Antiviral composition using tRNA-Splicing endonuclease subunit34

Abstract

The present invention relates to an antiviral composition using tRNA-splicing endonuclease subunit 34 (TSEN34). Since the composition according to the present invention inhibits the transcription of the hepatitis B virus (HBV) and exhibits excellent therapeutic efficacy, it can be used as a treatment for hepatitis B or as a health functional food capable of improving or alleviating hepatitis B.

Description

Technology Field

[0001] The present invention relates to an antiviral composition using tRNA-splicing endonuclease subunit 34 (TSEN34), and more specifically, to a composition for treating hepatitis B comprising a TSEN34 protein, or a TSEN34 expression promoter or activator. Background Technology

[0002] The Hepatitis B virus (HBV) causes the most harm to humanity among all viral infections, with over 350 million people currently infected worldwide. When an individual is infected with HBV, liver diseases such as chronic hepatitis, cirrhosis, and liver cancer can develop, and in severe cases, it can lead to death due to viral liver disease. HBV possesses a DNA genome and is one of the viruses with the smallest genomes known to date. Although vaccines capable of suppressing HBV infection have been developed and the rate of new infections has decreased significantly, the infection situation remains serious in developing countries, and the large number of patients infected with HBV prior to vaccination is causing significant social problems.

[0003] HBV is a virus capable of causing severe symptoms ranging from chronic hepatitis to liver cirrhosis and liver cancer. Complete treatment is impossible because no drugs have been developed to target cccDNA, which functions as a template for HBV replication; therefore, functional therapy aimed at alleviating disease symptoms is the best approach. Consequently, the development of new drugs capable of eliminating this cccDNA or inhibiting transcription from it is essential.

[0004] Currently, commercially available drugs for treating hepatitis B include interferon, lamivudine, and adefovir. However, interferon has limitations, such as the fact that more than half of treated patients do not respond to treatment, the indications for treatment are narrow, and there are relatively many side effects; lamivudine has limitations, such as the fact that the recurrence rate is very high even after the end of treatment, the duration of administration is long, and resistance develops easily; and adefovir has limitations, such as the high cost, limited insurance coverage, and the fact that the same therapeutic effect cannot be expected in patients.

[0005] Against this backdrop, there is a growing need for a treatment for hepatitis B infection that offers higher therapeutic efficacy due to its excellent transcriptional inhibitory effect against the hepatitis B virus. The problem to be solved

[0006] The inventors prepared an antiviral composition using tRNA-splicing endonuclease subunit 34 (TSEN34), and confirmed that the composition according to the present invention inhibits the transcription of hepatitis B virus (HBV) and increases the expression of liver-enriched transcription factors, thereby demonstrating superior therapeutic efficacy for hepatitis B.

[0007] Accordingly, the objective of the present invention is to provide a pharmaceutical composition for inhibiting, alleviating, treating, or preventing hepatitis B comprising TSEN34 as an active ingredient.

[0008] Another objective of the present invention is to provide a pharmaceutical composition for inhibiting, alleviating, treating, or preventing hepatitis B, comprising a TSEN34 expression promoter or activator as an active ingredient.

[0009] Another objective of the present invention is to provide a food composition for alleviating, inhibiting, or improving hepatitis B, comprising TSEN34.

[0010] Another objective of the present invention is to provide a food composition for alleviating, inhibiting, or improving hepatitis B, comprising an expression promoter or activator of TSEN34.

[0011] Another objective of the present invention is to provide a screening method for hepatitis B therapeutic agents using TSEN34.

[0012] Another objective of the present invention is to provide a use of TSEN34 for the treatment of hepatitis B. means of solving the problem

[0013] The present invention relates to an antiviral composition using tRNA-splicing endonuclease subunit 34 (TSEN34), and the composition according to the present invention inhibits the transcription of hepatitis B virus (HBV) and has excellent therapeutic efficacy.

[0014] The present invention will be described in more detail below.

[0016] One aspect of the present invention is a pharmaceutical composition for inhibiting, alleviating, treating, or preventing hepatitis B, comprising TSEN34 (TRNA Splicing Endonuclease Subunit 34) as an active ingredient.

[0017] The term “tRNA-Splicing endonuclease subunit34 (TSEN34)” in this specification refers to an enzyme encoded by the TSEN34 gene in humans. TSEN34 is a subunit of tRNA-splicing endonuclease and is known to catalyze intron removal, which is the first step of tRNA splicing. The inventors of the present invention have confirmed that the overexpression of TSEN34 inhibits the transcription of the hepatitis B virus (HBV) or increases the expression of the liver-enriched transcription factor HNF3β, and that TSEN34 or TSEN34 expression promoters and activators have therapeutic efficacy against hepatitis B.

[0018] The term “Hepatitis B” as used in this specification refers to a disease in which inflammation occurs in the liver due to the body’s immune response caused by infection with the Hepatitis B virus. When the Hepatitis B virus colonizes liver cells, an immune response is triggered to eliminate the virus; through this process, the infected liver cells are destroyed, leading to inflammation in the liver.

[0019] The term “hepatitis B virus” as used herein refers to a DNA virus that causes hepatitis B, also known as HBs. The hepatitis B virus contains DNA, DNA polymerase, HBc antigen, and HBe antigen in its central core.

[0020] In this specification, the term "containing as an active ingredient" means that TSEN34 or an expression promoter or activator of TSEN34 is included in an amount sufficient to achieve efficacy or activity. The quantitative upper limit of the active ingredient included in the composition of the present invention may be selected and implemented within an appropriate range by a person skilled in the art. According to one embodiment of the present invention, the composition of the present invention may be implemented as a pharmaceutical composition or a food composition.

[0021] The composition according to the present invention can inhibit the transcription of the hepatitis B virus (HBV) or increase the expression of the liver-enriched transcription factor HNF3β. According to one embodiment of the present invention, it was confirmed that when TSEN34 is overexpressed, it inhibits the transcription of HBV by reducing the activity of Enhancer I (Enh I) and Enhancer II (Enh II), which are enhancers of HBV. In addition, it was confirmed that when TSEN34 is overexpressed, it promotes the expression of HNF3β, a liver-enriched transcription factor that exerts an antiviral effect.

[0022] Another aspect of the present invention is a pharmaceutical composition for inhibiting, alleviating, treating, or preventing hepatitis B, comprising an expression promoter or activator of TSEN34 (TRNA Splicing Endonuclease Subunit 34) as an active ingredient.

[0023] In the present invention, the TSEN34 expression promoter is a substance capable of increasing the expression amount of TSEN34, and may be a recombinant vector comprising a nucleic acid encoding TSEN34, or any one selected from the group consisting of a compound, peptide, peptide mimetics, aptamer, antibody, and natural product that specifically binds to TSEN34, but is not limited thereto as long as it is a substance that promotes the expression of TSEN34.

[0024] The nucleic acid encoding the above TSEN34 may be a polynucleotide of SEQ ID NO. 1 encoding the amino acid sequence of SEQ ID NO. 2, and a functional equivalent of the TSEN34 protein represented by the amino acid sequence of SEQ ID NO. 2 may also be included within the scope of the present invention. In the present invention, a functional equivalent means a polypeptide having at least 60%, 70%, 80%, for example, 90% sequence homology with the above amino acid sequence as a result of the addition, substitution, or deletion of amino acids, and exhibiting substantially the same activity as the amino acid sequence represented by SEQ ID NO. 2.

[0025] The term “recombination vector” as used in this specification refers to a vector designed to express TSEN34. A recombination vector may be a liposome, plasmid vector, cosmid vector, bacteriophage vector, or viral vector, but is not limited thereto as long as it is a vector capable of expressing TSEN34 in the body. Examples of viral vectors include adenovirus, adeno-associated virus (AAV), retrovirus, lentivirus, herpes simplex virus, alpha virus, etc.

[0026] In one embodiment of the present invention, a recombinant vector comprising a nucleic acid encoding TSEN34 may comprise the polynucleotide of SEQ ID NO. 1.

[0027] The term "aptamer" as used in this specification refers to a single-stranded nucleic acid (DNA, RNA, or modified nucleic acid) that has a stable tertiary structure and is capable of binding to a target molecule with high affinity and specificity. Aptamers are compared to monoclonal antibodies because of their ability to bind to a target molecule with inherently high affinity (usually at the pM level) and specificity, and they have high potential as alternative antibodies, particularly to the extent that they are referred to as "chemical antibodies."

[0028] In the present invention, the "antibody" may be either one produced by TSEN34 injection or one purchased commercially. Additionally, the antibody may include a polyclonal antibody, a monoclonal antibody, and a fragment capable of binding to an epitope.

[0029] The content of the active ingredient in the composition according to the present invention can be appropriately adjusted according to the form and purpose of use, the patient's condition, the type and severity of symptoms, etc.

[0030] The daily dosage of the composition according to the present invention can be appropriately adjusted according to the form and purpose of use, the patient's condition, the type and severity of symptoms, etc., and may be 1 to 1000 μg / ml based on the content of the active ingredient, for example, 0.001 to 10000 mg / kg, but is not limited thereto.

[0031] The composition according to the present invention may be administered to mammals, including humans, by various routes. The mode of administration may be any commonly used mode, and may be administered by routes such as oral, skin, intravenous, intramuscular, subcutaneous, etc., and may be administered orally, for example.

[0032] The composition according to the present invention may be formulated and used in the form of oral formulations such as powders, granules, tablets, capsules, ointments, suspensions, emulsions, syrups, and aerosols, or parenteral formulations such as transdermal preparations, suppositories, and sterile injectable solutions, according to conventional methods.

[0033] Carriers, excipients, and diluents that may be included in the composition of the present invention may include, but are not limited to, lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, and mineral oil.

[0034] When formulating, diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrants, and surfactants commonly used in the industry may be used. Solid dosage forms for oral administration may include tablets, pills, powders, granules, capsules, etc., and such solid dosage forms may be prepared by mixing at least one excipient with the extract, for example, starch, calcium carbonate, sucrose or lactose, gelatin, etc., and in addition to simple excipients, lubricants such as magnesium styrate and talc may also be used, but are not limited thereto.

[0035] Preparations for oral administration include suspensions, liquid preparations, emulsions, syrups, ointments, etc. In addition to commonly used simple diluents such as water and liquid paraffin, various excipients, such as humectants, sweeteners, flavorings, and preservatives, may be included, but are not limited thereto.

[0036] Preparations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized preparations, suppositories, and transdermal preparations. Non-aqueous solvents and suspensions may include, but are not limited to, propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate.

[0037] Witepsol, Macrogol, Tween 61, Cacao, Laurin, Glycerozelatin, etc. may be used as suppository formulations, but are not limited thereto.

[0038] Another aspect of the present invention is a food composition for alleviating, inhibiting, or improving hepatitis B, comprising TSEN34 (TRNA Splicing Endonuclease Subunit 34).

[0039] Another aspect of the present invention is a food composition for alleviating, inhibiting, or improving hepatitis B, comprising an expression promoter or activator of TSEN34 (TRNA Splicing Endonuclease Subunit 34).

[0040] Since the food composition according to the present invention may include TSEN34, or an expression promoter or activator of TSEN34, in the same way as the pharmaceutical composition of the present invention described above, overlapping content between the two inventions is omitted to avoid excessive complexity in this specification.

[0041] The food composition according to the present invention may include ingredients that are typically added during food manufacturing, and may include, for example, proteins, carbohydrates, fats, nutrients, seasonings, and flavorings, but is not limited thereto.

[0042] Carbohydrates that may be included in the food composition according to the present invention may include monosaccharides such as glucose and fructose, disaccharides such as maltose, sucrose, and oligosaccharides, polysaccharides such as dextrin and cyclodextrin, and sugar alcohols such as xylitol, sorbitol, and erythritol, but are not limited thereto.

[0043] The flavoring agents that may be included in the food composition according to the present invention may include natural flavoring agents such as taumatin and stevia extract, and synthetic flavoring agents such as saccharin and aspartame, but are not limited thereto.

[0044] Another aspect of the present invention is a method for inhibiting, alleviating, treating, or preventing hepatitis B, comprising the step of administering to a subject a composition comprising TSEN34, a TSEN34 expression promoter, or an activator as an active ingredient.

[0045] In this specification, the term "administration" means providing a specific substance to a subject by any appropriate method. The route of administration of the composition for the alleviation, inhibition, treatment, or prevention of hepatitis B of the present invention may be oral or parenteral, as long as it can reach the target tissue. Additionally, the composition of the present invention may be administered using any device capable of delivering the active ingredient to target cells.

[0046] In this specification, the term “object” includes, but is not limited to, humans, monkeys, cattle, horses, sheep, pigs, chickens, turkeys, quails, cats, dogs, mice, rats, rabbits, or guinea pigs, and means, for example, mammals, specifically humans.

[0047] In one embodiment of the present invention, the pharmaceutical composition of the present invention may be administered alone, but may also be administered mixed with a pharmaceutical carrier selected in consideration of the method of administration and standard pharmaceutical practice.

[0048] For example, the pharmaceutical composition of the present invention may be administered orally, intraorally, or sublingually in the form of tablets, or as capsules containing excipients or alone, or as elixirs or suspensions containing chemicals that provide flavor or color. These liquid formulations may be formulated with pharmaceutically acceptable additives such as suspensions (e.g., glyceride mixtures such as methylcellulose, semi-synthetic glycerides such as witepsol, or mixtures of apricot kernel oil and PEG-6 esters, or mixtures of PEG-8 and caprylic / capric glycerides).

[0049] The dosage of the pharmaceutical composition of the present invention may vary depending on the patient's age, body weight, gender, form of administration, health condition, and degree of disease, and may be divided into one to several doses per day at regular intervals at the discretion of a doctor or pharmacist.

[0050] For example, based on the content of the active ingredient, the daily dosage may be 1 to 1000 μg / ml, but this is an example of an average case and the dosage may be higher or lower depending on individual differences.

[0051] Another aspect of the present invention is a screening method for hepatitis B therapeutic agents comprising the following steps:

[0052] A treatment step of treating cultured cells with a candidate substance;

[0053] A measurement step for measuring the expression level of TSEN34 (TRNA Splicing Endonuclease Subunit 34) in cells treated with the candidate substance; and

[0054] A screening step for selecting candidate substances that increase the expression level of TSEN34.

[0055] The term “expression level measurement” in this specification refers to measuring the expression level of mRNA and / or protein. Measuring the expression level of mRNA involves confirming the presence and degree of expression of TSEN34 mRNA in a biological sample, which can be confirmed by measuring the amount of mRNA. Analytical methods for this purpose include, but are not limited to, RT-PCR, competitive RT-PCR, real-time RT-PCR, RNase protection assay (RPA), northern blotting, and DNA microarray chips. Additionally, measuring the expression level of protein involves confirming the presence and level of expression of TSEN34 protein in a biological sample, which can be determined by confirming the amount of protein using an antibody that specifically binds to TSEN34 or by measuring the activity of the protein. Analytical methods for this include, but are not limited to, western blotting, ELISA (enzyme-linked immunosorbent assay), radioimmunoassay, radioimmunodiffusion, Ouchterlony immunodiffusion, Rocket immunoelectrophoresis, immunohistochemical staining, immunoprecipitation assay, complete fixation assay, FACS, and protein chip. Effects of the invention

[0056] The present invention relates to an antiviral composition using tRNA-splicing endonuclease subunit 34 (TSEN34). Since the composition according to the present invention inhibits the transcription of the hepatitis B virus (HBV) and exhibits excellent therapeutic efficacy, it can be used as a treatment for hepatitis B or as a health functional food capable of improving or alleviating hepatitis B. Brief explanation of the drawing

[0057] Figure 1a is a graph showing the results of calculating the multiple change for three grouped genes (ZC3H12A, TSEN34, TREX1). Figure 1b is a diagram showing the results of performing real-time PCR and PCR after treating PHH with a cytokine-like RNA-Seq scheme. Figure 1c is a photograph showing the results of a Western block analysis performed to confirm the difference in TSEN34 expression between cell lines. Figure 1d shows the results of confirming protein expression by Western blot using siRNA for TSEN34 after treating PHH with IFN-γ. Figure 2a is a diagram showing the results of measuring the degree of HBV replication by co-transfecting HepG2 with HBV 1.2mer replicon together with ZC3H12A, TREX1, and TSEN34 plasmids. Figure 2b shows the results of measuring the degree of HBV replication inhibition following the overexpression of TSEN34-Myc-Flag in HepG2 and Huh7. Figure 2c shows the results of measuring the degree of HBV replication inhibition by ELISA using Southern blot according to the overexpression of TSEN34-Myc-Flag in HepG2 and Huh7. Figure 2d is a diagram showing the results of confirming viral transcription through Northern blotting to identify the step of inhibiting HBV replication following the overexpression of TSEN34-Myc-Flag in HepG2 and Huh7. Figure 3a is a diagram showing the test process and results for confirming cccDNA levels according to TSEN34 expression using a Tet on / off system and a cccDNA on / off system using PFA. Figure 3b is a diagram showing the test process and results of confirming cccDNA levels according to TSEN34 expression by controlling the cccDNA on / off system and transfection period using PFA. Figure 3c is a diagram showing the results of HBeAg and HBsAg levels decreasing in a dose-dependent manner with TSEN34 when PHH is infected with HBV. Figure 3d is a diagram showing the result of capsid-associated HBV DNA also being reduced by TSEN34. Figure 4a is a diagram showing the structures of three reporter plasmids for the HBV enhancer region to evaluate the transcriptional inhibition of HBV by TSEN34. Figure 4b is a graph showing the results of measuring the inhibition of enhancer activity in HepG2 and Huh7 cell lines according to the overexpression of TSEN34. Figure 4c is a diagram showing the structure of a mutant reporter plasmid for the HBV enhancer region to evaluate the transcriptional repression of HBV by TSEN34. Figure 4d is a graph showing the results of measuring the inhibition of enhancer activity in HepG2 and Huh7 cell lines according to the overexpression of TSEN34 using a mutant reporter plasmid. Figure 5a shows the results of confirming the expression levels of liver-enriched transcription factors in HepG2 and Huh7 cell lines according to the overexpression of TSEN34. Figure 5b is a graph showing the results of confirming the expression levels of the liver strengthening transcription factor HNF3β in HepG2 and Huh7 cell lines according to the overexpression of TSEN34. Figure 5c shows the results of measuring the levels of phosphorylated ERK1 / 2 (p-ERK1 / 2), ERK1 / 2, phosphorylated p38 (P-p38), p38, phosphorylated JNK (P-JNK), and JNK in HepG2 and Huh7 cell lines according to the overexpression of TSEN34. Specific details for implementing the invention

[0058] The present invention will be explained in more detail below through the following examples. However, these examples are merely illustrative of the invention, and the scope of the invention is not limited by these examples.

[0060] Example 1: Materials and Method

[0061] 1-1. Cell Culture

[0062] Human liver cancer cell lines (Huh7, Korean Cell Line Bank, 60104; HepG2, American Type Culture Collection), human normal hepatocyte cell lines (LO2, The Cell Bank of Type Culture Collection of Chinese Academy of Science, CBTCCCAS), and human embryonic kidney cell lines (HEK293T) were used. HepAD38, capable of producing HBV by incorporating HBV DNA, was maintained by adding tetracycline (0.3 µg / ml) to the medium. Cultures were performed in Dulbecco's modified Eagle medium (Welgene, Seoul, Korea) containing 1% penicillin / streptomycin (Gibco; BRL, USA) and 10% fetal bovine serum (Capricon). Cells were cultured in an incubator maintained at 37°C and 5% CO2. Primary human hepatocytes (PHH) were isolated from donor livers according to the manufacturer's instructions and inoculated onto collagen-coated cell culture plates. PHH were cultured using William's E Medium (Gibco) containing Primary Hepatocyte Maintenance Supplements (CM4000, Gibco), 0.5% penicillin / streptomycin (Gibco), and MycoZap. Medium without MycoZap was used for transfection.

[0064] 1-2. Plasmid Construction and siRNA, shRNA Transfection

[0065] TREX1 (myc-DDK-tagged), ZC3H12A (myc-DDK-tagged), and TSEN34 (myc-DDK-tagged) plasmids were purchased from Origene. The sequence of the constructed TSEN34 plasmid and the coding amino acid sequence are shown in Table 1. siTSEN34#1 and siTSEN34#2 were designed and synthesized at IDT, while siTSEN34#3 was purchased as a pre-designed product from Ambion. For siControl, an siRNA negative control was purchased from Ambion. shTSEN34#1, shTSEN34#2, and shScramble plasmids were designed and synthesized at VectorBuilders. Cells were seeded in 6-well or 12-well cells at 60 to 80% confluence. After 24 hours, transfection was performed using Lipofectamin2000 (invitrogen) and Lipofectamine RNAiMAX (invitrogen) according to the manufacturer's instructions. Lipofectamin3000 (invitrogen) was used for the transfection of PHH.

[0067] Sequence number designation Sequence (5'->3') note 1 TSEN34_gene acctcgactg cgaattactg tttatgagga ggatgctggt ggtggaggtg gcgaacggcc gctccctggt gtggggagcc gaggcggtg aggccctccg ggagcgcctg gggtgtggggg gccgcacggt aggcgccctg ccccgcgggc cccgccagaa ctcgcgcctg ggcctcccgc tgctgctgat gcccgaagag gcgcggctct tggccgagat cggccgccgtg actctggtca gcgccccgc tccagactct cggcaccaca gcctggccct gacatccttc aagcgccagc aagaggagag cttccaggag cagagcgcct tggcagctga ggcccgggag acccgtcgtc aggagctcct ggagaagatt acggagggcc aggctgctaa gaagcagaaa ctagaacagg cttcaggggc cagctcaagc caggaggccg gctcgagcca ggctgccaaa gaggatgaga ccagtgatgg ccaggcttcg ggagagcagg aggaagctgg cccctcgtct tcccaagcag gaccctcaaa tggggtagcc cccttgccca gatctgctct ccttgtccag ctggccactg ccaggcctcg accggtcaag gccaggcccc tggactggcg tgtccagtct aaagactggc cccacgccgg ccgccctgcc cacgagctgc gctacagtat ctacagagac ctgtgggagc gaggcttctt cctcagtgcg gctggcaagt tcggaggtga cttcctggtc tatcctggtg accccctccg cttccacgcc cattatatcg ctcagtgctg ggcccctgag gacaccatcc cactccaaga cctggttgct gctgggcgcc ttggaaccag cgtcagaaag accctgctcc tctgttctccgcagcctgat gggtttaagt ctcaggaggt ctcaataaac ttggtatata aatgttcatg atttgaatgt ttgcgacagt cctggaaccc gtggatggtc tcatctgcat gtacaggtga gaaaaaggcc tggaggaggg ggactgactt gcccaaagtc acacacttagcc gcaaaggc ttttctgac tcctaaatct gcactctttc tacctcacta aacttccttt tgaaaagatt tctatgaaat ttcccagatg catacaaacg ttataaataa aatatagc tgggcacgat gacccacacc tgtaatccca cagaactttt ggaggccaag gcagggggat cgcttgaccgc gtaataccca gtctctacaa aaaataattt aaaaaaaaat tagccaggga tcccttgagc ctgggaagtt gaggctgctg tgagctgtga ttgcaccact gccctccagc ctgggagaca gagcaagaac ctgtctcaaa aaatatatat atgtgtgtgt gtatatatgtg agatacgttat gtattat gtatatt atatatatat tatgaaagga aatgagtatt gtaattttag gagttcagag cctggggaga aaggaaggac tctggaaggc gttctgcttt ttcatggcct gggtagtggt gaattttttt gatactgtat atttatattt tagactcttt tttggatgtg ttatattctg caatttttat aaaacacagcta ttatagtagtactactacta tgaaatcatt tacccatgtt tttgcttaag aaagtactag aacactacca ctattccaat aattacacctttatctttc aa 2 TSEN34_AA mlvvevangr slvwgaeavq alrerlgvgg rtvgalprgp rqnsrlglpl llmpeearll aeigavtlvs aprpdsrhhs laltsfkrqq eesfqeqsal aaearetrrq ellekitegq aakkqkleqa sgasssqeag ssqaakedet sdgqasgeqe eagpsssqag psngvaplpr sallvqlata rprpvkarpl dwrvqskdwp hagrpahelr ysiyrdlwer gfflsaagkf ggdflvypgd plrfhahyia qcwapedtip lqdlvaagrl gtsvrktlll cspqpdgfks qevsinlvyk cs

[0069] 1-3. Real-time Quantitative PCR

[0070] Cells were lysed using TRIzol reagent at room temperature for 10 minutes, and total RNA was extracted. 2 µg of RNA was synthesized into cDNA using the High-capacity RNA-to-cDNA Kit (Applied Biosystems). Real-time quantitative PCR was performed on a QuantStudio5 Real-Time PCR system. Amplification was verified using SYBR Green PCR Master Mix (Applied Biosystems). Results were normalized to GAPDH, and ΔΔ was calculated.

[0072] 1-4. ELISA

[0073] Cells were harvested 72 hours after transfection. At this time, the culture medium for ELISA was also harvested. The supernatant was diluted appropriately according to the transfection yield. HBeAg and HBsAg were measured using an ELISA kit (Wantai, Beijing, China) according to the manufacturer's instructions. Absorbance was measured at a wavelength of 450 nm using a microplate reader.

[0075] 1.5 Western blotting

[0076] Harvested cells were lysed in RIPA buffer (#9806, Cell signaling technology) containing a protease inhibitor cocktail (78430, Thermo Scientific) on ice for 30 minutes. After centrifugation at 13,000 rpm at 4°C for 20 minutes, the supernatant was transferred to a new tube. Subsequently, the lysate was mixed with 4X sample buffer (161-0747, Bio-rad) containing 2-mercaptoethanol (161-0710, Bio-rad), boiled at 100°C for 5 minutes, and then cooled on ice. Protein samples were separated by SDS-PAGE and transferred to a PVDF membrane using a Turbo Transfer System (170-4272, Bio-rad). After transfer, the membrane was washed with 1X TBS-T and blocked at RT for 1 hour using 5% skim milk buffer. After washing three times with 1X TBS-T buffer, a primary antibody at a ratio of 1:1000–1:2000 containing 3% BSA was used. After incubating overnight in a 4°C shaker, the antibody was washed three times with 1X TBS-T buffer, and a secondary antibody at a ratio of 1:10000 containing 3% skim milk was incubated at room temperature for 1 hour. The antibody was washed three more times and developed using ECL (Abclon).

[0078] 1.6 Southern blotting

[0079] Cells were harvested 72 hours after transfection, and the cell pellet was lysed in 100 µl of HEPES lysis buffer containing 1% NP-40 on ice for 20 minutes, followed by centrifugation at 13,000 rpm for 20 minutes at 4°C. The supernatant was transferred to a new tube, DNase I was added, and the mixture was incubated at 37°C for 1–2 hours. The capsid was precipitated on ice for 1 hour after the addition of PEG. The capsid was digested with proteinase K at 37°C for 2 hours. DNA purity was increased with phenol, chloroform, and isoamyl alcohol (PCI) and precipitated with 100% ethanol and 3M sodium acetate. DNA was separated on a 1% agarose gel by electrophoresis at 90V for approximately 3 hours and then transferred to a positively charged nylon membrane (11417240001, Roche) using the alkaline transfer method. Hybridization was performed by blocking the membrane with salmon sperm in church buffer and then adding an HBV-specific digoxigenin (DIG) labeled probe. HBV DNA was detected with the DIG probe using a DIG wash and block buffer set (11585762001, Roche), Anti-Digoxigenin (11093274910, Roche), and CSPD ready-to-use (12041677001, Roche).

[0081] 1-7. cccDNA extraction

[0082] cccDNA was extracted using Hirt-DNA extraction. To visualize the cccDNA clearly, it was boiled at 88°C for 5 minutes and then cooled to room temperature. Subsequently, the cccDNA was cleaved with EcoRI restriction enzyme at 37°C for 1 hour. After mixing with DNA loading dye, the DNA was isolated by electrophoresis on a 1.2% agarose gel at 20–25 V for approximately 18–20 hours. The subsequent process was carried out in the same manner as a Southern blot.

[0084] 1.8 Northern Blotting

[0085] Cells were harvested 72 hours after transfection, and the cell pellet was lysed with Trizol reagent at room temperature for 10 minutes to extract total RNA. Using 10 µg of total RNA, the RNA was separated by electrophoresis on a 1.5% formaldehyde-agarose gel in 1X MOPS buffer at 50V for 90 minutes. The RNA was transferred to a positively charged nylon membrane (11417240001, Roche) via 20X SSC buffer. The membrane was UV-crosslinked at 200J and detected in the same manner as a Southern blot.

[0087] 1.9 Enhancer Luciferase Analysis

[0088] The study was conducted on a 12-well scale and the cells were transfected with the enhancer reporter plasmid using the β-gal plasmid. Cells were harvested 48 hours after transfection. Cells were lysed according to the manufacturer's instructions for the Luciferase Assay system (E1500, Promega), and luciferase activity was measured using a luminometer. The measured values ​​were normalized to β-gal.

[0090] Example 2: Identification of antiviral genes among nuclease types using RNA seq analysis in PHH

[0091] We hypothesized that genes increased by cytokines would contribute to the antiviral molecular mechanism mediated by cytokines, and analyzed this using RNA sequencing. Primary Human Hepatocytes (PHH) from two different donors were used for RNA-seq.

[0092] A group infected with HBV was compared with a group infected with HBV and treated with cytokines, and an untreated control group (Mock). Subsequently, an analysis was conducted based on the hypothesis that nuclease groups could affect the HBV genome. Among them, ZC3H12A, TREX1, and TSEN34 were generally slightly decreased when two donors were infected with HBV, but increased when treated with cytokines, particularly IFN-γ and TNF-α (see 1a).

[0093] To verify RNA sequencing of screened nuclease genes, we tested whether they are induced by cytokines in human hepatocellular carcinoma cell lines HepG2 and Huh7. ZC3H12A and TREX1 were used as controls for RNA sequencing verification. ZC3H12A and TREX1 showed a tendency toward cytokine induction at the mRNA level, whereas TSEN34 did not. The expression level of TSEN34 was not cytokine-dependent at the protein level.

[0094] Since RNA seq was performed in PHH rather than cancer cell lines, it was thought that there might be differences accordingly. Real-time PCR and PCR were performed after treating PHH with a cytokine-like RNA-Seq scheme. The mRNA level of TSEN34 increased twofold compared to the control group, and showed a synergistic effect by increasing fourfold when treated with IFN-γ and TNF-α together (see Fig. 1b).

[0095] We hypothesized that the difference from cancer cells resulted from RNA sequencing performed in PHH. Western blot analysis was conducted to confirm differences in TSEN34 expression between cell lines, and the expression levels in immortalized cell lines were significantly higher than in PHH (see Fig. 1c). Additionally, IFN-γ treatment with PHH increased TSEN34, which was confirmed by siRNA targeting TSEN34 (see Fig. 1d).

[0096] These data showed that TSEN34 increased in a IFN-γ-dependent manner in PHH, but it was difficult to observe differences in cancer cell lines.

[0098] Example 3. TSEN34-Inhibited Ectopic Expression of Hepatitis B Virus

[0099] We screened cytokine-induced nucleases in RNA sequences to determine whether they actually affect HBV replication. HBV 1.2-mer replicons were co-transfected into HepG2 with ZC3H12A, TREX1, and TSEN34 plasmids. All nucleases inhibited HBV replication in a dose-dependent manner (see Fig. 2a).

[0100] Overexpression of TSEN34-Myc-Flag inhibited HBV replication in HepG2 and Huh7 in a dose-dependent manner (see Fig. 2b). HBeAg and HBsAg were also reduced in a dose-dependent manner in ELISA using Southern blotting (Fig. 2c). Viral transcription was examined via Northern blotting to confirm the steps by which TSEN34 inhibits HBV replication. Overexpression of TSEN34-Myc-flag reduced HBV RNA levels in HepG2 and Huh7 in a dose-dependent manner (Fig. 2d).

[0102] Example 4. Effect of TSEN34 Ectopic Expression on CCC DNA Levels

[0103] Since TSEN34 reduced HBV replication and RNA levels, we investigated whether there were changes in the levels of cccDNA, the template of HBV. HepAD38 cell lines were used with chromosomal-integrated HBV DNA for cccDNA detection. A tetracycline (Tet) on / off system was employed, and HBV DNA is expressed when Tet is off. To clearly distinguish the effects of TSEN34 on cccDNA between cccDNA formation and destabilization, a cccDNA on / off system using the polymerase inhibitor PFA (Phosphonoformic acid) was established. PFA halts the synthesis of min-strand HBV DNA and increases the accumulation of encapsulated pgRNA. Upon removal of PFA from the medium, pgRNA began to convert to cccDNA, allowing us to distinguish between the destabilization period and cccDNA formation (see Fig. 3a). After PFA removal, cccDNA was slightly visible starting at 18 hours and peaked at 24 hours. ETV was used as a control for PFA. ETV was used as a control for PFA. Additionally, cccDNA was enzymatically cleaved to verify the match of the corresponding band (see Fig. 3a). By adjusting the PFA and transfection periods, it was confirmed that TSEN34 did not affect cccDNA in both steps (see Fig. 3b).

[0104] Changes in cccDNA induced by TSEN34 were also confirmed in the HBV-infected system. When HBV infected PHH, the levels of HBeAg and HBsAg decreased in a dose-dependent manner with TSEN34, and capsid-associated HBV DNA was also reduced by TSEN34. In contrast, there were no significant changes in cccDNA. No changes in cccDNA induced by TSEN34 were observed in either the HBV stable cell line or the HBV-infected system. It was confirmed that the decrease in HBV DNA and RNA was not due to changes in the cccDNA levels themselves (see Figures 3c to 3d).

[0106] Example 5: Inhibition of enhancer activity due to TSEN34 overexpression

[0107] It was determined that the reduction of HBV DNA and RNA by TSEN34 was not due to changes in cccDNA. Therefore, TSEN34 was hypothesized to be involved in the repression of HBV transcription. HBV transcription can be controlled not only by four promoters but also by Enhancer I (Enh I) and Enhancer II (Enh II), which overlap with the core promoter (Enh II / Cp). Accordingly, we investigated whether TSEN34 affects the activity of enhancers using the three reporter plasmids shown in Figure 4a for the enhancer regions. Overexpression of TSEN34 reduced the activity of Enh I and Enh II in a dose-dependent manner in both HepG2 and Huh7 cell lines (see Figure 4b). Additional mutant reporter plasmids were used to more accurately identify the enhancer regions (see Figure 4c). The activity of these mutants was also reduced by the overexpression of TSEN34 (see Figure 4d). Through this, it was confirmed that TSEN34 affects all enhancer regions of HBV and inhibits HBV transcription.

[0109] Example 6: Increase in HNF3β expression following TSEN34 overexpression

[0110] It is known that HBV enhancers regulate activity by binding to liver-enriched transcription factors. Therefore, we investigated the expression levels of various transcription factors capable of regulating HBV transcription levels by binding to the HBV promoter when TSEN34 was overexpressed. HNF4α and HNF1α showed almost no change depending on the amount of TSEN34 (see Fig. 5a). Meanwhile, the expression of HNF3β, which exerts an antiviral effect by reducing HBV enhancer activity, was significantly increased by TSEN34 (see Figs. 5a to 5b). Since these HNFs are known to be regulated by MAPK (mitogen-activated protein kinase) signaling, they were confirmed to be associated with TSEN34. TSEN34 very weakly increased phosphorylated ERK1 / 2 and did not affect the levels of Jun N-terminal kinase (JNK) and p38 (see Fig. 5c). In summary, this suggests that TSEN34 may directly affect the upregulation of HNF3β or be mediated by other signaling pathways that regulate HNF3β expression.

Claims

Claim 1 A pharmaceutical composition for inhibiting, alleviating, treating, or preventing hepatitis B, comprising TSEN34 (TRNA Splicing Endonuclease Subunit 34) as an active ingredient. Claim 2 A pharmaceutical composition for inhibiting, alleviating, treating, or preventing hepatitis B, wherein the composition inhibits the transcription of the hepatitis B virus (Hepatitis B virus; HBV). Claim 3 A pharmaceutical composition for the inhibition, alleviation, treatment, or prevention of hepatitis B, wherein the composition increases the expression of liver-enriched transcription factors HNF3β. Claim 4 A pharmaceutical composition for the inhibition, alleviation, treatment, or prevention of hepatitis B, comprising an expression promoter of TSEN34 (TRNA Splicing Endonuclease Subunit 34) as an active ingredient, wherein the expression promoter of TSEN34 is a recombinant vector comprising a nucleic acid encoding TSEN34. Claim 5 delete Claim 6 delete Claim 7 In paragraph 4, the above composition is a pharmaceutical composition for inhibiting, alleviating, treating, or preventing hepatitis B, wherein the composition inhibits the transcription of the hepatitis B virus (Hepatitis B virus; HBV). Claim 8 A pharmaceutical composition for the inhibition, alleviation, treatment, or prevention of hepatitis B, wherein the composition increases the expression of liver-enriched transcription factors HNF3β. Claim 9 A food composition for alleviating, inhibiting, or improving hepatitis B, comprising TSEN34 (TRNA Splicing Endonuclease Subunit 34) as an active ingredient. Claim 10 A food composition for alleviating, inhibiting, or improving hepatitis B, comprising an expression promoter of TSEN34 (TRNA Splicing Endonuclease Subunit 34) as an active ingredient, wherein the expression promoter of TSEN34 is a recombinant vector comprising a nucleic acid encoding TSEN34. Claim 11 A screening method for a hepatitis B treatment comprising the following steps: a treatment step of treating cultured cells with a candidate substance; a measurement step of measuring the expression level of TSEN34 (TRNA Splicing Endonuclease Subunit 34) in the cells treated with the candidate substance; and a screening step of screening candidate substances that increase the expression level of TSEN34.

Images