Novel variant of threonine ammonia-lyase and method for producing 5'-inosinic acid using the same

Abstract

The present invention relates to a novel variant of threonine ammonia lyase and a method for producing 5'-inosinic acid using the same, wherein the protein activity of the threonine ammonia lyase variant is altered by substituting one or more amino acids in the amino acid sequence constituting threonine ammonia lyase, and a recombinant microorganism containing the same can efficiently produce 5'-inosinic acid.

Description

Technology Field

[0001] The present invention relates to a novel variant of threonine ammonia lyase and a method for producing 5'-inosinic acid using the same. Background Technology

[0002] 5'-inosinic acid (or inosine monophosphate, IMP) is an intermediate in the nucleic acid biosynthetic metabolic system and plays a physiologically important role in the bodies of animals and plants. It is also used in various fields, including food, pharmaceuticals, and various medical applications. In particular, it is one of the nucleic acid-based seasonings that is gaining popularity as a savory seasoning because it creates a synergistic effect in taste when used together with monosodium glutamate (MSG).

[0003] Methods for producing 5'-inosinic acid include enzymatically degrading ribonucleic acid extracted from yeast cells and chemically phosphorylating inosine produced by fermentation. Recently, however, a method of recovering 5'-inosinic acid accumulated in a culture medium by culturing microorganisms that produce 5'-inosinic acid is mainly used.

[0004] In the production of 5'-inosinic acid using microorganisms, genetic recombination technology is applied to microorganisms such as Escherichia coli and Corynebacterium, which are widely used in the production of useful substances like nucleic acids and L-amino acids, in order to improve the production efficiency of 5'-inosinic acid. This has led to the development of various recombinant strains or mutant strains with excellent 5'-inosinic acid production capabilities, as well as methods for producing 5'-inosinic acid using these strains. In particular, there have been attempts to increase the production of 5'-inosinic acid by targeting genes such as enzymes, transcription factors, and transport proteins involved in the biosynthetic pathway of 5'-inosinic acid, or by inducing mutations in promoters that regulate their expression. However, since there are tens to hundreds of types of proteins, such as enzymes, transcription factors, and transport proteins, that are directly or indirectly involved in 5'-inosinic acid production, much research is still needed regarding whether changes in the activity of these proteins lead to an increase in 5'-inosinic acid production capabilities. Prior art literature

[0005] Korean Registered Patent No. 10-1166027 The problem to be solved

[0006] The present invention aims to provide a novel threonine ammonia lyase variant.

[0007] In addition, the present invention provides a polynucleotide encoding the above variant.

[0008] In addition, the present invention provides a transformant comprising the above variant or polynucleotide.

[0009] In addition, the present invention aims to provide a method for producing 5'-inosinic acid using the transformant. means of solving the problem

[0010] One aspect of the present invention provides a threonine ammonia lyase variant in which one or more of the 9th and 401st amino acids in the amino acid sequence of SEQ ID NO. 4 are substituted with other amino acids.

[0011] The “threonine ammonia-lyase” used in the present invention catalyzes the reaction of converting L-threonine into 2-oxobutanoate and ammonia and also exhibits serine ammonia-lyase activity that produces pyruvate from L-serine, and may be a polypeptide or protein having threonine ammonia-lyase activity composed of the amino acid sequence of SEQ ID NO. 4.

[0012] The nucleic acid and protein sequence information of the above threonine ammoniases can be obtained through known sequence databases (e.g., GenBank, UniProt).

[0013] According to one embodiment of the present invention, the threonine ammonia lyase may be encoded by the base sequence of SEQ ID NO. 3.

[0014] The amino acid sequence of threonine ammonia lyase according to the present invention or the nucleotide sequence encoding the same may include a nucleotide sequence or amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% homology or identity compared with each sequence. Here, "homology" or "identity" refers to the percentage of agreement between two sequences when a reference nucleotide sequence or amino acid sequence and any other nucleotide sequence or amino acid sequence are aligned and analyzed to correspond as much as possible.

[0015] According to one embodiment of the present invention, the threonine ammonia lyase is wild-type Corynebacterium stearis ( Corynebacterium stationis It may have originated from ).

[0016] The term “variant” as used in this invention refers to a sequence in which one or more amino acids are conservatively substituted or / or modified at the N-terminus, C-terminus, and / or within a gene encoding a protein due to a variation in the nucleotide sequence, resulting in a sequence that differs from the amino acid sequence prior to the variation but retains its functions or properties. Here, “conservative substitution” refers to the substitution of a single amino acid with another amino acid having similar structural and / or chemical properties, which may have little to no effect on the activity of the protein or polypeptide. Additionally, “modification” refers to the substitution, insertion, deletion, etc., of amino acids. The above amino acids are selected from alanine (Ala, A), isoleucine (Ile, I), valine (Val, V), leucine (Leu, L), methionine (Met, M), asparagine (Asn, N), cysteine ​​(Cys, C), glutamine (Gln, Q), serine (Ser, S), threonine (Thr, T), phenylalanine (Phe, F), tryptophan (Trp, W), tyrosine (Tyr, Y), aspartic acid (Asp, D), glutamic acid (Glu, E), arginine (Arg, R), histidine (His, H), lysine (Lys, K), glycine (Gly, G), and proline (Pro, P).

[0017] Additionally, variants include those in which one or more parts, such as an N-terminal leader sequence or a transmembrane domain, are removed, or in which a portion is removed from the N- and / or C-terminus of a mature protein.

[0018] The ability of such variants may be increased (enhanced), unchanged, or decreased (weakened) compared to the pre-mutation protein. Here, "increase or enhancement" includes cases where the activity of the protein itself is increased compared to the pre-mutation protein, cases where the overall degree of protein activity within the cell is higher than that of the wild-type strain or the strain expressing the pre-mutation protein due to increased expression or translation of the gene encoding the protein, and combinations thereof. Additionally, "decrease or weakening" includes cases where the activity of the protein itself is decreased compared to the pre-mutation protein, cases where the overall degree of protein activity within the cell is lower than that of the wild-type strain or the strain expressing the pre-mutation protein due to inhibition of gene expression or translation of the protein encoding the protein, and combinations thereof. In the present invention, the terms variant, modification, variant polypeptide, mutated protein, mutation, etc. may be used interchangeably.

[0019] According to one embodiment of the present invention, the variant may be composed of the amino acid sequence of SEQ ID NO. 2, in which the 9th alanine in the amino acid sequence of SEQ ID NO. 4 is substituted with threonine and the 401st glycine is substituted with serine.

[0020] More specifically, the threonine ammonia lyase variant may include an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% homology or identity compared to the amino acid sequence of SEQ ID NO. 2.

[0022] Another aspect of the present invention provides a polynucleotide encoding the threonine ammonia lyase variant.

[0023] The term “polynucleotide” used in the present invention refers to a polymer of nucleotides in which nucleotide monomers are linked together in a long chain by covalent bonds, and is a DNA or RNA strand of a certain length or longer, more specifically, a polynucleotide fragment encoding the variant.

[0024] According to one embodiment of the present invention, the polynucleotide may comprise a base sequence encoding the amino acid sequence of SEQ ID NO. 2.

[0025] More specifically, the polynucleotide may include the base sequence of SEQ ID NO. 1, in which the 25th base g and the 1201st base g are substituted with a in the base sequence of SEQ ID NO. 3 encoding threonine ammonia lyase.

[0027] Another aspect of the present invention provides a vector comprising a polynucleotide encoding the threonine ammonia lyase variant.

[0028] In addition, another aspect of the present invention provides a transformant comprising the threonine ammonia lyase variant or polynucleotide.

[0029] As used in the present invention, the term “vector” refers to any type of nucleic acid sequence carrier structure used as a means to deliver and express a target gene in a host cell. Unless otherwise noted, the vector may mean a structure in which a carried nucleic acid sequence is inserted into the host cell genome to be expressed and / or expressed independently. Such a vector comprises an essential regulatory element operably linked to enable the expression of the gene insertion, where “operably linked” means that the target gene and its regulatory sequence are linked in such a way that they are functionally coupled to enable gene expression, and the “regulatory element” comprises a promoter for performing transcription, any operator sequence for regulating transcription, a sequence encoding a suitable mRNA ribosome binding site, and a sequence regulating the termination of transcription and translation.

[0030] The vector used in the present invention is not particularly limited as long as it is capable of replicating within a host cell, and any vector known in the art may be used. Examples of such vectors include plasmids, cosmids, viruses, and bacteriophages in their natural or recombinant state. For example, phage vectors or cosmid vectors include pWE15, M13, λMBL3, λMBL4, λIXII, λASHII, λAPII, λt10, λt11, Charon4A, Charon21A, etc., and plasmid vectors include pBR-based, pUC-based, pBluescriptII-based, pGEM-based, pTZ-based, pCL-based, and pET-based vectors, but are not limited thereto.

[0031] The above vector can typically be constructed as a vector for cloning or as a vector for expression. The vector for expression may be a conventional one used in the art to express foreign genes or proteins in plants, animals, or microorganisms, and may be constructed through various methods known in the art.

[0032] The “recombinant vector” used in the present invention, after being transformed into a suitable host cell, can be replicated independently of the host cell’s genome or can be sealed to the genome itself. In this case, the “suitable host cell” may include a replication origin, which is a specific nucleotide sequence where replication is initiated, and in which the vector is replicated. For example, when the vector used is an expression vector and the host is a prokaryotic cell, it generally includes a potent promoter capable of proceeding transcription (e.g., pLλ promoter, CMV promoter, trp promoter, lac promoter, tac promoter, T7 promoter), a ribosome binding site for initiating translation, and a transcription / translation termination sequence. When the host is a eukaryotic cell, the replication origins included in the vector that operate in eukaryotic cells include, but are not limited to, f1 replication origins, SV40 replication origins, pMB1 replication origins, adeno replication origins, AAV replication origins, and BBV replication origins. In addition, promoters derived from the genome of mammalian cells (e.g., metallothionine promoters) or promoters derived from mammalian viruses (e.g., adenovirus late promoter, vaccinia virus 7.5K promoter, SV40 promoter, cytomegalovirus promoter, HSV tk promoter) may be used and generally have a polyadenylation sequence as a transcription termination sequence.

[0033] The above-mentioned recombinant vector may include a selection marker, which is intended to select transformants (host cells) transformed by the vector. Since only cells expressing the selection marker can survive in a medium treated with the selection marker, selection of transformed cells is possible. Representative examples of the selection marker include kanamycin, streptomycin, and chloramphenicol, but are not limited thereto.

[0034] A transformant can be produced by inserting a recombinant vector into a host cell, and said transformant may be obtained by introducing the recombinant vector into a suitable host cell. Any host cell known in the art may be used as a cell capable of stably and continuously cloning or expressing said expression vector.

[0035] In the case of transforming prokaryotic cells to produce recombinant microorganisms, as a host cell E. coli DH5α, E. coli JM109, E. coli BL21, E. coli RR1, E. coli LE392, E. coli B, E. coli X 1776, E. coli W3110, E. coli Various intestinal bacteria and strains such as Escherichia coli strains like XL1-Blue, Bacillus strains like Bacillus subtilis and Bacillus churingensis, Corynebacterium strains like Corynebacterium glutamicum and Corynebacterium stearis, Salmonella typhimurium, Serratia marcescens and Pseudomonas species may be used, but are not limited thereto.

[0036] When transforming into a eukaryotic cell to produce a recombinant microorganism, host cells such as yeast (e.g., Saccharomyces cerevisiae), insect cells, plant cells, and animal cells, such as Sp2 / 0, CHO K1, CHO DG44, PER.C6, W138, BHK, COS7, 293, HepG2, Huh7, 3T3, RIN, MDCK cell lines, etc., may be used, but are not limited thereto.

[0037] As used in this invention, “transformation” refers to a phenomenon in which external DNA is introduced into a host cell to artificially induce genetic changes, and “transformat” refers to a host cell into which external DNA is introduced to stably maintain the expression of a target gene.

[0038] The above transformation may be performed by selecting a vector introduction technique suitable for the host cell to express the target gene or a recombinant vector containing it within the host cell. For example, vector introduction may be performed by electroporation, heat shock, calcium phosphate (CaPO4) precipitation, calcium chloride (CaCl2) precipitation, microinjection, polyethylene glycol (PEG) method, DEAE-dextran method, cationic liposome method, lithium acetate-DMSO method, or a combination thereof, but is not limited thereto. The transformed gene may be included without limitation, whether inserted into the chromosomes of the host cell or located extrachromosomally, as long as it can be expressed within the host cell.

[0039] The above transformant comprises cells that have been transfected, transformed, or infected with a recombinant vector according to the present invention in vivo or in vitro, and may be used interchangeably with recombinant host cells, recombinant cells, or recombinant microorganisms.

[0040] The genes inserted into the recombinant vector of the present invention can be substituted into host cells, such as strains of the genus Corynebacterium, through homologous recombination crossing.

[0041] According to one embodiment of the present invention, the transformant is Corynebacterium ( Corynebacterium It could be a microorganism of the genus.

[0042] The above-mentioned microorganisms of the genus Corynebacterium include Corynebacterium glutamicum ( Corynebacterium glutamicum ), Corynebacterium crudilactis( Corynebacterium crudilactis), Corynebacterium desertii( Corynebacterium deserti ), Corynebacterium carunae ( Corynebacterium callunae ), Corynebacterium suranaerae ( Corynebacterium suranareeae ), Corynebacterium lubricantis( Corynebacterium lubricantis ), Corynebacterium dusanense ( Corynebacterium doosanense ), Corynebacterium epiphysiens( Corynebacterium efficiens ), Corynebacterium uterechi( Corynebacterium uterequi ), Corynebacterium stationaryis( Corynebacterium stationis ), Corynebacterium pacense ( Corynebacterium pacaense ), Corynebacterium singulare( Corynebacterium singulare ), Corynebacterium humireducens( Corynebacterium humireducens ), Corynebacterium marinum( Corynebacterium marinum ), Corynebacterium halotolerans( Corynebacterium halotolerans ), Corynebacterium spaniscorum( Corynebacterium spheniscorum ), Corynebacterium freyburgense ( Corynebacterium freiburgense ), Corynebacterium striatum ( Corynebacterium striatum ), Corynebacterium canis ( Corynebacterium canis ), Corynebacterium ammoniagenes( Corynebacterium ammoniagenes ), Corynebacterium renale( Corynebacterium renale ), Corynebacterium pollatisoli ( Corynebacterium pollutisoli ), Corynebacterium imitans( Corynebacterium imitans ), Corynebacterium caspium ( Corynebacterium caspium ), Corynebacterium testudinoris( Corynebacterium testudinoris ), Corynebacterium pseudopellage ( Corynebacaterium pseudopelargi ) or Corynebacterium flavescens ( Corynebacterium flavescens It may be, but is not limited to.

[0043] The transformant in the present invention may be a strain comprising the aforementioned threonine ammonia lyase variant or a polynucleotide encoding the same, or a vector comprising the same, a strain expressing the threonine ammonia lyase variant or polynucleotide, or a strain having activity against the threonine ammonia lyase variant, but is not limited thereto.

[0044] The transformant in the present invention may include other protein variants or gene variants in addition to the threonine ammonia lyase variant.

[0045] According to one embodiment of the present invention, the transformant may have the ability to produce 5'-inosinic acid.

[0046] The above 5'-inosinic acid is a nucleic acid compound that produces the flavor, especially umami, of food, and is used interchangeably with inosine monophosphate (IMP).

[0047] The above-mentioned transformant may have the ability to produce 5'-inosinic acid naturally, or may have been artificially endowed with the ability to produce 5'-inosinic acid.

[0048] According to one embodiment of the present invention, the transformant may have a changed threonine ammonia lyase activity and an improved 5'-inosinic acid production capacity.

[0049] The term “improved production capacity” as used in the present invention means that the productivity of 5’-inosinic acid is increased compared to the parent strain. The parent strain refers to a wild-type or mutant strain that is the subject of mutation, and includes a subject that is directly subjected to mutation or transformed by a recombinant vector, etc. In the present invention, the parent strain may be a wild-type Corynebacterium strain or a Corynebacterium strain mutated from the wild type.

[0050] The transformant according to the present invention exhibits increased 5'-inosinic acid production capacity compared to the parent strain, as the activity of threonine ammonia lyase is changed by the introduction of a threonine ammonia lyase variant. More specifically, the transformant may have a 5'-inosinic acid production of at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% increased compared to the parent strain, or 1.1 times, 1.5 times, 2 times, 2.5 times, 3 times, 3.5 times, 4 times, 4.5 times, 5 times, 5.5 times, 6 times, 6.5 times, 7 times, 7.5 times, 8 times, 8.5 times, 9 times, 9.5 times, or 10 times increased, but is not limited thereto. For example, the transformant containing the above threonine ammonia lyase variant may have a 5'-inosinic acid production of 5% or more, specifically 5 to 50% (preferably 10 to 40%) increased compared to the parent strain.

[0052] Another aspect of the present invention provides a method for producing 5'-inosinic acid, comprising the steps of: culturing the transformant in a medium; and recovering 5'-inosinic acid from the transformant or the medium in which the transformant is cultured.

[0053] The above culture may be carried out according to appropriate media and culture conditions known in the art, and a person skilled in the art can easily adjust and use the media and culture conditions. Specifically, the media may be liquid media, but is not limited thereto. The culture method may include, for example, batch culture, continuous culture, fed-batch culture, or a combination thereof, but is not limited thereto.

[0054] According to one embodiment of the present invention, the medium must satisfy the requirements of a specific strain in an appropriate manner and can be appropriately modified by a person skilled in the art. For culture media for strains of the genus Escherichia, reference may be made to known literature (Manual of Methods for General Bacteriology. American Society for Bacteriology. Washington DC, USA, 1981), but is not limited thereto.

[0055] According to one embodiment of the present invention, the culture medium may contain various carbon sources, nitrogen sources, and trace element components. Carbon sources that may be used include sugars and carbohydrates such as glucose, sucrose, lactose, fructose, maltose, starch, and cellulose; oils and fats such as soybean oil, sunflower oil, castor oil, and coconut oil; fatty acids such as palmitic acid, stearic acid, and linoleic acid; alcohols such as glycerol and ethanol; and organic acids such as acetic acid. These substances may be used individually or as a mixture, but are not limited thereto. Nitrogen sources that may be used include peptone, yeast extract, meat broth, malt extract, corn steep liquid, soybean meal, and urea or inorganic compounds, such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate, and ammonium nitrate. Nitrogen sources may also be used individually or as a mixture, but are not limited thereto. Sources of phosphorus that may be used may include, but are not limited to, potassium dihydrogen phosphate or dipotassium hydrogen phosphate or corresponding sodium-containing salts. Additionally, the culture medium may contain metal salts such as magnesium sulfate or iron sulfate necessary for growth, but are not limited thereto. Furthermore, essential growth substances such as amino acids and vitamins may be included. In addition, suitable precursors may be used in the culture medium. The medium or individual components may be added to the culture solution in a batch or continuous manner in a manner suitable for the culture process, but are not limited thereto.

[0056] According to one embodiment of the present invention, the pH of the culture medium can be adjusted by adding compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, and sulfuric acid to the microbial culture medium in an appropriate manner during cultivation. Additionally, bubble formation can be suppressed by using an antifoaming agent such as a fatty acid polyglycol ester during cultivation. Furthermore, oxygen or an oxygen-containing gas (e.g., air) can be injected into the culture medium to maintain an aerobic state of the culture medium. The temperature of the culture medium can typically be 20 to 45°C, for example, 25 to 40°C. The cultivation period can continue until a desired amount of useful material is obtained, for example, 10 to 160 hours.

[0057] According to one embodiment of the present invention, the step of recovering 5'-inosinic acid from the cultured transformant or the medium in which the transformant is cultured may involve collecting or recovering the 5'-inosinic acid produced from the medium using a suitable method known in the art according to the culture method. For example, methods such as centrifugation, filtration, extraction, spraying, drying, evaporation, precipitation, crystallization, electrophoresis, fractional dissolution (e.g., ammonium sulfate precipitation), and chromatography (e.g., ion exchange, affinity, hydrophobicity, and size exclusion) may be used, but are not limited thereto.

[0058] According to one embodiment of the present invention, the step of recovering the 5'-inosinic acid may involve removing biomass by low-speed centrifugation of the culture medium and separating the obtained supernatant through ion exchange chromatography.

[0059] According to one embodiment of the present invention, the step of recovering the 5'-inosinic acid may include a process of purifying the 5'-inosinic acid. Effects of the invention

[0060] The threonine ammonia lyase variant according to the present invention has its protein activity altered by substituting one or more amino acids in the amino acid sequence constituting the threonine ammonia lyase, so that a recombinant microorganism containing the same can efficiently produce 5'-inosinic acid. Brief explanation of the drawing

[0061] Figure 1 is the structure of a pK19msb plasmid according to one embodiment of the present invention. Specific details for implementing the invention

[0062] The present invention will be described in more detail below. However, this description is provided merely as an example to aid in understanding the invention, and the scope of the invention is not limited by this exemplary description.

[0064] Example 1. Preparation of a strain expressing a threonine ammonia lyase variant

[0065] To determine the effect of a variant (Sequence No. 2) in which the 9th alanine (A) in the amino acid sequence of threonine ammonia lyase (Sequence No. 4) is substituted with threonine (T) and the 401st glycine (G) is substituted with serine (S) on the production of 5'-inosinic acid, a vector expressing the threonine ammonia lyase variant and a strain into which the vector was introduced were constructed.

[0067] 1-1. Vector Construction for Threonine Ammonia Lyase Variant Expression

[0068] PCR was performed using the genomic DNA of wild-type Corynebacterium stearis ATCC6872 as a template and the primer pair of primers 1 and 2. Subsequently, the PCR fragment and the pK19msb plasmid (SEQ No. 5) were treated with the restriction enzyme smaI (NEB) and cloned using T4 ligase. The constructed plasmid was named pK_TA.

[0069] For PCR amplification, pfu premix (bioneer) was used, and after denaturation at 95°C for 5 minutes, the reaction was repeated 30 times at 95°C for 30 seconds, 58°C for 30 seconds, and 72°C for 1 minute 30 seconds, followed by a reaction at 72°C for 5 minutes.

[0070] The primer sequences used for plasmid construction are as shown in Table 1 below.

[0071] Primer name Sequence number Primer sequence (5'-3') Primer 1 6 TACAAGCCAGAAGGTCACTACAGAA Primer 2 7 ATCAATGCTCGCCGCGCTTC

[0073] 1-2. Production of mutant strains into which a threonine ammonia lyase variant was introduced

[0074] For the transformation of Corynebacterium stearis KCCM13339P, an electrocompetent cell preparation method modified based on the method of van der Rest et al. was used.

[0075] First, a starter culture was prepared by primary culturing Corynebacterium stearis KCCM13339P in 10 mL of 2YT medium supplemented with 2% glucose (containing 16 g / L tryptone, 10 g / L yeast extract, and 5 g / L sodium chloride). Isonicotinic acid hydrazine at a concentration of 1 mg / mL and 2.5% glycine were added to 100 mL of 2YT medium excluding glucose. Next, OD 610 After inoculating the seed culture medium until the value becomes 0.3, incubate at 30℃ and 180 rpm for 5 to 8 hours to obtain the OD 610The value was adjusted to 0.6 to 0.7. After leaving the culture medium on ice for 30 minutes, it was centrifuged at 4°C and 3500 rpm for 10 minutes. Subsequently, the supernatant was discarded, and the precipitated Corynebacterium stearis KCCM13339P was washed four times with a 10% glycerol solution and finally resuspended in 0.5 ml of a 10% glycerol solution to prepare competent cells. Electroporation was performed using an electroporator from Bio-Rad. The prepared competent cells and the prepared pK_TA vector were added to an electroporation cuvette (0.2 mm), and an electric shock was applied under conditions of 2.5 kV, 200 Ω, and 12.5 μF. Immediately after the electric shock ended, 1 ml of RG medium (containing Brain Heart infusion 18.5 g / L and sorbitol 0.5 M) was added, and heat treatment was performed at 46°C for 6 minutes. After cooling to room temperature, the samples were transferred to 15 ml capped tubes, incubated at 30°C for 2 hours, and plated onto selective medium (containing tryptone 5 g / L, NaCl 5 g / L, yeast extract 2.5 g / L, Brain Heart infusion powder 18.5 g / L, agar 15 g / L, sorbitol 91 g / L, and kanamycin 20 µg / L). Colonies formed after incubation at 30°C for 72 hours were cultured on the medium until the stationary phase to induce secondary recombination, and 10 -5 ~ 10 -7 A strain that was diluted to [value] and plated on an antibiotic-free agar medium (containing 10% sucrose) was selected for having no kanamycin resistance and growing in a medium containing 10% sucrose, and was named ITA-1.

[0077] Experimental Example 1. Evaluation of 5'-inosinic acid production capacity of a strain expressing a threonine ammonia lyase variant

[0078] The 5'-inosinic acid production capacity of the parent strain KCCM13339P and the mutant strain ITA-1, into which a threonine ammonia lyase variant was introduced, was compared.

[0079] Each strain (parent strain or mutant strain) was inoculated at a volume of 1% into a 100 mL flask containing 10 mL of the 5'-inosinic acid production medium shown in Table 2 below, and the flask was cultured with shaking at 34°C and 200 rpm for 45 hours. After the culture was finished, the concentration of 5'-inosinic acid in the medium was measured using HPLC (Agilent), and the results are shown in Table 3 below.

[0080] ingredient Content Glucose 70 g / L (NH4)2SO4 2 g / L MgSO4 1 g / L Urea 2 g / L Yeast extract 20 g / L KH2PO4 2 g / L FeSO4 10 mg / L MnSO4 10 mg / L Thiamine_HCl 5 mg / L biotin 20 ug / L Cystein 20 mg / L Bata-alanine 20 mg / L Adenine 30 mg / L

[0081] strain 5'-inosinic acid production (g / L) KCCM13339P 19.8 ITA-1 23.2

[0082] As shown in Table 3 above, it was confirmed that the mutant strain into which the threonine ammonia lyase variant was introduced showed an approximately 17% increase in 5'-inosinic acid production compared to the parent strain, as the 9th and 401st amino acids were substituted with other amino acids. These results suggest that the introduction of a point mutation of threonine ammonia lyase provides an effective effect on 5'-inosinic acid productivity.

[0084] The present invention has been described above with reference to its preferred embodiments. Those skilled in the art will understand that the present invention may be embodied in modified forms without departing from the essential characteristics of the invention. Therefore, the disclosed embodiments should be considered in an illustrative rather than a restrictive sense. The scope of the invention is defined by the claims, not by the foregoing description, and all variations within the scope of the claims should be interpreted as being included in the invention.

[0086] Depository Name: Korean Culture Collection Center (KCCM) Trustee Number: KCCM13339P Date of Deposit: 2023-03-29

Claims

Claim 1 A threonine ammonia lyase variant composed of the amino acid sequence of SEQ ID NO. 2, wherein the 9th alanine in the amino acid sequence of SEQ ID NO. 4 is substituted with threonine and the 401st glycine is substituted with serine. Claim 2 delete Claim 3 A polynucleotide encoding a variant of claim 1. Claim 4 A transformant comprising a variant of claim 1 or a polynucleotide of claim 3. Claim 5 In claim 4, the transformant is Corynebacterium ( Corynebacterium Transgenic organism that is a microorganism of the genus ). Claim 6 In claim 4, the transformant is a transformant having the ability to produce 5'-inosinic acid. Claim 7 A method for producing 5'-inosinic acid, comprising the steps of: culturing the transformant of claim 4 in a medium; and recovering 5'-inosinic acid from the transformant or the medium in which the transformant is cultured.

Images