase), rfbA (Glucose-1-phosphate thymidylyltransferase 1), rffH (Glucose-1-phosphate thymidylyltransferase 2), wzxE (ECA polysaccharide chain length modulation protein), and pnp (Polyribonucleotide nucleotidyltransferase), tolA (colicin import membrane protein), tolB (Tol-Pal system periplasmic protein), tolC (outer membrane protein), tolR (biopolymer transport protein), nlpI (lipoprotein), nlpD (murein hydrolase activator), ompF (outer membrane pore) protein), pal (peptidoglycan-associated outer membrane lipoprotein), degS It may be selected from the group consisting of (serine endoprotease), degP (serine endoprotease), tatC (sec-independent protein translocase protein), lpp (murein lipoprotein), and combinations thereof, but is not limited thereto.

[0179] In the present invention, the library may include both the cell membrane vesicle-related gene alone and any combination of cell membrane vesicle-related genes in which recombinant microorganisms are inhibited.

[0180] In the present invention, “inner membrane vesicle-related genes” may include all genes involved in the formation of inner membrane vesicles.

[0181] In the present invention, the endometrium vesicle-related gene may be selected and used without limitation as long as it is a gene that enhances the formation of endometrium vesicles. In the present invention, if the recombinant microorganism for producing hydrophobic substances is a microorganism lacking an endometrium vesicle system, the library may be characterized by introducing an endometrium vesicle system gene derived from another eukaryotic or prokaryotic organism that forms an endometrium.

[0182] In the present invention, when the recombinant microorganism for producing hydrophobic substances naturally includes an endometrium vesicle system, the invention may be characterized by overexpressing a gene related to the endometrium vesicle, or introducing another endometrium vesicle system gene derived from a different eukaryotic or prokaryotic organism together with it.

[0183] In the present invention, the endomembrane vesicle-related gene may be a gene of the caveola system or the clathrin-epsin system derived from eukaryotic cells, or may be a gene of the mgs-dgs system derived from prokaryotic cells, and more specific examples may be selected from the group consisting of cav1 (Caveolin-1), cav2 (Caveolin-2), cav3 (Caveolin-3), EPN1 (Epsin1), CLINT1 (EpsinR), CLTC (clathrin heavy chain 1), CLTCL1 (clathrin heavy chain 2), CLTA (clathrin light chain A), CLTB (clathrin light chain B), AP180, AP2, almgs (1,2-diacylglycerol 3-glucosyltransferase), aldgs (1,2-diacylglycerol-3-glucose (1-2)-glucosyltransferase producing diglucosyldiacylglycerol), and combinations thereof, but are not limited thereto. It is not.

[0185] In the present invention, the library of the hydrophobic production microorganism may be characterized by comprising a recombinant microorganism in which any one gene selected from the group consisting of cell morphology-related genes, cell outer membrane vesicle-related genes and cell inner membrane vesicle-related genes, or any combination of these genes, is inhibited, introduced, or overexpressed.

[0187] In the present invention, the library of microorganisms for hydrophobic production may include a single genus or a single species of microorganism, or may include a mixture of microorganisms of different genera or species.

[0188] In the present invention, the library of hydrophobic production microorganisms comprises Escherichia coli, Rhizobium, Bifidobacterium, Rhodococcus, Candida, Erwinia, Enterobacter, Pasteurella, Mannheimia, Actinobacillus, Aggregatibacter, Xanthomonas, Vibrio, Pseudomonas, Azotobacter, Acinetobacter, Ralstonia, Agrobacterium, Rhodobacter, Zymomonas, Bacillus, and Staphylococcus It may be characterized by including microorganisms selected from the group consisting of Staphylococcus, Lactococcus, Streptococcus, Lactobacillus, Clostridium, Corynebacterium, Streptomyces, Bifidobacterium, Cyanobacterium, Cyclobacterium, and combinations thereof.

[0189] In the present invention, a library of microorganisms for producing hydrophobic substances may be characterized by having one or more of the following features: increased cell membrane area; increased formation and secretion of extracellular membrane vesicles; and increased formation of extracellular membrane vesicles.

[0191] Examples

[0192] The present invention will be described in more detail below through specific embodiments. However, the present invention is not limited by the following embodiments, and it is obvious to those skilled in the art that various modifications or variations may be made within the idea and scope of the present invention.

[0193] Example 1: Construction of a natural pigment-producing strain

[0194] Example 1-1: Construction of a carotenoid-producing strain

[0195] Carotenoids are responsible for the red, orange, and yellow light in the rainbow spectrum; among the various carotenoids, β-zeaxanthin and astaxanthin are representative, emitting orange, yellow, and red light, respectively. Prior to establishing E. coli strains that produce these three carotenoids, strains that produce lycopene, their precursor, were first established. Since E. coli can naturally produce farnesyl diphosphate through the 1-deoxy-D-xylulose 5-phosphate pathway, the introduction of three genes—crtE, crtB, and crtI—is necessary for the production of lycopene, which is located at the forefront of the carotenoid synthesis pathway (Fig. 1). To prevent the accumulation of unnecessary precursors and to balance metabolic flow, various combinations of expression levels for each gene were screened. Expression levels were regulated by modifying the sequence of the 5' untranslated region (5' UTR) (Fig. 2A). A 5' UTR sequence library was constructed for each gene using a UTR library designer program and consisted of a total of 16 5' UTR sequences. A pLYC library was constructed by combining each gene with 16 different 5' UTR sequences fused and introducing them into the pTac15K plasmid. To construct the pLYC library, the pTac15K plasmid was first linearized by PCR amplification using primers [Sequence No. 1] and [Sequence No. 2]. Next, the crtE, crtB, and crtI genes were introduced into pCar184 (Choi et al.After PCR amplification of the plasmid [Sequence No. 3] and [Sequence No. 4], [Sequence No. 5] and [Sequence No. 6], and [Sequence No. 7] and [Sequence No. 8], respectively, with primers [Sequence No. 8], they were cloned into the linearized pTac15k plasmid via Gibson assembly.

[0196] Primers used to construct the lycopene-producing strain name order Sequence number pTac15K Plasmid-Primer (Forward) CTTGGCTGTTTTGGCGGATG 1 pTac15K Plasmid-Primer (Reverse) TGTTTCCTGTGTGAAATTGTTATCCGCTC 2 crtE Primer (Forward) ATAACAATTT CACACAGGAA ACACGYTCMG CGGAAAGRAG CATCGWCCAT GTATCCGTTT ATAAGGACA 3 crtE Primer (Reverse) TTAACTGACGGCAGCGAGTT 4 crtB Primer (Forward) CGCTGCCGTC AGTTAAARCC TTGTTCAAAG GMSYATCTAG GATGAATAAT CCGTCGTTAC T 5 crtB Primer (Reverse) TTCGAACGGTTCTTAGAGCGGGCGCTGCCA 6 crtI primer (Forward) GCTCTAAGAACCGTTCGAAWGSAGCRTMCAAGATGAAACCAACTACGGTAAT 7 crtI primer (Reverse) CGCCAAAACAGCCAAGTTAAATCAGATCCTCCAGC 8

[0197] After introducing the constructed pLYC library into the E. coli WLGB-RPP strain developed in our research team's previous study, 200 colonies exhibiting particularly deep colors were selected from among colonies 10 times the size of the pLYC library. These were then cultured in test tubes, and the produced lycopene was extracted to compare the absorbance at 474 nm. Among them, the top 10 strains were additionally cultured in flasks, and the LYC79 strain produced the highest amount of lycopene at 23.90 mg / L.

[0198] Based on the selected LYC79 strain, β-zeaxanthin and astaxanthin-producing strains were constructed using the same method. First, the crtY gene is additionally required to produce β from lycopene, the crtZ gene to produce zeaxanthin from β, and the BKT gene to produce astaxanthin from zeaxanthin. For each of these genes, a 5' UTR library consisting of 16 different 5' UTR sequences was constructed and fused to the 5' end of the gene.

[0199] To construct the pBTC library, the pTrcCDFS plasmid was first linearized by PCR amplification using primers [SEQ No. 9] and [SEQ No. 10]. crtY, amplified by PCR from the pCar184 plasmid using primers [SEQ No. 11] and [SEQ No. 12], was cloned into the linearized pTrcCDFS via Gibson assembly. To construct the pZEA library, crtY and crtZ, amplified by PCR from pCar184 using primers [SEQ No. 11] and [SEQ No. 13], and [SEQ No. 14] and [SEQ No. 15], respectively, were cloned into the linearized pTrcCDFS via Gibson assembly. To construct the pATX library, trCrBKT, PCR-amplified from the pAX1 (Park et al., Metab Eng 2018, 49:105-115) plasmid using primers [Sequence No. 16] and [Sequence No. 17], was inserted into the SalI / HindIII site of pZEA.

[0200] Primers used to construct β-carotene, zeaxanthin, and astaxanthin-producing strains name order Sequence number pTrcCDFS Plasmid-Primer (Forward) 5'-TCTAGAGTCGACCTGCAG-3' 9 pTrcCDFS Plasmid-Primer (Reverse) 5'-TCTGTTTCCTGTGTGAAATT-3' 10 crtY Primer (Forward) 5'-CAATTTCACA CAGGAAACAG ACCTTCCTCC AWAAGRAGCA TCMASTATGG GAGCGGCTAT G-3' 11 crtY Primer 1 (Reverse) 5'-GCAGGTCGACTCTAGATTAACGATGAGTCGTCATAA-3' 12 crtY Primer 2 (Reverse) 5'-TTAACGATGAGTCGTCATAA-3' 13 crtZ Primer (Forward) 5'-CATTATGACG ACTCATCGTT AAAGTACATC CGAMMGSAGC ATCCTTKATG TTGTGGATTT GGAATGC-3' 14 crtZ Primer (Reverse) 5'-GCAGGTCGACTCTAGATTACTTCCCGGATGC-3' 15 trCrBKT Primer Forward) 5'-AGACAGGTCGACKCCACCCCGCAAAGGAGSATCGKCRATGGGTCCGGGCATC-3' 16 trCrBKT Primer (Reverse) 5'-AGACAGAAGCTTTTACGCCAGCGCCGC-3' 17

[0202] The constructed pBTC, pZEA, and pATX libraries were introduced into the LYC79 strain, and 20, 40, and 200 colonies, respectively, were visually selected and cultured in test tubes. The produced β-zeaxanthin and astaxanthin were extracted with acetone, and their absorbances were measured at wavelengths of 473, 452, and 475 nm to compare their production concentrations. At this time, since the color of astaxanthin could not be distinguished from its precursor, canthaxanthin, by visual inspection or absorbance measurement, additional HPLC analysis was performed on the top 50 strains based on absorbance measurements. Flask cultures were performed on the 3, 5, and 10 strains that produced the most β-zeaxanthin and astaxanthin in test tube cultures, and strains BTC1, ZEA20, and ATX68 showed the highest production of 18.65 mg / L β-zeaxanthin and 12.67 mg / L zeaxanthin and 14.49 mg / L zeaxanthin, respectively, and were selected as the final strains (Fig. 2).

[0204] 1-2. Construction of a strain producing a violacein analog

[0205] To complete the rainbow spectrum following carotenoids, our research team aimed to produce violacein analogs. Violacein analogs are classified as bis-indole pigments, produced by bacteria such as Chromobacterium violaceum and Janthinobacterium lividum, and are known to possess various pharmacological effects, including anticancer effects. Therefore, our research team constructed biosynthetic pathways to produce four types of violacein analogs: prodeoxyviolacein, proviolacein, deoxyviolacein, and violacein (Fig. 1, Fig. 3A), and observed the colors of the substances produced therefrom (Fig. 3G). Since our research team had already established a strain overproducing tryptophan, a common precursor of violacein analogs, from previous studies (IND5 harboring pTacGEL), we constructed basic strains for producing violacein analogs by transforming these strains with plasmids that introduced the pTacCDFS vector-based violacein analog biosynthetic pathway.

[0206] First, the pTacCDFS plasmid was used as the base vector, and the plasmid was linearized by performing a reverse PCR reaction using primers [SEQ No. 18] and [SEQ No. 19]. Subsequently, the vioAB gene was split into two gene fragments and amplified; the first fragment was amplified using [SEQ No. 20] and [SEQ No. 21], and the second fragment using [SEQ No. 22] and [SEQ No. 23]. These two DNA fragments were cloned with the previously linearized plasmid via Gibson assembly to construct the pTacCDFS-vioAB plasmid. Using the same method, the pTacCDFS-vioC, pTacCDFS-vioD, pTacCDFS-vioCD, and pTacCDFS-vioE plasmids were constructed. The genes vioC, vioD, vioCD, and vioE were PCR amplified using primer pairs [Sequence No. 24] and [Sequence No. 25], [Sequence No. 26] and [Sequence No. 27], [Sequence No. 24] and [Sequence No. 27], and [Sequence No. 28] and [Sequence No. 29], respectively. The plasmid pPDVIO (pTacCDFS-vioABE) for the production of prodeoxyviolacein (PDVIO) was constructed as follows. Using the pTacCDFS-vioE plasmid as a template, the vioE gene fragment was amplified using primers [Sequence No. 30] and [Sequence No. 31], and inserted into the SacI site of the pTacCDFS-vioAB plasmid. The pPVIO (pTacCDFS-vioABDE), pDVIO (pTacCDFS-vioABCE), and pVIO (pTacCDFS-vioABCDE) plasmids for producing proviolacein (PVIO), deoxyviolacein (DVIO), and violacein (VIO), respectively, were constructed as follows.Using each plasmid pTacCDFS-vioC, pTacCDFS-vioD, and pTacCDFS-vioCD as a template, [Sequence No. 32] and [Sequence No. 31] were used as common primers to amplify each gene fragment vioC, vioD, and vioCD. The amplified genes were inserted into the SacI site of the pTacCDFS-vioABE plasmid to complete the pDVIO (pTacCDFS-vioABCE), pPVIO (pTacCDFS-vioABDE), and pVIO (pTacCDFS-vioABCDE) plasmids.

[0207] Primers used to construct the violacein analog-producing strain name order Sequence number pTacCDFS Plasmid Primer (Forward) 5'-TGGAATTCGAGCTCGGTACC-3' 18 pTacCDFS Plasmid Primer (Reverse) 5'-TTCACACAGGAAACAGACCA-3' 19 vioAB Primer (Forward) 5'-CACACAGGAAACAGACCAATGAAGCATTCTTCCGATATCTGC-3' 20 vioAB_mid Primer(Reverse) 5'-GCCAGGCTTCGGAATCGAATG-3' 21 vioAB_mid Primer(Forward) 5'-CATTCGATTCCGAAGCCTGGC-3' 22 vioAB Primer (Reverse) 5'-GGTACCGAGCTCGAATTCCATTATCAGGCCTCTCTAGAAAGCTTTCC-3' 23 vioC Primer (Forward) 5'-CACACAGGAAACAGACCAATGAAAAGAGCAATCATAGTCGG-3' 24 vioC Primer (Reverse) 5'-GGTACCGAGCTCGAATTCCATTATCAGTTGACCCTCCCTATCTTG-3' 25 vioD Primer (Forward) 5'-CACACAGGAAACAGACCAATGAAGATTCTGGTCATCGGC-3' 26 vioD Primer (Reverse) 5'-GGTACCGAGCTCGAATTCCATTATCAGCGTTGCAGCGCGTAG-3' 27 vioE Primer (Forward) 5'-CACACAGGAAACAGACCAATGGAAAACCGGGAACCGCC-3' 28 vioE Primer (Reverse) 5'-GGTACCGAGCTCGAATTCCATTACTAGGCGCTTGGCGGCGAAG-3' 29 vioE_frag Primer(Forward) 5'-CCTGATAATGGAATTCGAGCTGACTGCACGGTGCACCAATG-3' 30 vioE_frag 프라이머(Reverse) 5'-CAGGTCGACTCTAGAGGATCC-3' 31 vio_frag 프라이머(Forward) 5'-GCTAGTAATGGAATTCGAGCTGACTGCACGGTGCACCAATG-3' 32

[0209] When violacein-producing strains were cultured in flasks using glucose and glycerol as carbon sources, respectively, higher concentrations of violacein were produced when glycerol was used as the carbon source, as shown in Fig. 3b. Accordingly, all violacein analogs utilized glycerol as the carbon source. From the strains constructed as described above, 1.09 g / L of deoxyviolacein was produced when the vioABCE biosynthetic pathway (BGC) was introduced, and 1.36 g / L of violacein and 0.13 g / L of deoxyviolacein were produced when vioABCDE BGC was introduced (Fig. 3D). When vioABE BGC was introduced, prodeoxyviolacein was produced, and when vioABDE BGC was introduced, proviolacein was produced; however, since quantification was impossible due to the absence of standard substances, the values ​​were calculated based on the HPLC calibration table of violacein (Fig. 3C).

[0210] The flask culture conditions were as follows. For carotenoid-producing strains, colonies were inoculated into 3 mL of TB (terrific broth; 20 g tryptone, 24 g yeast extract, 4 mL of glycerol, 0.017 M KH2PO4, and 0.072 M K2HPO4 per liter) medium supplemented with an appropriate concentration of antibiotics, and cultured at 30°C. When the OD600 of the culture reached 1-2, 1 mL of the culture was subcultured into a 250 mL round-bottom flask containing 20 mL of TB medium, and cultured until the OD600 also reached 1-2. For violacein analogs, colonies were inoculated into 10 mL of LB medium supplemented with an appropriate concentration of antibiotics and cultured overnight at 37°C. Subsequently, the prepared carotenoid and violacein analog cultures were subcultured into a 250 mL baffle flask containing 50 mL of R / 2 medium supplemented with 3 g / L yeast extract and 20 g / L glycerol (an additional 3 g / L (NH4)2SO4 for the violacein analog), and incubated at 30°C and 200 rpm. The composition of the R / 2 medium (pH 6.8) is as follows (per liter): 2 g (NH4)2HPO4, 6.75 g KH2PO4, 0.85 g citric acid, 0.7 g MgSO4 4. 7H2O, and 5 ml trace metal solution (TMS) [10 g FeSO 4. 7H2O, 2.25 g ZnSO4.7H2O, 1 g CuSO 4. 5H2O, 0.5 g MnSO 4. 5H2O, 0.23 g Na2B4O7.10H2O, 2 g CaCl 2. 2H2O and 0.1 g (NH4)6Mo7O 24[per liter of 5 M HCl]. When the OD600 of the culture medium reached 0.6-0.8, 1 mM isopropyl β (IPTG) was added to induce foreign gene expression. After induction, the cultures were incubated for 36 hours for carotenoids and 48 hours for violacein analogs.

[0211] After culture, yield analysis was performed under the following conditions. For carotenoids, 1 mL of culture medium was centrifuged to collect cells, the supernatant was removed, and 1 mL of acetone was added. The mixture was then vigorously vortexed at 55°C and 1,500 rpm to extract intracellular substances. Cell debris in the extract was filtered using a centrifuge to obtain the carotenoid extract from the supernatant. For violacein analogs, 50 μL of culture medium (the volume of culture medium added can be adjusted appropriately according to the estimated concentration range; the amount of DMSO added is adjusted so that the total volume is 1 mL) was mixed with 950 μL of dimethylsulfoxide (DMSO), and then vigorously vortexed at 40°C and 1,500 rpm to extract intracellular and extracellular substances. Subsequently, cell debris in the extract was filtered using a centrifuge in the same manner as above to obtain the supernatant violacein analog extract. Quantitative analysis of each extract was performed using HPLC. In the case of violacein analogs without standard substances, authenticity was determined using LC-MS (Figs. 3E to 3F).

[0213] 실시예 2. 세포 형태 엔지니어링을 통한 무지개 색소의 증산

[0214] Carotenoids possess long carbon chains, and violacein analogs possess hydrophobic carbon rings, resulting in hydrophobic properties. Due to these characteristics, when produced in E. coli, carotenoids and violacein analogs tend to accumulate inside the cell, particularly trapped within the cell membrane, rather than exiting the cell. Therefore, the aim was to increase the capacity limit by expanding the cell membrane surface area, thereby enabling the production of these substances in excess. To achieve this, the expression of genes responsible for cell membrane-related metabolic circuits was suppressed. A synthetic regulatory sRNA tool (Na et al., Nat Biotechnol 2013, 31(2):170-174) was utilized to suppress the expression of target genes. Sixteen genes involved in cell division and cell shape maintenance were selected as targets for suppression (Table 4). The target genes were selected based on two criteria; the first criterion was genes related to cell division (ftsABILQWZ, minD, zipA). It is expected that inhibiting cell division will alter cell length (Fig. 4A). The second criterion is genes related to cell wall synthesis or maintenance (rodZ, mrdAB, mreBCE, murE). Since the cell wall determines the rod-shaped form of E. coli, it is expected that inhibiting the expression of genes related to the cell wall will result in a more spherical and irregular cell shape (Fig. 4A). In this embodiment, gene targets expected to be most effective were selected based on the two criteria above, but the scope of the invention is not necessarily limited to this, and other genes corresponding to the two criteria above may also be used as targets.

[0215] 16 types of cell morphology-related genes (cell membrane-related metabolic circuit genes) targets 유전자 단백질 기능 Essentiality* NCBI ID rodZ transmembrane component of cytoskeleton NE 946992 ftsA ATP-binding cell division protein involved in recruitment of FtsK to Z ring E 944778 ftsB cell division protein E 946033 ftsI transpeptidase involved in septal peptidoglycan synthesis E 944799 ftsL membrane bound cell division protein at septum containing leucine zipper motif E 944803 ftsQ membrane anchored protein involved in growth of wall at septum E 944823 ftsW integral membrane protein involved in stabilising FstZ ring during cell division E 946322 ftsZ GTP-binding tubulin-like cell division protein E 944786 minD membrane ATPase of the MinC-MinD-MinE system E 945741 mrdA transpeptidase involved in peptidoglycan synthesis E 945240 mrdB cell wall shape-determining protein E 945238 mreB cell wall structural complex MreBCD, actin-like component MreB E 948588 mreC cell wall structural complex MreBCD transmembrane component MreC E 947655 zipA cell division protein involved in Z ring assembly E 946869 murE UDP-N-acetylmuramoyl-L-alanyl-D-glutamate:meso-diaminopimelate ligase E 944791 pbpC fused transglycosylase and transpeptidase NE 947152

[0216] *E, a gene essential for E. coli cell growth when cultured in minimal medium; NE, a gene not essential for E. coli cell growth when cultured in minimal medium.

[0217] Most of the target genes were essential genes, which clearly demonstrates the necessity of utilizing sRNA technology. In this experiment, tests were conducted using representative β-producing strains and deoxyviolacein-producing strains, and the results are shown in Figures 4B to 4C.

[0218] As can be seen in Figures 4 and 5, in the β-producing strain, when cell membrane-related genes were suppressed, changes in cell morphology were observed, but the production volume actually decreased. On the other hand, in the deoxyviolacein-producing strain, when the expression of the mrdB gene was suppressed, the production volume increased significantly to 1.37 g / L (25% increase in production). When mrdB was suppressed, as expected, the cell length shortened and the cell took on a more spherical shape, and it was found that the cell membrane area actually decreased.

[0219] Example 3. Transpiration of rainbow pigments through the formation of inner membrane vesicles

[0220] To further increase the production of rainbow pigments, the research team sought to introduce endometrial vesicles present in eukaryotic cell systems. Through this, the aim was to increase the production of substances accumulated in the membrane by expanding the membrane surface area inside the cell while maintaining the cell's volume (Fig. 4D). The introduced endometrial vesicle genes specifically borrowed the caveola system from among the endometrial vesicle systems of eukaryotes, which is responsible for the folded shape of the Golgi apparatus or vesicles. First, the cav1, cav2, and cav3 genes were introduced into the pTrc99A plasmid, and then introduced into β- and deoxyviolacein-producing strains, respectively, followed by flask culture. Although the eukaryotic caveola system was borrowed in this example, other eukaryotic or prokaryotic systems that form the endometrium (eukaryotic clathrin-epsin system, prokaryotic mgs-dgs system, etc.) also fall within the same scope as the present invention.

[0221] Each of the cav1 [Sequence No. 36], cav2 [Sequence No. 37], and cav3 [Sequence No. 38] genes was utilized after E. coli codon optimization using gene sequences derived from Homo sapiens. To construct the pTrc99A-cav1 plasmid, the cav1 gene was inserted into the EcoRI and BamHI sites of the pTrc99A plasmid. To construct pTrc99A-cav2 and pTrc99A-cav3, the cav2 and cav3 genes were inserted into the pTrc99A plasmid into the NcoI and BamHI sites, respectively. To construct the pTrc99A-cav12 plasmid (containing both cav1 and cav2), the cav2 gene was amplified using primers [Sequence No. 33] and [Sequence No. 34] and then inserted into the pTrc99A-cav1 plasmid into the BamHI and PstI sites. To construct pTrc99A-cav23 and pTrc99A-cav13, the cav3 gene was amplified using primers [SEQ No. 35] and [SEQ No. 34], and then inserted into the PstI sites of the pTrc99A-cav2 and pTrc99A-cav1 plasmids, respectively. To construct the pTrc99A-cav123 plasmid, the amplified cav3 gene was inserted into the PstI site of the pTrc99A-cav12 plasmid.

[0223] Introduced cell membrane vesicle-related gene and primer sequence name order Sequence number Cav2 Primer (Forward) TTAACTGGATCCTTTTCACACAGGAAACAGACCATGGGGCTTGAGACTGAGAAG 33 Cav Primer (Reverse) CATCCGCCAAAACAGCCAAGCTTG 34 Cav3 Primer (Forward) TTAACTCTGCAGTTTTCACACAGGAAACAGACCATGATGGCCGAAGAGCATACC 35 cav1 atgtctgggg gcaaatacgt agactcggag ggacatctct acaccgttcc catccgggaa cagggcaaca tctacaagcc caacaacaag gccatggcag acgagctgag cgagaagcaa gtgtacgacg cgcacaccaa ggagatcgac ctggtcaacc gcgaccctaa acacctcaac gatgacgtgg tcaagattga ctttgaagat gtgattgcag aaccagaagg gacacacagt tttcacggca tttggaaggc cagcttcacc accttcactg tgacgaaata ctggttttac cgcttgctgt ctgccctctt tggcatcccg atggcactca tctggggcat ttacttcgcc attctctctt tcctgcacat ctgggcagtt gtaccatgca ttaagagctt cctgattgag attcagtgca ccagccgtgt ctattccatc tacgtccaca ccgtctgtga cccactcttt gaagctgttg ggaaaatatt cagcaatgtc cgcatcaact tgcagaaaga aatataa 36 cav2 atggggcttg agactgagaa ggcagatgtc caactgttca tggatgatga ttcttactca catcactcag gactggaatatgcagatccagaaaagtttgcggactccgaccaggatcgtgacccccaccgcttaaatagtcacttaaaactgggctttgaagatgtgatcgcggagcctgtcacaactcatagtttcgataaggtttggatttgctcacacgcattatttgaaatttcaaagtacgttatgtataagttccttactgtatttttggccatccctcttgcctttatcgcaggaatcctgttcgctaccttgagttgtctgcacatttggattcttatgccattcgtaaagacatgccttatggtgttgccatcagtgcaaaccatctggaagtccgtcactgatgtaattattgcccctttgtgtacatctgtgggccgctgcttttcgagcgtctcacttcaattgtcgcaggattaa 37 cav3 atgatggccgaagagcataccgatcttgaagctcaaattgtaaaggatattcattgtaaggaaattgacttggttaatcgtgatcctaagaacatcaacgaggatatcgttaaggtagacttcgaggatgttattgcagaacctgttggaacatacagtttcgacggtgtctggaaggtgtcgtacactacgtttaccgttagtaagtattggtgctatcgcttactgtccactctgttgggtgtcccccttgctttgctttggggattcctgttcgcgtgtatctctttttgccatatttgggctgtcgttccatgtattaaatcgtacttaattgagattcaatgtatctctcatatttatagtctttgtatccgcacgttctgtaatcccctttttgcggccttggggcaggtgtgctcaagtattaaggttgtacttcgtaaggaggtctaa 38

[0224] To supply more cell membrane lipids that may be deficient due to the formation of intracellular membrane structures, the plsBC gene of E. coli was amplified; for this purpose, the pTrc99A-plsBC plasmid was first constructed. Accordingly, the plsB and plsC genes were amplified from the genomic DNA of E. coli using primers [SEQ No. 39] and [SEQ No. 40] and primer pairs [SEQ No. 41] and [SEQ No. 42], respectively, and then inserted into the PstI and HindIII sites of the pTrc99A plasmid using Gibson assembly. Subsequently, the constructed plasmid was cut using PstI and HindIII restriction enzymes, and the plsBC gene fragment was isolated and inserted into the PstI and HindIII sites of the pTrc99A-cav1 plasmid to construct the pTrc99A-cav1-plsBC plasmid.

[0226] To supply more cell membrane lipids that may be deficient due to the formation of intracellular membrane structures, the plsBC gene of E. coli was amplified; for this purpose, the pTrc99A-plsBC plasmid was first constructed. Accordingly, the plsB and plsC genes were amplified from the genomic DNA of E. coli using primers [SEQ No. 39] and [SEQ No. 40] and primer pairs [SEQ No. 41] and [SEQ No. 42], respectively, and then inserted into the PstI and HindIII sites of the pTrc99A plasmid using Gibson assembly. Subsequently, the constructed plasmid was cut using PstI and HindIII restriction enzymes, and the plsBC gene fragment was isolated and inserted into the PstI and HindIII sites of the pTrc99A-cav1 plasmid to construct the pTrc99A-cav1-plsBC plasmid.

[0228] Primers used for cell membrane lipid synthesis enzyme gene amplification 이름 서열 서열 번호 plsB 프라이머(Forward) CTAGAGTCGACCTGCAGTTTCACACAGGAAACAGACCATGTCCGGCTGGCCACGA 39 plsB Primer (Reverse) TCTGTTTCCTGTGTGAAAATTACCCTTCGCCCTGCGTC 40 plsC Primer (Forward) GAAGGGTAATTTCACACAGGAAACAGACCATGCTATATATCTTTCGTCTTATTATTACC 41 plsC Primer 1 (Reverse) CCGCCAAAACAGCCAAGCTTTTAAACTTTTCCGGCGGGC 42

[0229] As a result, when the cav1 gene was expressed in both β- and deoxyviolacein-producing strains, the production volume increased most significantly to 21.89 mg / L and 1.28 g / L, respectively. In particular, for the deoxyviolacein-producing strains, it was observed that the production volume decreased sharply when two or three combinations of cav1, cav2, and cav3 were expressed (Figs. 4E and 4F). When TEM (top of each figure) and SEM (bottom of each figure) were used to determine whether the formation of endometrial vesicles was induced in the control group (Figs. 4G and 4I) and the cav1-overexpressing strains (Figs. 4H and 4J), it was confirmed that endometrial vesicles were successfully formed in the cav1-overexpressing strains, without showing a significant difference in cell morphology compared to the control group.

[0231] Example 4. Transpiration of rainbow pigments through increased formation and secretion of extracellular membrane vesicles

[0232] To further increase the production of rainbow pigments, the research team aimed to release the rainbow pigments accumulated inside the cell through vesicles by increasing the expression of the microorganism's natural outer membrane vesicle formation genes (Fig. 6A). It has been reported that for the expression of outer membrane vesicles, it is important to suppress the expression of genes that play a role in maintaining the cell's peptidoglycan layer or the connection between the outer and inner membranes, rather than expressing specific genes. Therefore, the research team also utilized an sRNA-based target gene expression inhibition system to suppress the expression intensity of a total of 26 target genes. The 26 selected expression-inhibiting gene targets are as follows: rseA, rseB, rffD, rffC, rffA, ompR, gmhB, lpxL, ompA, ompC, rfaB, rfaC, rfaD, rfaE, rfaG, rfaI, rfaJ, rfaK, rfaP, rfaQ, rfaY, rfbA, rffH, wzxE, pnp (Table 7). At this time, (1) gene targets related to maintaining the outer membrane / peptidoglycan structure are rfaG, rffA, rffC, rffD, rffH, etc., (2) gene targets corresponding to outer membrane protein expression are ompR, ompC, etc., and (3) gene targets related to the expression of anti-sigma factor in the cell membrane metabolic circuit are rseA, rseB, etc. In this embodiment, gene targets expected to be most effective were selected based on the three criteria above, but the scope of the invention is not necessarily limited to this, and other genes corresponding to the three criteria above may also be used as targets. The production of β and deoxyviolacein when the expression of the corresponding gene targets was inhibited is shown in Figures 6B and 6C. In the case of β, when the expression of rfaD, rffD, and rfaQ was inhibited, the production effectively increased to 26.43, 24.21, and 20.29 mg / L, respectively.In the case of deoxyviolacein, production increased significantly, particularly when rfaI and rfaQ expression was inhibited; 1.74 g / L was produced in the strain in which rfaI expression was inhibited.

[0233] As a result of observing the BTC1 strain introduced with rffD and rfaD expression-inhibiting sRNA and the DVIO strain introduced with rfaI expression-inhibiting sRNA through SEM and TEM, it was confirmed that the formation and secretion of extracellular membrane vesicles were significantly increased (Figs. 6D-F). In particular, when the DVIO strain introduced with rfaI expression-inhibiting sRNA was cultured, extracellular membrane vesicles, deoxyviolacein, and cell debris were found to be clustered on the flask wall, and a microscopic image of this is shown in Fig. 7E.

[0234] 26 Extracellular Membrane Vesicle-Related Gene Targets for Increased Extracellular Membrane Vesicle Formation and Secretion Target gene Protein function Essentiality* NCBI ID rseA Inhibitor of σE NE 947053 rseB Inhibitor of σE E 947054 rffD Genes involved in the ECA pathway E 948977 rffC Genes involved in the ECA pathway NE 948298 rffA Genes involved in the ECA pathway NE 948296 ompR Response regulator for ompC and ompF NE 947913 gmhB Genes involved in LPS pathway NE 944879 lpxL Genes involved in LPS pathway NE 946216 lpxM Genes involved in LPS pathway NE 945143 ompA Outer membrane protein A NE 945571 ompC Outer membrane porin NE 946716 rfaB Genes involved in LPS pathway E 948144 rfaC Genes involved in LPS pathway NE 948136 rfaD Genes involved in LPS pathway NE 948134 rfaE Genes involved in LPS pathway NE 947548 rfaG LPS core biosynthesis; glucosyl transferase NE 948149 rfaI Genes involved in LPS pathway NE 948143 rfaJ Genes involved in LPS pathway E 948142 rfaK Genes involved in LPS pathway E 948147 rfaP Genes involved in LPS pathway E 948150 rfaQ Genes involved in LPS pathway E 948155 rfaY Genes involved in LPS pathway E 948145 rfbA Genes involved in the ECA pathway NE 945154 rffH Genes involved in the ECA pathway E 948299 wzxE Inner membrane translocase for a component of ECA NE 948294 pnp Polynucleotide phosphorylase NE 947672

[0235] *E, a gene essential for E. coli cell growth when cultured in minimal medium; NE, a gene not essential for E. coli cell growth when cultured in minimal medium.

[0237] Example 5. Confirmation of synergistic effect between cell morphology modification and vesicle formation

[0238] Based on the results obtained so far, we intended to test synergistic effects by combining the most effective genetically engineered targets in each category.

[0239] The cloning of the sRNA plasmid for simultaneous multiple-target gene knockdown was carried out as follows. The first sRNA fragment was PCR amplified using primers [SEQN 43] and [SEQN 44], and the plasmid containing the second sRNA fragment was linearized via reverse PCR using primers [SEQN 45] and [SEQN 46]. The two resulting sRNA-containing fragments were combined using Gibson assembly to complete the sRNA plasmid for double knockdown. To insert E. coli plsBC into the sRNA-containing plasmid, the plsBC gene was PCR amplified using primers [SEQN 47] and [SEQN 48] with the pTrc99A-plsBC plasmid as a template, and inserted into the sRNA-containing plasmid as the SphI site. To insert the cav1 gene into a plasmid containing sRNA, the pTrc99A-cav1 plasmid was used as a template and inserted into the SphI site of the plasmid containing sRNA using primers [SEQ No. 47] and [SEQ No. 49].

[0241] Primers used for cell membrane lipid synthesis enzyme gene amplification name order Sequence number sRNA primer 1 (Forward) CACTAGATCTCAAATGTGCTGGAATTCTAACACCGTGCGTG 43 sRNA primer 1 (Reverse) CCTTATAAAATCAAACATGTGCGGCGAATTGGGTACCTATAAAC 44 sRNA primer 2 (Forward) GCACATGTTTGATTTATAAGGG 45 sRNA Primer 2 (Reverse) CAGCACATTTGAGATCTAGTGG 46 ptrc primer (Forward) ATGTGACAGCTTATCGCATGCTTGACAATTAATCATCCGG 47 plsC Primer 2 (Reverse) CCTGGGTTTACCTAGGCATGCTTAAACTTTTCCGGCGGCTTC 48 cav1 Primer (Reverse) CCTGGGTTTACCTAGGCATGCTTATATTTCTTTCTGCAAGTTG 49

[0242] First, in the case of the β-producing strain, since no increase in production was observed when the gene related to the cell membrane metabolic circuit of Example 2 was inhibited, a combination of the overexpression of the endometrial membrane vesicle expression gene (cav1) of Example 3 and the inhibition of the endometrial membrane vesicle expression target genes (rfaD, rffD, rfaD) of Example 4 was applied. First, the expression of the three endometrial membrane vesicle expression target genes was inhibited in different combinations; when rfaD and rffD were inhibited simultaneously, the β-production increased significantly to 34.2 mg / L (Fig. 6B). Additionally, the cav1 gene was overexpressed in the strain to induce endometrial membrane vesicle formation, but the production actually decreased (Fig. 6G).

[0243] In deoxyviolacein-producing strains, the cell membrane metabolic circuit target gene (mrdB) from Example 2, the inner membrane vesicle expression gene (cav1) from Example 3, and the outer membrane vesicle expression target gene (rfaI) from Example 4 were expressed in combinations of two or three to test the deoxyviolacein production. As a result, the strain overexpressing cav1 while inhibiting rfaI expression showed a deoxyviolacein production of 1.9 g / L, demonstrating the highest increase in yield (Fig. 6H).

[0244] When BTC1 strain introduced with rffD and rfaD expression-inhibiting sRNA and cav1-plsBC and DVIO strain introduced with rfaI expression-inhibiting sRNA and cav1 were observed using SEM and TEM, it was confirmed that increased formation and secretion of outer membrane vesicles and increased formation of inner membrane vesicles occurred simultaneously (Figs. 6I and 6J).

[0245] We intended to demonstrate the versatility of the present invention by applying the strategies used in the above examples to other hydrophobic pigments. Accordingly, the cell membrane engineering strategies that were most effective for increasing the production of β, a representative carotenoid compound, and deoxyviolacein, a representative violacein analog, were applied to the remaining rainbow pigments in each category. Since the formation of inner membrane vesicles through the simultaneous overexpression of the cav1 and plsBC genes and the formation of outer membrane vesicles through the inhibition of rffD and rfaD gene expression were effectively enhanced for the increase of β, these strategies were applied to ZEA20 and ATX68, zeaxanthin and astaxanthin-producing strains, respectively, for testing. As a result, inner membrane vesicle formation actually decreased zeaxanthin production and slightly increased astaxanthin production. On the other hand, outer membrane vesicle formation increased the production of both zeaxanthin and astaxanthin (18.38 mg / L; Fig. 7H, 22.69 mg / L; Fig. 7I, respectively). In the case of violacein analogs, since the simultaneous expression of inner and outer membrane vesicles led to the highest deoxyviolacein production, we sought to investigate the effects of expressing inner and outer membrane vesicles either individually or simultaneously. Accordingly, three strategies were tested: (1) rfaI knockdown for the overexpression of outer membrane vesicles, (2) cav1 overexpression for the overexpression of inner membrane vesicles, and (3) rfaI knockdown and cav1 overexpression. For proviolacein and violacein, the highest production was obtained when inner and outer membrane vesicles were simultaneously expressed (402 mg / L, Fig. 7J; 2.84 g / L, Fig. 7L, each). However, for prodeoxyviolacein, the highest production was obtained when only outer membrane vesicles were expressed (341 mg / L; Fig. 7K).In this case, since commercially available reagents for proviolacein and prodeoxyviolacein were unavailable, the substances were purified using a fraction collector connected to an HPLC and then quantified.

[0247] Example 7. Development of a Fed-batch Fermentation Process for High-Efficiency Production of Rainbow Pigments

[0248] We intended to perform fed-batch fermentation in a 6.6 L fermenter using the recombinant E. coli strains constructed in the above example. The fed-batch fermentation was carried out under the following conditions. Carotenoid-producing strains were cultured in a 6.6 L fermenter (BioFlo 320, Eppendorf) with 1.6 LR / 2 medium (pH 6.95) containing 30 g / L glucose or glycerol, 3 g / L yeast extract, and antibiotics. Violacein derivative-producing strains were cultured in a 6.6 L fermenter (BioFlo 320, Eppendorf) with 1.95 LR / 2 medium (pH 6.8) containing 20 g / L glucose or glycerol, 3 g / L yeast extract, 3 g / L (NH4)2SO4, and antibiotics. For the carotenoid-producing strains, colonies were inoculated into 3 mL of TB medium supplemented with an appropriate concentration of antibiotics and cultured at 30°C. For the violacein analogs, colonies were inoculated into 10 mL of LB medium supplemented with an appropriate concentration of antibiotics and cultured overnight at 37°C. Subsequently, the prepared carotenoid and violacein analog cultures were subcultured into a 250 mL baffle flask containing 50 mL of R / 2 medium supplemented with 3 g / L yeast extract and 20 g / L glycerol or glucose (an additional 3 g / L (NH4)2SO4 for the violacein analogs), and cultured at 30°C and 200 rpm. Culture was continued until the OD600 reached 3-4, after which the cultures were inoculated into a fermenter. The pH was maintained at 6.8 using a 28% (v / v) aqueous ammonia solution, and the temperature was maintained at 30 °C. The dissolved oxygen (DO) value was maintained at 40% through 2 L / min of air, a stirring speed automatically adjustable up to 1,000 rpm, and increasing oxygen flow rates. Nutrient supply was carried out using a pH-stat strategy, with pH values ​​of 7 for carotenoids and 6 for violacein derivatives.The feed was set to automatically feed in when the value exceeded 85. The feed solution for carotenoid production contained the following components per 1 L: 800 g glucose or 817 g glycerol, 6 mL trace metal solution, and 12 g MgSO4·H2O. The feed solution for violacein derivative production contained the following components per 1 L: 650 g glucose or 800 g glycerol, 6 mL trace metal solution, 85 g (NH4)2SO4, and 8 g MgSO4·H2O. Expression of the foreign protein was induced using 1 mM IPTG when the OD600 value reached 20-30 after inoculation.

[0249] The concentrations of each pigment obtained by fed-batch culture of recombinant E. coli exhibiting the most superior production capacity for each pigment are as follows:

[0250] i) astaxanthin-producing recombinant microorganism ATX68 (inhibition of pWAS, rffD, rfaD expression): 322 mg / L (Fig. 8a);

[0251] ii) β-producing recombinant microorganism BTC1 (inhibition of pWAS, rffD, rfaD expression): 343 mg / L (Fig. 8b);

[0252] iii) Zeaxanthin-producing recombinant microorganism ZEA20 (inhibition of pWAS, rffD, rfaD expression): 218 mg / L (Fig. 8c);

[0253] iv) proviolacein-producing recombinant microorganism PVIO (pWAS, repression of rfaI expression & overexpression of cav1): 1.3 g / L (Fig. 8d);

[0254] v) prodeoxyviolacein-producing recombinant microorganism PDVIO (inhibition of pWAS, rfaI expression): 0.855 g / L (Fig. 8e);

[0255] vi) Violacein-producing recombinant microorganism VIO (pWAS, inhibition of rfaI expression & overexpression of cav1): Production of 6.69 g / L of violacein (also production of 1.39 g / L of deoxyviolacein) (Fig. 8f);

[0256] vii) Deoxyviolacein-producing recombinant microorganism DVIO (pWAS, inhibition of rfaI expression & overexpression of cav1): 11.3 g / L (Fig. 8g).

[0257] The fact that all seven types of hydrophobic pigments could be produced at high concentrations using the E. coli strain developed through this invention demonstrates that this invention is effective for the high-efficiency production of overall hydrophobic substances.

[0259] Foregoing, specific parts of the content of the present invention have been described in detail. It will be apparent to those skilled in the art that such specific descriptions are merely preferred embodiments and do not limit the scope of the invention. Accordingly, the actual scope of the invention is defined by the appended claims and their equivalents.

Claims

Claim 1 Engineered recombinant E. coli in which the rfaI gene is repressed and the cav1 (caveolin-1) gene is overexpressed. Claim 2 delete Claim 3 delete Claim 4 delete Claim 5 delete Claim 6 delete Claim 7 delete Claim 8 delete Claim 9 delete Claim 10 Recombinant E. coli according to claim 1, characterized as being for producing hydrophobic pigments including deoxyviolacein, proviolacein, or vioolacein. Claim 11 In claim 10, the recombinant E. coli is characterized in that the hydrophobic pigment accumulates in the cell membrane. Claim 12 delete Claim 13 delete Claim 14 delete Claim 15 delete Claim 16 delete Claim 17 A method for producing a hydrophobic pigment comprising: a step of culturing a recombinant E. coli of any one of claims 1, 10, and 11 to produce a hydrophobic pigment containing deoxyviolacein, proviolacein, or violacein; and a step of obtaining the produced hydrophobic pigment. Claim 18 A method for producing a hydrophobic pigment according to claim 17, characterized in that the culture is a fed-batch culture.

Images