Novel variant of 2-methylcitrate dehydratase and method for producing L-glutamic acid using the same
Patent Information
- Application Number
- KR1020240075096
- Authority / Receiving Office
- KR · KR
- Patent Type
- Patents
- Current Assignee / Owner
- Priority Date
- 2023-06-16
- Filing Date
- 2024-06-10
- Publication Date
- 2026-08-14
- Estimated Expiration
- 2044-06-10
Smart Images

Figure 1020240075096
Abstract
Description
Technology Field
[0001] The present invention relates to a novel variant of 2-methylcitrate dehydrogenase and a method for producing L-glutamic acid using the same. Background Technology
[0002] L-glutamic acid is a representative amino acid produced by microbial fermentation, and its salt form, monosodium L-glutamate (MSG), is widely used as a seasoning for household use and processed food production because it balances and harmonizes the overall taste of food, thereby increasing the preference for foods such as meat, fish, chicken, vegetables, sauces, soups, and seasonings, and can enhance the taste of low-salt foods with up to 30% less salt.
[0003] To briefly examine the fermentation pathway of L-glutamic acid, glucose primarily undergoes the glycolytic pathway, but some is metabolized into two molecules of pyruvate via the pentose phosphate pathway. One of these molecules fixes CO2 to become oxaloacetic acid, while the other molecule combines with acetyl CoA from pyruvate to become citric acid. Oxaloacetic acid and citric acid then enter the citric acid cycle (TCA cycle) to become alpha-ketoglutaric acid. Here, the oxidative metabolic pathway for the oxidation of alpha-ketoglutarate to succinic acid is absent, and isocitrate dehydrogenase and glutamate dehydrogenase are closely involved, so the reductive amino acid reaction of alpha-ketoglutarate proceeds efficiently and L-glutamic acid is produced.
[0004] L-glutamic acid production can be achieved using wild-type strains obtained from nature or mutant strains modified to enhance their glutamic acid production capabilities. Recently, to improve L-glutamic acid production efficiency, genetic recombination technology has been applied to microorganisms such as Escherichia coli and Corynebacterium, which are widely used for the production of useful substances like amino acids and nucleic acids. This has led to the development of various recombinant strains or mutants with superior L-glutamic acid production capabilities, as well as methods for producing L-glutamic acid using these strains. In particular, there have been attempts to increase L-glutamic acid production by directly inducing mutations in genes involved in the L-glutamic acid biosynthetic pathway, such as enzymes, transcription factors, and transport proteins, or by inducing mutations in promoters that regulate their expression. However, because there is a wide variety of proteins—including enzymes, transcription factors, and transport proteins—directly or indirectly involved in L-glutamic acid production, much research is still needed regarding whether changes in the activity of these proteins lead to an increase in L-glutamic acid production capabilities. Prior art literature
[0005] U.S. Patent No. 6,852,516 U.S. Patent No. 6,962,805 The problem to be solved
[0006] The present invention aims to provide a novel 2-methylcitrate dehydrogenase variant.
[0007] In addition, the present invention aims to provide a polynucleotide encoding the said variant.
[0008] In addition, the present invention aims to provide a transformant comprising the above variant or polynucleotide.
[0009] In addition, the present invention aims to provide a method for producing L-glutamic acid using the above-mentioned transformant. means of solving the problem
[0010] One aspect of the present invention provides a 2-methylcitrate dehydrogenase variant composed of the amino acid sequence of SEQ ID NO. 4, wherein the 144th alanine (A) in the amino acid sequence of SEQ ID NO. 2 is substituted with threonine (T).
[0011] The “2-methylcitrate dehydratase” used in the present invention is a dehydrogenase involved in the propionate metabolic pathway that catalyzes the reaction of converting 2-methylcitrate synthesized from oxaloacetate into 2-methylisocitrate. The 2-methylcitrate dehydratase in the present invention may be a polypeptide encoded by the NCgl0664 or prpD1 gene and having 2-methylcitrate dehydratase activity, but is not limited thereto.
[0012] Nucleic acid and protein sequence information for the above 2-methylcitrate dehydrogenase can be obtained through known sequence databases (e.g., GenBank, UniProt).
[0013] According to one embodiment of the present invention, the 2-methylcitrate dehydrogenase may be encoded by the base sequence of SEQ ID NO. 1 and may be composed of the amino acid sequence of SEQ ID NO. 2.
[0014] The nucleotide sequence or amino acid sequence of the 2-methylcitrate dehydrogenase according to the present invention may include a nucleotide sequence or amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% homology or identity compared with each sequence. Here, “homology” or “identity” refers to the percentage of agreement between two sequences when a reference nucleotide sequence or amino acid sequence and any other nucleotide sequence or amino acid sequence are aligned and analyzed to correspond as much as possible.
[0015] According to one embodiment of the present invention, the 2-methylcitrate dehydrogenase or the gene encoding it is wild-type Corynebacterium glutamicum ( Corynebacterium glutamicum It may have originated from ).
[0016] The term "variant" as used in the present invention refers to a protein that differs from its original amino acid sequence due to a variation in the base sequence of a gene encoding a protein. Specifically, one or more bases or nucleotides in the gene sequence are altered by substitution, insertion, deletion, etc., and the resulting translated polypeptide or protein is a protein variant in which one or more amino acids are conservatively substituted and / or modified at the N-terminus, C-terminus, and / or internally, differing from the amino acid sequence prior to the mutation, while maintaining functions or properties. Here, "conservative substitution" means replacing one amino acid with another amino acid that has similar structural and / or chemical properties, and may have little to no effect on the activity of the protein or polypeptide. The above amino acids are selected from alanine (Ala, A), isoleucine (Ile, I), valine (Val, V), leucine (Leu, L), methionine (Met, M), asparagine (Asn, N), cysteine (Cys, C), glutamine (Gln, Q), serine (Ser, S), threonine (Thr, T), phenylalanine (Phe, F), tryptophan (Trp, W), tyrosine (Tyr, Y), aspartic acid (Asp, D), glutamic acid (Glu, E), arginine (Arg, R), histidine (His, H), lysine (Lys, K), glycine (Gly, G), and proline (Pro, P).
[0017] Additionally, variants include those in which one or more parts, such as an N-terminal leader sequence or a transmembrane domain, are removed, or in which a portion is removed from the N- and / or C-terminus of a mature protein.
[0018] The ability of such variants may be increased (enhanced), unchanged, or decreased (weakened) compared to the pre-mutation protein. Here, "increase or enhancement" includes cases where the activity of the protein itself is increased compared to the pre-mutation protein, cases where the overall level of enzyme activity within the cell is higher than that of the wild-type strain or the strain expressing the pre-mutation protein due to increased expression or translation of the gene encoding the protein, and combinations thereof. Additionally, "decrease or weakening" includes cases where the activity of the protein itself is decreased compared to the pre-mutation protein, cases where the overall level of enzyme activity within the cell is lower than that of the wild-type strain or the strain expressing the pre-mutation protein due to inhibition of gene expression or translation of the protein encoding the protein, and combinations thereof. In the present invention, the terms variant, modification, variant polypeptide, mutated protein, mutation, etc. may be used interchangeably.
[0019] The 2-methylcitrate dehydrogenase variant according to the present invention may include an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% homology or identity with respect to the amino acid sequence of SEQ ID NO. 4, excluding the mutation position (the 144th amino acid residue). Such a 2-methylcitrate dehydrogenase variant may include, without limitation, any amino acid sequence that maintains the function or characteristics of the 2-methylcitrate dehydrogenase variant.
[0021] Another aspect of the present invention provides a polynucleotide encoding the 2-methylcitrate dehydrogenase variant.
[0022] The term "polynucleotide" used in the present invention refers to a polymer of nucleotides in which nucleotide monomers are linked together in a long chain by covalent bonds, and is a DNA or RNA strand of a certain length or longer, specifically a polynucleotide fragment encoding the 2-methylcitrate dehydrogenase variant.
[0023] According to one embodiment of the present invention, the polynucleotide comprises a base sequence encoding the amino acid sequence of SEQ ID NO. 4, for example, may comprise the base sequence of SEQ ID NO. 3.
[0025] Another aspect of the present invention provides a vector comprising a polynucleotide encoding the 2-methylcitrate dehydrogenase variant.
[0026] In addition, another aspect of the present invention provides a transformant comprising the 2-methylcitrate dehydrogenase variant or polynucleotide.
[0027] As used in the present invention, the term "vector" refers to any type of nucleic acid sequence carrier structure used as a means to deliver and express a target gene in a host cell. Unless otherwise noted, the vector may mean a structure in which a carried nucleic acid sequence is inserted into the host cell genome to be expressed and / or expressed independently. Such a vector comprises essential regulatory elements operably linked to enable the expression of the gene insertion, where "operably linked" means that the target gene and its regulatory sequence are linked in such a way that they are functionally coupled to enable gene expression, and the "regulatory sequence" comprises a promoter sequence for performing transcription, any operator sequence for regulating transcription, a sequence encoding a suitable mRNA ribosome binding site, and a sequence regulating the termination of transcription and translation.
[0028] The vector used in the present invention is not particularly limited as long as it is capable of replicating within a host cell, and any vector known in the art may be used. Examples of such vectors include plasmids, cosmids, viruses, and bacteriophages in their natural or recombinant state. For example, phage vectors or cosmid vectors include pWE15, M13, λMBL3, λMBL4, λIXII, λASHII, λAPII, λt10, λt11, Charon4A, Charon21A, etc., and plasmid vectors include pBR-based, pUC-based, pBluescriptII-based, pGEM-based, pTZ-based, pCL-based, and pET-based vectors, but are not limited thereto.
[0029] The above vector can typically be constructed as a vector for cloning or as a vector for expression. The vector for expression may be a conventional one used in the art to express foreign genes or proteins in plants, animals, or microorganisms, and may be constructed through various methods known in the art.
[0030] The "recombinant vector" used in the present invention may be constructed using a prokaryotic or eukaryotic cell as a host, and may be capable of replication independently of the host cell's genome or may be sealed to the genome itself. The host cell is capable of replication by the vector and may include a replication origin, which is a specific nucleotide sequence at which replication is initiated. For example, when the vector used is an expression vector and the host is a prokaryotic cell, it generally includes a potent promoter capable of proceeding transcription (e.g., pLλ promoter, CMV promoter, trp promoter, lac promoter, tac promoter, T7 promoter), a ribosome binding site for initiating translation, and a transcription / translation termination sequence. When the host is a eukaryotic cell, the replication origins included in the vector that operate in eukaryotic cells include, but are not limited to, f1 replication origins, SV40 replication origins, pMB1 replication origins, adeno replication origins, AAV replication origins, and BBV replication origins. In addition, promoters derived from the genome of mammalian cells (e.g., metallothionine promoters) or promoters derived from mammalian viruses (e.g., adenovirus late promoter, vaccinia virus 7.5K promoter, SV40 promoter, cytomegalovirus promoter, HSV tk promoter) may be used and generally have a polyadenylation sequence as a transcription termination sequence.
[0031] The above-mentioned recombinant vector may include a selection marker, which is intended to select transformants (host cells) transformed by the vector. Since only cells expressing the selection marker can survive in a medium treated with the selection marker, selection of transformed cells is possible. Representative examples of the selection marker include kanamycin, streptomycin, and chloramphenicol, but are not limited thereto.
[0032] A transformant can be produced by inserting the above-mentioned recombinant vector into a host cell, and the transformant may be obtained by introducing the recombinant vector into a suitable host cell. Any host cell known in the art may be used as a cell capable of stably and continuously cloning or expressing the above-mentioned expression vector.
[0033] In the case of transforming prokaryotic cells to produce recombinant microorganisms, as a host cell E. coli DH5α, E. coli JM109, E. coli BL21, E. coli RR1, E. coli LE392, E. coli B, E. coli X 1776, E. coli W3110, E. coli Various intestinal bacteria such as Escherichia coli (e.g., XL1-Blue), Corynebacterium, Bacillus subtilis, Bacillus churingensis, Salmonella typhimurium, Serratia marcescens, and Pseudomonas may be used, but are not limited thereto.
[0034] When transforming into a eukaryotic cell to produce a recombinant microorganism, host cells such as yeast (e.g., Saccharomyces cerevisiae), insect cells, plant cells, and animal cells, such as Sp2 / 0, CHO K1, CHO DG44, PER.C6, W138, BHK, COS7, 293, HepG2, Huh7, 3T3, RIN, MDCK cell lines, etc., may be used, but are not limited thereto.
[0035] As used in this invention, "transformation" refers to a phenomenon in which external DNA is introduced into a host cell to artificially induce a genetic change, and "transformant" refers to a host cell into which external DNA is introduced to stably maintain the expression of a target gene.
[0036] The above transformation may be performed by selecting a vector introduction technique suitable for the host cell to express the target gene or a recombinant vector containing it within the host cell. For example, vector introduction may be performed by electroporation, heat shock, calcium phosphate (CaPO4) precipitation, calcium chloride (CaCl2) precipitation, microinjection, polyethylene glycol (PEG) method, DEAE-dextran method, cationic liposome method, lithium acetate-DMSO method, or a combination thereof, but is not limited thereto. The transformed gene may be included without limitation, whether inserted into the chromosomes of the host cell or located extrachromosomally, as long as it can be expressed within the host cell.
[0037] The above transformant comprises cells that have been transfected, transformed, or infected with a recombinant vector according to the present invention in vivo or in vitro, and may be used interchangeably with recombinant host cells, recombinant cells, or recombinant microorganisms.
[0038] According to one embodiment of the present invention, the transformant is Escherichia ( Escherichia ) strains of the genus or Corynebacterium ( Corynebacterium It could be a strain of the genus )
[0039] The above-mentioned Escherichia genus strains include Escherichia coli ( Escherichia coli ), Esquerizia Alberti( Escherichia albertii ), Esquerichia Blatae ( Escherichia coli ), Esquerichia fergusoni ( Escherichia fergusonii ), Esquericcia Hermani ( Escherichia hermannii ), Esquerichia Bulneris ( Escherichia coli It may be ) etc., but is not limited to these.
[0040] The above-mentioned Corynebacterium strains include Corynebacterium glutamicum ( Corynebacterium glutamicum ), Corynebacterium crudilactis( Corynebacterium crudilactis ), Corynebacterium desertii( Corynebacterium deserti), Corynebacterium carunae ( Corynebacterium callunae ), Corynebacterium suranaerae ( Corynebacterium suranareeae ), Corynebacterium lubricantis( Corynebacterium lubricantis ), Corynebacterium dusanense ( Corynebacterium doosanense ), Corynebacterium epiphysiens( Corynebacterium efficiens ), Corynebacterium uterechi( Corynebacterium uteriqui ), Corynebacterium stationaryis( Corynebacterium stationis ), Corynebacterium pacense ( Corynebacterium pacaense ), Corynebacterium singulare( Corynebacterium singular ), Corynebacterium humireducens( Corynebacterium humireducens ), Corynebacterium marinum( Marine Corynebacterium ), Corynebacterium halotolerans( Corynebacterium halotolerans ), Corynebacterium spaniscorum( Corynebacterium spheniscorum ), Corynebacterium freyburgense ( Corynebacterium freiburgense ), Corynebacterium striatum ( Corynebacterium striatum ), Corynebacterium canis ( Corynebacterium canis ), Corynebacterium ammoniagenes( Corynebacterium ammoniagenes ), Corynebacterium renale( Corynebacterium renale ), Corynebacterium pollatisoli ( Corynebacterium pollutisoli ), Corynebacterium imitans( Corynebacterium imitans ), Corynebacterium caspium ( Corynebacterium caspium ), Corynebacterium testudinoris( Corynebacterium testudinoris ), Corynebacterium pseudopellage ( Corynebacterium pseudopelargus ), Corynebacterium flavuscens( Corynebacterium flavescens It may be ) etc., but is not limited to these.
[0041] For example, the above transformant may be a strain of the genus Corynebacterium, specifically Corynebacterium glutamicum.
[0042] The transformant in the present invention may be a strain comprising the aforementioned 2-methyl citrate dehydrogenase variant or a polynucleotide encoding the same, or a vector comprising the same, a strain expressing the 2-methyl citrate dehydrogenase variant or the polynucleotide, or a strain having activity against the 2-methyl citrate dehydrogenase variant, but is not limited thereto.
[0043] According to one embodiment of the present invention, the transformant may be transformed to express the 2-methylcitrate dehydrogenase variant, or transformed by introducing a polynucleotide encoding the 2-methylcitrate dehydrogenase variant.
[0044] The transformant in the present invention may include other protein variants or gene variants in addition to the 2-methylcitrate dehydrogenase variant.
[0045] According to one embodiment of the present invention, the transformant may have the ability to produce L-glutamic acid.
[0046] The above-mentioned transformant may have the ability to produce L-glutamic acid naturally, or may have been artificially endowed with the ability to produce L-glutamic acid.
[0047] According to one embodiment of the present invention, the transformant may have an improved L-glutamic acid production capacity due to a change in the activity of 2-methylcitrate dehydrogenase.
[0048] Specifically, the transformant according to the present invention can have its L-glutamic acid production capacity improved as the production pathway from oxaloacetate to 2-methylisocitrate is weakened due to a mutation in 2-methylcitrate dehydrogenase, thereby reinforcing the oxaloacetate pool within the TCA cycle.
[0049] The term "improved production capacity" as used in the present invention means that the productivity of L-glutamic acid is increased compared to the parent strain. The parent strain refers to a wild-type or mutant strain that is the subject of mutation, and includes a subject that is directly subjected to mutation or transformed by a recombinant vector, etc. In the present invention, the parent strain may be a wild-type Escherichia genus strain or a Corynebacterium genus strain, or an Escherichia genus strain or a Corynebacterium genus strain that has been mutated from the wild-type.
[0050] The transformant according to the present invention exhibits increased L-glutamic acid production capacity compared to a strain (parent strain) containing the pre-mutation protein, as the activity of 2-methylcitrate dehydrogenase is changed by the introduction of a 2-methylcitrate dehydrogenase variant. Specifically, the transformant has an L-glutamic acid production of at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% compared to the parent strain, or 1.1 times, 1.5 times, 2 times, 2.5 times, 3 times, 3.5 times, 4 times, 4.5 times, 5 times, 5.5 times, 6 times, 6.5 times, 7 times, 7.5 times, 8 times, 8.5 times, 9 times, 9.5 times, 10 times, 20 times, 30 times, 40 times, 50 times, It may be increased by 60, 70, 80, 90, or 100 times, but is not limited to this.
[0051] A composition comprising a transformant according to the present invention can be used as a composition for producing L-glutamic acid.
[0053] Another aspect of the present invention provides a method for producing L-glutamic acid, comprising the steps of: culturing the transformant in a medium; and recovering L-glutamic acid from the transformant or the medium in which the transformant is cultured.
[0054] The above culture may be carried out according to appropriate media and culture conditions known in the art, and a person skilled in the art can easily adjust and use the media and culture conditions. Specifically, the media may be liquid media, but is not limited thereto. The culture method may include, for example, batch culture, continuous culture, fed-batch culture, or a combination thereof, but is not limited thereto.
[0055] According to one embodiment of the present invention, the medium must satisfy the requirements of a specific strain in an appropriate manner and may be appropriately modified by a person skilled in the art. For culture media for Bacillus species, reference may be made to the known literature (Manual of Methods for General Bacteriology. American Society for Bacteriology. Washington DC, USA, 1981), but is not limited thereto.
[0056] According to one embodiment of the present invention, the culture medium may contain various carbon sources, nitrogen sources, and trace element components. Carbon sources that may be used include sugars and carbohydrates such as glucose, sucrose, lactose, fructose, maltose, starch, and cellulose; oils and fats such as soybean oil, sunflower oil, castor oil, and coconut oil; fatty acids such as palmitic acid, stearic acid, and linoleic acid; alcohols such as glycerol and ethanol; and organic acids such as acetic acid. These substances may be used individually or as a mixture, but are not limited thereto. Nitrogen sources that may be used include peptone, yeast extract, meat broth, malt extract, corn steep liquid, soybean meal, and urea or inorganic compounds, such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate, and ammonium nitrate. Nitrogen sources may also be used individually or as a mixture, but are not limited thereto. Sources of phosphorus that may be used may include, but are not limited to, potassium dihydrogen phosphate or dipotassium hydrogen phosphate or corresponding sodium-containing salts. Additionally, the culture medium may contain metal salts such as magnesium sulfate or iron sulfate necessary for growth, but are not limited thereto. Furthermore, essential growth substances such as amino acids and vitamins may be included. In addition, suitable precursors may be used in the culture medium. The medium or individual components may be added to the culture solution in a batch or continuous manner in a manner suitable for the culture process, but are not limited thereto.
[0057] According to one embodiment of the present invention, the pH of the culture medium can be adjusted by adding compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, and sulfuric acid to the microbial culture medium in an appropriate manner during cultivation. Additionally, bubble formation can be suppressed by using an antifoaming agent such as a fatty acid polyglycol ester during cultivation. Furthermore, oxygen or an oxygen-containing gas (e.g., air) can be injected into the culture medium to maintain an aerobic state of the culture medium. The temperature of the culture medium can typically be 20 to 45°C, for example, 25 to 40°C. The cultivation period can continue until a desired amount of useful material is obtained, for example, 10 to 160 hours.
[0058] According to one embodiment of the present invention, the step of recovering L-glutamic acid from the cultured transformant or the medium in which the transformant is cultured may involve collecting or recovering L-glutamic acid produced from the medium using a suitable method known in the art according to the culture method. For example, methods such as centrifugation, filtration, extraction, spraying, drying, evaporation, precipitation, crystallization, electrophoresis, fractional dissolution (e.g., ammonium sulfate precipitation), and chromatography (e.g., ion exchange, affinity, hydrophobicity, and size exclusion) may be used, but are not limited thereto.
[0059] According to one embodiment of the present invention, the step of recovering L-glutamic acid may involve removing biomass by low-speed centrifugation of the culture medium and separating the obtained supernatant through ion exchange chromatography.
[0060] According to one embodiment of the present invention, the step of recovering L-glutamic acid may include a process of purifying L-glutamic acid. Effects of the invention
[0061] The 2-methylcitrate dehydrogenase variant according to the present invention has its protein activity altered by substituting one or more amino acids in the amino acid sequence constituting the 2-methylcitrate dehydrogenase, thereby enabling the efficient production of L-glutamic acid from a recombinant microorganism expressing the variant. Specific details for implementing the invention
[0062] The present invention will be described in more detail below. However, this description is provided merely as an example to aid in understanding the invention, and the scope of the invention is not limited by this exemplary description.
[0064] Example 1. 2-METHYL 시타이트 토수효소 변이지하니다 균주 한국어
[0065] To determine the effect of a variant (Sequence No. 4) in which alanine (A) at the 144th position of the amino acid sequence of 2-methylcitrate dehydrogenase (Sequence No. 2) is substituted with threonine (T) on L-glutamic acid production, a vector expressing the 2-methylcitrate dehydrogenase variant and a strain into which the vector was introduced were constructed.
[0067] 1-1. 형임전환용 vector pK_prpD1(A144T) created
[0068] The genomic DNA of Corynebacterium glutamicum ATCC13869 was used as a template, and PCR was performed using the primer pair of primers 1 and 2 and the primer pair of primers 3 and 4. Two PCR products, approximately 0.5kb and 0.6kb in size, amplified by PCR, were mixed and used as a template, and overlapping PCR was performed using the primer pair of primers 1 and 4 to ligate them into a single fragment. After treating the pK19msb vector (SEQ No. 5) with the restriction enzyme smaI (NEB), the fragment was cloned using T4 ligase. The vector constructed in this way was named pK_prpD1(A144T). All PCRs were performed using pfu premix (bioneer). After denaturation at 95°C for 5 minutes, the reaction was repeated 30 times at 95°C for 30 seconds, 55°C for 30 seconds, and 72°C for 1 minute, followed by a reaction at 72°C for 5 minutes. The primer sequences used for vector construction are shown in Table 1 below.
[0069] கியுக்க்க்கு Primer name Primer sequence (5'-3') 6 Primer 1 GGTCAGATGGAAGAAAACCC 7 Primer 2 CATAGGCCGTGGTGATACCCCGAATG 8 Primer 3 CATTCGGGGTATCACCACGGCCTATG 9 Primer 4 TCCATTCAGGATCCTCCACG
[0071] 1-2. Production of an L-glutamic acid-producing strain introduced with pK_prpD1(A144T)
[0072] To construct an L-glutamic acid-producing strain, Corynebacterium glutamicum U3 (accession number KCCM13218P) was used as the parent strain. The pK_prpD1(A144T) vector was prepared to a final concentration of 1 μg / µl or higher, and after electroporating Corynebacterium glutamicum U3 (Reference: Tauch et al., FEMS Microbiology letters 123 (1994) 343-347), 1 ml of regeneration medium (containing Brain Heart infusion 18.5 g / ℓ and sorbitol 91 g / ℓ) was added and heat-treated at 46°C for 6 minutes. After treatment, the samples were transferred to 15 ml capped tubes, incubated at 30°C for 2 hours, and plated on selective medium containing 20 mg / L kanamycin (containing 5 g / L tryptone, 5 g / L NaCl, 2.5 g / L yeast extract, 18.5 g / L Brain Heart infusion powder, and 15 g / L agar). Colonies formed by incubation at 30°C for 72 hours were cultured in BHI medium (18.5 g / L Brain Heart infusion powder) for 15 hours to induce secondary recombination, and 10 -2 ~ 10 -3 Colonies were isolated by diluting to [amount] and plating on a screening medium containing 10% sucrose. The isolated colonies were cultured on two types of screening media containing kanamycin and sucrose, respectively, and strains that were free from kanamycin resistance and could grow in the sucrose-containing medium were selected. The selected strain was named prpD1(A144T).
[0074] Experimental Example 1. Evaluation of L-glutamic acid production capacity
[0075] The L-glutamic acid production capacity of the strain prpD1 (A144T), which expresses a 2-methylcitrate dehydrogenase variant, was evaluated compared to the parent strain Corynebacterium glutamicum U3.
[0076] Each strain was inoculated at a volume of 1% into a 100 mL flask containing 10 mL of the glutamic acid production medium shown in Table 2 below, and cultured with shaking at 30°C, 200 rpm, for 48 hours. After the culture was completed, the concentration of L-glutamic acid in the medium was measured using HPLC (Agilent), and the results are shown in Table 3 below.
[0077] Medium for glutamic acid production Glucose 70.0 g / L (NH4)2SO4 5.0 g / L MgSO4 0.4 g / L Urea 2.0 g / L Soybean hydrolysate 15.0 ml / L KH2PO4 1.0 g / L FeSO4 10.0 mg / L MnSO4 10.0 mg / L Thiamine_HCl 200.0 ug / L Biotin 2.0 ug / L CaCO3 5.0 %
[0078] L-glutamic acid production (g / L) Mother strain 15.1 prpD1(A144T) 16.8
[0079] As shown in Table 3 above, it was confirmed that the strain prpD1 (A144T), which expresses a 2-methylcitrate dehydrogenase variant, had an L-glutamic acid production of about 11.2% higher than the parent strain by substituting alanine, the 144th amino acid in the amino acid sequence of 2-methylcitrate dehydrogenase, with threonine.
[0081] The present invention has been described above with reference to its preferred embodiments. Those skilled in the art will understand that the present invention may be embodied in modified forms without departing from the essential characteristics of the invention. Therefore, the disclosed embodiments should be considered in an illustrative rather than a restrictive sense. The scope of the invention is defined by the claims, not by the foregoing description, and all variations within the scope of the claims should be interpreted as being included in the invention.
[0082] Depository Name: Korean Culture Collection Center (KCCM) Trustee Number: KCCM13218P Date of Deposit: 2022-06-29
Claims
Claim 1 A 2-methylcitrate dehydrogenase variant composed of the amino acid sequence of SEQ ID NO. 4, in which the 144th alanine (A) in the amino acid sequence of SEQ ID NO. 2 is substituted with threonine (T). Claim 2 A polynucleotide encoding a variant of claim 1. Claim 3 A transformant comprising a variant of claim 1 or a polynucleotide of claim 2. Claim 4 In claim 3, the transformant is esquerichia ( Escherichia ) strains of the genus or Corynebacterium ( Corynebacterium A transformant that is a strain of the genus ) Claim 5 In claim 3, the transformant is a transformant having the ability to produce L-glutamic acid. Claim 6 A method for producing L-glutamic acid comprising the steps of: culturing the transformant of claim 3 in a culture medium; and recovering L-glutamic acid from the transformant or the culture medium in which the transformant is cultured.
Citation Information
Patent Citations
Method for producing l-glutamic acid-based amino acid
JP2009254323A
Alleles of the prpd1 gene from coryneform bacteria
US20080274265A1