Materials and methods for protein production

KR103012174B1Active Publication Date: 2026-09-02IMPOSSIBLE FOODS INC
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
KR1020217037340
Authority / Receiving Office
KR · KR
Patent Type
Patents
Current Assignee / Owner
Priority Date
2019-04-17
Filing Date
2020-04-17
Publication Date
2026-09-02
Estimated Expiration
2040-04-17

Smart Images

  • Figure 112021131840408-PCT00004_ABST
    Figure 112021131840408-PCT00004_ABST
Patent Text Reader

Abstract

The present document relates to materials and methods for the production of proteins. In one aspect, the present document provides a nucleic acid construct comprising a first alcohol oxidase promoter element, wherein the first alcohol oxidase promoter element comprises a mutation at one or more nucleotide positions corresponding to any of nucleotide positions 668–734 relative to sequence identification number: 28.
Need to check novelty before this filing date? Find Prior Art

Description

Technology Field

[0001] Cross-reference regarding related applications

[0002] This application claims priority to U.S. provisional application serial number 62 / 835,338 filed on April 17, 2019, the full text of which is incorporated herein by reference.

[0003] Description of the electronically submitted text file

[0004] The full text of the text file submitted electronically with the Institution is incorporated herein by reference: Sequence Listing Filename: Computer-readable format copy of 38767-0193WO1_SequenceListing.txt, Date recorded, April 17, 2020, File size 53 kilobytes.

[0005] Technology field

[0006] The present disclosure generally relates to DNA constructs and methods for using such DNA constructs to genetically modify cells, such as yeast cells or methyltrophic yeast cells. Background Technology

[0007] Recombinant expression of a product is a conventional method of producing said product. In some cases, proteins may be produced by recombinant production. A construction that can be used to efficiently express one or more products (e.g., proteins) in a cell, e.g., a yeast cell or a methyltrophic yeast cell is provided herein.

[0008] This document is based on the identification of a point mutation in an AOX1 promoter capable of conferring increased expression of a linked coding sequence, at least in part. The mutated AOX1 promoter described herein can be used, for example, for the efficient expression of an operably linked coding sequence in Pichia.

[0009] In one aspect, a nucleic acid construct is provided herein comprising a first alcohol oxidase promoter element, wherein the first alcohol oxidase promoter element comprises a mutation at one or more nucleotide positions corresponding to any of nucleotide positions 668–734 relative to SEQ ID NO: 28.

[0010] The implementation may have one or more of the following features. The first alcohol oxidase promoter element may include a mutation at one or more nucleotide positions corresponding to any of nucleotide positions 673-729 relative to sequence identification number: 28. The first alcohol oxidase promoter element may include a mutation at one or more nucleotide positions corresponding to any of nucleotide positions 678-724 relative to sequence identification number: 28. The first alcohol oxidase promoter element may include a mutation at one or more nucleotide positions corresponding to any of nucleotide positions 683-719 relative to sequence identification number: 28. The first alcohol oxidase promoter element may include a mutation at one or more nucleotide positions corresponding to any of nucleotide positions 688-714 relative to sequence identification number: 28. The first alcohol oxidase promoter element may include two or more mutations at nucleotide positions corresponding to any of nucleotide positions 668-734 relative to sequence identification number: 28. The first alcohol oxidase promoter element may include three or more mutations at nucleotide positions corresponding to any of nucleotide positions 668-734 relative to sequence identification number: 28. The first alcohol oxidase promoter element may include four or more mutations at nucleotide positions corresponding to any of nucleotide positions 668-734 relative to sequence identification number: 28. The first alcohol oxidase promoter element may include five or more mutations at nucleotide positions corresponding to any of nucleotide positions 668-734 relative to sequence identification number: 28.

[0011] In another aspect, a nucleic acid construct is provided herein comprising a first alcohol oxidase promoter element, wherein the first alcohol oxidase promoter element may comprise one or more mutations at a nucleotide position selected from the group consisting of nucleotide positions corresponding to T146, C154, T303, T426, A433, A435, T530, C572, T596, T617, T688, A696, T702, A709, A712, T714, A790, A841, and T862 relative to sequence identification number: 28.

[0012] The implementation may include one or more of the following features. The first alcohol oxidase promoter element may include two or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to T146, C154, T303, T426, A433, A435, T530, C572, T596, T617, T688, A696, T702, A709, A712, T714, A790, A841, and T862 relative to sequence identification number: 28. The first alcohol oxidase promoter element may include three or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to T146, C154, T303, T426, A433, A435, T530, C572, T596, T617, T688, A696, T702, A709, A712, T714, A790, A841, and T862 relative to sequence identification number: 28. The first alcohol oxidase promoter element may include four or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to T146, C154, T303, T426, A433, A435, T530, C572, T596, T617, T688, A696, T702, A709, A712, T714, A790, A841, and T862 relative to sequence identification number: 28. The first alcohol oxidase promoter element may include five or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to T146, C154, T303, T426, A433, A435, T530, C572, T596, T617, T688, A696, T702, A709, A712, T714, A790, A841, and T862 relative to sequence identification number: 28.The first alcohol oxidase promoter element may include one or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to T688, A696, T702, A712, and T714 relative to sequence identification number: 28. The first alcohol oxidase promoter element may include two or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to T688, A696, T702, A712, and T714 relative to sequence identification number: 28. The first alcohol oxidase promoter element may include three or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to T688, A696, T702, A712, and T714 relative to sequence identification number: 28. The first alcohol oxidase promoter element may include four or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to T688, A696, T702, A712, and T714 relative to sequence identification number: 28. The first alcohol oxidase promoter element may include mutations at nucleotide positions corresponding to T688, A696, T702, A712, and T714 relative to sequence identification number: 28.

[0013] In another aspect, a nucleic acid construct is provided herein comprising a first alcohol oxidase promoter element, wherein the first alcohol oxidase promoter element may comprise one or more mutations selected from the group consisting of mutations corresponding to sequence identification number: 28 T146C, C154T, T303C, T426A, A433T, A435G, T530A, C572T, T596C, T617C, T688C, A696T, T702C, A709G, A712G, T714G, A790G, A841T, and T862A.

[0014] The implementation may include one or more of the following features. The first alcohol oxidase promoter element may include two or more mutations selected from the group consisting of mutations corresponding to T146C, C154T, T303C, T426A, A433T, A435G, T530A, C572T, T596C, T617C, T688C, A696T, T702C, A709G, A712G, T714G, A790G, A841T, and T862A relative to sequence identification number: 28. The first alcohol oxidase promoter element may include three or more mutations selected from the group consisting of mutations corresponding to T146C, C154T, T303C, T426A, A433T, A435G, T530A, C572T, T596C, T617C, T688C, A696T, T702C, A709G, A712G, T714G, A790G, A841T, and T862A relative to sequence identification number: 28. The first alcohol oxidase promoter element may include four or more mutations selected from the group consisting of mutations corresponding to T146C, C154T, T303C, T426A, A433T, A435G, T530A, C572T, T596C, T617C, T688C, A696T, T702C, A709G, A712G, T714G, A790G, A841T, and T862A relative to sequence identification number: 28. The first alcohol oxidase promoter element may include five or more mutations selected from the group consisting of mutations corresponding to T146C, C154T, T303C, T426A, A433T, A435G, T530A, C572T, T596C, T617C, T688C, A696T, T702C, A709G, A712G, T714G, A790G, A841T, and T862A relative to sequence identification number: 28.The first alcohol oxidase promoter element may include one or more mutations selected from the group consisting of T688C, A696T, T702C, A712G, and T714G against sequence identification number: 28. The first alcohol oxidase promoter element may include two or more mutations selected from the group consisting of T688C, A696T, T702C, A712G, and T714G against sequence identification number: 28. The first alcohol oxidase promoter element may include three or more mutations selected from the group consisting of T688C, A696T, T702C, A712G, and T714G against sequence identification number: 28. The first alcohol oxidase promoter element may include four or more mutations selected from the group consisting of T688C, A696T, T702C, A712G, and T714G against sequence identification number: 28. The first alcohol oxidase promoter element may include mutations T688C, A696T, T702C, A712G, and T714G against sequence identification number: 28.

[0015] An embodiment of any of the nucleic acid constructs described herein may have one or more of the following features. The first alcohol oxidase promoter element may be an alcohol oxidase 1 promoter element. The first alcohol oxidase promoter element may have at least 90% sequence identity with respect to Sequence Identification No. 28. The first alcohol oxidase promoter element may have at least 95% sequence identity with respect to Sequence Identification No. 28. The nucleic acid construct may further comprise a nucleotide sequence encoding a first protein, wherein the nucleotide sequence encoding the first protein is operably linked to the first alcohol oxidase promoter element. The first protein may be exogenous to methyltrophic yeast cells. The first protein may be heterogeneous to methyltrophic yeast cells. The first protein may be selected from the group consisting of antibodies or fragments thereof, enzymes, regulatory proteins, peptide hormones, blood clotting proteins, cytokines, cytokine inhibitors, and heme-binding proteins. The first protein may be a heme-binding protein. The heme-binding protein may be selected from the group consisting of globin, cytochrome, cytochrome c oxidase, ligninase, catalase, and peroxidase. The heme-binding protein may be selected from the group consisting of androglobin, chlorocruorin, cytoglobin, erythrocruorin, flavohedron, globin E, globin X, globin Y, hemoglobin, histoglobin, leghemoglobin, myoglobin, neuroglobin, non-symbiotic hemoglobin, protoglobin, and truncated hemoglobin. The heme-binding protein may be non-symbiotic hemoglobin. The heme-binding protein may be leghemoglobin. The heme-binding protein may include an amino acid sequence having at least 90% sequence identity with respect to the amino acid sequence of any of sequence identification numbers: 1-27. The first alcohol oxidase promoter element may include a recognition sequence for a transcription factor.

[0016] In another aspect, a methyltrophic yeast cell comprising a first nucleic acid construct, which is any nucleic acid construct described herein, is also provided herein.

[0017] The implementation may have one or more of the following features. The methyltrophic yeast cell may be a Pichia cell, a Candida cell, a Hansenula cell, or a Torulopsis cell. The methyltrophic yeast cell may be a Pichia methanolica cell, a Pichia pastoris cell, a Candida boidinii cell, or a Hansenula polymorpha cell. The methyltrophic yeast cell may be a Pichia pastoris cell. The methyltrophic yeast cell may further comprise a second nucleic acid construct comprising a nucleotide sequence encoding a second protein, wherein the nucleotide sequence encoding the second protein is operably linked to a first alcohol oxidase promoter element or a second promoter element. The nucleotide sequence encoding the second protein may be operably linked to a second promoter element having the same sequence as the first alcohol oxidase promoter element. The second protein may be a transcription factor. The nucleotide sequence encoding the second protein may be operably linked to a second promoter element that may include a recognition sequence for the transcription factor. The first alcohol oxidase promoter element may include a recognition sequence for the transcription factor. The second protein may be a protein involved in heme biosynthesis. Proteins involved in heme biosynthesis may be selected from the group consisting of aminolevulinate synthase (ALAS), δ-aminolevulinate dehydratase (ALAD), porpogylinogen deaminase (PBGD), uroporpyrinogen III synthase (UPG3S), uroporpyrinogen III decarboxylase (UPG3D), coprotoporpyrinogen oxidase (COPROX), protoporpyrinogen IX oxidase (PROTOX), and ferrogylinogen (FC).

[0018] In another aspect, a method for producing a protein in a methyltrophic yeast cell is provided herein, comprising expressing a nucleic acid construct comprising a nucleotide sequence encoding a first protein operably linked to a first alcohol oxidase promoter element, wherein the first alcohol oxidase promoter element comprises a mutation at one or more nucleotide positions corresponding to any of nucleotide positions 668-734 relative to sequence identification number: 28.

[0019] The implementation may include one or more of the following features. The first alcohol oxidase promoter element may include a mutation at one or more nucleotide positions corresponding to any of nucleotide positions 673-729 relative to sequence identification number: 28. The first alcohol oxidase promoter element may include a mutation at one or more nucleotide positions corresponding to any of nucleotide positions 678-724 relative to sequence identification number: 28. The first alcohol oxidase promoter element may include a mutation at one or more nucleotide positions corresponding to any of nucleotide positions 683-719 relative to sequence identification number: 28. The first alcohol oxidase promoter element may include a mutation at one or more nucleotide positions corresponding to any of nucleotide positions 688-714 relative to sequence identification number: 28. The first alcohol oxidase promoter element may include two or more mutations at nucleotide positions corresponding to any of nucleotide positions 668-734 relative to sequence identification number: 28. The first alcohol oxidase promoter element may include three or more mutations at nucleotide positions corresponding to any of nucleotide positions 668-734 relative to sequence identification number: 28. The first alcohol oxidase promoter element may include four or more mutations at nucleotide positions corresponding to any of nucleotide positions 668-734 relative to sequence identification number: 28. The first alcohol oxidase promoter element may include five or more mutations at nucleotide positions corresponding to any of nucleotide positions 668-734 relative to sequence identification number: 28.

[0020] In another aspect, a method for producing a protein in a methyltrophic yeast cell is also provided, comprising expressing a nucleic acid construct comprising a nucleotide sequence encoding a first protein operably linked to a first alcohol oxidase promoter element, wherein the first alcohol oxidase promoter element comprises one or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to T146, C154, T303, T426, A433, A435, T530, C572, T596, T617, T688, A696, T702, A709, A712, T714, A790, A841, and T862 relative to sequence identification number: 28.

[0021] The implementation may include one or more of the following features. The first alcohol oxidase promoter element may include two or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to T146, C154, T303, T426, A433, A435, T530, C572, T596, T617, T688, A696, T702, A709, A712, T714, A790, A841, and T862 relative to sequence identification number: 28. The first alcohol oxidase promoter element may include three or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to T146, C154, T303, T426, A433, A435, T530, C572, T596, T617, T688, A696, T702, A709, A712, T714, A790, A841, and T862 relative to sequence identification number: 28. The first alcohol oxidase promoter element may include four or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to T146, C154, T303, T426, A433, A435, T530, C572, T596, T617, T688, A696, T702, A709, A712, T714, A790, A841, and T862 relative to sequence identification number: 28. The first alcohol oxidase promoter element may include five or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to T146, C154, T303, T426, A433, A435, T530, C572, T596, T617, T688, A696, T702, A709, A712, T714, A790, A841, and T862 relative to sequence identification number: 28.The first alcohol oxidase promoter element may include one or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to T688, A696, T702, A712, and T714 relative to sequence identification number: 28. The first alcohol oxidase promoter element may include two or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to T688, A696, T702, A712, and T714 relative to sequence identification number: 28. The first alcohol oxidase promoter element may include three or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to T688, A696, T702, A712, and T714 relative to sequence identification number: 28. The first alcohol oxidase promoter element may include four or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to T688, A696, T702, A712, and T714 compared to sequence identification number: 28. The first alcohol oxidase promoter element may include mutations at nucleotide positions corresponding to T688, A696, T702, A712, and T714 compared to sequence identification number: 28.

[0022] In another aspect, a method for producing a protein in a methyltrophic yeast cell is also provided, comprising expressing a nucleic acid construct comprising a nucleotide sequence encoding a first protein operably linked to a first alcohol oxidase promoter element, wherein the first alcohol oxidase promoter element comprises one or more mutations selected from the group consisting of mutations corresponding to sequence identification number: 28 T146C, C154T, T303C, T426A, A433T, A435G, T530A, C572T, T596C, T617C, T688C, A696T, T702C, A709G, A712G, T714G, A790G, A841T, and T862A.

[0023] The implementation may include one or more of the following features. The first alcohol oxidase promoter element may include two or more mutations selected from the group consisting of mutations corresponding to T146C, C154T, T303C, T426A, A433T, A435G, T530A, C572T, T596C, T617C, T688C, A696T, T702C, A709G, A712G, T714G, A790G, A841T, and T862A relative to sequence identification number: 28. The first alcohol oxidase promoter element may include three or more mutations selected from the group consisting of mutations corresponding to T146C, C154T, T303C, T426A, A433T, A435G, T530A, C572T, T596C, T617C, T688C, A696T, T702C, A709G, A712G, T714G, A790G, A841T, and T862A relative to sequence identification number: 28. The first alcohol oxidase promoter element may include four or more mutations selected from the group consisting of mutations corresponding to T146C, C154T, T303C, T426A, A433T, A435G, T530A, C572T, T596C, T617C, T688C, A696T, T702C, A709G, A712G, T714G, A790G, A841T, and T862A relative to sequence identification number: 28. The first alcohol oxidase promoter element may include five or more mutations selected from the group consisting of mutations corresponding to T146C, C154T, T303C, T426A, A433T, A435G, T530A, C572T, T596C, T617C, T688C, A696T, T702C, A709G, A712G, T714G, A790G, A841T, and T862A relative to sequence identification number: 28.The first alcohol oxidase promoter element may include two or more mutations selected from the group consisting of T688C, A696T, T702C, A712G, and T714G against sequence identification number: 28. The first alcohol oxidase promoter element may include three or more mutations selected from the group consisting of T688C, A696T, T702C, A712G, and T714G against sequence identification number: 28. The first alcohol oxidase promoter element may include four or more mutations selected from the group consisting of T688C, A696T, T702C, A712G, and T714G against sequence identification number: 28. The first alcohol oxidase promoter element may include mutations T688C, A696T, T702C, A712G, and T714G compared to sequence identification number: 28.

[0024] An implementation of any of the methods described herein may have one or more of the following features. The first alcohol oxidase promoter element may be an alcohol oxidase 1 promoter element. The first alcohol oxidase promoter element may have at least 90% sequence identity with respect to Sequence Identification No. 28. The first alcohol oxidase promoter element may have at least 95% sequence identity with respect to Sequence Identification No. 28. The first protein may be exogenous to methyltrophic yeast cells. The first protein may be heterogeneous to methyltrophic yeast cells. The first protein may be selected from the group consisting of antibodies or fragments thereof, enzymes, regulatory proteins, peptide hormones, blood coagulation proteins, cytokines, and heme-binding proteins. The first protein may be a heme-binding protein. The heme-binding protein may be selected from the group consisting of globin, cytochrome, cytochrome c oxidase, ligninase, catalase, and peroxidase. The heme-binding protein may be selected from the group consisting of androglobin, chlorocruorin, cytoglobin, erythrocruorin, flavohemoglobin, globin E, globin X, globin Y, hemoglobin, histoglobin, leghemoglobin, myoglobin, neuroglobin, non-symbiotic hemoglobin, protoglobin, and truncated hemoglobin. The heme-binding protein may be non-symbiotic hemoglobin. The heme-binding protein may be leghemoglobin. The heme-binding protein may comprise an amino acid sequence having at least 90% sequence identity with respect to any one of the amino acid sequences of sequence identification numbers: 1-27. The first alcohol oxidase promoter element may comprise one or more recognition sequences for transcription factors. The method may further comprise expressing a second nucleic acid construct comprising a nucleotide sequence encoding a second protein, wherein the nucleotide sequence encoding the second protein is operably linked to the first alcohol oxidase promoter element or the second promoter element.The nucleotide sequence encoding the second protein may be operably linked to a second promoter element having the same sequence as the first alcohol oxidase promoter element. The second protein may be a transcription factor. The nucleotide sequence encoding the second protein may be operably linked to a second promoter element that may include a recognition sequence for the transcription factor. The first alcohol oxidase promoter element may include a recognition sequence for the transcription factor. The second protein may be a protein involved in heme biosynthesis. The protein involved in heme biosynthesis may be selected from the group consisting of ALAS, ALAD, PBGD, UPG3S, UPG3D, COPROX, PROTOX, and FC. The method may be performed in the absence of added methanol.

[0025] In another aspect, Pichia pastoris cells are provided herein comprising a nucleic acid construct comprising a nucleotide sequence encoding a first alcohol oxidase promoter element, wherein the first alcohol oxidase promoter element comprises one or more mutations selected from the group consisting of mutations corresponding to sequence identification number: 28 T146C, C154T, T303C, T426A, A433T, A435G, T530A, C572T, T596C, T617C, T688C, A696T, T702C, A709G, A712G, T714G, A790G, A841T, and T862A. In some embodiments, one or more mutations may be selected from the group consisting of mutations corresponding to T688C, A696T, T702C, A712G, and T714G relative to sequence identification number: 28.

[0026] In another aspect, a method for producing leghemoglobin is also provided herein, comprising expressing a nucleic acid construct comprising a nucleotide sequence encoding leghemoglobin operably linked to a first alcohol oxidase promoter element, wherein the first alcohol oxidase promoter element comprises one or more mutations selected from the group consisting of mutations corresponding to T146C, C154T, T303C, T426A, A433T, A435G, T530A, C572T, T596C, T617C, T688C, A696T, T702C, A709G, A712G, T714G, A790G, A841T, and T862A relative to sequence identification number: 28. In some embodiments, the method may be carried out in the absence of added methanol. In some embodiments, one or more mutations may be selected from the group consisting of mutations corresponding to T688C, A696T, T702C, A712G, and T714G relative to sequence identification number: 28.

[0027] In another aspect, a Pichia Pastoris cell is provided herein comprising a first nucleic acid construct comprising a nucleotide sequence having at least 90% sequence identity with respect to sequence identification number: 28, wherein the first nucleic acid construct comprises one or more mutations selected from the group consisting of mutations corresponding to T146C, C154T, T303C, T426A, A433T, A435G, T530A, C572T, T596C, T617C, T688C, A696T, T702C, A709G, A712G, T714G, A790G, A841T, and T862A with respect to sequence identification number: 28. In some embodiments, one or more mutations may be selected from the group consisting of mutations corresponding to T688C, A696T, T702C, A712G, and T714G relative to sequence identification number: 28.

[0028] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by a person skilled in the art to which the present invention pertains. Methods and materials similar or equivalent to those described herein may be used to practice the present invention, but suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In the event of a conflict, this specification, including definitions, shall prevail. Furthermore, materials, methods, and examples are merely illustrative and are not intended to be limiting.

[0029] Details of one or more embodiments of the present invention are set forth in the accompanying drawings and the following description. Other features, objects, and advantages of the present invention will be apparent from the description and drawings, and from the claims. In accordance with standard practice of patent law, the word "comprising" in the claims may be replaced with "essentially made of" or "made of." Brief explanation of the drawing

[0030] Figure 1 provides the sequence of an exemplary heme-binding protein (sequence identification number: 1-27). Figure 2 provides the sequences of pAOX1 wild-type and mutant sequences (sequence identification numbers: 28-29). Figure 3 is an image showing the growth of pMx0414 transformants on YPD medium. Figure 4 is a graph plotting the relative expression of GFP in strains MxY0270 and MxY0279 under different growth conditions. Figure 5 is a comparison of parts of the sequences of MxG0038 and MxG0220. Figure 6 is a graph plotting the relative expression of GFP in strains MxY0964, MxY965, and MxY1039. Figure 7 provides the sequence of sequence identification number: 30-37. Specific details for implementing the invention

[0031] This document relates to materials and methods for protein production. For example, in one aspect, this document relates to materials and methods for producing a product (e.g., protein (e.g., plant protein)) in a cell (e.g., yeast (e.g., methyltrophic yeast)) using an engineered promoter.

[0032] Methyltrophic yeasts, such as *Pichia pastoros*, are commonly used to produce recombinant products (e.g., proteins). *Pichia* strains can typically be grown on methanol as a single carbon source. Although *Pichia pastoros* has been reclassified into Komagataella species, such as *Komagataella phaffii*, *Komagataella pastoris*, or *Komagataella pseudopastoris*, it will be understood that the term '*Pichia pastoros*' is still in use and can refer to any appropriate Komagataella species. Typically, the laboratory strain of *Pichia pastoros* is *Komagataella phaffii*.

[0033] Methanol utilization can be initiated by the conversion of methanol to formaldehyde by the action of alcohol oxidase. P. Pastoris contains two genes for alcohol oxidase, AOX1 and AOX2. Strains with reduced alcohol oxidase activity ("methanol utilization slow" or MutS strains) can typically produce more recombinant products (e.g., proteins) expressed from the AOX1 promoter than strains without reduced alcohol oxidase activity. The P. Pastoris promoter for the alcohol oxidase 1 (AOX1) gene, designated as pAOX1, can be used for the production of heterologous products (e.g., proteins (e.g., industrially relevant proteins)). Expression from these promoters can be induced in the presence of methanol, flammable and toxic compounds. In some embodiments, the materials and methods described herein may enable the expression of high levels of recombinant products (e.g., proteins) from such promoters or promoter elements therefrom in the absence of methanol. In some embodiments, the materials and methods described herein may enable the expression of high levels of recombinant products (e.g., proteins) from such promoters or promoter elements therefrom in the absence of added methanol.

[0034] Expression from pAOX1 is typically absent or very poor in the presence of non-inducing carbon sources, such as glucose or glycerol. A mutation in pAOX1 that enables significant expression from pAOX1 in the absence of methanol is described herein. A mutation in pAOX1 that enables significant expression from pAOX1 in the absence of added methanol is described herein. Reference pAOX1 sequences are provided in sequence identification number: 28 (Fig. 2). Exemplary mutations in pAOX1 as described herein are provided in sequence identification number: 29 (Fig. 2). These mutations may be present individually or in any combination. These mutations may also provide a further increase in expression from pAOX1 in the presence of methanol.

[0035] Accordingly, a nucleic acid construct (sometimes also referred to as a nucleic acid molecule) comprising a promoter element having a sequence containing one or more mutations compared to a reference promoter sequence is provided herein. In some embodiments, the promoter element may be an alcohol oxidase promoter element. In some embodiments, the promoter element may have at least 70% (e.g., at least 75%, 80%, 85%, 90%, 95%, 97%, 98%, or 99%) sequence identity with respect to an alcohol oxidase promoter element (e.g., SEQ ID No. 28 or SEQ ID No. 29). In some embodiments, the promoter element may have the sequence of SEQ ID No. 29. In some embodiments, a single mutation may be present within the promoter element. For example, in some embodiments, a single mutation corresponding to a mutation at one of nucleotide positions 668-734 (e.g., nucleotide positions 673-729, nucleotide positions 678-724, nucleotide positions 683-719, or nucleotide positions 688-714) relative to sequence identification number: 28 may be present within the promoter element. For example, in some embodiments, a single mutation corresponding to one of the following mutations relative to sequence identification number: 28 may be present within the promoter element: T146C; C154T; T303C; T426A; A433T; A435G; T530A; C572T; T596C; T617C; T688C; A696T; T702C; A709G; A712G; T714G; A790G; A841T; or T862A.For example, in some embodiments, a single mutation corresponding to one of the mutations corresponding to sequence identification number: 28 may be present in the promoter element, provided that the indicated nucleus is not identical to the corresponding naturally occurring nucleus: 146C; 154T; 303C; 426A; 433T; 435G; 530A; 572T; 596C; 617C; 688C; 696T; 702C; 709G; 712G; 714G; 790G; 841T; or 862A. For example, in some embodiments, a single mutation at a position corresponding to one of the positions corresponding to sequence identification number: 28 may be present in the promoter element: T146; C154; T303; T426; A433; A435; T530; C572; T596; T617; T688; A696; T702; A709; A712; T714; A790; A841; or T862. For example, in some embodiments, a single mutation at a position corresponding to one of the following positions relative to sequence identification number: 28 may be present in the promoter element: 146; 154; 303; 426; 433; 435; 530; 572; 596; 617; 688; 696; 702; 709; 712; 714; 790; 841; or 862. For example, in some embodiments, a single mutation corresponding to one of the following mutations relative to sequence identification number: 28 may be present in the promoter element: T688C; A696T; T702C; A712G; or T714G. For example, in some embodiments, a single mutation corresponding to one of the mutations corresponding to sequence identification number: 28 may be present in the promoter element, provided that the indicated nucleus is not identical to the corresponding naturally occurring nucleus: 688C; 696T; 702C; 712G; or 714G.For example, in some embodiments, a single mutation at a position corresponding to one of the following positions relative to sequence identification number: 28 may be present in the promoter element: T688; A696; T702; A712; or T714. For example, in some embodiments, a single mutation at a position corresponding to one of the following positions relative to sequence identification number: 28 may be present in the promoter element: 688; 696; 702; 712; or 714.

[0036] Additionally, a nucleic acid construct comprising a promoter element having a sequence containing multiple (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more) mutations compared with a reference promoter sequence is provided herein. For example, in some embodiments, at least two mutations (e.g., at least 3, at least 4, at least 5, at least 10, at least 15, 2 to 5, 2 to 10, 2 to 15, 2 to 20, 5 to 10, 5 to 15, 5 to 20, 10 to 15, 10 to 20, or 15 to 20) corresponding to mutations at nucleotide positions 668-734 (e.g., nucleotide positions 673-729, nucleotide positions 678-724, nucleotide positions 683-719, or nucleotide positions 688-714) relative to sequence identification number: 28 may be present in the promoter element. For example, in some embodiments, at least two (e.g., at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 12, at least 14, at least 16, at least 18, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19) mutations corresponding to the mutations with respect to sequence identification number: 28 may be present within the promoter element: T146C; C154T; T303C; T426A; A433T; A435G; T530A; C572T; T596C; T617C; T688C; A696T; T702C; A709G; A712G; T714G; A790G; A841T; or T862A.For example, in some embodiments, at least two (e.g., at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 12, at least 14, at least 16, at least 18, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19) mutations corresponding to the mutations with respect to sequence identification number: 28 may be present in the promoter element, provided that the indicated nucleus is not identical to the corresponding naturally occurring nucleus: 146C; 154T; 303C; 426A; 433T; 435G; 530A; 572T; 596C; 617C; 688C; 696T; 702C; 709G; 712G; 714G; 790G; 841T; or 862A. For example, in some embodiments, at least two (e.g., at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 12, at least 14, at least 16, at least 18, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19) mutations may be present within the promoter element at positions corresponding to the position corresponding to sequence identification number: 28: T146; C154; T303; T426; A433; A435; T530; C572; T596; T617; T688; A696; T702; A709; A712; T714; A790; A841; or T862.For example, in some embodiments, at least two (e.g., at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 12, at least 14, at least 16, at least 18, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19) mutations may be present within the promoter element at positions corresponding to the following positions relative to sequence identification number: 28: 146; 154; 303; 426; 433; 435; 530; 572; 596; 617; 688; 696; 702; 709; 712; 714; 790; 841; or 862. For example, in some embodiments, at least two (e.g., at least three, at least four, two, three, four, or five) mutations corresponding to the mutations corresponding to sequence identification number: 28 may be present in the promoter element: T688C; A696T; T702C; A712G; or T714G. For example, in some embodiments, at least two (e.g., at least three, at least four, two, three, four, or five) mutations corresponding to the mutations corresponding to sequence identification number: 28 may be present in the promoter element, provided that the indicated nucleus is not identical to the corresponding naturally occurring nucleus: 688C; 696T; 702C; 712G; or 714G. For example, in some embodiments, at least two (e.g., at least three, at least four, two, three, four, or five) mutations corresponding to one of the following positions relative to sequence identification number: 28 may be present in the promoter element: T688; A696; T702; A712; or T714. For example, in some embodiments, at least two (e.g., at least three, at least four, two, three, four, or five) mutations corresponding to one of the following positions relative to sequence identification number: 28 may be present in the promoter element: 688; 696; 702; 712; or 714.

[0037] In some embodiments, mutations in nucleic acids may be insertions, deletions, or substitutions. In some embodiments, mutations in nucleic acids may be substitutions (e.g., mutations from guanosine to cytosine). In some embodiments, mutations in nucleic acids may be in non-coding sequences. In some embodiments, substitutions in coding sequences (e.g., coding for proteins) may be silent mutations (e.g., coding for the same amino acid). In some embodiments, substitutions in coding sequences may be non-synonymous mutations (e.g., missense mutations or nonsense mutations). In some embodiments, substitutions in coding sequences may be missense mutations (e.g., coding for different amino acids). In some embodiments, substitutions in coding sequences may be nonsense mutations (e.g., coding for an early stop codon). It will be understood that mutations may be used to alter endogenous nucleic acids, for example, using CRISPR, TALEN, and / or zinc-finger nucleases.

[0038] In some embodiments, mutations in the protein sequence may be insertions, deletions, or substitutions. It will be understood that mutations in the nucleic acid encoding the protein may cause mutations in the protein sequence. In some embodiments, mutations in the protein sequence are substitutions (e.g., mutations from cysteine ​​to serine, or mutations from cysteine ​​to alanine).

[0039] As used herein, "corresponding" nucleic acid positions (or substitutions) in nucleic acid sequences different from the reference nucleic acid sequence (e.g., in a truncated, extended, or mutated nucleic acid sequence of the pAOX1 promoter compared to the reference pAOX nucleic acid sequence, e.g., SEQ ID: 28) can be identified by performing sequence alignment between the nucleic acid sequences of interest. In some cases, it will be understood that gaps may exist in the nucleic acid alignment. Similarly, "corresponding" amino acid positions (or substitutions) in protein sequences different from the reference protein sequence (e.g., in a myoglobin protein sequence of a different organism compared to the reference myoglobin protein sequence, e.g., SEQ ID: 18) can be identified by performing sequence alignment between the protein sequences of interest. In some cases, it will be understood that gaps may exist in the protein alignment. As used herein, the reference sequence "comparison" nucleotide or amino acid positions may be the corresponding nucleotide or amino acid positions in the reference sequence.

[0040] In some embodiments, the reference sequence may be from the same taxonomic rank as the comparison sequence. In some embodiments, the reference sequence may be from the same domain as the comparison sequence. For example, in some embodiments, both the reference sequence and the comparison sequence may be from the eukaryotic domain. In some embodiments, the reference sequence may be from the same kingdom as the comparison sequence. For example, in some embodiments, both the reference sequence and the comparison sequence may be from the fungal kingdom. In some embodiments, the reference sequence may be from the same phylum as the comparison sequence. For example, in some embodiments, both the reference sequence and the comparison sequence may be from the phylum Ascomycota. In some embodiments, the reference sequence may be from the same class as the comparison sequence. For example, in some embodiments, both the reference sequence and the comparison sequence may be from the class Saccharomycetes. In some embodiments, the reference sequence may be from the same order as the comparison sequence. For example, in some embodiments, both the reference sequence and the comparison sequence may be from the order Saccharomycetales. In some embodiments, the reference sequence may be from the same family as the comparison sequence. For example, in some embodiments, both the reference sequence and the comparison sequence may be from the family Saccharomycetaceae. In some embodiments, the reference sequence may be from the same genus as the comparison sequence. For example, in some embodiments, both the reference sequence and the comparison sequence may be from the genus Pichia. In some embodiments, the reference sequence may be from the same species as the comparison sequence.

[0041] In some embodiments, the reference sequence and the comparison sequence may both be from yeast. In some embodiments, the reference sequence and the comparison sequence may both be from methyltrophic yeast.

[0042] In some embodiments, the reference sequence and the comparison sequence may have at least 50% (e.g., at least 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% or 99%) sequence identity.

[0043] In some embodiments, the nucleotide sequence of a promoter element as provided herein may contain two mutations compared with the nucleotide sequence of a reference promoter element. For example, in some embodiments, two mutations corresponding to the following mutations compared with sequence identification number: 28 may be present in the promoter sequence: T146C and C154T; T146C and T303C; T146C and T426A; T146C and A433T; T146C and A435G; T146C and T530A; T146C and C572T; T146C and T596C; T146C and T617C; T146C and T688C; T146C and A696T; T146C and T702C; T146C and A709G; T146C and A712G; T146C and T714G; T146C and A790G; T146C and A841T; T146C and T862A; C154T and T303C; C154T and T426A; C154T and A433T; C154T and A435G; C154T and T530A; C154T and C572T; C154T and T596C; C154T and T617C; C154T and T688C; C154T and A696T; C154T and T702C; C154T and A709G; C154T and A712G; C154T and T714G; C154T and A790G; C154T and A841T; C154T and T862A; T303C and T426A; T303C and A433T; T303C and A435G; T303C and T530A; T303C and C572T; T303C and T596C; T303C and T617C; T303C and T688C; T303C and A696T; T303C and T702C; T303C and A709G; T303C and A712G; T303C and T714G; T303C and A790G; T303C and A841T; T303C and T862A; T426A and A433T; T426A and A435G; T426A and T530A; T426A and C572T;T426A and T596C; T426A and T617C; T426A and T688C; T426A and A696T; T426A and T702C; T426A and A709G; T426A and A712G; T426A and T714G; T426A and A790G; T426A and A841T; T426A and T862A; A433T and A435G; A433T and T530A; A433T and C572T; A433T and T596C; A433T and T617C; A433T and T688C; A433T and A696T; A433T and T702C; A433T and A709G; A433T and A712G; A433T and T714G; A433T and A790G; A433T and A841T; A433T and T862A; A435G and T530A; A435G and C572T; A435G and T596C; A435G and T617C; A435G and T688C; A435G and A696T; A435G and T702C; A435G and A709G; A435G and A712G; A435G and T714G; A435G and A790G; A435G and A841T; A435G and T862A; T530A and C572T; T530A and T596C; T530A and T617C; T530A and T688C; T530A and A696T; T530A and T702C; T530A and A709G; T530A and A712G; T530A and T714G; T530A and A790G; T530A and A841T; T530A and T862A; C572T and T596C; C572T and T617C; C572T and T688C; C572T and A696T; C572T and T702C; C572T and A709G; C572T and A712G; C572T and T714G; C572T and A790G; C572T and A841T; C572T and T862A; T596C and T617C; T596C and T688C; T596C and A696T; T596C and T702C; T596C and A709G;T596C and A712G; T596C and T714G; T596C and A790G; T596C and A841T; T596C and T862A; T617C and T688C; T617C and A696T; T617C and T702C; T617C and A709G; T617C and A712G; T617C and T714G; T617C and A790G; T617C and A841T; T617C and T862A; T688C and A696T; T688C and T702C; T688C and A709G; T688C and A712G; T688C and T714G; T688C and A790G; T688C and A841T; T688C and T862A; A696T and T702C; A696T and A709G; A696T and A712G; A696T and T714G; A696T and A790G; A696T and A841T; A696T and T862A; T702C and A709G; T702C and A712G; T702C and T714G; T702C and A790G; T702C and A841T; T702C and T862A; A709G and A712G; A709G and T714G; A709G and A790G; A709G and A841T; A709G and T862A; A712G and T714G; A712G and A790G; A712G and A841T; A712G and T862A; T714G and A790G; T714G and A841T; T714G and T862A; A790G and A841T; A790G and T862A; or A841T and T862A.;

[0044] In some embodiments, the nucleotide sequence of a promoter element as provided herein may include three mutations compared to the nucleotide sequence of a reference promoter element. For example, in some embodiments, three mutations corresponding to the following mutations compared to sequence identification number: 28 may be present in the promoter sequence: T146C, C154T, and T303C; T146C, C154T, and T426A; T146C, C154T, and A433T; T146C, C154T, and A435G; T146C, C154T, and T530A; T146C, C154T, and C572T; T146C, C154T, and T596C; T146C, C154T, and T617C; T146C, C154T, and T688C; T146C, C154T, and A696T; T146C, C154T, and T702C; T146C, C154T, and A709G; T146C, C154T, and A712G; T146C, C154T, and T714G; T146C, C154T, and A790G; T146C, C154T, and A841T; T146C, C154T, and T862A; T146C, T303C, and T426A; T146C, T303C, and A433T; T146C, T303C, and A435G; T146C, T303C, and T530A; T146C, T303C, and C572T; T146C, T303C, and T596C; T146C, T303C, and T617C; T146C, T303C, and T688C; T146C, T303C, and A696T; T146C, T303C, and T702C; T146C, T303C, and A709G; T146C, T303C, and A712G; T146C, T303C, and T714G; T146C, T303C, and A790G; T146C, T303C, and A841T; T146C, T303C, and T862A; T146C, T426A, and A433T; T146C, T426A, and A435G; T146C, T426A, and T530A;T146C, T426A, and C572T; T146C, T426A, and T596C; T146C, T426A, and T617C; T146C, T426A, and T688C; T146C, T426A, and A696T; T146C, T426A, and T702C; T146C, T426A, and A709G; T146C, T426A, and A712G; T146C, T426A, and T714G; T146C, T426A, and A790G; T146C, T426A, and A841T; T146C, T426A, and T862A; T146C, A433T, and A435G; T146C, A433T, and T530A; T146C, A433T, and C572T; T146C, A433T, and T596C; T146C, A433T, and T617C; T146C, A433T, and T688C; T146C, A433T, and A696T; T146C, A433T, and T702C; T146C, A433T, and A709G; T146C, A433T, and A712G; T146C, A433T, and T714G; T146C, A433T, and A790G; T146C, A433T, and A841T; T146C, A433T, and T862A; T146C, A435G, and T530A; T146C, A435G, and C572T; T146C, A435G, and T596C; T146C, A435G, and T617C; T146C, A435G, and T688C; T146C, A435G, and A696T; T146C, A435G, and T702C; T146C, A435G, and A709G; T146C, A435G, and A712G; T146C, A435G, and T714G; T146C, A435G, and A790G; T146C, A435G, and A841T; T146C, A435G, and T862A; T146C, T530A, and C572T; T146C, T530A, and T596C; T146C, T530A, and T617C; T146C, T530A, and T688C;T146C, T530A, and A696T; T146C, T530A, and T702C; T146C, T530A, and A709G; T146C, T530A, and A712G; T146C, T530A, and T714G; T146C, T530A, and A790G; T146C, T530A, and A841T; T146C, T530A, and T862A; T146C, C572T, and T596C; T146C, C572T, and T617C; T146C, C572T, and T688C; T146C, C572T, and A696T; T146C, C572T, and T702C; T146C, C572T, and A709G; T146C, C572T, and A712G; T146C, C572T, and T714G; T146C, C572T, and A790G; T146C, C572T, and A841T; T146C, C572T, and T862A; T146C, T596C, and T617C; T146C, T596C, and T688C; T146C, T596C, and A696T; T146C, T596C, and T702C; T146C, T596C, and A709G; T146C, T596C, and A712G; T146C, T596C, and T714G; T146C, T596C, and A790G; T146C, T596C, and A841T; T146C, T596C, and T862A; T146C, T617C, and T688C; T146C, T617C, and A696T; T146C, T617C, and T702C; T146C, T617C, and A709G; T146C, T617C, and A712G; T146C, T617C, and T714G; T146C, T617C, and A790G; T146C, T617C, and A841T; T146C, T617C, and T862A; T146C, T688C, and A696T; T146C, T688C, and T702C; T146C, T688C, and A709G; T146C, T688C, and A712G; T146C, T688C, and T714G;T146C, T688C, and A790G; T146C, T688C, and A841T; T146C, T688C, and T862A; T146C, A696T, and T702C; T146C, A696T, and A709G; T146C, A696T, and A712G; T146C, A696T, and T714G; T146C, A696T, and A790G; T146C, A696T, and A841T; T146C, A696T, and T862A; T146C, T702C, and A709G; T146C, T702C, and A712G; T146C, T702C, and T714G; T146C, T702C, and A790G; T146C, T702C, and A841T; T146C, T702C, and T862A; T146C, A709G, and A712G; T146C, A709G, and T714G; T146C, A709G, and A790G; T146C, A709G, and A841T; T146C, A709G, and T862A; T146C, A712G, and T714G; T146C, A712G, and A790G; T146C, A712G, and A841T; T146C, A712G, and T862A; T146C, T714G, and A790G; T146C, T714G, and A841T; T146C, T714G, and T862A; T146C, A790G, and A841T; T146C, A790G, and T862A; T146C, A841T, and T862A; C154T, T303C, and T426A; C154T, T303C, and A433T; C154T, T303C, and A435G; C154T, T303C, and T530A; C154T, T303C, and C572T; C154T, T303C, and T596C; C154T, T303C, and T617C; C154T, T303C, and T688C; C154T, T303C, and A696T; C154T, T303C, and T702C; C154T, T303C, and A709G; C154T, T303C, and A712G;C154T, T303C, and T714G; C154T, T303C, and A790G; C154T, T303C, and A841T; C154T, T303C, and T862A; C154T, T426A, and A433T; C154T, T426A, and A435G; C154T, T426A, and T530A; C154T, T426A, and C572T; C154T, T426A, and T596C; C154T, T426A, and T617C; C154T, T426A, and T688C; C154T, T426A, and A696T; C154T, T426A, and T702C; C154T, T426A, and A709G; C154T, T426A, and A712G; C154T, T426A, and T714G; C154T, T426A, and A790G; C154T, T426A, and A841T; C154T, T426A, and T862A; C154T, A433T, and A435G; C154T, A433T, and T530A; C154T, A433T, and C572T; C154T, A433T, and T596C; C154T, A433T, and T617C; C154T, A433T, and T688C; C154T, A433T, and A696T; C154T, A433T, and T702C; C154T, A433T, and A709G; C154T, A433T, and A712G; C154T, A433T, and T714G; C154T, A433T, and A790G; C154T, A433T, and A841T; C154T, A433T, and T862A; C154T, A435G, and T530A; C154T, A435G, and C572T; C154T, A435G, and T596C; C154T, A435G, and T617C; C154T, A435G, and T688C; C154T, A435G, and A696T; C154T, A435G, and T702C; C154T, A435G, and A709G; C154T, A435G, and A712G; C154T, A435G, and T714G;C154T, A435G, and A790G; C154T, A435G, and A841T; C154T, A435G, and T862A; C154T, T530A, and C572T; C154T, T530A, and T596C; C154T, T530A, and T617C; C154T, T530A, and T688C; C154T, T530A, and A696T; C154T, T530A, and T702C; C154T, T530A, and A709G; C154T, T530A, and A712G; C154T, T530A, and T714G; C154T, T530A, and A790G; C154T, T530A, and A841T; C154T, T530A, and T862A; C154T, C572T, and T596C; C154T, C572T, and T617C; C154T, C572T, and T688C; C154T, C572T, and A696T; C154T, C572T, and T702C; C154T, C572T, and A709G; C154T, C572T, and A712G; C154T, C572T, and T714G; C154T, C572T, and A790G; C154T, C572T, and A841T; C154T, C572T, and T862A; C154T, T596C, and T617C; C154T, T596C, and T688C; C154T, T596C, and A696T; C154T, T596C, and T702C; C154T, T596C, and A709G; C154T, T596C, and A712G; C154T, T596C, and T714G; C154T, T596C, and A790G; C154T, T596C, and A841T; C154T, T596C, and T862A; C154T, T617C, and T688C; C154T, T617C, and A696T; C154T, T617C, and T702C; C154T, T617C, and A709G; C154T, T617C, and A712G; C154T, T617C, and T714G; C154T, T617C, and A790G;C154T, T617C, and A841T; C154T, T617C, and T862A; C154T, T688C, and A696T; C154T, T688C, and T702C; C154T, T688C, and A709G; C154T, T688C, and A712G; C154T, T688C, and T714G; C154T, T688C, and A790G; C154T, T688C, and A841T; C154T, T688C, and T862A; C154T, A696T, and T702C; C154T, A696T, and A709G; C154T, A696T, and A712G; C154T, A696T, and T714G; C154T, A696T, and A790G; C154T, A696T, and A841T; C154T, A696T, and T862A; C154T, T702C, and A709G; C154T, T702C, and A712G; C154T, T702C, and T714G; C154T, T702C, and A790G; C154T, T702C, and A841T; C154T, T702C, and T862A; C154T, A709G, and A712G; C154T, A709G, and T714G; C154T, A709G, and A790G; C154T, A709G, and A841T; C154T, A709G, and T862A; C154T, A712G, and T714G; C154T, A712G, and A790G; C154T, A712G, and A841T; C154T, A712G, and T862A; C154T, T714G, and A790G; C154T, T714G, and A841T; C154T, T714G, and T862A; C154T, A790G, and A841T; C154T, A790G, and T862A; C154T, A841T, and T862A; T303C, T426A, and A433T; T303C, T426A, and A435G; T303C, T426A, and T530A; T303C, T426A, and C572T; T303C, T426A, and T596C;T303C, T426A, and T617C; T303C, T426A, and T688C; T303C, T426A, and A696T; T303C, T426A, and T702C; T303C, T426A, and A709G; T303C, T426A, and A712G; T303C, T426A, and T714G; T303C, T426A, and A790G; T303C, T426A, and A841T; T303C, T426A, and T862A; T303C, A433T, and A435G; T303C, A433T, and T530A; T303C, A433T, and C572T; T303C, A433T, and T596C; T303C, A433T, and T617C; T303C, A433T, and T688C; T303C, A433T, and A696T; T303C, A433T, and T702C; T303C, A433T, and A709G; T303C, A433T, and A712G; T303C, A433T, and T714G; T303C, A433T, and A790G; T303C, A433T, and A841T; T303C, A433T, and T862A; T303C, A435G, and T530A; T303C, A435G, and C572T; T303C, A435G, and T596C; T303C, A435G, and T617C; T303C, A435G, and T688C; T303C, A435G, and A696T; T303C, A435G, and T702C; T303C, A435G, and A709G; T303C, A435G, and A712G; T303C, A435G, and T714G; T303C, A435G, and A790G; T303C, A435G, and A841T; T303C, A435G, and T862A; T303C, T530A, and C572T; T303C, T530A, and T596C; T303C, T530A, and T617C; T303C, T530A, and T688C; T303C, T530A, and A696T; T303C, T530A, and T702C;T303C, T530A, and A709G; T303C, T530A, and A712G; T303C, T530A, and T714G; T303C, T530A, and A790G; T303C, T530A, and A841T; T303C, T530A, and T862A; T303C, C572T, and T596C; T303C, C572T, and T617C; T303C, C572T, and T688C; T303C, C572T, and A696T; T303C, C572T, and T702C; T303C, C572T, and A709G; T303C, C572T, and A712G; T303C, C572T, and T714G; T303C, C572T, and A790G; T303C, C572T, and A841T; T303C, C572T, and T862A; T303C, T596C, and T617C; T303C, T596C, and T688C; T303C, T596C, and A696T; T303C, T596C, and T702C; T303C, T596C, and A709G; T303C, T596C, and A712G; T303C, T596C, and T714G; T303C, T596C, and A790G; T303C, T596C, and A841T; T303C, T596C, and T862A; T303C, T617C, and T688C; T303C, T617C, and A696T; T303C, T617C, and T702C; T303C, T617C, and A709G; T303C, T617C, and A712G; T303C, T617C, and T714G; T303C, T617C, and A790G; T303C, T617C, and A841T; T303C, T617C, and T862A; T303C, T688C, and A696T; T303C, T688C, and T702C; T303C, T688C, and A709G; T303C, T688C, and A712G; T303C, T688C, and T714G; T303C, T688C, and A790G; T303C, T688C, and A841T;T303C, T688C, and T862A; T303C, A696T, and T702C; T303C, A696T, and A709G; T303C, A696T, and A712G; T303C, A696T, and T714G; T303C, A696T, and A790G; T303C, A696T, and A841T; T303C, A696T, and T862A; T303C, T702C, and A709G; T303C, T702C, and A712G; T303C, T702C, and T714G; T303C, T702C, and A790G; T303C, T702C, and A841T; T303C, T702C, and T862A; T303C, A709G, and A712G; T303C, A709G, and T714G; T303C, A709G, and A790G; T303C, A709G, and A841T; T303C, A709G, and T862A; T303C, A712G, and T714G; T303C, A712G, and A790G; T303C, A712G, and A841T; T303C, A712G, and T862A; T303C, T714G, and A790G; T303C, T714G, and A841T; T303C, T714G, and T862A; T303C, A790G, and A841T; T303C, A790G, and T862A; T303C, A841T, and T862A; T426A, A433T, and A435G; T426A, A433T, and T530A; T426A, A433T, and C572T; T426A, A433T, and T596C; T426A, A433T, and T617C; T426A, A433T, and T688C; T426A, A433T, and A696T; T426A, A433T, and T702C; T426A, A433T, and A709G; T426A, A433T, and A712G; T426A, A433T, and T714G; T426A, A433T, and A790G; T426A, A433T, and A841T; T426A, A433T, and T862A;T426A, A435G, and T530A; T426A, A435G, and C572T; T426A, A435G, and T596C; T426A, A435G, and T617C; T426A, A435G, and T688C; T426A, A435G, and A696T; T426A, A435G, and T702C; T426A, A435G, and A709G; T426A, A435G, and A712G; T426A, A435G, and T714G; T426A, A435G, and A790G; T426A, A435G, and A841T; T426A, A435G, and T862A; T426A, T530A, and C572T; T426A, T530A, and T596C; T426A, T530A, and T617C; T426A, T530A, and T688C; T426A, T530A, and A696T; T426A, T530A, and T702C; T426A, T530A, and A709G; T426A, T530A, and A712G; T426A, T530A, and T714G; T426A, T530A, and A790G; T426A, T530A, and A841T; T426A, T530A, and T862A; T426A, C572T, and T596C; T426A, C572T, and T617C; T426A, C572T, and T688C; T426A, C572T, and A696T; T426A, C572T, and T702C; T426A, C572T, and A709G; T426A, C572T, and A712G; T426A, C572T, and T714G; T426A, C572T, and A790G; T426A, C572T, and A841T; T426A, C572T, and T862A; T426A, T596C, and T617C; T426A, T596C, and T688C; T426A, T596C, and A696T; T426A, T596C, and T702C; T426A, T596C, and A709G; T426A, T596C, and A712G; T426A, T596C, and T714G;T426A, T596C, and A790G; T426A, T596C, and A841T; T426A, T596C, and T862A; T426A, T617C, and T688C; T426A, T617C, and A696T; T426A, T617C, and T702C; T426A, T617C, and A709G; T426A, T617C, and A712G; T426A, T617C, and T714G; T426A, T617C, and A790G; T426A, T617C, and A841T; T426A, T617C, and T862A; T426A, T688C, and A696T; T426A, T688C, and T702C; T426A, T688C, and A709G; T426A, T688C, and A712G; T426A, T688C, and T714G; T426A, T688C, and A790G; T426A, T688C, and A841T; T426A, T688C, and T862A; T426A, A696T, and T702C; T426A, A696T, and A709G; T426A, A696T, and A712G; T426A, A696T, and T714G; T426A, A696T, and A790G; T426A, A696T, and A841T; T426A, A696T, and T862A; T426A, T702C, and A709G; T426A, T702C, and A712G; T426A, T702C, and T714G; T426A, T702C, and A790G; T426A, T702C, and A841T; T426A, T702C, and T862A; T426A, A709G, and A712G; T426A, A709G, and T714G; T426A, A709G, and A790G; T426A, A709G, and A841T; T426A, A709G, and T862A; T426A, A712G, and T714G; T426A, A712G, and A790G; T426A, A712G, and A841T; T426A, A712G, and T862A; T426A, T714G, and A790G;T426A, T714G, and A841T; T426A, T714G, and T862A; T426A, A790G, and A841T; T426A, A790G, and T862A; T426A, A841T, and T862A; A433T, A435G, and T530A; A433T, A435G, and C572T; A433T, A435G, and T596C; A433T, A435G, and T617C; A433T, A435G, and T688C; A433T, A435G, and A696T; A433T, A435G, and T702C; A433T, A435G, and A709G; A433T, A435G, and A712G; A433T, A435G, and T714G; A433T, A435G, and A790G; A433T, A435G, and A841T; A433T, A435G, and T862A; A433T, T530A, and C572T; A433T, T530A, and T596C; A433T, T530A, and T617C; A433T, T530A, and T688C; A433T, T530A, and A696T; A433T, T530A, and T702C; A433T, T530A, and A709G; A433T, T530A, and A712G; A433T, T530A, and T714G; A433T, T530A, and A790G; A433T, T530A, and A841T; A433T, T530A, and T862A; A433T, C572T, and T596C; A433T, C572T, and T617C; A433T, C572T, and T688C; A433T, C572T, and A696T; A433T, C572T, and T702C; A433T, C572T, and A709G; A433T, C572T, and A712G; A433T, C572T, and T714G; A433T, C572T, and A790G; A433T, C572T, and A841T; A433T, C572T, and T862A; A433T, T596C, and T617C; A433T, T596C, and T688C;A433T, T596C, and A696T; A433T, T596C, and T702C; A433T, T596C, and A709G; A433T, T596C, and A712G; A433T, T596C, and T714G; A433T, T596C, and A790G; A433T, T596C, and A841T; A433T, T596C, and T862A; A433T, T617C, and T688C; A433T, T617C, and A696T; A433T, T617C, and T702C; A433T, T617C, and A709G; A433T, T617C, and A712G; A433T, T617C, and T714G; A433T, T617C, and A790G; A433T, T617C, and A841T; A433T, T617C, and T862A; A433T, T688C, and A696T; A433T, T688C, and T702C; A433T, T688C, and A709G; A433T, T688C, and A712G; A433T, T688C, and T714G; A433T, T688C, and A790G; A433T, T688C, and A841T; A433T, T688C, and T862A; A433T, A696T, and T702C; A433T, A696T, and A709G; A433T, A696T, and A712G; A433T, A696T, and T714G; A433T, A696T, and A790G; A433T, A696T, and A841T; A433T, A696T, and T862A; A433T, T702C, and A709G; A433T, T702C, and A712G; A433T, T702C, and T714G; A433T, T702C, and A790G; A433T, T702C, and A841T; A433T, T702C, and T862A; A433T, A709G, and A712G; A433T, A709G, and T714G; A433T, A709G, and A790G; A433T, A709G, and A841T; A433T, A709G, and T862A;A433T, A712G, and T714G; A433T, A712G, and A790G; A433T, A712G, and A841T; A433T, A712G, and T862A; A433T, T714G, and A790G; A433T, T714G, and A841T; A433T, T714G, and T862A; A433T, A790G, and A841T; A433T, A790G, and T862A; A433T, A841T, and T862A; A435G, T530A, and C572T; A435G, T530A, and T596C; A435G, T530A, and T617C; A435G, T530A, and T688C; A435G, T530A, and A696T; A435G, T530A, and T702C; A435G, T530A, and A709G; A435G, T530A, and A712G; A435G, T530A, and T714G; A435G, T530A, and A790G; A435G, T530A, and A841T; A435G, T530A, and T862A; A435G, C572T, and T596C; A435G, C572T, and T617C; A435G, C572T, and T688C; A435G, C572T, and A696T; A435G, C572T, and T702C; A435G, C572T, and A709G; A435G, C572T, and A712G; A435G, C572T, and T714G; A435G, C572T, and A790G; A435G, C572T, and A841T; A435G, C572T, and T862A; A435G, T596C, and T617C; A435G, T596C, and T688C; A435G, T596C, and A696T; A435G, T596C, and T702C; A435G, T596C, and A709G; A435G, T596C, and A712G; A435G, T596C, and T714G; A435G, T596C, and A790G; A435G, T596C, and A841T; A435G, T596C, and T862A;A435G, T617C, and T688C; A435G, T617C, and A696T; A435G, T617C, and T702C; A435G, T617C, and A709G; A435G, T617C, and A712G; A435G, T617C, and T714G; A435G, T617C, and A790G; A435G, T617C, and A841T; A435G, T617C, and T862A; A435G, T688C, and A696T; A435G, T688C, and T702C; A435G, T688C, and A709G; A435G, T688C, and A712G; A435G, T688C, and T714G; A435G, T688C, and A790G; A435G, T688C, and A841T; A435G, T688C, and T862A; A435G, A696T, and T702C; A435G, A696T, and A709G; A435G, A696T, and A712G; A435G, A696T, and T714G; A435G, A696T, and A790G; A435G, A696T, and A841T; A435G, A696T, and T862A; A435G, T702C, and A709G; A435G, T702C, and A712G; A435G, T702C, and T714G; A435G, T702C, and A790G; A435G, T702C, and A841T; A435G, T702C, and T862A; A435G, A709G, and A712G; A435G, A709G, and T714G; A435G, A709G, and A790G; A435G, A709G, and A841T; A435G, A709G, and T862A; A435G, A712G, and T714G; A435G, A712G, and A790G; A435G, A712G, and A841T; A435G, A712G, and T862A; A435G, T714G, and A790G; A435G, T714G, and A841T; A435G, T714G, and T862A; A435G, A790G, and A841T;A435G, A790G, and T862A; A435G, A841T, and T862A; T530A, C572T, and T596C; T530A, C572T, and T617C; T530A, C572T, and T688C; T530A, C572T, and A696T; T530A, C572T, and T702C; T530A, C572T, and A709G; T530A, C572T, and A712G; T530A, C572T, and T714G; T530A, C572T, and A790G; T530A, C572T, and A841T; T530A, C572T, and T862A; T530A, T596C, and T617C; T530A, T596C, and T688C; T530A, T596C, and A696T; T530A, T596C, and T702C; T530A, T596C, and A709G; T530A, T596C, and A712G; T530A, T596C, and T714G; T530A, T596C, and A790G; T530A, T596C, and A841T; T530A, T596C, and T862A; T530A, T617C, and T688C; T530A, T617C, and A696T; T530A, T617C, and T702C; T530A, T617C, and A709G; T530A, T617C, and A712G; T530A, T617C, and T714G; T530A, T617C, and A790G; T530A, T617C, and A841T; T530A, T617C, and T862A; T530A, T688C, and A696T; T530A, T688C, and T702C; T530A, T688C, and A709G; T530A, T688C, and A712G; T530A, T688C, and T714G; T530A, T688C, and A790G; T530A, T688C, and A841T; T530A, T688C, and T862A; T530A, A696T, and T702C; T530A, A696T, and A709G; T530A, A696T, and A712G;T530A, A696T, and T714G; T530A, A696T, and A790G; T530A, A696T, and A841T; T530A, A696T, and T862A; T530A, T702C, and A709G; T530A, T702C, and A712G; T530A, T702C, and T714G; T530A, T702C, and A790G; T530A, T702C, and A841T; T530A, T702C, and T862A; T530A, A709G, and A712G; T530A, A709G, and T714G; T530A, A709G, and A790G; T530A, A709G, and A841T; T530A, A709G, and T862A; T530A, A712G, and T714G; T530A, A712G, and A790G; T530A, A712G, and A841T; T530A, A712G, and T862A; T530A, T714G, and A790G; T530A, T714G, and A841T; T530A, T714G, and T862A; T530A, A790G, and A841T; T530A, A790G, and T862A; T530A, A841T, and T862A; C572T, T596C, and T617C; C572T, T596C, and T688C; C572T, T596C, and A696T; C572T, T596C, and T702C; C572T, T596C, and A709G; C572T, T596C, and A712G; C572T, T596C, and T714G; C572T, T596C, and A790G; C572T, T596C, and A841T; C572T, T596C, and T862A; C572T, T617C, and T688C; C572T, T617C, and A696T; C572T, T617C, and T702C; C572T, T617C, and A709G; C572T, T617C, and A712G; C572T, T617C, and T714G; C572T, T617C, and A790G; C572T, T617C, and A841T;C572T, T617C, and T862A; C572T, T688C, and A696T; C572T, T688C, and T702C; C572T, T688C, and A709G; C572T, T688C, and A712G; C572T, T688C, and T714G; C572T, T688C, and A790G; C572T, T688C, and A841T; C572T, T688C, and T862A; C572T, A696T, and T702C; C572T, A696T, and A709G; C572T, A696T, and A712G; C572T, A696T, and T714G; C572T, A696T, and A790G; C572T, A696T, and A841T; C572T, A696T, and T862A; C572T, T702C, and A709G; C572T, T702C, and A712G; C572T, T702C, and T714G; C572T, T702C, and A790G; C572T, T702C, and A841T; C572T, T702C, and T862A; C572T, A709G, and A712G; C572T, A709G, and T714G; C572T, A709G, and A790G; C572T, A709G, and A841T; C572T, A709G, and T862A; C572T, A712G, and T714G; C572T, A712G, and A790G; C572T, A712G, and A841T; C572T, A712G, and T862A; C572T, T714G, and A790G; C572T, T714G, and A841T; C572T, T714G, and T862A; C572T, A790G, and A841T; C572T, A790G, and T862A; C572T, A841T, and T862A; T596C, T617C, and T688C; T596C, T617C, and A696T; T596C, T617C, and T702C; T596C, T617C, and A709G; T596C, T617C, and A712G; T596C, T617C, and T714G;T596C, T617C, and A790G; T596C, T617C, and A841T; T596C, T617C, and T862A; T596C, T688C, and A696T; T596C, T688C, and T702C; T596C, T688C, and A709G; T596C, T688C, and A712G; T596C, T688C, and T714G; T596C, T688C, and A790G; T596C, T688C, and A841T; T596C, T688C, and T862A; T596C, A696T, and T702C; T596C, A696T, and A709G; T596C, A696T, and A712G; T596C, A696T, and T714G; T596C, A696T, and A790G; T596C, A696T, and A841T; T596C, A696T, and T862A; T596C, T702C, and A709G; T596C, T702C, and A712G; T596C, T702C, and T714G; T596C, T702C, and A790G; T596C, T702C, and A841T; T596C, T702C, and T862A; T596C, A709G, and A712G; T596C, A709G, and T714G; T596C, A709G, and A790G; T596C, A709G, and A841T; T596C, A709G, and T862A; T596C, A712G, and T714G; T596C, A712G, and A790G; T596C, A712G, and A841T; T596C, A712G, and T862A; T596C, T714G, and A790G; T596C, T714G, and A841T; T596C, T714G, and T862A; T596C, A790G, and A841T; T596C, A790G, and T862A; T596C, A841T, and T862A; T617C, T688C, and A696T; T617C, T688C, and T702C; T617C, T688C, and A709G; T617C, T688C, and A712G;T617C, T688C, and T714G; T617C, T688C, and A790G; T617C, T688C, and A841T; T617C, T688C, and T862A; T617C, A696T, and T702C; T617C, A696T, and A709G; T617C, A696T, and A712G; T617C, A696T, and T714G; T617C, A696T, and A790G; T617C, A696T, and A841T; T617C, A696T, and T862A; T617C, T702C, and A709G; T617C, T702C, and A712G; T617C, T702C, and T714G; T617C, T702C, and A790G; T617C, T702C, and A841T; T617C, T702C, and T862A; T617C, A709G, and A712G; T617C, A709G, and T714G; T617C, A709G, and A790G; T617C, A709G, and A841T; T617C, A709G, and T862A; T617C, A712G, and T714G; T617C, A712G, and A790G; T617C, A712G, and A841T; T617C, A712G, and T862A; T617C, T714G, and A790G; T617C, T714G, and A841T; T617C, T714G, and T862A; T617C, A790G, and A841T; T617C, A790G, and T862A; T617C, A841T, and T862A; T688C, A696T, and T702C; T688C, A696T, and A709G; T688C, A696T, and A712G; T688C, A696T, and T714G; T688C, A696T, and A790G; T688C, A696T, and A841T; T688C, A696T, and T862A; T688C, T702C, and A709G; T688C, T702C, and A712G; T688C, T702C, and T714G; T688C, T702C, and A790G;T688C, T702C, and A841T; T688C, T702C, and T862A; T688C, A709G, and A712G; T688C, A709G, and T714G; T688C, A709G, and A790G; T688C, A709G, and A841T; T688C, A709G, and T862A; T688C, A712G, and T714G; T688C, A712G, and A790G; T688C, A712G, and A841T; T688C, A712G, and T862A; T688C, T714G, and A790G; T688C, T714G, and A841T; T688C, T714G, and T862A; T688C, A790G, and A841T; T688C, A790G, and T862A; T688C, A841T, and T862A; A696T, T702C, and A709G; A696T, T702C, and A712G; A696T, T702C, and T714G; A696T, T702C, and A790G; A696T, T702C, and A841T; A696T, T702C, and T862A; A696T, A709G, and A712G; A696T, A709G, and T714G; A696T, A709G, and A790G; A696T, A709G, and A841T; A696T, A709G, and T862A; A696T, A712G, and T714G; A696T, A712G, and A790G; A696T, A712G, and A841T; A696T, A712G, and T862A; A696T, T714G, and A790G; A696T, T714G, and A841T; A696T, T714G, and T862A; A696T, A790G, and A841T; A696T, A790G, and T862A; A696T, A841T, and T862A; T702C, A709G, and A712G; T702C, A709G, and T714G; T702C, A709G, and A790G; T702C, A709G, and A841T; T702C, A709G, and T862A;T702C, A712G, and T714G; T702C, A712G, and A790G; T702C, A712G, and A841T; T702C, A712G, and T862A; T702C, T714G, and A790G; T702C, T714G, and A841T; T702C, T714G, and T862A; T702C, A790G, and A841T; T702C, A790G, and T862A; T702C, A841T, and T862A; A709G, A712G, and T714G; A709G, A712G, and A790G; A709G, A712G, and A841T; A709G, A712G, and T862A; A709G, T714G, and A790G; A709G, T714G, and A841T; A709G, T714G, and T862A; A709G, A790G, and A841T; A709G, A790G, and T862A; A709G, A841T, and T862A; A712G, T714G, and A790G; A712G, T714G, and A841T; A712G, T714G, and T862A; A712G, A790G, and A841T; A712G, A790G, and T862A; A712G, A841T, and T862A; T714G, A790G, and A841T; T714G, A790G, and T862A; T714G, A841T, and T862A; or A790G, A841T, and T862A.;

[0045] In some embodiments, the nucleotide sequence of a promoter element as provided herein may include two mutations compared with the nucleotide sequence of a reference promoter element. For example, in some embodiments, two mutations corresponding to the following mutations compared with sequence identification number: 28 may be present in the promoter sequence: T688C and A696T; T688C and T702C; T688C and A712G; T688C and T714G; A696T and T702C; A696T and A712G; A696T and T714G; T702C and A712G; T702C and T714G; or A712G and T714G.

[0046] In some embodiments, the nucleotide sequence of a promoter element as provided herein may include three mutations compared to the nucleotide sequence of a reference promoter element. For example, in some embodiments, three mutations corresponding to the following mutations compared to sequence identification number: 28 may be present in the promoter sequence: T688C, A696T, and T702C; T688C, A696T, and A712G; T688C, A696T, and T714G; T688C, T702C, and A712G; T688C, T702C, and T714G; T688C, A712G, and T714G; A696T, T702C, and A712G; A696T, T702C, and T714G; A696T, A712G, and T714G; or T702C, A712G, and T714G.

[0047] In some embodiments, the nucleotide sequence of a promoter element as provided herein may include four mutations compared to the nucleotide sequence of a reference promoter element. For example, in some embodiments, four mutations corresponding to the following mutations compared to sequence identification number: 28 may be present in the promoter sequence: T688C, A696T, T702C, and A712G; T688C, A696T, T702C, and T714G; T688C, A696T, A712G, and T714G; T688C, T702C, A712G, and T714G; or A696T, T702C, A712G, and T714G.

[0048] In some embodiments, the nucleotide sequence of a promoter element as provided herein may include five mutations compared to the nucleotide sequence of a reference promoter element. For example, in some embodiments, five mutations corresponding to the following mutations compared to sequence identification number: 28 may be present in the promoter sequence: T688C, A696T, T702C, A712G, and T714G.

[0049] In some embodiments, the nucleotide sequence of a promoter element as provided herein may include two mutations compared with the nucleotide sequence of a reference promoter element. For example, in some embodiments, two mutations corresponding to the mutations below compared with sequence identification number: 28 may be present in the promoter sequence, provided that the indicated nucleotides are not identical to the corresponding naturally occurring nucleotides: 146C and 154T; 146C and 303C; 146C and 426A; 146C and 433T; 146C and 435G; 146C and 530A; 146C and 572T; 146C and 596C; 146C and 617C; 146C and 688C; 146C and 696T; 146C and 702C; 146C and 709G; 146C and 712G; 146C and 714G; 146C and 790G; 146C and A841T; 146C and 862A; 154T and 303C; 154T and 426A; 154T and 433T; 154T and 435G; 154T and 530A; 154T and 572T; 154T and 596C; 154T and 617C; 154T and 688C; 154T and 696T; 154T and 702C; 154T and 709G; 154T and 712G; 154T and 714G; 154T and 790G; 154T and A841T; 154T and 862A; 303C and 426A; 303C and 433T; 303C and 435G; 303C and 530A; 303C and 572T; 303C and 596C; 303C and 617C; 303C and 688C; 303C and 696T; 303C and 702C; 303C and 709G; 303C and 712G; 303C and 714G; 303C and 790G; 303C and A841T; 303C and 862A; 426A and 433T; 426A and 435G; 426A and 530A; 426A and 572T; 426A and 596C; 426A and 617C; 426A and 688C; 426A and 696T; 426A and 702C;426A and 709G; 426A and 712G; 426A and 714G; 426A and 790G; 426A and A841T; 426A and 862A; 433T and 435G; 433T and 530A; 433T and 572T; 433T and 596C; 433T and 617C; 433T and 688C; 433T and 696T; 433T and 702C; 433T and 709G; 433T and 712G; 433T and 714G; 433T and 790G; 433T and A841T; 433T and 862A; 435G and 530A; 435G and 572T; 435G and 596C; 435G and 617C; 435G and 688C; 435G and 696T; 435G and 702C; 435G and 709G; 435G and 712G; 435G and 714G; 435G and 790G; 435G and A841T; 435G and 862A; 530A and 572T; 530A and 596C; 530A and 617C; 530A and 688C; 530A and 696T; 530A and 702C; 530A and 709G; 530A and 712G; 530A and 714G; 530A and 790G; 530A and A841T; 530A and 862A; 572T and 596C; 572T and 617C; 572T and 688C; 572T and 696T; 572T and 702C; 572T and 709G; 572T and 712G; 572T and 714G; 572T and 790G; 572T and A841T; 572T and 862A; 596C and 617C; 596C and 688C; 596C and 696T; 596C and 702C; 596C and 709G; 596C and 712G; 596C and 714G; 596C and 790G; 596C and A841T; 596C and 862A; 617C and 688C; 617C and 696T; 617C and 702C; 617C and 709G; 617C and 712G; 617C and 714G; 617C and 790G; 617C and A841T; 617C and 862A; 688C and 696T;688C and 702C; 688C and 709G; 688C and 712G; 688C and 714G; 688C and 790G; 688C and A841T; 688C and 862A; 696T and 702C; 696T and 709G; 696T and 712G; 696T and 714G; 696T and 790G; 696T and A841T; 696T and 862A; 702C and 709G; 702C and 712G; 702C and 714G; 702C and 790G; 702C and A841T; 702C and 862A; 709G and 712G; 709G and 714G; 709G and 790G; 709G and A841T; 709G and 862A; 712G and 714G; 712G and 790G; 712G and A841T; 712G and 862A; 714G and 790G; 714G and A841T; 714G and 862A; 790G and A841T; 790G and 862A; or A841T and 862A.;

[0050] In some embodiments, the nucleotide sequence of a promoter element as provided herein may include three mutations compared to the nucleotide sequence of a reference promoter element. For example, in some embodiments, three mutations corresponding to the mutations below compared to sequence identification number: 28 may be present in the promoter sequence, provided that the indicated nucleotides are not identical to the corresponding naturally occurring nucleotides: 146C, 154T, and 303C; 146C, 154T, and 426A; 146C, 154T, and 433T; 146C, 154T, and 435G; 146C, 154T, and 530A; 146C, 154T, and 572T; 146C, 154T, and 596C; 146C, 154T, and 617C; 146C, 154T, and 688C; 146C, 154T, and 696T; 146C, 154T, and 702C; 146C, 154T, and 709G; 146C, 154T, and 712G; 146C, 154T, and 714G; 146C, 154T, and 790G; 146C, 154T, and A841T; 146C, 154T, and 862A; 146C, 303C, and 426A; 146C, 303C, and 433T; 146C, 303C, and 435G; 146C, 303C, and 530A; 146C, 303C, and 572T; 146C, 303C, and 596C; 146C, 303C, and 617C; 146C, 303C, and 688C; 146C, 303C, and 696T; 146C, 303C, and 702C; 146C, 303C, and 709G; 146C, 303C, and 712G; 146C, 303C, and 714G; 146C, 303C, and 790G; 146C, 303C, and A841T; 146C, 303C, and 862A; 146C, 426A, and 433T; 146C, 426A, and 435G; 146C, 426A, and 530A; 146C, 426A, and 572T; 146C, 426A, and 596C; 146C, 426A, and 617C;146C, 426A, and 688C; 146C, 426A, and 696T; 146C, 426A, and 702C; 146C, 426A, and 709G; 146C, 426A, and 712G; 146C, 426A, and 714G; 146C, 426A, and 790G; 146C, 426A, and A841T; 146C, 426A, and 862A; 146C, 433T, and 435G; 146C, 433T, and 530A; 146C, 433T, and 572T; 146C, 433T, and 596C; 146C, 433T, and 617C; 146C, 433T, and 688C; 146C, 433T, and 696T; 146C, 433T, and 702C; 146C, 433T, and 709G; 146C, 433T, and 712G; 146C, 433T, and 714G; 146C, 433T, and 790G; 146C, 433T, and A841T; 146C, 433T, and 862A; 146C, 435G, and 530A; 146C, 435G, and 572T; 146C, 435G, and 596C; 146C, 435G, and 617C; 146C, 435G, and 688C; 146C, 435G, and 696T; 146C, 435G, and 702C; 146C, 435G, and 709G; 146C, 435G, and 712G; 146C, 435G, and 714G; 146C, 435G, and 790G; 146C, 435G, and A841T; 146C, 435G, and 862A; 146C, 530A, and 572T; 146C, 530A, and 596C; 146C, 530A, and 617C; 146C, 530A, and 688C; 146C, 530A, and 696T; 146C, 530A, and 702C; 146C, 530A, and 709G; 146C, 530A, and 712G; 146C, 530A, and 714G; 146C, 530A, and 790G; 146C, 530A, and A841T; 146C, 530A, and 862A; 146C, 572T, and 596C;146C, 572T, and 617C; 146C, 572T, and 688C; 146C, 572T, and 696T; 146C, 572T, and 702C; 146C, 572T, and 709G; 146C, 572T, and 712G; 146C, 572T, and 714G; 146C, 572T, and 790G; 146C, 572T, and A841T; 146C, 572T, and 862A; 146C, 596C, and 617C; 146C, 596C, and 688C; 146C, 596C, and 696T; 146C, 596C, and 702C; 146C, 596C, and 709G; 146C, 596C, and 712G; 146C, 596C, and 714G; 146C, 596C, and 790G; 146C, 596C, and A841T; 146C, 596C, and 862A; 146C, 617C, and 688C; 146C, 617C, and 696T; 146C, 617C, and 702C; 146C, 617C, and 709G; 146C, 617C, and 712G; 146C, 617C, and 714G; 146C, 617C, and 790G; 146C, 617C, and A841T; 146C, 617C, and 862A; 146C, 688C, and 696T; 146C, 688C, and 702C; 146C, 688C, and 709G; 146C, 688C, and 712G; 146C, 688C, and 714G; 146C, 688C, and 790G; 146C, 688C, and A841T; 146C, 688C, and 862A; 146C, 696T, and 702C; 146C, 696T, and 709G; 146C, 696T, and 712G; 146C, 696T, and 714G; 146C, 696T, and 790G; 146C, 696T, and A841T; 146C, 696T, and 862A; 146C, 702C, and 709G; 146C, 702C, and 712G; 146C, 702C, and 714G; 146C, 702C, and 790G; 146C, 702C, and A841T;146C, 702C, and 862A; 146C, 709G, and 712G; 146C, 709G, and 714G; 146C, 709G, and 790G; 146C, 709G, and A841T; 146C, 709G, and 862A; 146C, 712G, and 714G; 146C, 712G, and 790G; 146C, 712G, and A841T; 146C, 712G, and 862A; 146C, 714G, and 790G; 146C, 714G, and A841T; 146C, 714G, and 862A; 146C, 790G, and A841T; 146C, 790G, and 862A; 146C, A841T, and 862A; 154T, 303C, and 426A; 154T, 303C, and 433T; 154T, 303C, and 435G; 154T, 303C, and 530A; 154T, 303C, and 572T; 154T, 303C, and 596C; 154T, 303C, and 617C; 154T, 303C, and 688C; 154T, 303C, and 696T; 154T, 303C, and 702C; 154T, 303C, and 709G; 154T, 303C, and 712G; 154T, 303C, and 714G; 154T, 303C, and 790G; 154T, 303C, and A841T; 154T, 303C, and 862A; 154T, 426A, and 433T; 154T, 426A, and 435G; 154T, 426A, and 530A; 154T, 426A, and 572T; 154T, 426A, and 596C; 154T, 426A, and 617C; 154T, 426A, and 688C; 154T, 426A, and 696T; 154T, 426A, and 702C; 154T, 426A, and 709G; 154T, 426A, and 712G; 154T, 426A, and 714G; 154T, 426A, and 790G; 154T, 426A, and A841T; 154T, 426A, and 862A; 154T, 433T, and 435G; 154T, 433T, and 530A;154T, 433T, and 572T; 154T, 433T, and 596C; 154T, 433T, and 617C; 154T, 433T, and 688C; 154T, 433T, and 696T; 154T, 433T, and 702C; 154T, 433T, and 709G; 154T, 433T, and 712G; 154T, 433T, and 714G; 154T, 433T, and 790G; 154T, 433T, and A841T; 154T, 433T, and 862A; 154T, 435G, and 530A; 154T, 435G, and 572T; 154T, 435G, and 596C; 154T, 435G, and 617C; 154T, 435G, and 688C; 154T, 435G, and 696T; 154T, 435G, and 702C; 154T, 435G, and 709G; 154T, 435G, and 712G; 154T, 435G, and 714G; 154T, 435G, and 790G; 154T, 435G, and A841T; 154T, 435G, and 862A; 154T, 530A, and 572T; 154T, 530A, and 596C; 154T, 530A, and 617C; 154T, 530A, and 688C; 154T, 530A, and 696T; 154T, 530A, and 702C; 154T, 530A, and 709G; 154T, 530A, and 712G; 154T, 530A, and 714G; 154T, 530A, and 790G; 154T, 530A, and A841T; 154T, 530A, and 862A; 154T, 572T, and 596C; 154T, 572T, and 617C; 154T, 572T, and 688C; 154T, 572T, and 696T; 154T, 572T, and 702C; 154T, 572T, and 709G; 154T, 572T, and 712G; 154T, 572T, and 714G; 154T, 572T, and 790G; 154T, 572T, and A841T; 154T, 572T, and 862A; 154T, 596C, and 617C;154T, 596C, and 688C; 154T, 596C, and 696T; 154T, 596C, and 702C; 154T, 596C, and 709G; 154T, 596C, and 712G; 154T, 596C, and 714G; 154T, 596C, and 790G; 154T, 596C, and A841T; 154T, 596C, and 862A; 154T, 617C, and 688C; 154T, 617C, and 696T; 154T, 617C, and 702C; 154T, 617C, and 709G; 154T, 617C, and 712G; 154T, 617C, and 714G; 154T, 617C, and 790G; 154T, 617C, and A841T; 154T, 617C, and 862A; 154T, 688C, and 696T; 154T, 688C, and 702C; 154T, 688C, and 709G; 154T, 688C, and 712G; 154T, 688C, and 714G; 154T, 688C, and 790G; 154T, 688C, and A841T; 154T, 688C, and 862A; 154T, 696T, and 702C; 154T, 696T, and 709G; 154T, 696T, and 712G; 154T, 696T, and 714G; 154T, 696T, and 790G; 154T, 696T, and A841T; 154T, 696T, and 862A; 154T, 702C, and 709G; 154T, 702C, and 712G; 154T, 702C, and 714G; 154T, 702C, and 790G; 154T, 702C, and A841T; 154T, 702C, and 862A; 154T, 709G, and 712G; 154T, 709G, and 714G; 154T, 709G, and 790G; 154T, 709G, and A841T; 154T, 709G, and 862A; 154T, 712G, and 714G; 154T, 712G, and 790G; 154T, 712G, and A841T; 154T, 712G, and 862A; 154T, 714G, and 790G;154T, 714G, and A841T; 154T, 714G, and 862A; 154T, 790G, and A841T; 154T, 790G, and 862A; 154T, A841T, and 862A; 303C, 426A, and 433T; 303C, 426A, and 435G; 303C, 426A, and 530A; 303C, 426A, and 572T; 303C, 426A, and 596C; 303C, 426A, and 617C; 303C, 426A, and 688C; 303C, 426A, and 696T; 303C, 426A, and 702C; 303C, 426A, and 709G; 303C, 426A, and 712G; 303C, 426A, and 714G; 303C, 426A, and 790G; 303C, 426A, and A841T; 303C, 426A, and 862A; 303C, 433T, and 435G; 303C, 433T, and 530A; 303C, 433T, and 572T; 303C, 433T, and 596C; 303C, 433T, and 617C; 303C, 433T, and 688C; 303C, 433T, and 696T; 303C, 433T, and 702C; 303C, 433T, and 709G; 303C, 433T, and 712G; 303C, 433T, and 714G; 303C, 433T, and 790G; 303C, 433T, and A841T; 303C, 433T, and 862A; 303C, 435G, and 530A; 303C, 435G, and 572T; 303C, 435G, and 596C; 303C, 435G, and 617C; 303C, 435G, and 688C; 303C, 435G, and 696T; 303C, 435G, and 702C; 303C, 435G, and 709G; 303C, 435G, and 712G; 303C, 435G, and 714G; 303C, 435G, and 790G; 303C, 435G, and A841T; 303C, 435G, and 862A; 303C, 530A, and 572T; 303C, 530A, and 596C;303C, 530A, and 617C; 303C, 530A, and 688C; 303C, 530A, and 696T; 303C, 530A, and 702C; 303C, 530A, and 709G; 303C, 530A, and 712G; 303C, 530A, and 714G; 303C, 530A, and 790G; 303C, 530A, and A841T; 303C, 530A, and 862A; 303C, 572T, and 596C; 303C, 572T, and 617C; 303C, 572T, and 688C; 303C, 572T, and 696T; 303C, 572T, and 702C; 303C, 572T, and 709G; 303C, 572T, and 712G; 303C, 572T, and 714G; 303C, 572T, and 790G; 303C, 572T, and A841T; 303C, 572T, and 862A; 303C, 596C, and 617C; 303C, 596C, and 688C; 303C, 596C, and 696T; 303C, 596C, and 702C; 303C, 596C, and 709G; 303C, 596C, and 712G; 303C, 596C, and 714G; 303C, 596C, and 790G; 303C, 596C, and A841T; 303C, 596C, and 862A; 303C, 617C, and 688C; 303C, 617C, and 696T; 303C, 617C, and 702C; 303C, 617C, and 709G; 303C, 617C, and 712G; 303C, 617C, and 714G; 303C, 617C, and 790G; 303C, 617C, and A841T; 303C, 617C, and 862A; 303C, 688C, and 696T; 303C, 688C, and 702C; 303C, 688C, and 709G; 303C, 688C, and 712G; 303C, 688C, and 714G; 303C, 688C, and 790G; 303C, 688C, and A841T; 303C, 688C, and 862A; 303C, 696T, and 702C;303C, 696T, and 709G; 303C, 696T, and 712G; 303C, 696T, and 714G; 303C, 696T, and 790G; 303C, 696T, and A841T; 303C, 696T, and 862A; 303C, 702C, and 709G; 303C, 702C, and 712G; 303C, 702C, and 714G; 303C, 702C, and 790G; 303C, 702C, and A841T; 303C, 702C, and 862A; 303C, 709G, and 712G; 303C, 709G, and 714G; 303C, 709G, and 790G; 303C, 709G, and A841T; 303C, 709G, and 862A; 303C, 712G, and 714G; 303C, 712G, and 790G; 303C, 712G, and A841T; 303C, 712G, and 862A; 303C, 714G, and 790G; 303C, 714G, and A841T; 303C, 714G, and 862A; 303C, 790G, and A841T; 303C, 790G, and 862A; 303C, A841T, and 862A; 426A, 433T, and 435G; 426A, 433T, and 530A; 426A, 433T, and 572T; 426A, 433T, and 596C; 426A, 433T, and 617C; 426A, 433T, and 688C; 426A, 433T, and 696T; 426A, 433T, and 702C; 426A, 433T, and 709G; 426A, 433T, and 712G; 426A, 433T, and 714G; 426A, 433T, and 790G; 426A, 433T, and A841T; 426A, 433T, and 862A; 426A, 435G, and 530A; 426A, 435G, and 572T; 426A, 435G, and 596C; 426A, 435G, and 617C; 426A, 435G, and 688C; 426A, 435G, and 696T; 426A, 435G, and 702C; 426A, 435G, and 709G;426A, 435G, and 712G; 426A, 435G, and 714G; 426A, 435G, and 790G; 426A, 435G, and A841T; 426A, 435G, and 862A; 426A, 530A, and 572T; 426A, 530A, and 596C; 426A, 530A, and 617C; 426A, 530A, and 688C; 426A, 530A, and 696T; 426A, 530A, and 702C; 426A, 530A, and 709G; 426A, 530A, and 712G; 426A, 530A, and 714G; 426A, 530A, and 790G; 426A, 530A, and A841T; 426A, 530A, and 862A; 426A, 572T, and 596C; 426A, 572T, and 617C; 426A, 572T, and 688C; 426A, 572T, and 696T; 426A, 572T, and 702C; 426A, 572T, and 709G; 426A, 572T, and 712G; 426A, 572T, and 714G; 426A, 572T, and 790G; 426A, 572T, and A841T; 426A, 572T, and 862A; 426A, 596C, and 617C; 426A, 596C, and 688C; 426A, 596C, and 696T; 426A, 596C, and 702C; 426A, 596C, and 709G; 426A, 596C, and 712G; 426A, 596C, and 714G; 426A, 596C, and 790G; 426A, 596C, and A841T; 426A, 596C, and 862A; 426A, 617C, and 688C; 426A, 617C, and 696T; 426A, 617C, and 702C; 426A, 617C, and 709G; 426A, 617C, and 712G; 426A, 617C, and 714G; 426A, 617C, and 790G; 426A, 617C, and A841T; 426A, 617C, and 862A; 426A, 688C, and 696T; 426A, 688C, and 702C;426A, 688C, and 709G; 426A, 688C, and 712G; 426A, 688C, and 714G; 426A, 688C, and 790G; 426A, 688C, and A841T; 426A, 688C, and 862A; 426A, 696T, and 702C; 426A, 696T, and 709G; 426A, 696T, and 712G; 426A, 696T, and 714G; 426A, 696T, and 790G; 426A, 696T, and A841T; 426A, 696T, and 862A; 426A, 702C, and 709G; 426A, 702C, and 712G; 426A, 702C, and 714G; 426A, 702C, and 790G; 426A, 702C, and A841T; 426A, 702C, and 862A; 426A, 709G, and 712G; 426A, 709G, and 714G; 426A, 709G, and 790G; 426A, 709G, and A841T; 426A, 709G, and 862A; 426A, 712G, and 714G; 426A, 712G, and 790G; 426A, 712G, and A841T; 426A, 712G, and 862A; 426A, 714G, and 790G; 426A, 714G, and A841T; 426A, 714G, and 862A; 426A, 790G, and A841T; 426A, 790G, and 862A; 426A, A841T, and 862A; 433T, 435G, and 530A; 433T, 435G, and 572T; 433T, 435G, and 596C; 433T, 435G, and 617C; 433T, 435G, and 688C; 433T, 435G, and 696T; 433T, 435G, and 702C; 433T, 435G, and 709G; 433T, 435G, and 712G; 433T, 435G, and 714G; 433T, 435G, and 790G; 433T, 435G, and A841T; 433T, 435G, and 862A; 433T, 530A, and 572T; 433T, 530A, and 596C;433T, 530A, and 617C; 433T, 530A, and 688C; 433T, 530A, and 696T; 433T, 530A, and 702C; 433T, 530A, and 709G; 433T, 530A, and 712G; 433T, 530A, and 714G; 433T, 530A, and 790G; 433T, 530A, and A841T; 433T, 530A, and 862A; 433T, 572T, and 596C; 433T, 572T, and 617C; 433T, 572T, and 688C; 433T, 572T, and 696T; 433T, 572T, and 702C; 433T, 572T, and 709G; 433T, 572T, and 712G; 433T, 572T, and 714G; 433T, 572T, and 790G; 433T, 572T, and A841T; 433T, 572T, and 862A; 433T, 596C, and 617C; 433T, 596C, and 688C; 433T, 596C, and 696T; 433T, 596C, and 702C; 433T, 596C, and 709G; 433T, 596C, and 712G; 433T, 596C, and 714G; 433T, 596C, and 790G; 433T, 596C, and A841T; 433T, 596C, and 862A; 433T, 617C, and 688C; 433T, 617C, and 696T; 433T, 617C, and 702C; 433T, 617C, and 709G; 433T, 617C, and 712G; 433T, 617C, and 714G; 433T, 617C, and 790G; 433T, 617C, and A841T; 433T, 617C, and 862A; 433T, 688C, and 696T; 433T, 688C, and 702C; 433T, 688C, and 709G; 433T, 688C, and 712G; 433T, 688C, and 714G; 433T, 688C, and 790G; 433T, 688C, and A841T; 433T, 688C, and 862A; 433T, 696T, and 702C;433T, 696T, and 709G; 433T, 696T, and 712G; 433T, 696T, and 714G; 433T, 696T, and 790G; 433T, 696T, and A841T; 433T, 696T, and 862A; 433T, 702C, and 709G; 433T, 702C, and 712G; 433T, 702C, and 714G; 433T, 702C, and 790G; 433T, 702C, and A841T; 433T, 702C, and 862A; 433T, 709G, and 712G; 433T, 709G, and 714G; 433T, 709G, and 790G; 433T, 709G, and A841T; 433T, 709G, and 862A; 433T, 712G, and 714G; 433T, 712G, and 790G; 433T, 712G, and A841T; 433T, 712G, and 862A; 433T, 714G, and 790G; 433T, 714G, and A841T; 433T, 714G, and 862A; 433T, 790G, and A841T; 433T, 790G, and 862A; 433T, A841T, and 862A; 435G, 530A, and 572T; 435G, 530A, and 596C; 435G, 530A, and 617C; 435G, 530A, and 688C; 435G, 530A, and 696T; 435G, 530A, and 702C; 435G, 530A, and 709G; 435G, 530A, and 712G; 435G, 530A, and 714G; 435G, 530A, and 790G; 435G, 530A, and A841T; 435G, 530A, and 862A; 435G, 572T, and 596C; 435G, 572T, and 617C; 435G, 572T, and 688C; 435G, 572T, and 696T; 435G, 572T, and 702C; 435G, 572T, and 709G; 435G, 572T, and 712G; 435G, 572T, and 714G; 435G, 572T, and 790G; 435G, 572T, and A841T;435G, 572T, and 862A; 435G, 596C, and 617C; 435G, 596C, and 688C; 435G, 596C, and 696T; 435G, 596C, and 702C; 435G, 596C, and 709G; 435G, 596C, and 712G; 435G, 596C, and 714G; 435G, 596C, and 790G; 435G, 596C, and A841T; 435G, 596C, and 862A; 435G, 617C, and 688C; 435G, 617C, and 696T; 435G, 617C, and 702C; 435G, 617C, and 709G; 435G, 617C, and 712G; 435G, 617C, and 714G; 435G, 617C, and 790G; 435G, 617C, and A841T; 435G, 617C, and 862A; 435G, 688C, and 696T; 435G, 688C, and 702C; 435G, 688C, and 709G; 435G, 688C, and 712G; 435G, 688C, and 714G; 435G, 688C, and 790G; 435G, 688C, and A841T; 435G, 688C, and 862A; 435G, 696T, and 702C; 435G, 696T, and 709G; 435G, 696T, and 712G; 435G, 696T, and 714G; 435G, 696T, and 790G; 435G, 696T, and A841T; 435G, 696T, and 862A; 435G, 702C, and 709G; 435G, 702C, and 712G; 435G, 702C, and 714G; 435G, 702C, and 790G; 435G, 702C, and A841T; 435G, 702C, and 862A; 435G, 709G, and 712G; 435G, 709G, and 714G; 435G, 709G, and 790G; 435G, 709G, and A841T; 435G, 709G, and 862A; 435G, 712G, and 714G; 435G, 712G, and 790G; 435G, 712G, and A841T;435G, 712G, and 862A; 435G, 714G, and 790G; 435G, 714G, and A841T; 435G, 714G, and 862A; 435G, 790G, and A841T; 435G, 790G, and 862A; 435G, A841T, and 862A; 530A, 572T, and 596C; 530A, 572T, and 617C; 530A, 572T, and 688C; 530A, 572T, and 696T; 530A, 572T, and 702C; 530A, 572T, and 709G; 530A, 572T, and 712G; 530A, 572T, and 714G; 530A, 572T, and 790G; 530A, 572T, and A841T; 530A, 572T, and 862A; 530A, 596C, and 617C; 530A, 596C, and 688C; 530A, 596C, and 696T; 530A, 596C, and 702C; 530A, 596C, and 709G; 530A, 596C, and 712G; 530A, 596C, and 714G; 530A, 596C, and 790G; 530A, 596C, and A841T; 530A, 596C, and 862A; 530A, 617C, and 688C; 530A, 617C, and 696T; 530A, 617C, and 702C; 530A, 617C, and 709G; 530A, 617C, and 712G; 530A, 617C, and 714G; 530A, 617C, and 790G; 530A, 617C, and A841T; 530A, 617C, and 862A; 530A, 688C, and 696T; 530A, 688C, and 702C; 530A, 688C, and 709G; 530A, 688C, and 712G; 530A, 688C, and 714G; 530A, 688C, and 790G; 530A, 688C, and A841T; 530A, 688C, and 862A; 530A, 696T, and 702C; 530A, 696T, and 709G; 530A, 696T, and 712G; 530A, 696T, and 714G;530A, 696T, and 790G; 530A, 696T, and A841T; 530A, 696T, and 862A; 530A, 702C, and 709G; 530A, 702C, and 712G; 530A, 702C, and 714G; 530A, 702C, and 790G; 530A, 702C, and A841T; 530A, 702C, and 862A; 530A, 709G, and 712G; 530A, 709G, and 714G; 530A, 709G, and 790G; 530A, 709G, and A841T; 530A, 709G, and 862A; 530A, 712G, and 714G; 530A, 712G, and 790G; 530A, 712G, and A841T; 530A, 712G, and 862A; 530A, 714G, and 790G; 530A, 714G, and A841T; 530A, 714G, and 862A; 530A, 790G, and A841T; 530A, 790G, and 862A; 530A, A841T, and 862A; 572T, 596C, and 617C; 572T, 596C, and 688C; 572T, 596C, and 696T; 572T, 596C, and 702C; 572T, 596C, and 709G; 572T, 596C, and 712G; 572T, 596C, and 714G; 572T, 596C, and 790G; 572T, 596C, and A841T; 572T, 596C, and 862A; 572T, 617C, and 688C; 572T, 617C, and 696T; 572T, 617C, and 702C; 572T, 617C, and 709G; 572T, 617C, and 712G; 572T, 617C, and 714G; 572T, 617C, and 790G; 572T, 617C, and A841T; 572T, 617C, and 862A; 572T, 688C, and 696T; 572T, 688C, and 702C; 572T, 688C, and 709G; 572T, 688C, and 712G; 572T, 688C, and 714G; 572T, 688C, and 790G;572T, 688C, and A841T; 572T, 688C, and 862A; 572T, 696T, and 702C; 572T, 696T, and 709G; 572T, 696T, and 712G; 572T, 696T, and 714G; 572T, 696T, and 790G; 572T, 696T, and A841T; 572T, 696T, and 862A; 572T, 702C, and 709G; 572T, 702C, and 712G; 572T, 702C, and 714G; 572T, 702C, and 790G; 572T, 702C, and A841T; 572T, 702C, and 862A; 572T, 709G, and 712G; 572T, 709G, and 714G; 572T, 709G, and 790G; 572T, 709G, and A841T; 572T, 709G, and 862A; 572T, 712G, and 714G; 572T, 712G, and 790G; 572T, 712G, and A841T; 572T, 712G, and 862A; 572T, 714G, and 790G; 572T, 714G, and A841T; 572T, 714G, and 862A; 572T, 790G, and A841T; 572T, 790G, and 862A; 572T, A841T, and 862A; 596C, 617C, and 688C; 596C, 617C, and 696T; 596C, 617C, and 702C; 596C, 617C, and 709G; 596C, 617C, and 712G; 596C, 617C, and 714G; 596C, 617C, and 790G; 596C, 617C, and A841T; 596C, 617C, and 862A; 596C, 688C, and 696T; 596C, 688C, and 702C; 596C, 688C, and 709G; 596C, 688C, and 712G; 596C, 688C, and 714G; 596C, 688C, and 790G; 596C, 688C, and A841T; 596C, 688C, and 862A; 596C, 696T, and 702C; 596C, 696T, and 709G;596C, 696T, and 712G; 596C, 696T, and 714G; 596C, 696T, and 790G; 596C, 696T, and A841T; 596C, 696T, and 862A; 596C, 702C, and 709G; 596C, 702C, and 712G; 596C, 702C, and 714G; 596C, 702C, and 790G; 596C, 702C, and A841T; 596C, 702C, and 862A; 596C, 709G, and 712G; 596C, 709G, and 714G; 596C, 709G, and 790G; 596C, 709G, and A841T; 596C, 709G, and 862A; 596C, 712G, and 714G; 596C, 712G, and 790G; 596C, 712G, and A841T; 596C, 712G, and 862A; 596C, 714G, and 790G; 596C, 714G, and A841T; 596C, 714G, and 862A; 596C, 790G, and A841T; 596C, 790G, and 862A; 596C, A841T, and 862A; 617C, 688C, and 696T; 617C, 688C, and 702C; 617C, 688C, and 709G; 617C, 688C, and 712G; 617C, 688C, and 714G; 617C, 688C, and 790G; 617C, 688C, and A841T; 617C, 688C, and 862A; 617C, 696T, and 702C; 617C, 696T, and 709G; 617C, 696T, and 712G; 617C, 696T, and 714G; 617C, 696T, and 790G; 617C, 696T, and A841T; 617C, 696T, and 862A; 617C, 702C, and 709G; 617C, 702C, and 712G; 617C, 702C, and 714G; 617C, 702C, and 790G; 617C, 702C, and A841T; 617C, 702C, and 862A; 617C, 709G, and 712G; 617C, 709G, and 714G;617C, 709G, and 790G; 617C, 709G, and A841T; 617C, 709G, and 862A; 617C, 712G, and 714G; 617C, 712G, and 790G; 617C, 712G, and A841T; 617C, 712G, and 862A; 617C, 714G, and 790G; 617C, 714G, and A841T; 617C, 714G, and 862A; 617C, 790G, and A841T; 617C, 790G, and 862A; 617C, A841T, and 862A; 688C, 696T, and 702C; 688C, 696T, and 709G; 688C, 696T, and 712G; 688C, 696T, and 714G; 688C, 696T, and 790G; 688C, 696T, and A841T; 688C, 696T, and 862A; 688C, 702C, and 709G; 688C, 702C, and 712G; 688C, 702C, and 714G; 688C, 702C, and 790G; 688C, 702C, and A841T; 688C, 702C, and 862A; 688C, 709G, and 712G; 688C, 709G, and 714G; 688C, 709G, and 790G; 688C, 709G, and A841T; 688C, 709G, and 862A; 688C, 712G, and 714G; 688C, 712G, and 790G; 688C, 712G, and A841T; 688C, 712G, and 862A; 688C, 714G, and 790G; 688C, 714G, and A841T; 688C, 714G, and 862A; 688C, 790G, and A841T; 688C, 790G, and 862A; 688C, A841T, and 862A; 696T, 702C, and 709G; 696T, 702C, and 712G; 696T, 702C, and 714G; 696T, 702C, and 790G; 696T, 702C, and A841T; 696T, 702C, and 862A; 696T, 709G, and 712G; 696T, 709G, and 714G;696T, 709G, and 790G; 696T, 709G, and A841T; 696T, 709G, and 862A; 696T, 712G, and 714G; 696T, 712G, and 790G; 696T, 712G, and A841T; 696T, 712G, and 862A; 696T, 714G, and 790G; 696T, 714G, and A841T; 696T, 714G, and 862A; 696T, 790G, and A841T; 696T, 790G, and 862A; 696T, A841T, and 862A; 702C, 709G, and 712G; 702C, 709G, and 714G; 702C, 709G, and 790G; 702C, 709G, and A841T; 702C, 709G, and 862A; 702C, 712G, and 714G; 702C, 712G, and 790G; 702C, 712G, and A841T; 702C, 712G, and 862A; 702C, 714G, and 790G; 702C, 714G, and A841T; 702C, 714G, and 862A; 702C, 790G, and A841T; 702C, 790G, and 862A; 702C, A841T, and 862A; 709G, 712G, and 714G; 709G, 712G, and 790G; 709G, 712G, and A841T; 709G, 712G, and 862A; 709G, 714G, and 790G; 709G, 714G, and A841T; 709G, 714G, and 862A; 709G, 790G, and A841T; 709G, 790G, and 862A; 709G, A841T, and 862A; 712G, 714G, and 790G; 712G, 714G, and A841T; 712G, 714G, and 862A; 712G, 790G, and A841T; 712G, 790G, and 862A; 712G, A841T, and 862A; 714G, 790G, and A841T; 714G, 790G, and 862A; 714G, A841T, and 862A; or 790G, A841T, and 862A.;

[0051] In some embodiments, the nucleotide sequence of a promoter element as provided herein may include two mutations compared with the nucleotide sequence of a reference promoter element. For example, in some embodiments, two mutations corresponding to the mutations below compared with sequence identification number: 28 may be present in the promoter sequence, provided that the indicated nucleotides are not identical to the corresponding naturally occurring nucleotides: 688C and 696T; 688C and 702C; 688C and 712G; 688C and 714G; 696T and 702C; 696T and 712G; 696T and 714G; 702C and 712G; 702C and 714G; or 712G and 714G.

[0052] In some embodiments, the nucleotide sequence of a promoter element as provided herein may include three mutations compared to the nucleotide sequence of a reference promoter element. For example, in some embodiments, three mutations corresponding to the mutations below compared to sequence identification number: 28 may be present in the promoter sequence, provided that the indicated nucleotides are not identical to the corresponding naturally occurring nucleotides: 688C, 696T, and 702C; 688C, 696T, and 712G; 688C, 696T, and 714G; 688C, 702C, and 712G; 688C, 702C, and 714G; 688C, 712G, and 714G; 696T, 702C, and 712G; 696T, 702C, and 714G; 696T, 712G, and 714G; or 702C, 712G, and 714G.

[0053] In some embodiments, the nucleotide sequence of a promoter element as provided herein may include four mutations compared to the nucleotide sequence of a reference promoter element. For example, in some embodiments, four mutations corresponding to the mutations below compared to sequence identification number: 28 may be present in the promoter sequence, provided that the indicated nucleotides are not identical to the corresponding naturally occurring nucleotides: 688C, 696T, 702C, and 712G; 688C, 696T, 702C, and 714G; 688C, 696T, 712G, and 714G; 688C, 702C, 712G, and 714G; or 696T, 702C, 712G, and 714G.

[0054] In some embodiments, the nucleotide sequence of a promoter element as provided herein may include five mutations compared to the nucleotide sequence of a reference promoter element. For example, in some embodiments, five mutations corresponding to the mutations below compared to sequence identification number: 28 may be present in the promoter sequence, provided that the indicated nucleotides are not identical to the corresponding naturally occurring nucleotides: 688C, 696T, 702C, 712G, and 714G.

[0055] In some embodiments, the nucleotide sequence of a promoter element as provided herein may contain two mutations compared to the nucleotide sequence of a reference promoter element. For example, in some embodiments, two mutations may be present in the promoter sequence at positions corresponding to the following positions compared to sequence identification number: 28: T146 and C154; T146 and T303; T146 and T426; T146 and A433; T146 and A435; T146 and T530; T146 and C572; T146 and T596; T146 and T617; T146 and T688; T146 and A696; T146 and T702; T146 and A709; T146 and A712; T146 and T714; T146 and A790; T146 and A841; T146 and T862; C154 and T303; C154 and T426; C154 and A433; C154 and A435; C154 and T530; C154 and C572; C154 and T596; C154 and T617; C154 and T688; C154 and A696; C154 and T702; C154 and A709; C154 and A712; C154 and T714; C154 and A790; C154 and A841; C154 and T862; T303 and T426; T303 and A433; T303 and A435; T303 and T530; T303 and C572; T303 and T596; T303 and T617; T303 and T688; T303 and A696; T303 and T702; T303 and A709; T303 and A712; T303 and T714; T303 and A790; T303 and A841; T303 and T862; T426 and A433; T426 and A435; T426 and T530; T426 and C572; T426 and T596; T426 and T617; T426 and T688; T426 and A696; T426 and T702; T426 and A709; T426 and A712; T426 and T714;T426 and A790; T426 and A841; T426 and T862; A433 and A435; A433 and T530; A433 and C572; A433 and T596; A433 and T617; A433 and T688; A433 and A696; A433 and T702; A433 and A709; A433 and A712; A433 and T714; A433 and A790; A433 and A841; A433 and T862; A435 and T530; A435 and C572; A435 and T596; A435 and T617; A435 and T688; A435 and A696; A435 and T702; A435 and A709; A435 and A712; A435 and T714; A435 and A790; A435 and A841; A435 and T862; T530 and C572; T530 and T596; T530 and T617; T530 and T688; T530 and A696; T530 and T702; T530 and A709; T530 and A712; T530 and T714; T530 and A790; T530 and A841; T530 and T862; C572 and T596; C572 and T617; C572 and T688; C572 and A696; C572 and T702; C572 and A709; C572 and A712; C572 and T714; C572 and A790; C572 and A841; C572 and T862; T596 and T617; T596 and T688; T596 and A696; T596 and T702; T596 and A709; T596 and A712; T596 and T714; T596 and A790; T596 and A841; T596 and T862; T617 and T688; T617 and A696; T617 and T702; T617 and A709; T617 and A712; T617 and T714; T617 and A790; T617 and A841; T617 and T862; T688 and A696; T688 and T702; T688 and A709; T688 and A712; T688 and T714;T688 and A790; T688 and A841; T688 and T862; A696 and T702; A696 and A709; A696 and A712; A696 and T714; A696 and A790; A696 and A841; A696 and T862; T702 and A709; T702 and A712; T702 and T714; T702 and A790; T702 and A841; T702 and T862; A709 and A712; A709 and T714; A709 and A790; A709 and A841; A709 and T862; A712 and T714; A712 and A790; A712 and A841; A712 and T862; T714 and A790; T714 and A841; T714 and T862; A790 and A841; A790 and T862; or A841 and T862.;

[0056] In some embodiments, the nucleotide sequence of a promoter element as provided herein may contain three mutations compared to the nucleotide sequence of a reference promoter element. For example, in some embodiments, three mutations may be present in the promoter sequence at positions corresponding to the following positions compared to sequence identification number: 28: T146, C154, and T303; T146, C154, and T426; T146, C154, and A433; T146, C154, and A435; T146, C154, and T530; T146, C154, and C572; T146, C154, and T596; T146, C154, and T617; T146, C154, and T688; T146, C154, and A696; T146, C154, and T702; T146, C154, and A709; T146, C154, and A712; T146, C154, and T714; T146, C154, and A790; T146, C154, and A841; T146, C154, and T862; T146, T303, and T426; T146, T303, and A433; T146, T303, and A435; T146, T303, and T530; T146, T303, and C572; T146, T303, and T596; T146, T303, and T617; T146, T303, and T688; T146, T303, and A696; T146, T303, and T702; T146, T303, and A709; T146, T303, and A712; T146, T303, and T714; T146, T303, and A790; T146, T303, and A841; T146, T303, and T862; T146, T426, and A433; T146, T426, and A435; T146, T426, and T530; T146, T426, and C572; T146, T426, and T596; T146, T426, and T617; T146, T426, and T688; T146, T426, and A696;T146, T426, and T702; T146, T426, and A709; T146, T426, and A712; T146, T426, and T714; T146, T426, and A790; T146, T426, and A841; T146, T426, and T862; T146, A433, and A435; T146, A433, and T530; T146, A433, and C572; T146, A433, and T596; T146, A433, and T617; T146, A433, and T688; T146, A433, and A696; T146, A433, and T702; T146, A433, and A709; T146, A433, and A712; T146, A433, and T714; T146, A433, and A790; T146, A433, and A841; T146, A433, and T862; T146, A435, and T530; T146, A435, and C572; T146, A435, and T596; T146, A435, and T617; T146, A435, and T688; T146, A435, and A696; T146, A435, and T702; T146, A435, and A709; T146, A435, and A712; T146, A435, and T714; T146, A435, and A790; T146, A435, and A841; T146, A435, and T862; T146, T530, and C572; T146, T530, and T596; T146, T530, and T617; T146, T530, and T688; T146, T530, and A696; T146, T530, and T702; T146, T530, and A709; T146, T530, and A712; T146, T530, and T714; T146, T530, and A790; T146, T530, and A841; T146, T530, and T862; T146, C572, and T596; T146, C572, and T617; T146, C572, and T688; T146, C572, and A696;T146, C572, and T702; T146, C572, and A709; T146, C572, and A712; T146, C572, and T714; T146, C572, and A790; T146, C572, and A841; T146, C572, and T862; T146, T596, and T617; T146, T596, and T688; T146, T596, and A696; T146, T596, and T702; T146, T596, and A709; T146, T596, and A712; T146, T596, and T714; T146, T596, and A790; T146, T596, and A841; T146, T596, and T862; T146, T617, and T688; T146, T617, and A696; T146, T617, and T702; T146, T617, and A709; T146, T617, and A712; T146, T617, and T714; T146, T617, and A790; T146, T617, and A841; T146, T617, and T862; T146, T688, and A696; T146, T688, and T702; T146, T688, and A709; T146, T688, and A712; T146, T688, and T714; T146, T688, and A790; T146, T688, and A841; T146, T688, and T862; T146, A696, and T702; T146, A696, and A709; T146, A696, and A712; T146, A696, and T714; T146, A696, and A790; T146, A696, and A841; T146, A696, and T862; T146, T702, and A709; T146, T702, and A712; T146, T702, and T714; T146, T702, and A790; T146, T702, and A841; T146, T702, and T862; T146, A709, and A712; T146, A709, and T714; T146, A709, and A790;T146, A709, and A841; T146, A709, and T862; T146, A712, and T714; T146, A712, and A790; T146, A712, and A841; T146, A712, and T862; T146, T714, and A790; T146, T714, and A841; T146, T714, and T862; T146, A790, and A841; T146, A790, and T862; T146, A841, and T862; C154, T303, and T426; C154, T303, and A433; C154, T303, and A435; C154, T303, and T530; C154, T303, and C572; C154, T303, and T596; C154, T303, and T617; C154, T303, and T688; C154, T303, and A696; C154, T303, and T702; C154, T303, and A709; C154, T303, and A712; C154, T303, and T714; C154, T303, and A790; C154, T303, and A841; C154, T303, and T862; C154, T426, and A433; C154, T426, and A435; C154, T426, and T530; C154, T426, and C572; C154, T426, and T596; C154, T426, and T617; C154, T426, and T688; C154, T426, and A696; C154, T426, and T702; C154, T426, and A709; C154, T426, and A712; C154, T426, and T714; C154, T426, and A790; C154, T426, and A841; C154, T426, and T862; C154, A433, and A435; C154, A433, and T530; C154, A433, and C572; C154, A433, and T596; C154, A433, and T617; C154, A433, and T688; C154, A433, and A696;C154, A433, and T702; C154, A433, and A709; C154, A433, and A712; C154, A433, and T714; C154, A433, and A790; C154, A433, and A841; C154, A433, and T862; C154, A435, and T530; C154, A435, and C572; C154, A435, and T596; C154, A435, and T617; C154, A435, and T688; C154, A435, and A696; C154, A435, and T702; C154, A435, and A709; C154, A435, and A712; C154, A435, and T714; C154, A435, and A790; C154, A435, and A841; C154, A435, and T862; C154, T530, and C572; C154, T530, and T596; C154, T530, and T617; C154, T530, and T688; C154, T530, and A696; C154, T530, and T702; C154, T530, and A709; C154, T530, and A712; C154, T530, and T714; C154, T530, and A790; C154, T530, and A841; C154, T530, and T862; C154, C572, and T596; C154, C572, and T617; C154, C572, and T688; C154, C572, and A696; C154, C572, and T702; C154, C572, and A709; C154, C572, and A712; C154, C572, and T714; C154, C572, and A790; C154, C572, and A841; C154, C572, and T862; C154, T596, and T617; C154, T596, and T688; C154, T596, and A696; C154, T596, and T702; C154, T596, and A709; C154, T596, and A712; C154, T596, and T714;C154, T596, and A790; C154, T596, and A841; C154, T596, and T862; C154, T617, and T688; C154, T617, and A696; C154, T617, and T702; C154, T617, and A709; C154, T617, and A712; C154, T617, and T714; C154, T617, and A790; C154, T617, and A841; C154, T617, and T862; C154, T688, and A696; C154, T688, and T702; C154, T688, and A709; C154, T688, and A712; C154, T688, and T714; C154, T688, and A790; C154, T688, and A841; C154, T688, and T862; C154, A696, and T702; C154, A696, and A709; C154, A696, and A712; C154, A696, and T714; C154, A696, and A790; C154, A696, and A841; C154, A696, and T862; C154, T702, and A709; C154, T702, and A712; C154, T702, and T714; C154, T702, and A790; C154, T702, and A841; C154, T702, and T862; C154, A709, and A712; C154, A709, and T714; C154, A709, and A790; C154, A709, and A841; C154, A709, and T862; C154, A712, and T714; C154, A712, and A790; C154, A712, and A841; C154, A712, and T862; C154, T714, and A790; C154, T714, and A841; C154, T714, and T862; C154, A790, and A841; C154, A790, and T862; C154, A841, and T862; T303, T426, and A433; T303, T426, and A435;T303, T426, and T530; T303, T426, and C572; T303, T426, and T596; T303, T426, and T617; T303, T426, and T688; T303, T426, and A696; T303, T426, and T702; T303, T426, and A709; T303, T426, and A712; T303, T426, and T714; T303, T426, and A790; T303, T426, and A841; T303, T426, and T862; T303, A433, and A435; T303, A433, and T530; T303, A433, and C572; T303, A433, and T596; T303, A433, and T617; T303, A433, and T688; T303, A433, and A696; T303, A433, and T702; T303, A433, and A709; T303, A433, and A712; T303, A433, and T714; T303, A433, and A790; T303, A433, and A841; T303, A433, and T862; T303, A435, and T530; T303, A435, and C572; T303, A435, and T596; T303, A435, and T617; T303, A435, and T688; T303, A435, and A696; T303, A435, and T702; T303, A435, and A709; T303, A435, and A712; T303, A435, and T714; T303, A435, and A790; T303, A435, and A841; T303, A435, and T862; T303, T530, and C572; T303, T530, and T596; T303, T530, and T617; T303, T530, and T688; T303, T530, and A696; T303, T530, and T702; T303, T530, and A709; T303, T530, and A712; T303, T530, and T714; T303, T530, and A790;T303, T530, and A841; T303, T530, and T862; T303, C572, and T596; T303, C572, and T617; T303, C572, and T688; T303, C572, and A696; T303, C572, and T702; T303, C572, and A709; T303, C572, and A712; T303, C572, and T714; T303, C572, and A790; T303, C572, and A841; T303, C572, and T862; T303, T596, and T617; T303, T596, and T688; T303, T596, and A696; T303, T596, and T702; T303, T596, and A709; T303, T596, and A712; T303, T596, and T714; T303, T596, and A790; T303, T596, and A841; T303, T596, and T862; T303, T617, and T688; T303, T617, and A696; T303, T617, and T702; T303, T617, and A709; T303, T617, and A712; T303, T617, and T714; T303, T617, and A790; T303, T617, and A841; T303, T617, and T862; T303, T688, and A696; T303, T688, and T702; T303, T688, and A709; T303, T688, and A712; T303, T688, and T714; T303, T688, and A790; T303, T688, and A841; T303, T688, and T862; T303, A696, and T702; T303, A696, and A709; T303, A696, and A712; T303, A696, and T714; T303, A696, and A790; T303, A696, and A841; T303, A696, and T862; T303, T702, and A709; T303, T702, and A712; T303, T702, and T714;T303, T702, and A790; T303, T702, and A841; T303, T702, and T862; T303, A709, and A712; T303, A709, and T714; T303, A709, and A790; T303, A709, and A841; T303, A709, and T862; T303, A712, and T714; T303, A712, and A790; T303, A712, and A841; T303, A712, and T862; T303, T714, and A790; T303, T714, and A841; T303, T714, and T862; T303, A790, and A841; T303, A790, and T862; T303, A841, and T862; T426, A433, and A435; T426, A433, and T530; T426, A433, and C572; T426, A433, and T596; T426, A433, and T617; T426, A433, and T688; T426, A433, and A696; T426, A433, and T702; T426, A433, and A709; T426, A433, and A712; T426, A433, and T714; T426, A433, and A790; T426, A433, and A841; T426, A433, and T862; T426, A435, and T530; T426, A435, and C572; T426, A435, and T596; T426, A435, and T617; T426, A435, and T688; T426, A435, and A696; T426, A435, and T702; T426, A435, and A709; T426, A435, and A712; T426, A435, and T714; T426, A435, and A790; T426, A435, and A841; T426, A435, and T862; T426, T530, and C572; T426, T530, and T596; T426, T530, and T617; T426, T530, and T688; T426, T530, and A696;T426, T530, and T702; T426, T530, and A709; T426, T530, and A712; T426, T530, and T714; T426, T530, and A790; T426, T530, and A841; T426, T530, and T862; T426, C572, and T596; T426, C572, and T617; T426, C572, and T688; T426, C572, and A696; T426, C572, and T702; T426, C572, and A709; T426, C572, and A712; T426, C572, and T714; T426, C572, and A790; T426, C572, and A841; T426, C572, and T862; T426, T596, and T617; T426, T596, and T688; T426, T596, and A696; T426, T596, and T702; T426, T596, and A709; T426, T596, and A712; T426, T596, and T714; T426, T596, and A790; T426, T596, and A841; T426, T596, and T862; T426, T617, and T688; T426, T617, and A696; T426, T617, and T702; T426, T617, and A709; T426, T617, and A712; T426, T617, and T714; T426, T617, and A790; T426, T617, and A841; T426, T617, and T862; T426, T688, and A696; T426, T688, and T702; T426, T688, and A709; T426, T688, and A712; T426, T688, and T714; T426, T688, and A790; T426, T688, and A841; T426, T688, and T862; T426, A696, and T702; T426, A696, and A709; T426, A696, and A712; T426, A696, and T714; T426, A696, and A790;T426, A696, and A841; T426, A696, and T862; T426, T702, and A709; T426, T702, and A712; T426, T702, and T714; T426, T702, and A790; T426, T702, and A841; T426, T702, and T862; T426, A709, and A712; T426, A709, and T714; T426, A709, and A790; T426, A709, and A841; T426, A709, and T862; T426, A712, and T714; T426, A712, and A790; T426, A712, and A841; T426, A712, and T862; T426, T714, and A790; T426, T714, and A841; T426, T714, and T862; T426, A790, and A841; T426, A790, and T862; T426, A841, and T862; A433, A435, and T530; A433, A435, and C572; A433, A435, and T596; A433, A435, and T617; A433, A435, and T688; A433, A435, and A696; A433, A435, and T702; A433, A435, and A709; A433, A435, and A712; A433, A435, and T714; A433, A435, and A790; A433, A435, and A841; A433, A435, and T862; A433, T530, and C572; A433, T530, and T596; A433, T530, and T617; A433, T530, and T688; A433, T530, and A696; A433, T530, and T702; A433, T530, and A709; A433, T530, and A712; A433, T530, and T714; A433, T530, and A790; A433, T530, and A841; A433, T530, and T862; A433, C572, and T596; A433, C572, and T617;A433, C572, and T688; A433, C572, and A696; A433, C572, and T702; A433, C572, and A709; A433, C572, and A712; A433, C572, and T714; A433, C572, and A790; A433, C572, and A841; A433, C572, and T862; A433, T596, and T617; A433, T596, and T688; A433, T596, and A696; A433, T596, and T702; A433, T596, and A709; A433, T596, and A712; A433, T596, and T714; A433, T596, and A790; A433, T596, and A841; A433, T596, and T862; A433, T617, and T688; A433, T617, and A696; A433, T617, and T702; A433, T617, and A709; A433, T617, and A712; A433, T617, and T714; A433, T617, and A790; A433, T617, and A841; A433, T617, and T862; A433, T688, and A696; A433, T688, and T702; A433, T688, and A709; A433, T688, and A712; A433, T688, and T714; A433, T688, and A790; A433, T688, and A841; A433, T688, and T862; A433, A696, and T702; A433, A696, and A709; A433, A696, and A712; A433, A696, and T714; A433, A696, and A790; A433, A696, and A841; A433, A696, and T862; A433, T702, and A709; A433, T702, and A712; A433, T702, and T714; A433, T702, and A790; A433, T702, and A841; A433, T702, and T862; A433, A709, and A712;A433, A709, and T714; A433, A709, and A790; A433, A709, and A841; A433, A709, and T862; A433, A712, and T714; A433, A712, and A790; A433, A712, and A841; A433, A712, and T862; A433, T714, and A790; A433, T714, and A841; A433, T714, and T862; A433, A790, and A841; A433, A790, and T862; A433, A841, and T862; A435, T530, and C572; A435, T530, and T596; A435, T530, and T617; A435, T530, and T688; A435, T530, and A696; A435, T530, and T702; A435, T530, and A709; A435, T530, and A712; A435, T530, and T714; A435, T530, and A790; A435, T530, and A841; A435, T530, and T862; A435, C572, and T596; A435, C572, and T617; A435, C572, and T688; A435, C572, and A696; A435, C572, and T702; A435, C572, and A709; A435, C572, and A712; A435, C572, and T714; A435, C572, and A790; A435, C572, and A841; A435, C572, and T862; A435, T596, and T617; A435, T596, and T688; A435, T596, and A696; A435, T596, and T702; A435, T596, and A709; A435, T596, and A712; A435, T596, and T714; A435, T596, and A790; A435, T596, and A841; A435, T596, and T862; A435, T617, and T688; A435, T617, and A696; A435, T617, and T702;A435, T617, and A709; A435, T617, and A712; A435, T617, and T714; A435, T617, and A790; A435, T617, and A841; A435, T617, and T862; A435, T688, and A696; A435, T688, and T702; A435, T688, and A709; A435, T688, and A712; A435, T688, and T714; A435, T688, and A790; A435, T688, and A841; A435, T688, and T862; A435, A696, and T702; A435, A696, and A709; A435, A696, and A712; A435, A696, and T714; A435, A696, and A790; A435, A696, and A841; A435, A696, and T862; A435, T702, and A709; A435, T702, and A712; A435, T702, and T714; A435, T702, and A790; A435, T702, and A841; A435, T702, and T862; A435, A709, and A712; A435, A709, and T714; A435, A709, and A790; A435, A709, and A841; A435, A709, and T862; A435, A712, and T714; A435, A712, and A790; A435, A712, and A841; A435, A712, and T862; A435, T714, and A790; A435, T714, and A841; A435, T714, and T862; A435, A790, and A841; A435, A790, and T862; A435, A841, and T862; T530, C572, and T596; T530, C572, and T617; T530, C572, and T688; T530, C572, and A696; T530, C572, and T702; T530, C572, and A709; T530, C572, and A712; T530, C572, and T714;T530, C572, and A790; T530, C572, and A841; T530, C572, and T862; T530, T596, and T617; T530, T596, and T688; T530, T596, and A696; T530, T596, and T702; T530, T596, and A709; T530, T596, and A712; T530, T596, and T714; T530, T596, and A790; T530, T596, and A841; T530, T596, and T862; T530, T617, and T688; T530, T617, and A696; T530, T617, and T702; T530, T617, and A709; T530, T617, and A712; T530, T617, and T714; T530, T617, and A790; T530, T617, and A841; T530, T617, and T862; T530, T688, and A696; T530, T688, and T702; T530, T688, and A709; T530, T688, and A712; T530, T688, and T714; T530, T688, and A790; T530, T688, and A841; T530, T688, and T862; T530, A696, and T702; T530, A696, and A709; T530, A696, and A712; T530, A696, and T714; T530, A696, and A790; T530, A696, and A841; T530, A696, and T862; T530, T702, and A709; T530, T702, and A712; T530, T702, and T714; T530, T702, and A790; T530, T702, and A841; T530, T702, and T862; T530, A709, and A712; T530, A709, and T714; T530, A709, and A790; T530, A709, and A841; T530, A709, and T862; T530, A712, and T714; T530, A712, and A790;T530, A712, and A841; T530, A712, and T862; T530, T714, and A790; T530, T714, and A841; T530, T714, and T862; T530, A790, and A841; T530, A790, and T862; T530, A841, and T862; C572, T596, and T617; C572, T596, and T688; C572, T596, and A696; C572, T596, and T702; C572, T596, and A709; C572, T596, and A712; C572, T596, and T714; C572, T596, and A790; C572, T596, and A841; C572, T596, and T862; C572, T617, and T688; C572, T617, and A696; C572, T617, and T702; C572, T617, and A709; C572, T617, and A712; C572, T617, and T714; C572, T617, and A790; C572, T617, and A841; C572, T617, and T862; C572, T688, and A696; C572, T688, and T702; C572, T688, and A709; C572, T688, and A712; C572, T688, and T714; C572, T688, and A790; C572, T688, and A841; C572, T688, and T862; C572, A696, and T702; C572, A696, and A709; C572, A696, and A712; C572, A696, and T714; C572, A696, and A790; C572, A696, and A841; C572, A696, and T862; C572, T702, and A709; C572, T702, and A712; C572, T702, and T714; C572, T702, and A790; C572, T702, and A841; C572, T702, and T862; C572, A709, and A712; C572, A709, and T714;C572, A709, and A790; C572, A709, and A841; C572, A709, and T862; C572, A712, and T714; C572, A712, and A790; C572, A712, and A841; C572, A712, and T862; C572, T714, and A790; C572, T714, and A841; C572, T714, and T862; C572, A790, and A841; C572, A790, and T862; C572, A841, and T862; T596, T617, and T688; T596, T617, and A696; T596, T617, and T702; T596, T617, and A709; T596, T617, and A712; T596, T617, and T714; T596, T617, and A790; T596, T617, and A841; T596, T617, and T862; T596, T688, and A696; T596, T688, and T702; T596, T688, and A709; T596, T688, and A712; T596, T688, and T714; T596, T688, and A790; T596, T688, and A841; T596, T688, and T862; T596, A696, and T702; T596, A696, and A709; T596, A696, and A712; T596, A696, and T714; T596, A696, and A790; T596, A696, and A841; T596, A696, and T862; T596, T702, and A709; T596, T702, and A712; T596, T702, and T714; T596, T702, and A790; T596, T702, and A841; T596, T702, and T862; T596, A709, and A712; T596, A709, and T714; T596, A709, and A790; T596, A709, and A841; T596, A709, and T862; T596, A712, and T714; T596, A712, and A790;T596, A712, and A841; T596, A712, and T862; T596, T714, and A790; T596, T714, and A841; T596, T714, and T862; T596, A790, and A841; T596, A790, and T862; T596, A841, and T862; T617, T688, and A696; T617, T688, and T702; T617, T688, and A709; T617, T688, and A712; T617, T688, and T714; T617, T688, and A790; T617, T688, and A841; T617, T688, and T862; T617, A696, and T702; T617, A696, and A709; T617, A696, and A712; T617, A696, and T714; T617, A696, and A790; T617, A696, and A841; T617, A696, and T862; T617, T702, and A709; T617, T702, and A712; T617, T702, and T714; T617, T702, and A790; T617, T702, and A841; T617, T702, and T862; T617, A709, and A712; T617, A709, and T714; T617, A709, and A790; T617, A709, and A841; T617, A709, and T862; T617, A712, and T714; T617, A712, and A790; T617, A712, and A841; T617, A712, and T862; T617, T714, and A790; T617, T714, and A841; T617, T714, and T862; T617, A790, and A841; T617, A790, and T862; T617, A841, and T862; T688, A696, and T702; T688, A696, and A709; T688, A696, and A712; T688, A696, and T714; T688, A696, and A790; T688, A696, and A841;T688, A696, and T862; T688, T702, and A709; T688, T702, and A712; T688, T702, and T714; T688, T702, and A790; T688, T702, and A841; T688, T702, and T862; T688, A709, and A712; T688, A709, and T714; T688, A709, and A790; T688, A709, and A841; T688, A709, and T862; T688, A712, and T714; T688, A712, and A790; T688, A712, and A841; T688, A712, and T862; T688, T714, and A790; T688, T714, and A841; T688, T714, and T862; T688, A790, and A841; T688, A790, and T862; T688, A841, and T862; A696, T702, and A709; A696, T702, and A712; A696, T702, and T714; A696, T702, and A790; A696, T702, and A841; A696, T702, and T862; A696, A709, and A712; A696, A709, and T714; A696, A709, and A790; A696, A709, and A841; A696, A709, and T862; A696, A712, and T714; A696, A712, and A790; A696, A712, and A841; A696, A712, and T862; A696, T714, and A790; A696, T714, and A841; A696, T714, and T862; A696, A790, and A841; A696, A790, and T862; A696, A841, and T862; T702, A709, and A712; T702, A709, and T714; T702, A709, and A790; T702, A709, and A841; T702, A709, and T862; T702, A712, and T714; T702, A712, and A790;T702, A712, and A841; T702, A712, and T862; T702, T714, and A790; T702, T714, and A841; T702, T714, and T862; T702, A790, and A841; T702, A790, and T862; T702, A841, and T862; A709, A712, and T714; A709, A712, and A790; A709, A712, and A841; A709, A712, and T862; A709, T714, and A790; A709, T714, and A841; A709, T714, and T862; A709, A790, and A841; A709, A790, and T862; A709, A841, and T862; A712, T714, and A790; A712, T714, and A841; A712, T714, and T862; A712, A790, and A841; A712, A790, and T862; A712, A841, and T862; T714, A790, and A841; T714, A790, and T862; T714, A841, and T862; or A790, A841, and T862.;

[0057] In some embodiments, the nucleotide sequence of a promoter element as provided herein may contain two mutations compared to the nucleotide sequence of a reference promoter element. For example, in some embodiments, two mutations may be present in the promoter sequence at positions corresponding to the following positions compared to sequence identification number: 28: T688 and A696; T688 and T702; T688 and A712; T688 and T714; A696 and T702; A696 and A712; A696 and T714; T702 and A712; T702 and T714; or A712 and T714.

[0058] In some embodiments, the nucleotide sequence of a promoter element as provided herein may include three mutations compared to the nucleotide sequence of a reference promoter element. For example, in some embodiments, three mutations may be present in the promoter sequence at positions corresponding to the following positions compared to sequence identification number: 28: T688, A696, and T702; T688, A696, and A712; T688, A696, and T714; T688, T702, and A712; T688, T702, and T714; T688, A712, and T714; A696, T702, and A712; A696, T702, and T714; A696, A712, and T714; or T702, A712, and T714.

[0059] In some embodiments, the nucleotide sequence of a promoter element as provided herein may include four mutations compared to the nucleotide sequence of a reference promoter element. For example, in some embodiments, four mutations may be present in the promoter sequence at positions corresponding to the following positions compared to sequence identification number: 28: T688, A696, T702, and A712; T688, A696, T702, and T714; T688, A696, A712, and T714; T688, T702, A712, and T714; or A696, T702, A712, and T714.

[0060] In some embodiments, the nucleotide sequence of a promoter element as provided herein may include five mutations compared to the nucleotide sequence of a reference promoter element. For example, in some embodiments, five mutations may be present in the promoter sequence at positions corresponding to the following positions compared to sequence identification number: 28: T688, A696, T702, A712, and T714.

[0061] In some embodiments, the nucleotide sequence of a promoter element as provided herein may include two mutations compared to the nucleotide sequence of a reference promoter element. For example, in some embodiments, two mutations may be present in the promoter sequence at positions corresponding to the following positions compared to sequence identification number: 28: 146 and 154; 146 and 303; 146 and 426; 146 and 433; 146 and 435; 146 and 530; 146 and 572; 146 and 596; 146 and 617; 146 and 688; 146 and 696; 146 and 702; 146 and 709; 146 and A712; 146 and 714; 146 and 790; 146 and 841; 146 and 862; 154 and 303; 154 and 426; 154 and 433; 154 and 435; 154 and 530; 154 and 572; 154 and 596; 154 and 617; 154 and 688; 154 and 696; 154 and 702; 154 and 709; 154 and A712; 154 and 714; 154 and 790; 154 and 841; 154 and 862; 303 and 426; 303 and 433; 303 and 435; 303 and 530; 303 and 572; 303 and 596; 303 and 617; 303 and 688; 303 and 696; 303 and 702; 303 and 709; 303 and A712; 303 and 714; 303 and 790; 303 and 841; 303 and 862; 426 and 433; 426 and 435; 426 and 530; 426 and 572; 426 and 596; 426 and 617; 426 and 688; 426 and 696; 426 and 702; 426 and 709; 426 and A712; 426 and 714; 426 and 790; 426 and 841; 426 and 862; 433 and 435; 433 and 530; 433 and 572; 433 and 596; 433 and 617; 433 and 688; 433 and 696; 433 and 702; 433 and 709;433 and A712; 433 and 714; 433 and 790; 433 and 841; 433 and 862; 435 and 530; 435 and 572; 435 and 596; 435 and 617; 435 and 688; 435 and 696; 435 and 702; 435 and 709; 435 and A712; 435 and 714; 435 and 790; 435 and 841; 435 and 862; 530 and 572; 530 and 596; 530 and 617; 530 and 688; 530 and 696; 530 and 702; 530 and 709; 530 and A712; 530 and 714; 530 and 790; 530 and 841; 530 and 862; 572 and 596; 572 and 617; 572 and 688; 572 and 696; 572 and 702; 572 and 709; 572 and A712; 572 and 714; 572 and 790; 572 and 841; 572 and 862; 596 and 617; 596 and 688; 596 and 696; 596 and 702; 596 and 709; 596 and A712; 596 and 714; 596 and 790; 596 and 841; 596 and 862; 617 and 688; 617 and 696; 617 and 702; 617 and 709; 617 and A712; 617 and 714; 617 and 790; 617 and 841; 617 and 862; 688 and 696; 688 and 702; 688 and 709; 688 and A712; 688 and 714; 688 and 790; 688 and 841; 688 and 862; 696 and 702; 696 and 709; 696 and A712; 696 and 714; 696 and 790; 696 and 841; 696 and 862; 702 and 709; 702 and A712; 702 and 714; 702 and 790; 702 and 841; 702 and 862; 709 and A712; 709 and 714; 709 and 790; 709 and 841; 709 and 862; A712 and 714; A712 and 790; A712 and 841;A712 and 862; 714 and 790; 714 and 841; 714 and 862; 790 and 841; 790 and 862; or 841 and 862.;

[0062] In some embodiments, the nucleotide sequence of a promoter element as provided herein may include three mutations compared to the nucleotide sequence of a reference promoter element. For example, in some embodiments, three mutations may be present in the promoter sequence at positions corresponding to the following positions compared to sequence identification number: 28: 146, 154, and 303; 146, 154, and 426; 146, 154, and 433; 146, 154, and 435; 146, 154, and 530; 146, 154, and 572; 146, 154, and 596; 146, 154, and 617; 146, 154, and 688; 146, 154, and 696; 146, 154, and 702; 146, 154, and 709; 146, 154, and A712; 146, 154, and 714; 146, 154, and 790; 146, 154, and 841; 146, 154, and 862; 146, 303, and 426; 146, 303, and 433; 146, 303, and 435; 146, 303, and 530; 146, 303, and 572; 146, 303, and 596; 146, 303, and 617; 146, 303, and 688; 146, 303, and 696; 146, 303, and 702; 146, 303, and 709; 146, 303, and A712; 146, 303, and 714; 146, 303, and 790; 146, 303, and 841; 146, 303, and 862; 146, 426, and 433; 146, 426, and 435; 146, 426, and 530; 146, 426, and 572; 146, 426, and 596; 146, 426, and 617; 146, 426, and 688; 146, 426, and 696; 146, 426, and 702; 146, 426, and 709; 146, 426, and A712; 146, 426, and 714; 146, 426, and 790; 146, 426, and 841; 146, 426, and 862;146, 433, and 435; 146, 433, and 530; 146, 433, and 572; 146, 433, and 596; 146, 433, and 617; 146, 433, and 688; 146, 433, and 696; 146, 433, and 702; 146, 433, and 709; 146, 433, and A712; 146, 433, and 714; 146, 433, and 790; 146, 433, and 841; 146, 433, and 862; 146, 435, and 530; 146, 435, and 572; 146, 435, and 596; 146, 435, and 617; 146, 435, and 688; 146, 435, and 696; 146, 435, and 702; 146, 435, and 709; 146, 435, and A712; 146, 435, and 714; 146, 435, and 790; 146, 435, and 841; 146, 435, and 862; 146, 530, and 572; 146, 530, and 596; 146, 530, and 617; 146, 530, and 688; 146, 530, and 696; 146, 530, and 702; 146, 530, and 709; 146, 530, and A712; 146, 530, and 714; 146, 530, and 790; 146, 530, and 841; 146, 530, and 862; 146, 572, and 596; 146, 572, and 617; 146, 572, and 688; 146, 572, and 696; 146, 572, and 702; 146, 572, and 709; 146, 572, and A712; 146, 572, and 714; 146, 572, and 790; 146, 572, and 841; 146, 572, and 862; 146, 596, and 617; 146, 596, and 688; 146, 596, and 696; 146, 596, and 702; 146, 596, and 709; 146, 596, and A712; 146, 596, and 714; 146, 596, and 790;146, 596, and 841; 146, 596, and 862; 146, 617, and 688; 146, 617, and 696; 146, 617, and 702; 146, 617, and 709; 146, 617, and A712; 146, 617, and 714; 146, 617, and 790; 146, 617, and 841; 146, 617, and 862; 146, 688, and 696; 146, 688, and 702; 146, 688, and 709; 146, 688, and A712; 146, 688, and 714; 146, 688, and 790; 146, 688, and 841; 146, 688, and 862; 146, 696, and 702; 146, 696, and 709; 146, 696, and A712; 146, 696, and 714; 146, 696, and 790; 146, 696, and 841; 146, 696, and 862; 146, 702, and 709; 146, 702, and A712; 146, 702, and 714; 146, 702, and 790; 146, 702, and 841; 146, 702, and 862; 146, 709, and A712; 146, 709, and 714; 146, 709, and 790; 146, 709, and 841; 146, 709, and 862; 146, A712, and 714; 146, A712, and 790; 146, A712, and 841; 146, A712, and 862; 146, 714, and 790; 146, 714, and 841; 146, 714, and 862; 146, 790, and 841; 146, 790, and 862; 146, 841, and 862; 154, 303, and 426; 154, 303, and 433; 154, 303, and 435; 154, 303, and 530; 154, 303, and 572; 154, 303, and 596; 154, 303, and 617; 154, 303, and 688; 154, 303, and 696; 154, 303, and 702; 154, 303, and 709;154, 303, and A712; 154, 303, and 714; 154, 303, and 790; 154, 303, and 841; 154, 303, and 862; 154, 426, and 433; 154, 426, and 435; 154, 426, and 530; 154, 426, and 572; 154, 426, and 596; 154, 426, and 617; 154, 426, and 688; 154, 426, and 696; 154, 426, and 702; 154, 426, and 709; 154, 426, and A712; 154, 426, and 714; 154, 426, and 790; 154, 426, and 841; 154, 426, and 862; 154, 433, and 435; 154, 433, and 530; 154, 433, and 572; 154, 433, and 596; 154, 433, and 617; 154, 433, and 688; 154, 433, and 696; 154, 433, and 702; 154, 433, and 709; 154, 433, and A712; 154, 433, and 714; 154, 433, and 790; 154, 433, and 841; 154, 433, and 862; 154, 435, and 530; 154, 435, and 572; 154, 435, and 596; 154, 435, and 617; 154, 435, and 688; 154, 435, and 696; 154, 435, and 702; 154, 435, and 709; 154, 435, and A712; 154, 435, and 714; 154, 435, and 790; 154, 435, and 841; 154, 435, and 862; 154, 530, and 572; 154, 530, and 596; 154, 530, and 617; 154, 530, and 688; 154, 530, and 696; 154, 530, and 702; 154, 530, and 709; 154, 530, and A712; 154, 530, and 714; 154, 530, and 790; 154, 530, and 841;154, 530, and 862; 154, 572, and 596; 154, 572, and 617; 154, 572, and 688; 154, 572, and 696; 154, 572, and 702; 154, 572, and 709; 154, 572, and A712; 154, 572, and 714; 154, 572, and 790; 154, 572, and 841; 154, 572, and 862; 154, 596, and 617; 154, 596, and 688; 154, 596, and 696; 154, 596, and 702; 154, 596, and 709; 154, 596, and A712; 154, 596, and 714; 154, 596, and 790; 154, 596, and 841; 154, 596, and 862; 154, 617, and 688; 154, 617, and 696; 154, 617, and 702; 154, 617, and 709; 154, 617, and A712; 154, 617, and 714; 154, 617, and 790; 154, 617, and 841; 154, 617, and 862; 154, 688, and 696; 154, 688, and 702; 154, 688, and 709; 154, 688, and A712; 154, 688, and 714; 154, 688, and 790; 154, 688, and 841; 154, 688, and 862; 154, 696, and 702; 154, 696, and 709; 154, 696, and A712; 154, 696, and 714; 154, 696, and 790; 154, 696, and 841; 154, 696, and 862; 154, 702, and 709; 154, 702, and A712; 154, 702, and 714; 154, 702, and 790; 154, 702, and 841; 154, 702, and 862; 154, 709, and A712; 154, 709, and 714; 154, 709, and 790; 154, 709, and 841; 154, 709, and 862; 154, A712, and 714;154, A712, and 790; 154, A712, and 841; 154, A712, and 862; 154, 714, and 790; 154, 714, and 841; 154, 714, and 862; 154, 790, and 841; 154, 790, and 862; 154, 841, and 862; 303, 426, and 433; 303, 426, and 435; 303, 426, and 530; 303, 426, and 572; 303, 426, and 596; 303, 426, and 617; 303, 426, and 688; 303, 426, and 696; 303, 426, and 702; 303, 426, and 709; 303, 426, and A712; 303, 426, and 714; 303, 426, and 790; 303, 426, and 841; 303, 426, and 862; 303, 433, and 435; 303, 433, and 530; 303, 433, and 572; 303, 433, and 596; 303, 433, and 617; 303, 433, and 688; 303, 433, and 696; 303, 433, and 702; 303, 433, and 709; 303, 433, and A712; 303, 433, and 714; 303, 433, and 790; 303, 433, and 841; 303, 433, and 862; 303, 435, and 530; 303, 435, and 572; 303, 435, and 596; 303, 435, and 617; 303, 435, and 688; 303, 435, and 696; 303, 435, and 702; 303, 435, and 709; 303, 435, and A712; 303, 435, and 714; 303, 435, and 790; 303, 435, and 841; 303, 435, and 862; 303, 530, and 572; 303, 530, and 596; 303, 530, and 617; 303, 530, and 688; 303, 530, and 696; 303, 530, and 702; 303, 530, and 709;303, 530, and A712; 303, 530, and 714; 303, 530, and 790; 303, 530, and 841; 303, 530, and 862; 303, 572, and 596; 303, 572, and 617; 303, 572, and 688; 303, 572, and 696; 303, 572, and 702; 303, 572, and 709; 303, 572, and A712; 303, 572, and 714; 303, 572, and 790; 303, 572, and 841; 303, 572, and 862; 303, 596, and 617; 303, 596, and 688; 303, 596, and 696; 303, 596, and 702; 303, 596, and 709; 303, 596, and A712; 303, 596, and 714; 303, 596, and 790; 303, 596, and 841; 303, 596, and 862; 303, 617, and 688; 303, 617, and 696; 303, 617, and 702; 303, 617, and 709; 303, 617, and A712; 303, 617, and 714; 303, 617, and 790; 303, 617, and 841; 303, 617, and 862; 303, 688, and 696; 303, 688, and 702; 303, 688, and 709; 303, 688, and A712; 303, 688, and 714; 303, 688, and 790; 303, 688, and 841; 303, 688, and 862; 303, 696, and 702; 303, 696, and 709; 303, 696, and A712; 303, 696, and 714; 303, 696, and 790; 303, 696, and 841; 303, 696, and 862; 303, 702, and 709; 303, 702, and A712; 303, 702, and 714; 303, 702, and 790; 303, 702, and 841; 303, 702, and 862; 303, 709, and A712; 303, 709, and 714;303, 709, and 790; 303, 709, and 841; 303, 709, and 862; 303, A712, and 714; 303, A712, and 790; 303, A712, and 841; 303, A712, and 862; 303, 714, and 790; 303, 714, and 841; 303, 714, and 862; 303, 790, and 841; 303, 790, and 862; 303, 841, and 862; 426, 433, and 435; 426, 433, and 530; 426, 433, and 572; 426, 433, and 596; 426, 433, and 617; 426, 433, and 688; 426, 433, and 696; 426, 433, and 702; 426, 433, and 709; 426, 433, and A712; 426, 433, and 714; 426, 433, and 790; 426, 433, and 841; 426, 433, and 862; 426, 435, and 530; 426, 435, and 572; 426, 435, and 596; 426, 435, and 617; 426, 435, and 688; 426, 435, and 696; 426, 435, and 702; 426, 435, and 709; 426, 435, and A712; 426, 435, and 714; 426, 435, and 790; 426, 435, and 841; 426, 435, and 862; 426, 530, and 572; 426, 530, and 596; 426, 530, and 617; 426, 530, and 688; 426, 530, and 696; 426, 530, and 702; 426, 530, and 709; 426, 530, and A712; 426, 530, and 714; 426, 530, and 790; 426, 530, and 841; 426, 530, and 862; 426, 572, and 596; 426, 572, and 617; 426, 572, and 688; 426, 572, and 696; 426, 572, and 702; 426, 572, and 709;426, 572, and A712; 426, 572, and 714; 426, 572, and 790; 426, 572, and 841; 426, 572, and 862; 426, 596, and 617; 426, 596, and 688; 426, 596, and 696; 426, 596, and 702; 426, 596, and 709; 426, 596, and A712; 426, 596, and 714; 426, 596, and 790; 426, 596, and 841; 426, 596, and 862; 426, 617, and 688; 426, 617, and 696; 426, 617, and 702; 426, 617, and 709; 426, 617, and A712; 426, 617, and 714; 426, 617, and 790; 426, 617, and 841; 426, 617, and 862; 426, 688, and 696; 426, 688, and 702; 426, 688, and 709; 426, 688, and A712; 426, 688, and 714; 426, 688, and 790; 426, 688, and 841; 426, 688, and 862; 426, 696, and 702; 426, 696, and 709; 426, 696, and A712; 426, 696, and 714; 426, 696, and 790; 426, 696, and 841; 426, 696, and 862; 426, 702, and 709; 426, 702, and A712; 426, 702, and 714; 426, 702, and 790; 426, 702, and 841; 426, 702, and 862; 426, 709, and A712; 426, 709, and 714; 426, 709, and 790; 426, 709, and 841; 426, 709, and 862; 426, A712, and 714; 426, A712, and 790; 426, A712, and 841; 426, A712, and 862; 426, 714, and 790; 426, 714, and 841; 426, 714, and 862; 426, 790, and 841;426, 790, and 862; 426, 841, and 862; 433, 435, and 530; 433, 435, and 572; 433, 435, and 596; 433, 435, and 617; 433, 435, and 688; 433, 435, and 696; 433, 435, and 702; 433, 435, and 709; 433, 435, and A712; 433, 435, and 714; 433, 435, and 790; 433, 435, and 841; 433, 435, and 862; 433, 530, and 572; 433, 530, and 596; 433, 530, and 617; 433, 530, and 688; 433, 530, and 696; 433, 530, and 702; 433, 530, and 709; 433, 530, and A712; 433, 530, and 714; 433, 530, and 790; 433, 530, and 841; 433, 530, and 862; 433, 572, and 596; 433, 572, and 617; 433, 572, and 688; 433, 572, and 696; 433, 572, and 702; 433, 572, and 709; 433, 572, and A712; 433, 572, and 714; 433, 572, and 790; 433, 572, and 841; 433, 572, and 862; 433, 596, and 617; 433, 596, and 688; 433, 596, and 696; 433, 596, and 702; 433, 596, and 709; 433, 596, and A712; 433, 596, and 714; 433, 596, and 790; 433, 596, and 841; 433, 596, and 862; 433, 617, and 688; 433, 617, and 696; 433, 617, and 702; 433, 617, and 709; 433, 617, and A712; 433, 617, and 714; 433, 617, and 790; 433, 617, and 841; 433, 617, and 862; 433, 688, and 696;433, 688, and 702; 433, 688, and 709; 433, 688, and A712; 433, 688, and 714; 433, 688, and 790; 433, 688, and 841; 433, 688, and 862; 433, 696, and 702; 433, 696, and 709; 433, 696, and A712; 433, 696, and 714; 433, 696, and 790; 433, 696, and 841; 433, 696, and 862; 433, 702, and 709; 433, 702, and A712; 433, 702, and 714; 433, 702, and 790; 433, 702, and 841; 433, 702, and 862; 433, 709, and A712; 433, 709, and 714; 433, 709, and 790; 433, 709, and 841; 433, 709, and 862; 433, A712, and 714; 433, A712, and 790; 433, A712, and 841; 433, A712, and 862; 433, 714, and 790; 433, 714, and 841; 433, 714, and 862; 433, 790, and 841; 433, 790, and 862; 433, 841, and 862; 435, 530, and 572; 435, 530, and 596; 435, 530, and 617; 435, 530, and 688; 435, 530, and 696; 435, 530, and 702; 435, 530, and 709; 435, 530, and A712; 435, 530, and 714; 435, 530, and 790; 435, 530, and 841; 435, 530, and 862; 435, 572, and 596; 435, 572, and 617; 435, 572, and 688; 435, 572, and 696; 435, 572, and 702; 435, 572, and 709; 435, 572, and A712; 435, 572, and 714; 435, 572, and 790; 435, 572, and 841; 435, 572, and 862;435, 596, and 617; 435, 596, and 688; 435, 596, and 696; 435, 596, and 702; 435, 596, and 709; 435, 596, and A712; 435, 596, and 714; 435, 596, and 790; 435, 596, and 841; 435, 596, and 862; 435, 617, and 688; 435, 617, and 696; 435, 617, and 702; 435, 617, and 709; 435, 617, and A712; 435, 617, and 714; 435, 617, and 790; 435, 617, and 841; 435, 617, and 862; 435, 688, and 696; 435, 688, and 702; 435, 688, and 709; 435, 688, and A712; 435, 688, and 714; 435, 688, and 790; 435, 688, and 841; 435, 688, and 862; 435, 696, and 702; 435, 696, and 709; 435, 696, and A712; 435, 696, and 714; 435, 696, and 790; 435, 696, and 841; 435, 696, and 862; 435, 702, and 709; 435, 702, and A712; 435, 702, and 714; 435, 702, and 790; 435, 702, and 841; 435, 702, and 862; 435, 709, and A712; 435, 709, and 714; 435, 709, and 790; 435, 709, and 841; 435, 709, and 862; 435, A712, and 714; 435, A712, and 790; 435, A712, and 841; 435, A712, and 862; 435, 714, and 790; 435, 714, and 841; 435, 714, and 862; 435, 790, and 841; 435, 790, and 862; 435, 841, and 862; 530, 572, and 596; 530, 572, and 617; 530, 572, and 688;530, 572, and 696; 530, 572, and 702; 530, 572, and 709; 530, 572, and A712; 530, 572, and 714; 530, 572, and 790; 530, 572, and 841; 530, 572, and 862; 530, 596, and 617; 530, 596, and 688; 530, 596, and 696; 530, 596, and 702; 530, 596, and 709; 530, 596, and A712; 530, 596, and 714; 530, 596, and 790; 530, 596, and 841; 530, 596, and 862; 530, 617, and 688; 530, 617, and 696; 530, 617, and 702; 530, 617, and 709; 530, 617, and A712; 530, 617, and 714; 530, 617, and 790; 530, 617, and 841; 530, 617, and 862; 530, 688, and 696; 530, 688, and 702; 530, 688, and 709; 530, 688, and A712; 530, 688, and 714; 530, 688, and 790; 530, 688, and 841; 530, 688, and 862; 530, 696, and 702; 530, 696, and 709; 530, 696, and A712; 530, 696, and 714; 530, 696, and 790; 530, 696, and 841; 530, 696, and 862; 530, 702, and 709; 530, 702, and A712; 530, 702, and 714; 530, 702, and 790; 530, 702, and 841; 530, 702, and 862; 530, 709, and A712; 530, 709, and 714; 530, 709, and 790; 530, 709, and 841; 530, 709, and 862; 530, A712, and 714; 530, A712, and 790; 530, A712, and 841; 530, A712, and 862; 530, 714, and 790;530, 714, and 841; 530, 714, and 862; 530, 790, and 841; 530, 790, and 862; 530, 841, and 862; 572, 596, and 617; 572, 596, and 688; 572, 596, and 696; 572, 596, and 702; 572, 596, and 709; 572, 596, and A712; 572, 596, and 714; 572, 596, and 790; 572, 596, and 841; 572, 596, and 862; 572, 617, and 688; 572, 617, and 696; 572, 617, and 702; 572, 617, and 709; 572, 617, and A712; 572, 617, and 714; 572, 617, and 790; 572, 617, and 841; 572, 617, and 862; 572, 688, and 696; 572, 688, and 702; 572, 688, and 709; 572, 688, and A712; 572, 688, and 714; 572, 688, and 790; 572, 688, and 841; 572, 688, and 862; 572, 696, and 702; 572, 696, and 709; 572, 696, and A712; 572, 696, and 714; 572, 696, and 790; 572, 696, and 841; 572, 696, and 862; 572, 702, and 709; 572, 702, and A712; 572, 702, and 714; 572, 702, and 790; 572, 702, and 841; 572, 702, and 862; 572, 709, and A712; 572, 709, and 714; 572, 709, and 790; 572, 709, and 841; 572, 709, and 862; 572, A712, and 714; 572, A712, and 790; 572, A712, and 841; 572, A712, and 862; 572, 714, and 790; 572, 714, and 841; 572, 714, and 862; 572, 790, and 841;572, 790, and 862; 572, 841, and 862; 596, 617, and 688; 596, 617, and 696; 596, 617, and 702; 596, 617, and 709; 596, 617, and A712; 596, 617, and 714; 596, 617, and 790; 596, 617, and 841; 596, 617, and 862; 596, 688, and 696; 596, 688, and 702; 596, 688, and 709; 596, 688, and A712; 596, 688, and 714; 596, 688, and 790; 596, 688, and 841; 596, 688, and 862; 596, 696, and 702; 596, 696, and 709; 596, 696, and A712; 596, 696, and 714; 596, 696, and 790; 596, 696, and 841; 596, 696, and 862; 596, 702, and 709; 596, 702, and A712; 596, 702, and 714; 596, 702, and 790; 596, 702, and 841; 596, 702, and 862; 596, 709, and A712; 596, 709, and 714; 596, 709, and 790; 596, 709, and 841; 596, 709, and 862; 596, A712, and 714; 596, A712, and 790; 596, A712, and 841; 596, A712, and 862; 596, 714, and 790; 596, 714, and 841; 596, 714, and 862; 596, 790, and 841; 596, 790, and 862; 596, 841, and 862; 617, 688, and 696; 617, 688, and 702; 617, 688, and 709; 617, 688, and A712; 617, 688, and 714; 617, 688, and 790; 617, 688, and 841; 617, 688, and 862; 617, 696, and 702; 617, 696, and 709; 617, 696, and A712;617, 696, and 714; 617, 696, and 790; 617, 696, and 841; 617, 696, and 862; 617, 702, and 709; 617, 702, and A712; 617, 702, and 714; 617, 702, and 790; 617, 702, and 841; 617, 702, and 862; 617, 709, and A712; 617, 709, and 714; 617, 709, and 790; 617, 709, and 841; 617, 709, and 862; 617, A712, and 714; 617, A712, and 790; 617, A712, and 841; 617, A712, and 862; 617, 714, and 790; 617, 714, and 841; 617, 714, and 862; 617, 790, and 841; 617, 790, and 862; 617, 841, and 862; 688, 696, and 702; 688, 696, and 709; 688, 696, and A712; 688, 696, and 714; 688, 696, and 790; 688, 696, and 841; 688, 696, and 862; 688, 702, and 709; 688, 702, and A712; 688, 702, and 714; 688, 702, and 790; 688, 702, and 841; 688, 702, and 862; 688, 709, and A712; 688, 709, and 714; 688, 709, and 790; 688, 709, and 841; 688, 709, and 862; 688, A712, and 714; 688, A712, and 790; 688, A712, and 841; 688, A712, and 862; 688, 714, and 790; 688, 714, and 841; 688, 714, and 862; 688, 790, and 841; 688, 790, and 862; 688, 841, and 862; 696, 702, and 709; 696, 702, and A712; 696, 702, and 714; 696, 702, and 790; 696, 702, and 841;696, 702, and 862; 696, 709, and A712; 696, 709, and 714; 696, 709, and 790; 696, 709, and 841; 696, 709, and 862; 696, A712, and 714; 696, A712, and 790; 696, A712, and 841; 696, A712, and 862; 696, 714, and 790; 696, 714, and 841; 696, 714, and 862; 696, 790, and 841; 696, 790, and 862; 696, 841, and 862; 702, 709, and A712; 702, 709, and 714; 702, 709, and 790; 702, 709, and 841; 702, 709, and 862; 702, A712, and 714; 702, A712, and 790; 702, A712, and 841; 702, A712, and 862; 702, 714, and 790; 702, 714, and 841; 702, 714, and 862; 702, 790, and 841; 702, 790, and 862; 702, 841, and 862; 709, A712, and 714; 709, A712, and 790; 709, A712, and 841; 709, A712, and 862; 709, 714, and 790; 709, 714, and 841; 709, 714, and 862; 709, 790, and 841; 709, 790, and 862; 709, 841, and 862; A712, 714, and 790; A712, 714, and 841; A712, 714, and 862; A712, 790, and 841; A712, 790, and 862; A712, 841, and 862; 714, 790, and 841; 714, 790, and 862; 714, 841, and 862; or 790, 841, and 862.;

[0063] In some embodiments, the nucleotide sequence of a promoter element as provided herein may include two mutations compared to the nucleotide sequence of a reference promoter element. For example, in some embodiments, two mutations may be present in the promoter sequence at positions corresponding to the following positions compared to sequence identification number: 28: 688 and 696; 688 and 702; 688 and A712; 688 and 714; 696 and 702; 696 and A712; 696 and 714; 702 and A712; 702 and 714; or A712 and 714.

[0064] In some embodiments, the nucleotide sequence of a promoter element as provided herein may include three mutations compared to the nucleotide sequence of a reference promoter element. For example, in some embodiments, three mutations may be present in the promoter sequence at positions corresponding to the following positions compared to sequence identification number: 28: 688, 696, and 702; 688, 696, and A712; 688, 696, and 714; 688, 702, and A712; 688, 702, and 714; 688, A712, and 714; 696, 702, and A712; 696, 702, and 714; 696, A712, and 714; or 702, A712, and 714.

[0065] In some embodiments, the nucleotide sequence of a promoter element as provided herein may include four mutations compared to the nucleotide sequence of a reference promoter element. For example, in some embodiments, four mutations may be present in the promoter sequence at positions corresponding to the following positions compared to sequence identification number: 28: 688, 696, 702, and A712; 688, 696, 702, and 714; 688, 696, A712, and 714; 688, 702, A712, and 714; or 696, 702, A712, and 714.

[0066] In some embodiments, the nucleotide sequence of a promoter element as provided herein may include five mutations compared to the nucleotide sequence of a reference promoter element. For example, in some embodiments, five mutations may be present in the promoter sequence at positions corresponding to the following positions compared to sequence identification number: 28: 688, 696, 702, A712, and 714.

[0067] The nucleic acid molecules used in the methods described herein are typically DNA, but RNA molecules may be used under appropriate circumstances. As used herein, “exogenous” refers to any nucleic acid sequence introduced into a cell from, for example, the same or different organism, or synthetically generated nucleic acid (e.g., a codon-optimized nucleic acid sequence). For example, the exogenous nucleic acid may be a nucleic acid from one microorganism (e.g., a methyltrophic yeast of one genus or species) introduced into a methyltrophic yeast of a different genus or species; however, the exogenous nucleic acid may also be a nucleic acid from a methyltrophic yeast introduced recombinantly into a methyltrophic yeast as an additional copy despite the presence of the corresponding natural nucleic acid sequence, or a nucleic acid from a methyltrophic yeast introduced recombinantly into a methyltrophic yeast containing one or more mutations, insertions, or deletions compared to the sequence natural for the methyltrophic yeast. For example, p. Pastoris contains an endogenous nucleic acid encoding ALAS; and p. Additional copies of the Pastoris ALAS nucleic acid (e.g., those recombinantly introduced into P. Pastoris) are considered exogenous. Similarly, "exogenous" proteins are proteins encoded by exogenous nucleic acids.

[0068] In some cases, exogenous nucleic acids may be heterogeneous nucleic acids. As used herein, “heterogeneous” nucleic acids refer to any nucleic acid sequence that is not natural for an organism (e.g., heterogeneous nucleic acids may be nucleic acids from one microorganism introduced into a methyltrophic yeast of a different genus or species (e.g., a methyltrophic yeast of one genus or species, whether or not codon-optimized)). Similarly, “heterogeneous” proteins are proteins encoded by heterogeneous nucleic acids.

[0069] A nucleic acid molecule is considered exogenous to the host organism if any part of it (e.g., a promoter sequence or a sequence of a coded protein) is exogenous to the host organism. A nucleic acid molecule is considered heterogeneous to the host organism if any part of it (e.g., a promoter sequence or a sequence of a coded protein) is heterogeneous to the host organism.

[0070] Nucleic acid constructs that enable genetic engineering of cells (e.g., yeast cells (e.g., methyltrophic yeast cells)) are provided herein. In some embodiments, nucleic acid constructs that enable genetic engineering of cells (e.g., yeast cells (e.g., methyltrophic yeast cells)) to produce RNA are provided herein. Recombinantly produced RNA may be used to modify the function of the cell, for example, by RNA interference or as a guide for DNA editing. In some embodiments, nucleic acid constructs that enable genetic engineering of cells (e.g., yeast cells (e.g., methyltrophic yeast cells)) to produce a product (e.g., a protein) are provided herein. In some embodiments, nucleic acid constructs that enable genetic engineering of cells (e.g., yeast cells (e.g., methyltrophic yeast cells)) to produce an exogenous product (e.g., a protein) are provided herein. In some embodiments, nucleic acid constructs that enable genetic engineering of cells (e.g., yeast cells (e.g., methyltrophic yeast cells)) to produce a heterogeneous product (e.g., a protein) are provided herein. In some embodiments, nucleic acid constructs are provided herein that enable genetic engineering of cells (e.g., yeast cells (e.g., methyltrophic yeast cells)) to produce a product (e.g., a protein) in the absence of methanol. Additionally, nucleic acid constructs are provided herein that enable genetic engineering of cells (e.g., yeast cells (e.g., methyltrophic yeast cells)) to increase the expression of a heme-binding protein.

[0071] Additionally, a cell comprising any of the promoter elements described herein is provided herein. The cell may be any suitable cell. For example, the cell may be a bacterial cell (e.g., E. coli cell, B. subtilis cell, or Lactococcus lactis cell), a fungal cell, an algal cell, a plant cell, an insect cell, or a mammalian cell. In some embodiments, the cell may be a yeast cell. Non-limiting examples of yeast cells include Pichia (e.g., Pichia methanolica, Pichia pastoris), Candida (e.g., Candida boidini) cell, Hansenula (e.g., Hansenula polymorpha) cell, torulopsis cell, and Saccharomyces (e.g., Saccharomyces cerevisae) cell. In some embodiments, the cell may be a methyltrophic yeast cell. Non-limiting examples of methyltrophic yeast cells include Pichia cells, Candida cells, Hansenula cells, and torulopsis cells. In some embodiments, the cell may be a Pichia cell or a Saccharomyces cell.

[0072] In some embodiments, the present document provides a cell containing a nucleic acid construct (e.g., a first nucleic acid construct, a second nucleic acid construct, etc.) comprising a nucleotide sequence operably linked to a promoter element as described herein. The nucleic acid construct comprising the nucleotide sequence may include any suitable nucleotide sequence.

[0073] As used herein, "operably linked" means that the promoter or other expression element(s) are located relative to the coding sequence (e.g., in-frame) in such a manner that they direct or regulate the expression of the coding sequence.

[0074] A nucleic acid construct comprising a nucleotide sequence operably linked to any of the promoter elements described herein will be recognized as being capable of comprising the nucleotide sequence of interest. In some embodiments, transcription and / or translation of the nucleotide sequence may result in the production of the product of interest (e.g., protein, DNA, RNA, or small molecule). For example, in some embodiments, the nucleic acid construct comprising the nucleotide sequence may be a nucleic acid construct encoding a protein. For example, in some embodiments, the nucleic acid construct comprising the nucleotide sequence may be a nucleic acid construct encoding RNA (e.g., mRNA, tRNA, ribozyme, siRNA, miRNA, or shRNA). For example, in some embodiments, the nucleic acid construct comprising the nucleotide sequence may be a nucleic acid construct encoding DNA. For example, in some embodiments, the nucleic acid construct comprising the nucleotide sequence may be a nucleic acid construct whose transcription results in or contributes to the production of a small molecule (e.g., heme, ethanol, or pharmaceutical active agent).

[0075] In some embodiments, a nucleic acid construct comprising a nucleotide sequence (e.g., a first nucleic acid construct, a second nucleic acid construct, etc.) may be a nucleic acid construct encoding a protein (e.g., a first protein, a second protein, etc.).

[0076] Recombinantly expressed proteins can be widely used in many applications, such as food, research, and medicine. In some embodiments, the protein encoded by a nucleic acid construct comprising a nucleotide sequence operably linked to any of the promoter elements described herein may be dehydrin, phytase, protease, catalase, lipase, peroxidase, amylase, transglutaminase, oxidoreductase, transferase, hydrolase, lyase, isomerase, or ligase. In some embodiments, a protein encoded by a nucleic acid operably linked to any of the promoter elements as described herein is an antibody or fragment thereof (e.g., adalimumab, rituximab, trastuzumab, bevacizumab, infliximab, or ranibizumab), an enzyme (e.g., therapeutic enzyme such as alpha-galactosidase A, alpha-L-iduronidase, N-acetylgalactosamine-4-sulfatase, dornase alpha, glucocerebrosidase, tissue plasminogen activator, rasburicase, industrial enzyme (e.g., catalase, cellulase, laccase, glutaminase, or glycosidase), or a biocatalyst (e.g., transaminase, cytochrome P450, kinase, phosphorylase, or isomerase)), a regulatory protein (e.g., transcription factor (e.g., Mxr1, Adr1)), a peptide hormone (e.g., It may be insulin, insulin-like growth factor 1, granulocyte colony-stimulating factor, follicle-stimulating hormone, or growth hormone, e.g., human growth hormone), blood clotting protein (e.g., factor VII), cytokine (e.g., interferon or erythropoietin), or cytokine inhibitor (e.g., etanercept).

[0077] In some embodiments, the protein may be a heme-binding protein (e.g., an exogenous or heterogeneous heme-binding protein). In some embodiments, the heme-binding protein may be selected from the group consisting of globin (PF00042 in the Pfam database), cytochrome (e.g., cytochrome P450, cytochrome a, cytochrome b, cytochrome c), cytochrome c oxidase, ligninase, catalase, and peroxidase. In some embodiments, globin may be selected from the group consisting of androglobin, chlorocruorin, cytoglobin, erythrocruorin, flavohemoglobin, globin E, globin X, globin Y, hemoglobin (e.g., beta-hemoglobin, alpha-hemoglobin), histoglobin, leghemoglobin, myoglobin, neuroglobin, non-symbiotic hemoglobin, protoglobin, and truncated hemoglobin (e.g., HbN, HbO, Glb3, cyanoglobin). In some embodiments, the heme-binding protein may be non-symbiotic hemoglobin. In some embodiments, the heme-binding protein may be leghemoglobin. In some embodiments, the heme-binding protein may be soybean leghemoglobin (LegH). The reference amino acid sequence for LegH is provided in FIG. 1 as sequence identification number: 4. LegH is a heme-binding protein that produces a characteristic absorption at 415 nm and a distinct red color. The LegH protein (also known as LGB2) is found naturally in the root nodules of soybeans (see, e.g., UniprotKB accession number P02236). Also, refer to WO 2014 / 110539 and WO 2014 / 110532, the full text of which is incorporated herein by reference. In some embodiments, the heme-binding protein may have an amino acid sequence that is at least 70% (e.g., at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) identical to the amino acid sequence presented in any of sequence identification numbers: 1-27 (Fig. 1).In some embodiments, the heme-binding protein is the amino acid sequence presented in any of sequence identification numbers: 1-27 (Fig. 1).

[0078] Although materials and methods using an alcohol oxidase promoter element from the Pichia species (P. pastoris) are exemplified herein, other organisms may be used. For example, an alcohol oxidase promoter element from different methyltrophic yeasts, such as other species of the genus Pichia, or from any species of the genera Candida, Hansenula, Pichia, and Torulopsis may be used. Non-limiting examples of methyltrophic yeast species include Pichia methanolica, Pichia pastoris, Candida boidini, and Hansenula polymorpha (also called Pichia angusta). In some embodiments, the promoter element may be an alcohol oxidase promoter element from any of the genera Candida, Hansenula, Pichia, and Torulopsis. In some embodiments, the promoter element may have at least 70% (e.g., at least 75%, 80%, 85%, 90%, 95%, 97%, 98%, or 99%) sequence identity with an alcohol oxidase promoter element from any of the genera Candida, Hansenula, Pichia, and Torulopsis. In some embodiments, the promoter element may be an alcohol oxidase promoter element from any of the genera Candida, Hansenula, Pichia, and Torulopsis. In some embodiments, the promoter element may be an alcohol oxidase promoter element from Pichia methanolica, Pichia pastoris, Candida boidini, or Hansenula polymorpha. In some embodiments, the promoter element may have at least 70% (e.g., at least 75%, 80%, 85%, 90%, 95%, 97%, 98%, or 99%) sequence identity with respect to an alcohol oxidase promoter element from Pichia methanolica, Pichia pastorris, Candida boidini, or Hansenula polymorpha. In some embodiments, the promoter element may be an alcohol oxidase promoter element from Pichia methanolica, Pichia pastorris, Candida boidini, or Hansenula polymorpha.Non-limiting examples of other alcohol oxidase promoters include the AOX2 promoter from Pichia pastoris (e.g., see reference [Ohi, Hideyuki, et al., Molecular and General Genetics MGG 243.5 (1994): 489-499], the alcohol oxidase (AOD1) promoter from Candida boidini (e.g., see GeneBank accession number YSAAOD1A), the alcohol oxidase (MOX) promoter from Hansenula polymorpha (e.g., see GeneBank accession number X02425), or the MOD1 or MOD2 promoter from Pichia methanolica (e.g., see reference [Raymond et al., 1998, Yeast, 14:11-23; and Nakagawa et al., 1999, Yeast, 15:1223-30]). In some embodiments, the alcohol oxidase promoter element may be selected from the group consisting of promoter elements from AOX1, AOX2, AOD1, MOX, MOD1, and MOD2. In some embodiments, the alcohol oxidase promoter element may be a promoter element from AOX1. In some embodiments, the alcohol oxidase promoter element may be a promoter element from AOX2. In some embodiments, the alcohol oxidase promoter element may be a promoter element from AOD1. In some embodiments, the alcohol oxidase promoter element may be a promoter element from MOX. In some embodiments, the alcohol oxidase promoter element may be a promoter element from MOD1. In some embodiments, the alcohol oxidase promoter element may be a promoter element from MOD2.

[0079] In some embodiments, any of the cells described herein (e.g., yeast cells (e.g., methyltrophic yeast cells)) may comprise a second nucleic acid construct comprising a nucleotide sequence, and its transcription and / or translation may result in the production of a second product (e.g., protein, RNA, DNA, or small molecule) operably linked to a promoter element. In some embodiments, the promoter element to which the nucleotide sequence of the second nucleic acid construct is operably linked is identical to the promoter element to which the nucleotide sequence of the first nucleic acid construct is operably linked. In some embodiments, the promoter element to which the nucleotide sequence of the second nucleic acid construct is operably linked is the second promoter element. In some embodiments, the second promoter element may be any of the promoter elements described herein. In some embodiments, the second promoter element may have the same sequence as the first promoter element. In some embodiments, the second promoter element may include one or more mutations corresponding to nucleotide positions 668-734 (e.g., nucleotide positions 673-729, nucleotide positions 678-724, nucleotide positions 683-719, or nucleotide positions 688-714) relative to sequence identification number: 28. In some embodiments, the second promoter element may include one or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19) mutations selected from the group consisting of mutations corresponding to sequence identification number: 28 T146C, C154T, T303C, T426A, A433T, A435G, T530A, C572T, T596C, T617C, T688C, A696T, T702C, A709G, A712G, T714G, A790G, A841T, and T862A.In some embodiments, the second promoter element may include one or more mutations (e.g., 2, 3, 4, 5, 6, 433T, 435G, 530A, 572T, 596C, 617C, 688C, 696T, 702C, 709G, 712G, 714G, 790G, 841T, and 862A) selected from the group of mutations corresponding to sequence identification number: 28, provided that the indicated nucleus is not identical to the corresponding naturally occurring nucleus. In some embodiments, one or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19) mutations may be present in the second promoter element at positions corresponding to the following positions relative to sequence identification number: 28: T146; C154; T303; T426; A433; A435; T530; C572; T596; T617; T688; A696; T702; A709; A712; T714; A790; A841; or T862. In some embodiments, one or more mutations (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19) may be present in the second promoter element at positions corresponding to the following positions relative to sequence identification number: 28: 146; 154; 303; 426; 433; 435; 530; 572; 596; 617; 688; 696; 702; 709; 712; 714; 790; 841; or 862. In some embodiments, the second promoter element may include one or more (e.g., 2, 3, 4, or 5) mutations selected from the group consisting of mutations corresponding to T688C, A696T, T702C, A712G, or T714G relative to sequence identification number: 28.In some embodiments, the second promoter element may include one or more (e.g., 2, 3, 4, or 5) mutations selected from the group consisting of mutations corresponding to 688C, 696T, 702C, 712G, or 714G relative to SEQ ID No. 28, provided that the indicated nucleus is not identical to the corresponding naturally occurring nucleus. In some embodiments, one or more (e.g., 2, 3, 4, or 5) mutations corresponding to one of the following positions relative to SEQ ID No. 28 may be present in the second promoter element: T688; A696; T702; A712; or T714. In some embodiments, one or more (e.g., 2, 3, 4, or 5) mutations corresponding to one of the following positions relative to SEQ ID No. 28 may be present in the second promoter element: 688; 696; 702; 712; or 714. In some embodiments, the second promoter element may be an inducible promoter element (e.g., a methanol-inducible promoter element) or a constitutive promoter element.

[0080] When genetically modifying cells (e.g., yeast (e.g., methyltrophic yeast)), any of the multiple inducible promoters may generally be used. For example, a methanol-inducible promoter or a promoter element derived therefrom may be used. Suitable methanol-inducible promoters include pAOX1 as described herein, as well as other methanol-inducible promoters or promoter elements derived therefrom. These are, without limitation, the pAOX2 promoter from *Phychia pasterosi*, the alcohol oxidase (AOD1) promoter from *Candida boidini* (e.g., see GeneBank accession number YSAAOD1A), the alcohol oxidase (MOX) promoter from *Hansenula polymorpha* (e.g., see GeneBank accession number X02425), the MOD1 or MOD2 promoter from *Phychia methanolica* (e.g., see references [Raymond et al., 1998, Yeast, 14:11-23; and Nakagawa et al., 1999, Yeast, 15:1223-30]), the DHAS promoter from *Phychia pasterosi* (e.g., see GeneBank accession number FJ752551) or promoter elements derived therefrom, p. Includes the formaldehyde dehydrogenase (FLD1) promoter from Pastoris (e.g., see GeneBank accession number AF066054), or the PEX8 promoter from P. Pastoris (e.g., see reference [Kranthi et al., 2010, Yeast, 27:705-11]). All of these promoters are known to be induced by methanol. Suitable constitutive promoters and constitutive promoter elements include, without limitation, the P. Pastoris promoter (or parts thereof) from the transcription elongation factor EF-1α gene (TEF1) which is strongly transcribed in a constitutive manner. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) promoter from P. Pastoris (e.g., see GeneBank accession number U62648.1), P.Other suitable constitutive promoters (or promoter elements therefrom) may also be used, to the non-limiting extent, including a potential glycosyl phosphatidylinositol (GPI)-anchored protein from Pastoris, a promoter from GCW14p (PAS_chr1-4_0586) (see, e.g., GeneBank accession number XM_002490678), and a promoter from the 3-phosphoglycerate kinase gene (PGK1) from Pastoris (see, e.g., GeneBank accession number AY288296). Additionally, it is noted that a combination of inducible (e.g., methanol-inducible) and constitutive promoters (or promoter elements therefrom) may be combined to further increase the expression of any of the nucleic acids operably linked thereto.

[0081] In some embodiments, the second protein may be any of the proteins described above. In some embodiments, the second protein may be a transcription factor (e.g., Mxr1). In some embodiments, any of the promoter elements of the present invention (e.g., the first promoter element or the second promoter element) may contain one or more recognition sequences for the transcription factor. Thus, in some embodiments, a feedback loop may be constructed so that the transcription factor drives the expression of the protein of interest and also the expression of additional copies of the transcription factor. In some embodiments, the transcription factor may be Mxr1. In some embodiments, the second protein may be a protein involved in heme biosynthesis (e.g., a protein selected from the group consisting of aminolevulinate synthase (ALAS), δ-aminolevulinate dehydratase (ALAD), porfobilinogen deaminase (PBGD), uroporpyrinogen III synthase (UPG3S), uroporpyrinogen III decarboxylase (UPG3D), coprotoporpyrinogen oxidase (COPROX), protoporpyrinogen IX oxidase (PROTOX), and / or ferrokilatase (FC)).

[0082] Nucleic acids encoding one or more of the eight different enzymes involved in heme biosynthesis (as determined from the sequence of the Pichia pastoris genome and annotated) may be expressed as described herein. For example, heteronucleic acid molecules encoding ALA synthase, ALA dehydratase, porfobilinogen deaminase, UPG III synthase, UPG III decarboxylase, CPG oxidase, PPG oxidase, and ferrokilatase may be expressed in strains described herein (e.g., yeast strains (e.g., methyltrophic yeast strains)). When cells (e.g., yeast (e.g., methyltrophic yeast)) are genetically engineered to contain more than one heteronucleic acid (e.g., transgene), the expression of these nucleic acids may be further increased by combining methanol-inducible and constitutive promoters or elements derived therefrom.

[0083] Any of the cells described herein (e.g., yeast cells (e.g., methyltrophic yeast cells)) may include additional nucleic acid constructs as third, fourth, fifth, etc. nucleic acid constructs, and it will be understood that such constructs may be as described above for the second nucleic acid construct in some embodiments.

[0084] Previous studies in Saccharomyces cerevisiae identified ALAD and porfobilinogen deaminase as rate-limiting enzymes in heme biosynthesis (e.g., see [Hoffman et al., 2003, Biochem. Biophys. Res. Commun., 310(4):1247-53]). However, heterogeneous expression of individual heme enzymes in p. pastoris from the glyceraldehyde-3-phosphate dehydrogenase (GAP) promoter failed to overcome the limitations associated with the expression of heme-containing recombinant proteins (see [Krainer et al., 2015, Microb. Cell Fact., 13;14:4]). p. Expression of recombinant heme-containing proteins in pastoris can be achieved by co-expressing the entire heme biosynthetic pathway from a methanol-inducible promoter, but it will be recognized that one or more of the genes associated with the heme biosynthetic pathway may be expressed from one or more constitutive promoters (see, for example, U.S. Patent No. 9,938,327, the full text of which is incorporated by reference).

[0085] Additionally, a method for producing a product (e.g., a protein) using any of the nucleic acid constructs and / or cells described herein is provided. In some embodiments, the method provided herein may include expressing a nucleic acid construct comprising a nucleotide sequence (e.g., encoding a first protein) operably linked to a first promoter element. In some embodiments, the first promoter element may be any promoter element described herein. In some embodiments, the first promoter element comprises one or more mutations corresponding to nucleotide positions 668-734 (e.g., nucleotide positions 673-729, nucleotide positions 678-724, nucleotide positions 683-719, or nucleotide positions 688-714) relative to sequence identification number: 28. In some embodiments, the method provided herein may comprise expressing a nucleic acid construct comprising a nucleotide sequence (e.g., encoding a first protein) operably linked to a first promoter element, wherein the first promoter element comprises one or more mutations selected from the group consisting of mutations corresponding to T146C, C154T, T303C, T426A, A433T, A435G, T530A, C572T, T596C, T617C, T688C, A696T, T702C, A709G, A712G, T714G, A790G, A841T, and T862A relative to sequence identification number: 28 (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, Includes 18 or 19 mutations.In some embodiments, the method provided herein may comprise expressing a nucleic acid construct comprising a nucleotide sequence (e.g., encoding a first protein) operably linked to a first promoter element, wherein the first promoter element is one or more selected from the group consisting of mutations corresponding to 146C, 154T, 303C, 426A, 433T, 435G, 530A, 572T, 596C, 617C, 688C, 696T, 702C, 709G, 712G, 714G, 790G, 841T, and 862A relative to Sequence Identification No.: 28, provided that the indicated nucleus is not identical to a corresponding naturally occurring nucleus (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, It includes 14, 15, 16, 17, 18, or 19) mutations. In some embodiments, the method provided herein may include expressing a nucleic acid construct comprising a nucleotide sequence (e.g., encoding a first protein) operably linked to a first promoter element, wherein the promoter element includes one or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19) mutations at a position corresponding to the following relative to sequence identification number: 28: T146; C154; T303; T426; A433; A435; T530; C572; T596; T617; T688; A696; T702; A709; A712; T714; A790; A841; or T862.In some embodiments, the method provided herein may comprise expressing a nucleic acid construct comprising a nucleotide sequence (e.g., encoding a first protein) operably linked to a first promoter element, wherein the promoter element comprises one or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19) mutations at positions corresponding to the following positions relative to sequence identification number: 28: 146; 154; 303; 426; 433; 435; 530; 572; 596; 617; 688; 696; 702; 709; 712; 714; 790; 841; or 862. In some embodiments, the method provided herein may comprise expressing a nucleic acid construct comprising a nucleotide sequence (e.g., encoding a first protein) operably linked to a first promoter element, wherein the first promoter element comprises one or more (e.g., 2, 3, 4, or 5) mutations selected from the group consisting of mutations corresponding to T688C, A696T, T702C, A712G, and T714G relative to sequence identification number: 28. In some embodiments, the method provided herein may comprise expressing a nucleic acid construct comprising a nucleotide sequence (e.g., encoding a first protein) operably linked to a first promoter element, wherein the first promoter element comprises one or more (e.g., 2, 3, 4, or 5) mutations selected from the group consisting of mutations corresponding to 688C, 696T, 702C, 712G, and 714G relative to sequence identification number: 28, provided that the indicated nucleus is not identical to the corresponding naturally occurring nucleus.In some embodiments, the method provided herein may comprise expressing a nucleic acid construct comprising a nucleotide sequence (e.g., encoding a first protein) operably linked to a first promoter element, wherein the promoter element comprises one or more (e.g., 2, 3, 4, or 5) mutations at a position corresponding to the position below relative to SEQ ID NO: 28: T688; A696; T702; A712; or T714. In some embodiments, the method provided herein may comprise expressing a nucleic acid construct comprising a nucleotide sequence (e.g., encoding a first protein) operably linked to a first promoter element, wherein the promoter element comprises one or more (e.g., 2, 3, 4, or 5) mutations at a position corresponding to the position below relative to SEQ ID NO: 28: 688; 696; 702; 712; Or 714. In some embodiments of any of the methods described herein, the method may be carried out in the absence of added methanol. In some embodiments, the primary carbon source for methyltrophic yeast cells may be dextrose, sucrose, xylose, lactose, maltose, isomaltose, arabinose, sugar alcohol, ethanol, acetate, or glycerol. In some embodiments, the primary carbon source may be selected from the group consisting of glucose, sucrose, sorbitol, methanol, and glycerol. In some embodiments, the primary carbon source may be selected from the group consisting of glucose, sucrose, sorbitol, and glycerol. In some embodiments, the primary carbon source may be an oligosaccharide or polysaccharide (e.g., starch, pectin, cellulose, or hemicellulose). In some embodiments, the primary carbon source for methyltrophic yeast cells may be a mixture of sugars (e.g., derived from cellulose biomass or starch).

[0086] In some embodiments, the method provided herein causes the potency of a product (e.g., protein) to increase. In some embodiments, the potency of the product (e.g., protein) may be increased by at least 5% (e.g., at least 6%, 7%, 8%, 9%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 150%, 200%, 250%, 300%, 350%, 400%, 500%, 600%, 700%, 800%, 900%, 1000%, or more) compared to a corresponding method lacking a nucleic acid construct as described herein. In some embodiments, the titer of the product (e.g., protein) is at least 5% (e.g., at least 6%, 7%, 8%, 9%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 150%, 300%, 250%, 300%, 300%, 300%, 150%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 150%, 200%, 250%, 300%, compared to a corresponding method comprising expressing a nucleic acid encoding a first product (e.g., protein) operably linked to a first promoter element in which any mutation at nucleotide positions corresponding to nucleotide positions 668-734 (e.g., nucleotide positions 673-729, nucleotide positions 678-724, nucleotide positions 683-719, or nucleotide positions 688-714) is lacking, compared to a corresponding method comprising expressing a nucleic acid encoding a first product (e.g., at least 6%, 7%, 8%, 9%, 200%, 250%, 300%, It can be increased by 350%, 400%, 500%, 600%, 700%, 800%, 900%, 1000% or more.In some embodiments, the titer of the product (e.g., protein) is at least 5% (e.g., at least 6%, 7%, 8%, 9%, 10%, 15%, 20%, 30%, 40%, 50%, compared to a corresponding method comprising expressing a nucleic acid construct comprising a nucleotide sequence (e.g., encoding a first protein) operably linked to a first promoter element lacking any mutation selected from the group consisting of mutations corresponding to T146C, C154T, T303C, T426A, A433T, A435G, T530A, C572T, T596C, T617C, T688C, A696T, T702C, A709G, A712G, T714G, A790G, A841T, and T862A relative to SEQ ID No. 28) It can be increased by 60%, 70%, 80%, 90%, 100%, 150%, 200%, 250%, 300%, 350%, 400%, 500%, 600%, 700%, 800%, 900%, 1000% or more.In some embodiments, the titer of the product (e.g., protein) is at least 5% (e.g., at least 6%, 7%, 8%, 9%, 10%, 15%, 20%, 20%, 20%, 20%, 20%, 20%, 20%, 303C, 426A, 433T, 435G, 530A, 572T, 596C, 617C, 688C, 696T, 702C, 709G, 712G, 714G, 790G, 841T, and 862A) compared to a corresponding method comprising expressing a nucleic acid construct comprising a nucleotide sequence (e.g., encoding a first protein) comprising a nucleotide sequence operably linked to a first promoter element lacking any mutation selected from the group consisting of mutations corresponding to SEQ ID No. 28, 146C, 154T, 303C, 426A, 433T, 435G, 530A, 572T, 596C, 617C, 688C, 696T, 702C, 709G, 712G, 714G, 790G, 841T, and 862A, provided that the indicated nucleobase is not identical to the corresponding naturally occurring nucleobase, compared to a corresponding method comprising expressing a nucleic acid construct comprising a nucleotide sequence comprising a nucleotide (e.g., encoding a first protein) that lacks any mutation selected from the group consisting of mutations corresponding to 146C, 154T, 303C, 426A, 433T, 435G, 530A, 572T, 596C, 617 It can be increased by 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 150%, 200%, 250%, 300%, 350%, 400%, 500%, 600%, 700%, 800%, 900%, 1000% or more.In some embodiments, the titer of the product (e.g., protein) is at least 5% (e.g., at least 6%, 7%, 8%, 9%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 80%, 80%) compared to a corresponding method comprising expressing a nucleic acid construct comprising a nucleotide sequence (e.g., encoding a first protein) comprising a nucleotide sequence operably linked to a first promoter element lacking any mutation at nucleotide positions corresponding to nucleotide positions T146, C154, T303, T426, A433, A435, T530, C572, T596, T617, T688, A696, T702, A709, A712, T714, A790, A841, and T862 relative to Sequence Identification No.: 28 It can be increased by 90%, 100%, 150%, 200%, 250%, 300%, 350%, 400%, 500%, 600%, 700%, 800%, 900%, 1000% or more. In some embodiments, the titer of the product (e.g., protein) is at least 5% (e.g., at least 6%, 7%, 8%, 9%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 80%, 80%) compared to a corresponding method comprising expressing a nucleic acid construct comprising a nucleotide sequence (e.g., encoding a first protein) comprising a nucleotide sequence operably linked to a first promoter element lacking any mutation at nucleotide positions corresponding to nucleotide positions 146, 154, 303, 426, 433, 435, 530, 572, 596, 617, 688, 696, 702, 709, 712, 714, 790, 841, and 862 relative to Sequence Identification No.: 28. It can be increased by 90%, 100%, 150%, 200%, 250%, 300%, 350%, 400%, 500%, 600%, 700%, 800%, 900%, 1000% or more.

[0087] In some embodiments, the titer of the product (e.g., protein) is at least 5% (e.g., at least 6%, 7%, 8%, 9%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 150%, 200%, 50%, 60%, 70%, 80%, 90%, 100%, 150%, 200%, 250%, 300%, 350%, 400%, 500%, 60%, 70%, 80%, 90%, 100%, 150%, 200%, 250%, 300%, 350%, 400%, 500%, 600%, 700%, 8 It can be increased by 900%, 1000%, or more. In some embodiments, the titer of the product (e.g., protein) is at least 5% (e.g., at least 6%, 7%, 8%, 9%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 150%, 20%, 7%, 8%, 9%, 60%, 70%, 80%, 90%, 100%, 150%, 200%, 50%, 60%, 70%, 80%, 90%, 100%, 150%, 200%, 250%, 300%, 350%, 400%, 500%, 600%, 700%, 8 It can be increased by 900%, 1000%, or more.In some embodiments, the titer of the product (e.g., protein) is at least 5% (e.g., at least 6%, 7%, 8%, 9%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 150%, 20%, 50%, 60%, 70%, 80%, 90%, 100%, 150%, 200%, 250%, 300%, 350%, 400%, 50%, 60%, 70%, 80%, 90%, 100%, 150%, 200%, 250%, 300%, 350%, 400%, 500%, 600%, 700%, 8 It can be increased by 900%, 1000%, or more. In some embodiments, the titer of the product (e.g., protein) is at least 5% (e.g., at least 6%, 7%, 8%, 9%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 150%, 20%, 7%, 8%, 9%, 60%, 70%, 80%, 90%, 100%, 150%, 200%, 50%, 60%, 70%, 80%, 90%, 100%, 150%, 200%, 250%, 300%, 350%, 400%, 500%, 600%, 700%, 8 It can be increased by 900%, 1000%, or more.

[0088] Generally, "potency" is a measure of the amount of a substance in solution. As used herein, "potency" of a heme-binding protein refers to the total amount of polypeptide, whether bound to or unbound to heme, unless otherwise specified. The potency of a product (e.g., protein) may be measured by any suitable method, such as high-performance liquid chromatography (HPLC), high-performance liquid chromatography-mass spectrometry (HPLC-MS), enzyme-linked immunosorbent assay (ELISA), or ultraviolet and / or visible light spectroscopy.

[0089] The "corresponding method" used herein is essentially the same as the reference method in all respects, except for identified differences. For example, a corresponding method for expressing a nucleic acid construct comprising a nucleotide sequence (e.g., encoding a first protein) operably linked to a first promoter element lacking one or more mutations corresponding to mutations at nucleotide positions corresponding to nucleotide positions 668-734 (e.g., nucleotide positions 673-729, nucleotide positions 678-724, nucleotide positions 683-719, or nucleotide positions 688-714) relative to sequence identification number: 28, wherein the corresponding method comprises a nucleotide sequence operably linked to a first promoter element lacking any mutation corresponding to mutations at nucleotide positions corresponding to nucleotide positions 668-734 (e.g., nucleotide positions 673-729, nucleotide positions 678-724, nucleotide positions 683-719, or nucleotide positions 688-714) relative to sequence identification number: 28. Except for expressing a nucleic acid construct containing a sequence (e.g., encoding the first protein), it will be essentially the same as the reference method in all aspects (e.g., genetic composition of the cell, culture temperature and time, etc.).For example, a corresponding method for expressing a nucleic acid construct comprising a nucleotide sequence (e.g., encoding a first protein) operably linked to a first promoter element lacking one or more mutations selected from the group consisting of mutations corresponding to T146C, C154T, T303C, T426A, A433T, A435G, T530A, C572T, T596C, T617C, T688C, A696T, T702C, A709G, A712G, T714G, A790G, A841T, and T862A relative to sequence identification number: 28, wherein the corresponding method is T146C, C154T, T303C, T426A, A433T, A435G, T530A, C572T, T596C relative to sequence identification number: 28, Except for expressing a nucleic acid construct comprising a nucleotide sequence (e.g., encoding a first protein) operably linked to a first promoter element in which any of the mutations included in the group corresponding to T617C, T688C, A696T, T702C, A709G, A712G, T714G, A790G, A841T, and T862A are lacking, it will be essentially the same as the reference method in all aspects (e.g., genetic composition of the cell, culture temperature and time, etc.).For example, a corresponding method for expressing a nucleic acid construct comprising a nucleotide sequence (e.g., encoding a first protein) operably linked to a first promoter element having one or more mutations lacking at nucleotide positions corresponding to sequence identification number: 28, nucleotide positions T146, C154, T303, T426, A433, A435, T530, C572, T596, T617, T688, A696, T702, A709, A712, T714, A790, A841, and T862, wherein the corresponding method wherein the nucleotide sequence (e.g. encoding a first protein) corresponding to sequence identification number: 28, nucleotide positions T146, C154, T303, T426, A433, A435, T530, C572, T596, T617, T688, A696, T702, Except for expressing a nucleic acid construct comprising a nucleotide sequence (e.g., encoding a first protein) operably linked to a first promoter element lacking any of the mutations at nucleotide positions corresponding to A709, A712, T714, A790, A841, and T862, it will be essentially the same as the reference method in all aspects (e.g., genetic composition of the cell, culture temperature and time, etc.).For example, a corresponding method for expressing a nucleic acid construct comprising a nucleotide sequence (e.g., encoding a first protein) operably linked to a first promoter element lacking one or more mutations selected from the group consisting of mutations corresponding to 146C, 154T, 303C, 426A, 433T, 435G, 530A, 572T, 596C, 617C, 688C, 696T, 702C, 709G, 712G, 714G, 790G, 841T, and 862A against sequence identification number: 28, wherein the corresponding method [complies with] 146C, 154T, 303C, 426A, 433T, 435G, 530A, 572T, 596C, Except for expressing a nucleic acid construct comprising a nucleotide sequence (e.g., encoding a first protein) operably linked to a first promoter element lacking any of the mutations included in the group corresponding to 617C, 688C, 696T, 702C, 709G, 712G, 714G, 790G, 841T, and 862A, it will be essentially the same as the reference method in all aspects (e.g., genetic composition of the cell, culture temperature and time, etc.).For example, a corresponding method for expressing a nucleic acid construct comprising a nucleotide sequence (e.g., encoding a first protein) operably linked to a first promoter element having one or more mutations lacking at nucleotide positions corresponding to sequence identification number: 28, nucleotide positions 146, 154, 303, 426, 433, 435, 530, 572, 596, 617, 688, 696, 702, 709, 712, 714, 790, 841, and 862, wherein the corresponding method wherein the nucleotide sequence (e.g., encoding a first protein) relative to sequence identification number: 28, nucleotide positions 146, 154, 303, 426, 433, 435, 530, 572, 596, 617, 688, 696, 702, Except for expressing a nucleic acid construct comprising a nucleotide sequence (e.g., encoding a first protein) operably linked to a first promoter element in which any of the mutations at nucleotide positions corresponding to 709, 712, 714, 790, 841, and 862 are missing, it will be essentially the same as the reference method in all aspects (e.g., genetic composition of the cell, culture temperature and time, etc.).

[0090] For example, a corresponding method for expressing a nucleic acid construct comprising a nucleotide sequence operably linked to a first promoter element (e.g., encoding a first protein) lacking one or more mutations selected from the group of mutations corresponding to T688C, A696T, T702C, A712G, and T714G relative to sequence identification number: 28 will be essentially the same as the reference method in all respects (e.g., genetic composition of the cell, culture temperature and time, etc.), except that the corresponding method expresses a nucleic acid construct comprising a nucleotide sequence operably linked to a first promoter element (e.g., encoding a first protein) lacking any of the mutations included in the group of mutations corresponding to T688C, A696T, T702C, A712G, and T714G relative to sequence identification number: 28. For example, a corresponding method for expressing a nucleic acid construct comprising a nucleotide sequence operably linked to a first promoter element (e.g., encoding a first protein) lacking one or more mutations selected from the group of mutations corresponding to sequence identification number: 28, 688C, 696T, 702C, 712G, and 714G, will be essentially the same as the reference method in all respects (e.g., genetic composition of the cell, culture temperature and time, etc.), except that the corresponding method expresses a nucleic acid construct comprising a nucleotide sequence operably linked to a first promoter element (e.g., encoding a first protein) lacking any of the mutations included in the group of mutations corresponding to sequence identification number: 28, 688C, 696T, 702C, 712G, and 714G.For example, a corresponding method for expressing a nucleic acid construct comprising a nucleotide sequence (e.g., encoding a first protein) operably linked to a first promoter element lacking one or more mutations at nucleotide positions T688, A696, T702, A712, and T714 relative to sequence identification number: 28 will be essentially the same as the reference method in all respects (e.g., genetic composition of the cell, culture temperature, and time, etc.), except that the corresponding method expresses a nucleic acid construct comprising a nucleotide sequence (e.g., encoding a first protein) operably linked to a first promoter element lacking any of the mutations included in the group consisting of mutations corresponding to T688, A696, T702, A712, and T714 relative to sequence identification number: 28. For example, a corresponding method for expressing a nucleic acid construct comprising a nucleotide sequence (e.g., encoding a first protein) operably linked to a first promoter element lacking one or more mutations at nucleotide positions 688, 696, 702, 712, and 714 relative to sequence identification number: 28 will be essentially the same as the reference method in all respects (e.g., genetic composition of the cell, culture temperature and time, etc.), except that the corresponding method expresses a nucleic acid construct comprising a nucleotide sequence (e.g., encoding a first protein) operably linked to a first promoter element lacking any of the mutations included in the group consisting of mutations corresponding to sequence identification number: 28, 688, 696, 702, 712, and 714 relative to sequence identification number: 28.

[0091] Genetically modifying a cell (e.g., a yeast cell (e.g., a methyltrophic yeast cell)) typically involves introducing a recombinant nucleic acid molecule (also referred to as a nucleic acid construct) into the cell. As described herein, the recombinant nucleic acid molecule typically comprises an exogenous nucleic acid encoding a product (e.g., a protein (e.g., a protein involved in heme biosynthesis, a heme-binding protein, or a transcription factor)) operably linked to at least one promoter element (e.g., an inducible or constitutive promoter element). In some embodiments, the recombinant nucleic acid molecule may comprise a linear sequence of two or more protein-coding sequences operably linked to the same or distinct promoter elements (e.g., a first promoter operably linked to a first nucleic acid construct comprising a nucleotide sequence (e.g., encoding a first protein) and a second promoter operably linked to a second nucleic acid construct comprising a nucleotide sequence (e.g., encoding a second protein), or a first nucleic acid construct comprising a nucleotide sequence (e.g., encoding a first protein) and a promoter operably linked to a second nucleic acid construct comprising a nucleotide sequence (e.g., encoding a second protein). In some cases, a recombinant nucleic acid molecule comprising at least one promoter operably linked to a nucleotide sequence (e.g., encoding a protein) may be referred to as a cassette.

[0092] Recombinant nucleic acids may contain expression elements. Expression elements include nucleic acid sequences that direct and regulate the expression of a nucleic acid coding sequence. One example of an expression element is a promoter sequence. Expression elements may also include introns, enhancer sequences, reaction elements, or inducible elements that coordinate the expression of the nucleic acid. Expression elements may be of bacterial, yeast, insect, mammalian, or viral origin, and vectors may contain a combination of elements from different origins.

[0093] Nucleic acids can be detected using any number of amplification techniques with appropriate pairs of oligonucleotides (e.g., primers) (see, e.g., literature [PCR Primer: A Laboratory Manual, 1995, Dieffenbach & Dveksler, Eds., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY]; and U.S. Patent Nos. 4,683,195; 4,683,202; 4,800,159; and 4,965,188). Numerous variations of the original PCR method have been developed and can be used to detect selected nucleic acids.

[0094] Suitable transcription factors and nucleic acids encoding the transcription factors (e.g., exogenous nucleic acids encoding the transcription factors) include, for example, Mxr1 from P. p. pastoris. Representative P. pastoris Mxr1 nucleic acid sequences can be found, for example, at GeneBank accession number DQ395124, and representative P. pastoris Mxr1 polypeptide sequences can be found, for example, at GeneBank accession number ABD57365. In some embodiments, the transcription factor may be the Mit1 sequence from P. pastoris (see, for example, GeneBank accession number CAY70887). Suitable transcription factors can also be found in *Hansenula polymorpha* (e.g., Adr1; e.g., see GeneBank accession number AEOI02000005 for nucleic acid sequence, bases 858873 to 862352 and GeneBank accession number ESX01253 for amino acid sequence) and *Candida boidini* (e.g., Trm1; e.g., see GeneBank accession number AB365355 for nucleic acid sequence and GeneBank accession number BAF99700 for amino acid sequence; and Trm2; e.g., see GeneBank accession number AB548760 for nucleic acid sequence and GeneBank accession number BAJ07608 for amino acid sequence).

[0095] Transcription factors such as Mxr1 can typically be expressed at low levels. In some embodiments, it is preferable to place exogenous nucleic acids (e.g., transcription factors) under the control of an inducible promoter.

[0096] In some embodiments, a transcription factor may bind to a promoter element as described herein and may activate transcription from the promoter element. In some embodiments, when a nucleic acid sequence encoding a transcription factor is operably linked to the promoter element to which it binds, a positive feedback loop may be created to help drive the expression of another nucleic acid sequence (e.g., a protein-coding nucleic acid sequence) operably linked to the promoter. Non-limiting examples of transcription factors that may be used with an AOX1 promoter (e.g., a mutated AOX1 promoter) include Mxr1, Mit1, Adr1, Trm1, Trm2, and combinations thereof. In some embodiments, transcription factors that may be used with an AOX1 promoter may include Mxr1. Non-limiting examples of transcription factors that may be used with a MOX promoter (e.g., a mutated MOX promoter) are Adr1. Non-limiting examples of transcription factors that can be used with the AOD1 promoter (e.g., a mutated AOD1 promoter) include Trm1, Trm2, or a combination thereof. In some embodiments, two methanol-regulated transcription factors (e.g., Mxr1 and Mit1) may be operably linked to a methanol-inducible promoter element (e.g., pAOX1).

[0097] The recombinant nucleic acid molecules described herein can be stably incorporated into the genome of a cell (e.g., a yeast cell (e.g., a methyltrophic yeast cell)) or expressed extrachromosomally from a replication-eligible plasmid. Methods for achieving both are widely known and are commercially used in the relevant art.

[0098] Additionally, it is noted that a first nucleic acid construct comprising a nucleotide sequence operably linked to a promoter element (e.g., a promoter element as described herein) (e.g., encoding a first protein (e.g., a heme-binding protein)) can be physically separated from a second nucleic acid construct comprising a nucleotide sequence operably linked to a promoter element (e.g., a promoter element as described herein) (e.g., encoding a second protein (e.g., a transcription factor)) (i.e., the first and second nucleic acid constructs can be completely separate molecules). Alternatively, the first nucleic acid construct comprising a nucleotide sequence operably linked to a promoter element (e.g., a promoter element as described herein) (e.g., encoding a first protein) and the second nucleic acid construct comprising a nucleotide sequence operably linked to a promoter element (e.g., a promoter element as described herein) (e.g., encoding a second protein) may be contained within the same nucleic acid construct. In some embodiments, a first nucleic acid construct comprising a nucleotide sequence (e.g., encoding a first protein) operably linked to a promoter element may be adjacent to a second nucleic acid construct comprising a nucleotide sequence (e.g., encoding a second protein) operably linked to a promoter element. A person skilled in the art will recognize that when a second nucleic acid construct comprising a nucleotide sequence (e.g. encoding a second protein) is adjacent to a first nucleic acid construct comprising a nucleotide sequence (e.g. encoding a protein of interest), a single promoter or a promoter element therefrom may be used to drive the transcription of both or all nucleotide sequences (e.g., nucleic acids encoding the first protein as well as the second protein).

[0099] Methods for introducing nucleic acids into cells (e.g., yeast cells (e.g., methyltrophic yeast cells)) are known in the art and include, but are not limited to, transduction, electroporation, bioplastic particle delivery, and chemical conversion. Methods for culturing cells (e.g., yeast cells (e.g., methyltrophic yeast cells)) are also known in the art. For example, the literature [Pichia Protocols, Methods In Molecular Biology, 389, Cregg, Ed., 2007, 2 nd Refer to [Ed., Humana Press, Inc.]. Under some circumstances, it may be desirable to introduce or add methanol to the culture medium, but as demonstrated herein, methanol is not required to obtain efficient expression of one or more products of interest (e.g., proteins) at high levels. Under some circumstances (e.g., when one or more nucleic acids encoding enzyme(s) involved in heme biosynthesis are expressed), it may be desirable to supplement the culture medium with iron or its pharmaceutically or metabolically acceptable (or GRAS) salts.

[0100] The method provided herein may also include purifying the expressed protein. The “enriched” protein used herein is a protein that accounts for at least 5% (e.g., at least 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, or more) based on the dry weight of the mass of the producing cell, or at least 10% (e.g., at least 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 90%, 95%, or 99%) based on the dry weight of the mass of the producing cell lysate (e.g., cell wall or membrane material). The “purified” protein used herein is a protein isolated from its naturally associated cellular components. Typically, a protein is considered “purified” if it is free of other naturally associated proteins and naturally occurring molecules by at least 70% (e.g., at least 75%, 80%, 85%, 90%, 95%, or 99%) on a dry weight basis.

[0101] The nucleic acids used herein may include DNA and RNA, and include nucleic acids containing one or more nucleotide analogs or backbone modifications. The nucleic acids may be single-stranded or double-stranded, which typically depends on their intended use. Additionally, nucleic acids and polypeptides different from a given sequence are provided. The nucleic acids and polypeptides may have at least 50% sequence identity with respect to a given nucleic acid or polypeptide sequence (e.g., at least 55%, 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity). In some embodiments, the nucleic acid or polypeptide may have 100% sequence identity with respect to a given nucleic acid or polypeptide sequence.

[0102] In calculating the percent sequence identity, two sequences are aligned, and the number of identical matches of nucleotide or amino acid residues between the two sequences is determined. The number of identical matches is divided by the length of the aligned region (i.e., the number of aligned nucleotide or amino acid residues) and multiplied by 100 to arrive at the percent sequence identity value. The length of the aligned region is recognized as being part of one or both sequences up to the full length of the shortest sequence. Additionally, a single sequence may be aligned with more than one other sequence, and thus may have different percent sequence identity values ​​across each aligned region.

[0103] Alignment of two or more sequences to determine percent sequence identity can be performed using the computer program ClustalW and default parameters, which ensures that the alignment of nucleic acid or polypeptide sequences occurs along their entire length (overall alignment). Reference [Chenna et al., 2003, Nucleic Acids Res., 31(13):3497-500]. ClustalW calculates the best match between a query sequence and one or more target sequences and aligns them so that identity, similarity, and difference can be determined. To maximize sequence alignment, a gap of one or more residues can be inserted into the query sequence, the target sequence, or both. For rapid pairwise alignment of nucleic acid sequences, default parameters can be used (i.e., Word size: 2; Window size: 4; Scoring method: Percentage; Number of upper diagonals: 4; and Gap penalty: 5); For the alignment of multiple nucleic acid sequences, the following parameters may be used: Gap opening penalty: 10.0; Gap extension penalty: 5.0; and weight change: e.g. For rapid pairwise alignment of polypeptide sequences, the following parameters may be used: Word size: 1; Window size: 5; Scoring method: Percentage; Number of upper diagonals: 5; and Gap penalty: 3. For multiple alignment of polypeptide sequences, the following parameters may be used: Weight matrix: Blossom; Gap opening penalty: 10.0; Gap extension penalty: 0.05; Hydrophilic gap: ON; Hydrophilic residues: Gly, Pro, Ser, Asn, Asp, Gln, Glu, Arg, and Lys; and residue-specific gap penalty: ON. ClustalW can be run, for example, on the Baylor College of Medicine search launcher website or the European Bioinformatics Institute website on the World Wide Web.

[0104] Changes can be introduced into nucleic acid molecules and can lead to changes in the amino acid sequence of the polypeptide encoded by them. For example, changes can be introduced into the nucleic acid coding sequence by using mutagenic agents (e.g., site-specific mutagenic, PCR-mediated mutagenic, transposon mutagenic, chemical mutagenic, UV mutagenic, or radiation-induced mutagenic) or by chemically synthesizing nucleic acid molecules having such changes. These nucleic acid changes can lead to conservative and / or non-conservative amino acid substitutions at one or more amino acid residues. A "conservative amino acid substitution" is the replacement of one amino acid residue with a different amino acid residue having a similar side chain (e.g., see references providing frequency tables for amino acid substitutions [Dayhoff et al., 1978, Atlas of Protein Sequence and Structure, 5(Suppl. 3):345-352]), and a non-conservative substitution is the replacement of an amino acid residue with an amino acid residue that does not have a similar side chain. Nucleic acid and / or polypeptide sequences may be modified as described herein to improve one or more characteristics, such as, to a non-limiting extent, increased expression (e.g., transcription and / or translation), stricter regulation, deregulation, loss of catabolic inhibition, modified specificity, secretion, thermal stability, solvent stability, oxidative stability, protease resistance, catalytic activity, and / or color.

[0105] The "isolated" nucleic acid molecules used herein are nucleic acid molecules from the genome of the organism from which the isolated nucleic acid molecules originated (e.g., cDNA or genomic DNA fragments produced by PCR or restriction endonuclease digestion) that lack naturally flanked sequences at one or both ends of the nucleic acid. These isolated nucleic acid molecules are generally introduced into a vector (e.g., a cloning vector or an expression vector) for the convenience of manipulation or to generate fusion nucleic acid molecules, which is discussed in more detail below. Additionally, the isolated nucleic acid molecules may include engineered nucleic acid molecules, such as recombinant or synthetic nucleic acid molecules.

[0106] Vectors as described herein may be introduced into host cells. As used herein, “host cell” refers to a specific cell into which nucleic acid is introduced, and also includes the progeny of such cells harboring the vector. Host cells may be any prokaryotic or eukaryotic cells. For example, nucleic acid may be expressed in bacterial cells, e.g., E. coli, or in insect cells, yeast, or mammalian cells (e.g., Chinese hamster ovary cells (CHO) or COS cells). Other suitable host cells are known to those skilled in the art. Many methods for introducing nucleic acid into host cells, both in vivo and in vitro, are widely known to those skilled in the art and include, but are not limited to, electroporation, calcium phosphate precipitation, polyethylene glycol (PEG) transformation, heat shock, lipofection, microinjection, and virus-mediated nucleic acid delivery.

[0107] Nucleic acids may be isolated using commercial technologies in the relevant technical field. For example, nucleic acids may be isolated using any method including, but not limited to, recombinant nucleic acid technology and / or polymerase chain reaction (PCR). General PCR technology is described, for example, in the literature [PCR Primer: A Laboratory Manual, Dieffenbach & Dveksler, Eds., Cold Spring Harbor Laboratory Press, 1995]. Recombinant nucleic acid technology includes, for example, restriction enzyme digestion and ligation, which can be used to isolate nucleic acids. Isolated nucleic acids may also be chemically synthesized as a single nucleic acid molecule or as a series of oligonucleotides.

[0108] Polypeptides can be purified from natural sources (e.g., biological samples) by known methods, such as DEAE ion exchange, gel filtration, and hydroxyapatite chromatography. Polypeptides can also be purified, for example, by expressing nucleic acids in an expression vector. Additionally, purified polypeptides can be obtained by chemical synthesis. The degree of purity of the polypeptide can be measured using any suitable method, for example, column chromatography, polyacrylamide gel electrophoresis, or HPLC analysis.

[0109] Constructs or vectors containing a nucleic acid construct as described herein (e.g., a nucleotide sequence encoding a polypeptide operably linked to a promoter element as described herein) are also provided. Constructs or vectors, including expression constructs or vectors, may be commercially available or produced by commercial recombinant DNA technology in the relevant art. Constructs or vectors containing nucleic acids may have an expression element operably linked to such nucleic acids and may further include sequences such as encoding a selection marker (e.g., an antibiotic resistance gene). Constructs or vectors containing nucleic acids may encode a chimeric or fusion polypeptide (i.e., a polypeptide operably linked to a heterogeneous polypeptide that may be located at the N-terminus or C-terminus of the polypeptide). Representative heterogeneous polypeptides are those that can be used for the purification of the encoded polypeptide (e.g., 6xHis tag, glutathione S-transferase (GST)).

[0110] Nucleic acids can also be detected using hybridization. Hybridization between nucleic acids is discussed in detail in the literature [Sambrook et al., (1989, Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY; Sections 7.37–7.57, 9.47–9.57, 11.7–11.8, and 11.45–11.57)]. Sambrook et al. disclose suitable Southern blot conditions for oligonucleotide probes of less than about 100 nucleotides (Sections 11.45–11.46). The Tm between a sequence of less than 100 nucleotides in length and a second sequence can be calculated using the formula provided in Section 11.46. Additionally, Sambrook et al. disclose Southern blot conditions for oligonucleotide probes of more than about 100 nucleotides (see Sections 9.47–9.54). The Tm between a sequence with a length of more than 100 nucleotides and a second sequence can be calculated using the formula provided in sections 9.50-9.51 of the literature [Sambrook et al.].

[0111] The conditions under which the nucleic acid-containing membrane is pre-hybridized and hybridized, as well as the conditions under which the membrane is washed to remove excess non-specifically bound probes, can play a significant role in the severity of hybridization. Such hybridization and washing can be performed under medium or high severity conditions where appropriate. For example, washing conditions can be made stricter by reducing the salt concentration in the washing solution and / or increasing the temperature at which the washing is performed. As a simple example, high severity conditions typically involve washing the membrane in 0.2X SSC at 65°C.

[0112] Additionally, the interpretation of the amount of hybridization may be influenced, for example, by the inactivity of the labeled oligonucleotide probe, the number of probe-binding sites on the template nucleic acid to which the probe hybridizes, and the exposure amount of autoradiography or other detection media. While any number of hybridization and washing conditions may be used to examine the hybridization of the probe nucleic acid molecule to the immobilized target nucleic acid, those skilled in the art will readily recognize that it is more important to examine the hybridization of the probe to the target nucleic acid under the same hybridization, washing, and exposure conditions. Preferably, the target nucleic acid is present on the same membrane.

[0113] If hybridization to a nucleic acid is at least 5-fold (e.g., at least 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 20-fold, 50-fold, or 100-fold) greater than hybridization to another nucleic acid, the nucleic acid molecule is considered to hybridize to the nucleic acid but not to the other nucleic acid. The amount of hybridization can be quantified directly on the membrane or from autoradiography, for example using a PhosphorImager or a densitometer (Molecular Dynamics, Sunnyvale, California).

[0114] Polypeptides can be detected using antibodies. Techniques for detecting polypeptides using antibodies include enzyme-linked immunosorbent assay (ELISA), Western blot, immunoprecipitation, and immunofluorescence. Antibodies may be polyclonal or monoclonal. Antibodies having a specific binding affinity for polypeptides may be generated using methods widely known in the art. Antibodies may be attached to a solid support, such as a microtiter plate, using methods known in the art. In the presence of polypeptides, antibody-polypeptide complexes are formed.

[0115] Detection (of, for example, amplification products, hybridization complexes, or polypeptides) is typically achieved using detectable labels. The term "label" is intended to encompass the use of indirect labels as well as direct labels. Detectable labels include enzymes, prosthetic groups, fluorescent substances, luminescent substances, bioluminescent substances, and radioactive substances.

[0116] Methods that can be used to generate strains lacking a selection sequence (i.e., lacking a selection marker) are described herein. These methods include using a circular plasmid DNA vector and a linear DNA sequence; the circular plasmid DNA vector contains a selection marker and a DNA replication origin (also known as an autonomous replication sequence (ARS)), and the linear DNA sequence contains a sequence for integration into the Pichia genome by homologous recombination. The linear DNA molecule may additionally comprise a nucleic acid sequence encoding one or more proteins of interest, such as, non-limitingly, heme-linked LegH, dehydrin, phytase, protease, catalase, lipase, peroxidase, amylase, transglutaminase, oxidoreductase, transferase, hydrolase, lyase, isomerase, ligase, one or more enzymes involved in a pathway for the production of small molecules, such as ethanol, lactic acid, butanol, adipic acid, or succinic acid, or an antibody against any of these proteins.

[0117] Cells (e.g., yeast cells (e.g., methyltrophic yeast cells (e.g., Pichia))) can be transformed into both DNA molecules and transformants selected by the presence of a selection marker on a circular plasmid. Subsequently, the transformants can be screened for the integration of the linear DNA molecule into the genome using, for example, PCR. Once a transformant with the correct integration of the marker-free linear DNA molecule is identified, the cells can be grown in the absence of selection for the circular plasmid. Because the marker-containing plasmid does not remain stable in the absence of selection, the plasmid is often lost very rapidly after selection is relieved. The resulting strain possesses the linear DNA integrated in the absence of a heterologous sequence for selection. Therefore, this approach can be used to construct a strain (e.g., Pichia strain) lacking a selection marker (e.g., a heterologous selection marker) with little to no impact on the yield of the recombinant product (e.g., protein).

[0118] According to the present disclosure, conventional molecular biology, microbiology, biochemistry, and recombinant DNA techniques within the art of the relevant field may be used. Such techniques are sufficiently described in the literature. The materials and methods of the disclosure will be further described in the following examples, which do not limit the scope of the composition of the methods and materials described in the claims.

[0119] Exemplary embodiment

[0120] Embodiment 1 is a nucleic acid construct comprising a first alcohol oxidase promoter element, wherein the first alcohol oxidase promoter element comprises a mutation at one or more nucleotide positions corresponding to any of nucleotide positions 668-734 relative to sequence identification number: 28.

[0121] Embodiment 2 is a nucleic acid construct of Embodiment 1 in which the first alcohol oxidase promoter element contains a mutation at one or more nucleotide positions corresponding to any of nucleotide positions 673-729 relative to sequence identification number: 28.

[0122] Embodiment 3 is a nucleic acid construct of Embodiment 1 in which the first alcohol oxidase promoter element contains a mutation at one or more nucleotide positions corresponding to any of nucleotide positions 678-724 relative to sequence identification number: 28.

[0123] Embodiment 4 is a nucleic acid construct of Embodiment 1 in which the first alcohol oxidase promoter element contains a mutation at one or more nucleotide positions corresponding to any of nucleotide positions 683-719 relative to sequence identification number: 28.

[0124] Embodiment 5 is a nucleic acid construct of Embodiment 1 in which the first alcohol oxidase promoter element contains a mutation at one or more nucleotide positions corresponding to any of nucleotide positions 688-714 relative to sequence identification number: 28.

[0125] Embodiment 6 is a nucleic acid construct of Embodiment 1 in which the first alcohol oxidase promoter element contains two or more mutations at nucleotide positions corresponding to any of nucleotide positions 668-734 relative to sequence identification number: 28.

[0126] Embodiment 7 is a nucleic acid construct of Embodiment 1 in which the first alcohol oxidase promoter element contains three or more mutations at nucleotide positions corresponding to any of nucleotide positions 668-734 relative to sequence identification number: 28.

[0127] Embodiment 8 is a nucleic acid construct of Embodiment 1 in which the first alcohol oxidase promoter element contains four or more mutations at nucleotide positions corresponding to any of nucleotide positions 668-734 relative to sequence identification number: 28.

[0128] Embodiment 9 is a nucleic acid construct of Embodiment 1 in which the first alcohol oxidase promoter element contains five or more mutations at nucleotide positions corresponding to any of nucleotide positions 668-734 relative to sequence identification number: 28.

[0129] Embodiment 10 is a nucleic acid construct of Embodiment 1 in which the first alcohol oxidase promoter has the sequence of sequence identification number: 29.

[0130] Embodiment 11 is a nucleic acid construct comprising a first alcohol oxidase promoter element, wherein the first alcohol oxidase promoter element comprises one or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to T146, C154, T303, T426, A433, A435, T530, C572, T596, T617, T688, A696, T702, A709, A712, T714, A790, A841, and T862 relative to sequence identification number: 28.

[0131] Embodiment 12 is a nucleic acid construct of Embodiment 11 in which the first alcohol oxidase promoter element comprises two or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to T146, C154, T303, T426, A433, A435, T530, C572, T596, T617, T688, A696, T702, A709, A712, T714, A790, A841, and T862 relative to sequence identification number: 28.

[0132] Embodiment 13 is a nucleic acid construct of Embodiment 11 in which the first alcohol oxidase promoter element comprises three or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to T146, C154, T303, T426, A433, A435, T530, C572, T596, T617, T688, A696, T702, A709, A712, T714, A790, A841, and T862 relative to sequence identification number: 28.

[0133] Embodiment 14 is a nucleic acid construct of Embodiment 11 in which the first alcohol oxidase promoter element comprises four or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to T146, C154, T303, T426, A433, A435, T530, C572, T596, T617, T688, A696, T702, A709, A712, T714, A790, A841, and T862 relative to sequence identification number: 28.

[0134] Embodiment 15 is a nucleic acid construct of Embodiment 11 in which the first alcohol oxidase promoter element comprises five or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to T146, C154, T303, T426, A433, A435, T530, C572, T596, T617, T688, A696, T702, A709, A712, T714, A790, A841, and T862 relative to sequence identification number: 28.

[0135] Embodiment 16 is a nucleic acid construct of any one of Embodiments 11 to 15, wherein the first alcohol oxidase promoter element comprises one or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to T688, A696, T702, A712, and T714 relative to sequence identification number: 28.

[0136] Embodiment 17 is a nucleic acid construct of any one of Embodiments 11 to 15, wherein the first alcohol oxidase promoter element comprises two or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to T688, A696, T702, A712, and T714 relative to sequence identification number: 28.

[0137] Embodiment 18 is a nucleic acid construct of any one of Embodiments 11 to 15, wherein the first alcohol oxidase promoter element comprises three or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to T688, A696, T702, A712, and T714 relative to sequence identification number: 28.

[0138] Embodiment 19 is a nucleic acid construct of any one of Embodiments 11 to 15, wherein the first alcohol oxidase promoter element comprises four or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to T688, A696, T702, A712, and T714 relative to sequence identification number: 28.

[0139] Embodiment 20 is a nucleic acid construct of any one of Embodiments 11 to 15, wherein the first alcohol oxidase promoter element comprises mutations at nucleotide positions corresponding to T688, A696, T702, A712, and T714 relative to sequence identification number: 28.

[0140] Embodiment 21 is a nucleic acid construct comprising a first alcohol oxidase promoter element, wherein the first alcohol oxidase promoter element comprises one or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to 146, 154, 303, 426, 433, 435, 530, 572, 596, 617, 688, 696, 702, 709, 712, 714, 790, 841, and 862 relative to sequence identification number: 28.

[0141] Embodiment 22 is a nucleic acid construct of Embodiment 21 in which the first alcohol oxidase promoter element comprises two or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to sequence identification number: 28, 146, 154, 303, 426, 433, 435, 530, 572, 596, 617, 688, 696, 702, 709, 712, 714, 790, 841, and 862.

[0142] Embodiment 23 is a nucleic acid construct of Embodiment 21 in which the first alcohol oxidase promoter element comprises three or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to sequence identification number: 28, 146, 154, 303, 426, 433, 435, 530, 572, 596, 617, 688, 696, 702, 709, 712, 714, 790, 841, and 862.

[0143] Embodiment 24 is a nucleic acid construct of Embodiment 21 in which the first alcohol oxidase promoter element comprises four or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to sequence identification number: 28, 146, 154, 303, 426, 433, 435, 530, 572, 596, 617, 688, 696, 702, 709, 712, 714, 790, 841, and 862.

[0144] Embodiment 25 is a nucleic acid construct of Embodiment 21 in which the first alcohol oxidase promoter element comprises five or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to sequence identification number: 28, 146, 154, 303, 426, 433, 435, 530, 572, 596, 617, 688, 696, 702, 709, 712, 714, 790, 841, and 862.

[0145] Embodiment 26 is a nucleic acid construct of any one of Embodiments 21 to 25, wherein the first alcohol oxidase promoter element comprises one or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to 688, 696, 702, 712, and 714 relative to sequence identification number: 28.

[0146] Embodiment 27 is a nucleic acid construct of any one of Embodiments 21 to 25, wherein the first alcohol oxidase promoter element comprises two or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to 688, 696, 702, 712, and 714 relative to sequence identification number: 28.

[0147] Embodiment 28 is a nucleic acid construct of any one of Embodiments 21 to 25, wherein the first alcohol oxidase promoter element comprises three or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to 688, 696, 702, 712, and 714 relative to sequence identification number: 28.

[0148] Embodiment 29 is a nucleic acid construct of any one of Embodiments 21 to 25, wherein the first alcohol oxidase promoter element comprises four or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to 688, 696, 702, 712, and 714 relative to sequence identification number: 28.

[0149] Embodiment 30 is a nucleic acid construct of any one of Embodiments 21 to 25, wherein the first alcohol oxidase promoter element comprises mutations at nucleotide positions corresponding to 688, 696, 702, 712, and 714 relative to sequence identification number: 28.

[0150] Embodiment 31 is a nucleic acid construct comprising a first alcohol oxidase promoter element, wherein the first alcohol oxidase promoter element comprises one or more mutations selected from the group consisting of mutations corresponding to T146C, C154T, T303C, T426A, A433T, A435G, T530A, C572T, T596C, T617C, T688C, A696T, T702C, A709G, A712G, T714G, A790G, A841T, and T862A relative to sequence identification number: 28.

[0151] Embodiment 32 is a nucleic acid construct of Embodiment 31 in which the first alcohol oxidase promoter element comprises two or more mutations selected from the group consisting of mutations corresponding to sequence identification number: 28 T146C, C154T, T303C, T426A, A433T, A435G, T530A, C572T, T596C, T617C, T688C, A696T, T702C, A709G, A712G, T714G, A790G, A841T, and T862A.

[0152] Embodiment 33 is a nucleic acid construct of Embodiment 31 in which the first alcohol oxidase promoter element comprises three or more mutations selected from the group consisting of mutations corresponding to sequence identification number: 28 T146C, C154T, T303C, T426A, A433T, A435G, T530A, C572T, T596C, T617C, T688C, A696T, T702C, A709G, A712G, T714G, A790G, A841T, and T862A.

[0153] Embodiment 34 is a nucleic acid construct of Embodiment 31 in which the first alcohol oxidase promoter element comprises four or more mutations selected from the group consisting of mutations corresponding to sequence identification number: 28 T146C, C154T, T303C, T426A, A433T, A435G, T530A, C572T, T596C, T617C, T688C, A696T, T702C, A709G, A712G, T714G, A790G, A841T, and T862A.

[0154] Embodiment 35 is a nucleic acid construct of Embodiment 31 in which the first alcohol oxidase promoter element comprises five or more mutations selected from the group consisting of mutations corresponding to sequence identification number: 28 T146C, C154T, T303C, T426A, A433T, A435G, T530A, C572T, T596C, T617C, T688C, A696T, T702C, A709G, A712G, T714G, A790G, A841T, and T862A.

[0155] Embodiment 36 is a nucleic acid construct of any one of Embodiments 1 to 35, wherein the first alcohol oxidase promoter element comprises one or more mutations selected from the group consisting of T688C, A696T, T702C, A712G, and T714G relative to sequence identification number: 28.

[0156] Embodiment 37 is a nucleic acid construct of any one of Embodiments 1 to 35, wherein the first alcohol oxidase promoter element comprises two or more mutations selected from the group consisting of T688C, A696T, T702C, A712G, and T714G relative to sequence identification number: 28.

[0157] Embodiment 38 is a nucleic acid construct of any one of Embodiments 1 to 35, wherein the first alcohol oxidase promoter element comprises three or more mutations selected from the group consisting of T688C, A696T, T702C, A712G, and T714G relative to sequence identification number: 28.

[0158] Embodiment 39 is a nucleic acid construct of any one of Embodiments 1 to 35, wherein the first alcohol oxidase promoter element comprises four or more mutations selected from the group consisting of T688C, A696T, T702C, A712G, and T714G relative to sequence identification number: 28.

[0159] Embodiment 40 is a nucleic acid construct of any one of Embodiments 1 to 35, wherein the first alcohol oxidase promoter element comprises the mutations T688C, A696T, T702C, A712G, and T714G relative to sequence identification number: 28.

[0160] Embodiment 41 is a nucleic acid construct comprising a first alcohol oxidase promoter element, wherein the first alcohol oxidase promoter element comprises one or more mutations selected from the group consisting of mutations corresponding to 146C, 154T, 303C, 426A, 433T, 435G, 530A, 572T, 596C, 617C, 688C, 696T, 702C, 709G, 712G, 714G, 790G, 841T, and 862A relative to sequence identification number: 28.

[0161] Embodiment 42 is a nucleic acid construct of Embodiment 41 in which the first alcohol oxidase promoter element comprises two or more mutations selected from the group consisting of mutations corresponding to sequence identification number: 28, 146C, 154T, 303C, 426A, 433T, 435G, 530A, 572T, 596C, 617C, 688C, 696T, 702C, 709G, 712G, 714G, 790G, 841T, and 862A.

[0162] Embodiment 43 is a nucleic acid construct of Embodiment 41 in which the first alcohol oxidase promoter element comprises three or more mutations selected from the group consisting of mutations corresponding to sequence identification number: 28, 146C, 154T, 303C, 426A, 433T, 435G, 530A, 572T, 596C, 617C, 688C, 696T, 702C, 709G, 712G, 714G, 790G, 841T, and 862A.

[0163] Embodiment 44 is a nucleic acid construct of Embodiment 41 in which the first alcohol oxidase promoter element comprises four or more mutations selected from the group consisting of mutations corresponding to sequence identification number: 28, 146C, 154T, 303C, 426A, 433T, 435G, 530A, 572T, 596C, 617C, 688C, 696T, 702C, 709G, 712G, 714G, 790G, 841T, and 862A.

[0164] Embodiment 45 is a nucleic acid construct of Embodiment 41 in which the first alcohol oxidase promoter element comprises five or more mutations selected from the group consisting of mutations corresponding to sequence identification number: 28, 146C, 154T, 303C, 426A, 433T, 435G, 530A, 572T, 596C, 617C, 688C, 696T, 702C, 709G, 712G, 714G, 790G, 841T, and 862A.

[0165] Embodiment 46 is a nucleic acid construct of any one of Embodiments 1 to 45, wherein the first alcohol oxidase promoter element comprises one or more mutations selected from the group consisting of 688C, 696T, 702C, 712G, and 714G relative to sequence identification number: 28.

[0166] Embodiment 47 is a nucleic acid construct of any one of Embodiments 1 to 45, wherein the first alcohol oxidase promoter element comprises two or more mutations selected from the group consisting of 688C, 696T, 702C, 712G, and 714G relative to sequence identification number: 28.

[0167] Embodiment 48 is a nucleic acid construct of any one of Embodiments 1 to 45, wherein the first alcohol oxidase promoter element comprises three or more mutations selected from the group consisting of 688C, 696T, 702C, 712G, and 714G relative to sequence identification number: 28.

[0168] Embodiment 49 is a nucleic acid construct of any one of Embodiments 1 to 45, wherein the first alcohol oxidase promoter element comprises four or more mutations selected from the group consisting of 688C, 696T, 702C, 712G, and 714G relative to sequence identification number: 28.

[0169] Embodiment 50 is a nucleic acid construct of any one of Embodiments 1 to 45, wherein the first alcohol oxidase promoter element comprises mutations 688C, 696T, 702C, 712G, and 714G relative to sequence identification number: 28.

[0170] Embodiment 51 is a nucleic acid construct of any one of Embodiments 1 to 50, wherein the first alcohol oxidase promoter element is an alcohol oxidase promoter element from a promoter selected from the group consisting of AOX1, AOX2, AOD1, MOX, MOD1, and MOD2.

[0171] Embodiment 52 is a nucleic acid construct of any one of Embodiments 1 to 51, wherein the first alcohol oxidase promoter element is an alcohol oxidase 1 (AOX1) promoter element.

[0172] Embodiment 53 is a nucleic acid construct of any one of Embodiments 1 to 52, wherein the first alcohol oxidase promoter element has at least 90% sequence identity with respect to sequence identification number: 28.

[0173] Embodiment 54 is a nucleic acid construct of any one of Embodiments 1 to 52, wherein the first alcohol oxidase promoter element has at least 95% sequence identity with respect to sequence identification number: 28.

[0174] Embodiment 55 is a nucleic acid construct of any one of Embodiments 1 to 54, which further comprises a nucleotide sequence, wherein the nucleotide sequence is operably linked to a first alcohol oxidase promoter element.

[0175] Embodiment 56 is a nucleic acid construct of Embodiment 55 in which the nucleotide sequence codes for the first protein.

[0176] Embodiment 57 is a nucleic acid construct of Embodiment 56 in which the first protein is exogenous to methyltrophic yeast cells.

[0177] Embodiment 58 is a nucleic acid construct of Embodiment 56 or Embodiment 57 in which the first protein is heterogeneous to methyltrophic yeast cells.

[0178] Embodiment 59 is a nucleic acid construct of any one of embodiments 56 to 58, wherein the first protein is selected from the group consisting of an antibody or a fragment thereof, an enzyme, a regulatory protein, a peptide hormone, a blood coagulation protein, a cytokine, a cytokine inhibitor, and a heme-binding protein.

[0179] Embodiment 60 is a nucleic acid construct of any one of embodiments 56 to 59, in which the first protein is a heme-binding protein.

[0180] Embodiment 61 is a nucleic acid construct of Embodiment 60 in which the heme-binding protein is selected from the group consisting of globin, cytochrome, cytochrome c oxidase, ligninase, catalase, and peroxidase.

[0181] Embodiment 62 is a nucleic acid construct of Embodiment 60 in which the heme-binding protein is selected from the group consisting of androglobin, chlorocruorin, cytoglobin, erythrocruorin, flavohemoglobin, globin E, globin X, globin Y, hemoglobin, histoglobin, leghemoglobin, myoglobin, neuroglobin, non-symbiotic hemoglobin, protoglobin, and terminally truncated hemoglobin.

[0182] Embodiment 63 is a nucleic acid construct of Embodiment 60 in which the heme-binding protein is a non-symbiotic hemoglobin.

[0183] Embodiment 64 is a nucleic acid construct of Embodiment 60 in which the heme-binding protein is leghemoglobin.

[0184] Embodiment 65 is a nucleic acid construct of Embodiment 60 in which the heme-binding protein comprises an amino acid sequence having at least 90% sequence identity with respect to any of the amino acid sequences of Sequence Identification No. 1-27.

[0185] Embodiment 66 is a nucleic acid construct of any one of Embodiments 1 to 65, wherein the first alcohol oxidase promoter element comprises a recognition sequence for a transcription factor.

[0186] Embodiment 67 is a cell comprising a first nucleic acid construct which is a nucleic acid construct of any one of embodiments 1 to 66.

[0187] Embodiment 68 is the cell of Embodiment 67, in which the cell is a yeast cell.

[0188] Embodiment 69 is a cell of Embodiment 68 in which the yeast cell is a methyltrophic yeast cell.

[0189] Embodiment 70 is the cell of Embodiment 69, in which the methyltrophic yeast cell is a Pichia cell, Candida cell, Hansenula cell, or Torulopsis cell.

[0190] Embodiment 71 is a cell of Embodiment 69 or Embodiment 70 in which the methyltrophic yeast cell is a Pichia methanolica cell, a Pichia pastoris cell, a Candida boidini cell, or a Hansenula polymorpha cell.

[0191] Embodiment 72 is a cell of any one of Embodiments 69 to 71, in which the methyltrophic yeast cell is a Pichia pastoris cell.

[0192] Embodiment 73 is a cell of any one of Embodiments 67 to 72, further comprising a second nucleic acid construct comprising a nucleotide sequence, wherein the nucleotide sequence is operably linked to a first alcohol oxidase promoter element or a second promoter element.

[0193] Embodiment 74 is a cell of Embodiment 73 in which the nucleotide sequence of the second nucleic acid construct is operably connected to a second promoter element having the same sequence as the first alcohol oxidase promoter element.

[0194] Embodiment 75 is a cell of Embodiment 73 or 74 in which the nucleotide sequence of the second nucleic acid construct codes for the second protein.

[0195] Embodiment 76 is a cell of Embodiment 75 in which the second protein is a transcription factor.

[0196] Embodiment 77 is a cell of Embodiment 76 in which a nucleotide sequence encoding a second protein is operably linked to a second promoter element comprising a recognition sequence for a transcription factor.

[0197] Embodiment 78 is a cell of Embodiment 76 or Embodiment 77 in which the first alcohol oxidase promoter element includes a recognition sequence for a transcription factor.

[0198] Embodiment 79 is a cell of any one of embodiments 75 to 78, in which the second protein is a protein involved in heme biosynthesis.

[0199] Embodiment 80 is a cell of Embodiment 79 in which the protein involved in heme biosynthesis is selected from the group consisting of aminolevulinate synthase (ALAS), δ-aminolevulinate dehydratase (ALAD), porpogylinogen deaminase (PBGD), uroporpyrinogen III synthase (UPG3S), uroporpyrinogen III decarboxylase (UPG3D), coprotoporpyrinogen oxidase (COPROX), protoporpyrinogen IX oxidase (PROTOX), and ferrogylinogen synthase (FC).

[0200] Embodiment 81 is a method for producing a product in a cell comprising expressing a nucleic acid construct comprising a nucleotide sequence operably linked to a first alcohol oxidase promoter element, wherein the first alcohol oxidase promoter element comprises a mutation at one or more nucleotide positions corresponding to any of nucleotide positions 668-734 relative to sequence identification number: 28.

[0201] Embodiment 82 is the method of Embodiment 81, wherein the first alcohol oxidase promoter element comprises a mutation at one or more nucleotide positions corresponding to any of nucleotide positions 673-729 relative to sequence identification number: 28.

[0202] Embodiment 83 is the method of Embodiment 81, wherein the first alcohol oxidase promoter element comprises a mutation at one or more nucleotide positions corresponding to any of nucleotide positions 678-724 relative to sequence identification number: 28.

[0203] Embodiment 84 is the method of Embodiment 81, wherein the first alcohol oxidase promoter element comprises a mutation at one or more nucleotide positions corresponding to any of nucleotide positions 683-719 relative to sequence identification number: 28.

[0204] Embodiment 85 is the method of Embodiment 81, wherein the first alcohol oxidase promoter element comprises a mutation at one or more nucleotide positions corresponding to any of nucleotide positions 688-714 relative to sequence identification number: 28.

[0205] Embodiment 86 is the method of Embodiment 81, wherein the first alcohol oxidase promoter element comprises two or more mutations at nucleotide positions corresponding to any of nucleotide positions 668-734 relative to sequence identification number: 28.

[0206] Embodiment 87 is the method of Embodiment 81, wherein the first alcohol oxidase promoter element comprises three or more mutations at nucleotide positions corresponding to any of nucleotide positions 668-734 relative to sequence identification number: 28.

[0207] Embodiment 88 is the method of Embodiment 81, wherein the first alcohol oxidase promoter element comprises four or more mutations at nucleotide positions corresponding to any of nucleotide positions 668-734 relative to sequence identification number: 28.

[0208] Embodiment 89 is the method of Embodiment 81, wherein the first alcohol oxidase promoter element comprises five or more mutations at nucleotide positions corresponding to any of nucleotide positions 668-734 relative to sequence identification number: 28.

[0209] Embodiment 90 is a method of any one of embodiments 81 to 89, wherein the titer of a product produced by expressing a nucleic acid construct comprising a nucleotide sequence operably linked to a first alcohol oxidase promoter element containing a mutation at any one or more nucleotide positions corresponding to any of nucleotide positions 668-734 relative to sequence identification number: 28 is greater than the titer of a product produced by expressing a nucleic acid construct comprising a nucleotide sequence operably linked to a first alcohol oxidase promoter element lacking any mutation at nucleotide positions corresponding to any of nucleotide positions 668-734 relative to sequence identification number: 28.

[0210] Embodiment 91 is a method for producing a product in a cell comprising expressing a nucleic acid construct comprising a nucleotide sequence operably linked to a first alcohol oxidase promoter element, wherein the first alcohol oxidase promoter element comprises one or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to T146, C154, T303, T426, A433, A435, T530, C572, T596, T617, T688, A696, T702, A709, A712, T714, A790, A841, and T862 relative to sequence identification number: 28.

[0211] Embodiment 92 is the method of Embodiment 91, wherein the first alcohol oxidase promoter element comprises two or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to T146, C154, T303, T426, A433, A435, T530, C572, T596, T617, T688, A696, T702, A709, A712, T714, A790, A841, and T862 relative to sequence identification number: 28.

[0212] Embodiment 93 is the method of Embodiment 91, wherein the first alcohol oxidase promoter element comprises three or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to T146, C154, T303, T426, A433, A435, T530, C572, T596, T617, T688, A696, T702, A709, A712, T714, A790, A841, and T862 relative to sequence identification number: 28.

[0213] Embodiment 94 is the method of Embodiment 91, wherein the first alcohol oxidase promoter element comprises four or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to T146, C154, T303, T426, A433, A435, T530, C572, T596, T617, T688, A696, T702, A709, A712, T714, A790, A841, and T862 relative to sequence identification number: 28.

[0214] Embodiment 95 is the method of Embodiment 91, wherein the first alcohol oxidase promoter element comprises five or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to T146, C154, T303, T426, A433, A435, T530, C572, T596, T617, T688, A696, T702, A709, A712, T714, A790, A841, and T862 relative to sequence identification number: 28.

[0215] Embodiment 96 is a method of any one of embodiments 91 to 95, wherein the first alcohol oxidase promoter element comprises one or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to T688, A696, T702, A712, and T714 relative to sequence identification number: 28.

[0216] Embodiment 97 is a method of any one of embodiments 91 to 95, wherein the first alcohol oxidase promoter element comprises two or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to T688, A696, T702, A712, and T714 relative to sequence identification number: 28.

[0217] Embodiment 98 is a method of any one of embodiments 91 to 95, wherein the first alcohol oxidase promoter element comprises three or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to T688, A696, T702, A712, and T714 relative to sequence identification number: 28.

[0218] Embodiment 99 is a method of any one of embodiments 91 to 95, wherein the first alcohol oxidase promoter element comprises four or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to T688, A696, T702, A712, and T714 compared with sequence identification number: 28.

[0219] Embodiment 100 is a method of any one of embodiments 91 to 95 in which the first alcohol oxidase promoter element comprises mutations at nucleotide positions corresponding to T688, A696, T702, A712, and T714 compared with sequence identification number: 28.

[0220] Embodiment 101 describes a nucleic acid construct comprising a nucleotide sequence operably linked to a first alcohol oxidase promoter element comprising one or more mutations at a nucleotide position selected from the group consisting of nucleotide positions corresponding to T146, C154, T303, T426, A433, A435, T530, C572, T596, T617, T688, A696, T702, A709, A712, T714, A790, A841, and T862 relative to SEQ ID No. 28, wherein the titer of the product produced by expressing the nucleotide construct comprises T146, C154, T303, T426, A433, A435, T530, C572, T596, T617, T688, A696, T702, A709 relative to SEQ ID No. 28 A method of any one of embodiments 91 to 100, wherein the titer of the product produced by expressing a nucleic acid construct comprising a nucleotide sequence encoding a first protein operably linked to a first alcohol oxidase promoter element having any mutation lacking at a nucleotide position selected from the group consisting of nucleotide positions corresponding to A712, T714, A790, A841, and T862 is greater than the titer of the product produced by expressing the nucleotide construct.

[0221] Embodiment 102 is a method for producing a product in a cell comprising expressing a nucleic acid construct comprising a nucleotide sequence operably linked to a first alcohol oxidase promoter element, wherein the first alcohol oxidase promoter element comprises one or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to 146, 154, 303, 426, 433, 435, 530, 572, 596, 617, 688, 696, 702, 709, 712, 714, 790, 841, and 862 relative to sequence identification number: 28.

[0222] Embodiment 103 is the method of Embodiment 102, wherein the first alcohol oxidase promoter element comprises two or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to sequence identification number: 28, 146, 154, 303, 426, 433, 435, 530, 572, 596, 617, 688, 696, 702, 709, 712, 714, 790, 841, and 862.

[0223] Embodiment 104 is the method of Embodiment 102, wherein the first alcohol oxidase promoter element comprises three or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to sequence identification number: 28, 146, 154, 303, 426, 433, 435, 530, 572, 596, 617, 688, 696, 702, 709, 712, 714, 790, 841, and 862.

[0224] Embodiment 105 is the method of Embodiment 102, wherein the first alcohol oxidase promoter element comprises four or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to sequence identification number: 28, 146, 154, 303, 426, 433, 435, 530, 572, 596, 617, 688, 696, 702, 709, 712, 714, 790, 841, and 862.

[0225] Embodiment 106 is the method of Embodiment 102, wherein the first alcohol oxidase promoter element comprises five or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to sequence identification number: 28, 146, 154, 303, 426, 433, 435, 530, 572, 596, 617, 688, 696, 702, 709, 712, 714, 790, 841, and 862.

[0226] Embodiment 107 is a method of any one of embodiments 102 to 106, wherein the first alcohol oxidase promoter element comprises one or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to 688, 696, 702, 712, and 714 relative to sequence identification number: 28.

[0227] Embodiment 108 is a method of any one of embodiments 102 to 106, wherein the first alcohol oxidase promoter element comprises two or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to 688, 696, 702, 712, and 714 relative to sequence identification number: 28.

[0228] Embodiment 109 is a method of any one of embodiments 102 to 106, wherein the first alcohol oxidase promoter element comprises three or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to 688, 696, 702, 712, and 714 relative to sequence identification number: 28.

[0229] Embodiment 110 is a method of any one of embodiments 102 to 106, wherein the first alcohol oxidase promoter element comprises four or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to 688, 696, 702, 712, and 714 compared with sequence identification number: 28.

[0230] Embodiment 111 is a method of any one of Embodiments 102 to 106 in which the first alcohol oxidase promoter element comprises mutations at nucleotide positions corresponding to 688, 696, 702, 712, and 714 compared with sequence identification number: 28.

[0231] Embodiment 112 describes a nucleic acid construct comprising a nucleotide sequence operably linked to a first alcohol oxidase promoter element comprising one or more mutations at a nucleotide position selected from the group consisting of nucleotide positions corresponding to 146, 154, 303, 426, 433, 435, 530, 572, 596, 617, 688, 696, 702, 709, 712, 714, 790, 841, and 862 relative to sequence identification number: 28, wherein the titer of the product produced by expressing the nucleotide construct comprises 146, 154, 303, 426, 433, 435, 530, 572, 596, 617, 688, 696, 702, 709, relative to sequence identification number: 28 A method of any one of embodiments 102 to 111, wherein the titer of the product produced by expressing a nucleic acid construct comprising a nucleotide sequence encoding a first protein operably linked to a first alcohol oxidase promoter element having any mutations lacking at a nucleotide position selected from the group consisting of nucleotide positions corresponding to 712, 714, 790, 841, and 862 is greater than the titer of the product produced by expressing the nucleotide construct.

[0232] Embodiment 113 is a method for producing a product in a cell comprising expressing a nucleic acid construct comprising a nucleotide sequence operably linked to a first alcohol oxidase promoter element, wherein the first alcohol oxidase promoter element comprises one or more mutations selected from the group consisting of mutations corresponding to T146C, C154T, T303C, T426A, A433T, A435G, T530A, C572T, T596C, T617C, T688C, A696T, T702C, A709G, A712G, T714G, A790G, A841T, and T862A relative to sequence identification number: 28.

[0233] Embodiment 114 is the method of Embodiment 113, wherein the first alcohol oxidase promoter element comprises two or more mutations selected from the group consisting of mutations corresponding to sequence identification number: 28 T146C, C154T, T303C, T426A, A433T, A435G, T530A, C572T, T596C, T617C, T688C, A696T, T702C, A709G, A712G, T714G, A790G, A841T, and T862A.

[0234] Embodiment 115 is the method of Embodiment 113, wherein the first alcohol oxidase promoter element comprises three or more mutations selected from the group consisting of mutations corresponding to sequence identification number: 28 T146C, C154T, T303C, T426A, A433T, A435G, T530A, C572T, T596C, T617C, T688C, A696T, T702C, A709G, A712G, T714G, A790G, A841T, and T862A.

[0235] Embodiment 116 is the method of Embodiment 113, wherein the first alcohol oxidase promoter element comprises four or more mutations selected from the group consisting of mutations corresponding to sequence identification number: 28 T146C, C154T, T303C, T426A, A433T, A435G, T530A, C572T, T596C, T617C, T688C, A696T, T702C, A709G, A712G, T714G, A790G, A841T, and T862A.

[0236] Embodiment 117 is the method of Embodiment 113, wherein the first alcohol oxidase promoter element comprises five or more mutations selected from the group consisting of mutations corresponding to sequence identification number: 28 T146C, C154T, T303C, T426A, A433T, A435G, T530A, C572T, T596C, T617C, T688C, A696T, T702C, A709G, A712G, T714G, A790G, A841T, and T862A.

[0237] Embodiment 118 describes a nucleic acid construct comprising a nucleotide sequence operably linked to a first alcohol oxidase promoter element, comprising one or more mutations selected from the group consisting of mutations corresponding to T146C, C154T, T303C, T426A, A433T, A435G, T530A, C572T, T596C, T617C, T688C, A696T, T702C, A709G, A712G, T714G, A790G, A841T, and T862A relative to SEQ ID No. 28, wherein the titer of the product produced by expressing SEQ ID No. 28 T146C, C154T, T303C, T426A, A433T, A435G, T530A, C572T, T596C, A method of any one of embodiments 113 to 117, wherein the titer of the product produced by expressing a nucleic acid construct comprising a nucleotide sequence encoding a first protein operably linked to a first alcohol oxidase promoter element lacking any mutation selected from the group consisting of mutations corresponding to T617C, T688C, A696T, T702C, A709G, A712G, T714G, A790G, A841T, and T862A is greater than the titer of the product produced by expressing the nucleotide sequence comprising a first protein operably linked to a first alcohol oxidase promoter element lacking any mutation selected from the group consisting of mutations corresponding to T617C, T688C, A696T, T702C, A709G, A712G, T714G, A790G, A841T, and T862A.

[0238] Embodiment 119 is a method of any one of embodiments 81 to 118 in which the first alcohol oxidase promoter element comprises two or more mutations selected from the group consisting of T688C, A696T, T702C, A712G, and T714G relative to sequence identification number: 28.

[0239] Embodiment 120 is a method of any one of embodiments 81 to 118 in which the first alcohol oxidase promoter element comprises three or more mutations selected from the group consisting of T688C, A696T, T702C, A712G, and T714G relative to sequence identification number: 28.

[0240] Embodiment 121 is a method of any one of embodiments 81 to 118 in which the first alcohol oxidase promoter element comprises four or more mutations selected from the group consisting of T688C, A696T, T702C, A712G, and T714G relative to sequence identification number: 28.

[0241] Embodiment 122 is a method of any one of embodiments 81 to 118 in which the first alcohol oxidase promoter element comprises mutations T688C, A696T, T702C, A712G, and T714G relative to sequence identification number: 28.

[0242] Embodiment 123 is a method for producing a product in a cell comprising expressing a nucleic acid construct comprising a nucleotide sequence operably linked to a first alcohol oxidase promoter element, wherein the first alcohol oxidase promoter element comprises one or more mutations selected from the group consisting of mutations corresponding to 146C, 154T, 303C, 426A, 433T, 435G, 530A, 572T, 596C, 617C, 688C, 696T, 702C, 709G, 712G, 714G, 790G, 841T, and 862A relative to sequence identification number: 28.

[0243] Embodiment 124 is the method of Embodiment 123, wherein the first alcohol oxidase promoter element comprises two or more mutations selected from the group consisting of mutations corresponding to sequence identification number: 28, 146C, 154T, 303C, 426A, 433T, 435G, 530A, 572T, 596C, 617C, 688C, 696T, 702C, 709G, 712G, 714G, 790G, 841T, and 862A.

[0244] Embodiment 125 is the method of Embodiment 123, wherein the first alcohol oxidase promoter element comprises three or more mutations selected from the group consisting of mutations corresponding to sequence identification number: 28, 146C, 154T, 303C, 426A, 433T, 435G, 530A, 572T, 596C, 617C, 688C, 696T, 702C, 709G, 712G, 714G, 790G, 841T, and 862A.

[0245] Embodiment 126 is the method of Embodiment 123, wherein the first alcohol oxidase promoter element comprises four or more mutations selected from the group consisting of mutations corresponding to sequence identification number: 28, 146C, 154T, 303C, 426A, 433T, 435G, 530A, 572T, 596C, 617C, 688C, 696T, 702C, 709G, 712G, 714G, 790G, 841T, and 862A.

[0246] Embodiment 127 is the method of Embodiment 123, wherein the first alcohol oxidase promoter element comprises five or more mutations selected from the group consisting of mutations corresponding to sequence identification number: 28, 146C, 154T, 303C, 426A, 433T, 435G, 530A, 572T, 596C, 617C, 688C, 696T, 702C, 709G, 712G, 714G, 790G, 841T, and 862A.

[0247] Embodiment 128 describes a nucleic acid construct comprising a nucleotide sequence operably linked to a first alcohol oxidase promoter element comprising one or more mutations selected from the group consisting of mutations corresponding to 146C, 154T, 303C, 426A, 433T, 435G, 530A, 572T, 596C, 617C, 688C, 696T, 702C, 709G, 712G, 714G, 790G, 841T, and 862A relative to SEQ ID No. 28, wherein the titer of the product produced by expressing 146C, 154T, 303C, 426A, 433T, 435G, 530A, 572T, 596C relative to SEQ ID No. 28 A method of any one of embodiments 123 to 127, wherein the titer of the product produced by expressing a nucleic acid construct comprising a nucleotide sequence encoding a first protein operably linked to a first alcohol oxidase promoter element lacking any mutation selected from the group consisting of mutations corresponding to 617C, 688C, 696T, 702C, 709G, 712G, 714G, 790G, 841T, and 862A is greater than the titer of the product produced by expressing the nucleotide sequence comprising a first protein operably linked to a first alcohol oxidase promoter element lacking any mutation selected from the group consisting of mutations corresponding to 617C, 688C, 696T, 702C, 709G, 712G, 714G, 790G, 841T, and 862A.

[0248] Embodiment 129 is a method of any one of embodiments 81 to 128 in which the first alcohol oxidase promoter element comprises two or more mutations selected from the group consisting of 688C, 696T, 702C, 712G, and 714G relative to sequence identification number: 28.

[0249] Embodiment 130 is a method of any one of embodiments 81 to 128 in which the first alcohol oxidase promoter element comprises three or more mutations selected from the group consisting of 688C, 696T, 702C, 712G, and 714G relative to sequence identification number: 28.

[0250] Embodiment 131 is a method of any one of embodiments 81 to 128 in which the first alcohol oxidase promoter element comprises four or more mutations selected from the group consisting of 688C, 696T, 702C, 712G, and 714G relative to sequence identification number: 28.

[0251] Embodiment 132 is a method of any one of embodiments 81 to 128 in which the first alcohol oxidase promoter element comprises mutations 688C, 696T, 702C, 712G, and 714G relative to sequence identification number: 28.

[0252] Embodiment 133 is a method for producing a product in a cell comprising expressing a nucleic acid construct comprising a nucleotide sequence operably linked to a first alcohol oxidase promoter element, which is a nucleic acid construct of any one of Embodiments 1 to 54.

[0253] Embodiment 134 is a method of any one of Embodiments 81 to 133, wherein the first alcohol oxidase promoter element is an alcohol oxidase promoter element from a promoter selected from the group consisting of AOX1, AOX2, AOD1, MOX, MOD1, and MOD2.

[0254] Embodiment 135 is a method of any one of Embodiments 81 to 134, wherein the first alcohol oxidase promoter element is an alcohol oxidase 1 (AOX1) promoter element.

[0255] Embodiment 136 is a method of any one of Embodiments 81 to 135 in which the first alcohol oxidase promoter element has at least 90% sequence identity with respect to sequence identification number: 28.

[0256] Embodiment 137 is a method of any one of Embodiments 55 to 135 in which the first alcohol oxidase promoter element has at least 95% sequence identity with respect to sequence identification number: 28.

[0257] Embodiment 138 is a method of any one of embodiments 81 to 137 in which the first alcohol oxidase promoter element has the sequence of sequence identification number: 29.

[0258] Embodiment 139 is a method of any one of Embodiments 81 to 138 in which the cell is a yeast cell.

[0259] Embodiment 140 is the method of Embodiment 139, in which the yeast cells are methyltrophic yeast cells.

[0260] Embodiment 141 is a method of any one of embodiments 81 to 140, wherein a nucleotide sequence operably linked to a first alcohol oxidase promoter element codes for a first protein.

[0261] Embodiment 142 is the method of Embodiment 141 in which the first protein is exogenous to the cell.

[0262] Embodiment 143 is the method of Embodiment 141 or 142, in which the first protein is heterogeneous to the cell.

[0263] Embodiment 144 is a method of any one of embodiments 141 to 143, wherein the first protein is selected from the group consisting of an antibody or a fragment thereof, an enzyme, a regulatory protein, a peptide hormone, a blood coagulation protein, a cytokine, and a heme-binding protein.

[0264] Embodiment 145 is a method of any one of Embodiments 141 to 144, in which the first protein is a heme-binding protein.

[0265] Embodiment 146 is the method of Embodiment 145, wherein the heme-binding protein is selected from the group consisting of globin, cytochrome, cytochrome c oxidase, ligninase, catalase, and peroxidase.

[0266] Embodiment 147 is the method of Embodiment 145, wherein the heme-binding protein is selected from the group consisting of androglobin, chlorocruorin, cytoglobin, erythrocruorin, flavohemoglobin, globin E, globin X, globin Y, hemoglobin, histoglobin, leghemoglobin, myoglobin, neuroglobin, non-symbiotic hemoglobin, protoglobin, and terminally truncated hemoglobin.

[0267] Embodiment 148 is the method of Embodiment 145, in which the heme-binding protein is non-symbiotic hemoglobin.

[0268] Embodiment 149 is the method of Embodiment 145, in which the heme-binding protein is leghemoglobin.

[0269] Embodiment 150 is the method of Embodiment 145, wherein the heme-binding protein comprises an amino acid sequence having at least 90% sequence identity with respect to any one of the amino acid sequences of sequence identification number: 1-27.

[0270] Embodiment 151 is a method of any one of embodiments 81 to 150, wherein the first alcohol oxidase promoter element contains one or more recognition sequences for a transcription factor.

[0271] Embodiment 152 is a method of any one of Embodiments 81 to 151, further comprising expressing a second nucleic acid construct comprising a nucleotide sequence, wherein the nucleotide sequence of the second nucleic acid construct is operably linked to a first alcohol oxidase promoter element or a second promoter element.

[0272] Embodiment 153 is the method of Embodiment 152, wherein the nucleotide sequence of the second nucleic acid construct is operably connected to a second promoter element having the same sequence as the first alcohol oxidase promoter element.

[0273] Embodiment 154 is the method of Embodiment 152 or 153, wherein the nucleotide sequence of the second nucleic acid construct codes for the second protein.

[0274] Embodiment 155 is the method of Embodiment 154, in which the second protein is a transcription factor.

[0275] Embodiment 156 is the method of Embodiment 155, wherein a nucleotide sequence encoding a second protein is operably connected to a second promoter element comprising a recognition sequence for a transcription factor.

[0276] Embodiment 157 is the method of Embodiment 155, wherein the first alcohol oxidase promoter element comprises a recognition sequence for a transcription factor.

[0277] Embodiment 158 ​​is the method of 154, wherein the second protein is a protein involved in heme biosynthesis.

[0278] Embodiment 159 is the method of Embodiment 158, wherein the protein involved in heme biosynthesis is selected from the group consisting of ALAS, ALAD, PBGD, UPG3S, UPG3D, COPROX, PROTOX, and FC.

[0279] Embodiment 160 is a method of any one of embodiments 81 to 159, wherein the method is carried out in the absence of methanol to be added.

[0280] The materials and methods of the disclosed content will be further described in the following examples, which do not limit the scope of the claims.

[0281] Examples

[0282] Example 1

[0283] polymerase chain reaction

[0284] Genes of interest were amplified from genomic DNA or plasmid DNA templates using Phusion Hi-fidelity DNA polymerase (New England Biolabs). Briefly, 0.6 μM forward and reverse primers, each, were incubated with 10–50 ng of template DNA and 400 μM of nucleotide mix in the presence of 1–2 U of Phusion DNA polymerase. The reaction conditions were as follows:

[0285]

[0286] Example 2

[0287] Plasmid construction by ligation

[0288] 50–100 ng of restriction enzyme-digested plasmid and 3X molar excess of PCR-amplified insert were incubated in the presence of T4 DNA ligase (New England Biolabs). Ligation was performed at 16°C for more than 2 hours. DH10B electrically qualified E. coli cells were transformed with 2 μl of ligation reaction mixture.

[0289] Example 3

[0290] E. Transfection into E. coli Electromax DH10B T1 phage-resistant qualified cells

[0291] 20 μl of Electromax DH10B T1 phage-resistant qualified cells (Invitrogen, Cat # 12033-015) were transfected with 1.5-2 μl of ligation mixture (Example 2) by electroporation using a micropulser (BioRad) set to 1.7 kV with a 1 mm gap cuvette (BioRad, Cat # 165-2089); after the pulse, 1 ml of SOC (best optimal broth with catabolic inhibition) was added to the cells, and the cells were incubated at 37°C for 1 hour while shaking at 200 rpm. 10 μl of the recovered mixture was plated onto LB (lysogenic broth) agar plates containing ampicillin at a concentration of 100 μg / ml. The plates were incubated overnight at 37°C. The plasmid was isolated and purified using the NUCLEOSPIN® plasmid kit from Macherev-Nagel according to the manufacturer's instructions.

[0292] Example 4

[0293] P. Preparation of Pastoris Transformed-Eligible Cells

[0294] Selected P. pastoris strains were grown in 25 ml YPD (yeast extract-peptone-dextrose) medium to the intermediate-exponential growth phase (approx. 2 OD). Cells were collected by centrifugation at 930xg for 15 minutes. The cell pellet was resuspended in 2 ml of a solution of 80% YPD and 200 mM HEPES (4-(2-hydroxyethyl)-1-piperazine ethanesulfonic acid), pH 6.8. 75 μl of 1 M DTT (dithiothreitol) was added. The resuspended cell pellet was mixed at 100 rpm at 30°C for 25 minutes. 40 ml of ice-cold sterile water was added to the suspension, cells were collected by centrifugation at 1125xg for 15 minutes, and the mixture was placed on ice. The cell pellet was resuspended in 40 ml of ice-cold water and collected as before for two additional washing steps. Subsequently, the cell pellet was resuspended in 20 ml of ice-cold 1 M sorbitol and collected by centrifugation as before. The final cell pellet was suspended in 0.3 ml of ice-cold, sterile 1 M sorbitol, aliquoted, and frozen at -80℃.

[0295] Example 5

[0296] Transformation into P. Pastoris

[0297] 30 μl of electrically qualified P. p. pastororis cells were transformed with 50-100 ng of plasmid DNA using a 1 mm gap GenePulser cuvette (BioRad) with a GenePulser (BioRad) set to 1.15 kV. 1 ml of YPD / 1M sorbitol was added and mixed with the cells in a 1:1 ratio. The cells were allowed to be recovered at 30°C for 3 hours while shaking at 100 rpm. 100 μl of the recovered mixture was plated onto a YPD plate (primary transformation plate) containing an appropriate antibiotic, and the remaining transformed cells were plated onto a second YPD plate containing an appropriate antibiotic. The plates were incubated at 30°C for 48 hours. The primary transformation plate was streaked onto an additional YPD plate containing an appropriate antibiotic, and the plates were incubated at 30°C for 48 hours. Individual clones were patched onto YPD plates containing antibiotics, and the strains were grown in a shaking flask using the patches for further analysis.

[0298] Example 6

[0299] Construction of an AOX1 promoter-green fluorescent protein reporter vector

[0300] A vector for monitoring the expression from the AOX1 promoter and mutated variants was constructed using green fluorescent protein (GFP) as a reporter protein. A GFP open reading frame was inserted into a pGAB vector (e.g., U.S. Patent No. 9,938,327, the full text of which is incorporated herein by reference) containing a transcription termination factor sequence from the P. p

[0301] An open reading frame encoding a Dasher GFP variant protein was amplified by PCR from the pJ1214-03c plasmid vector obtained from DNA2.0 Inc. (Newark, California). The Dasher GFP open reading frame was amplified from pJ1214-03c using primers MxO0560 (GAGGGTCTCGGATGACAGCTTTAACTGAAGGGGCC; SEQ ID: 30) and MxO0561 (GAGGGTCTCGATTATTGGTAAGTGTCGAGATCAACTGCC; SEQ ID: 31), which added a flanking Eco31I / BsaI restriction endonuclease recognition site. Amplification was achieved using PCR as described in Example 1.

[0302] The amplified Dasher GFP PCR products and pGAB vectors were digested with 10 units of FastDigest Eco31I restriction endonuclease (Thermo Fisher Scientific) in 1x FastDigest buffer (Thermo Fisher Scientific) at 37°C for 1 hour. The Eco31I-digested amplified Dasher GFP fragments and pGAB vectors were separated by electrophoresis on a 1% agarose gel in 1x TBE buffer (89 mM Tris, 89 mM boric acid, 2 mM EDTA (ethylenediaminetetraacetic acid), pH 8.3) and visualized using SYBR Safe DNA gel staining (Life Technologies, Carlsbad, California). The target DNA fragment was cut from an agarose gel, and the DNA was recovered using the ZYMOCLEAN™ gel DNA recovery kit (Zymo Research, Irvine, California).

[0303] An Eco31I-digested fragment containing the Darsher GFP open reading frame was introduced into pGAB by ligation at the Eco31I site immediately downstream of the AOX1 promoter. A mixture containing 72 ng of Eco31I-digested DNA encoding the Darsher GFP open reading frame and 35 ng of Eco31I-digested pGAB was incubated with 400 units of T4 DNA ligase (New England Biolabs) in 1x T4 DNA ligase reaction buffer (50 mM Tris-HCl, 10 mM MgCl2, 1 mM ATP, 10 mM DTT, pH 7.5 @ 25℃) in 20 μl of reactants at 16℃ for 2 hours. Electrically qualified E. coli DH10B cells were transformed with 2 μl of ligation reaction product, and antibiotic-resistant transformants were selected on LSB (Listeria Special Broth) agar plates supplemented with 100 μg / μl ampicillin. The plates were incubated overnight at 37°C. Colonies were screened for the presence of the insert by PCR using primers MxO0560 and MxO0561. The sequence of the final vector was confirmed by DNA sequencing.

[0304] The generated vector, pMx0369, contained the p. Pastoris AOX1 promoter, followed sequentially by the Dasher GFP open reading frame and the p. Pastoris FDH1 termination factor. These elements were amplified from the pMx0369 DNA using primers MxO0513 (GTGCTAGGATCCAACATCCAAAGACG; sequence identification number: 32) and MxO0514 (TTTTTCTAGAACCTTATCAAGATAGCTAGAAATAGAAATGGTTGC; sequence identification number: 33) using a polymerase chain reaction as described in Example 1. The primers introduced BamHI and XbaI restriction sites at the 5' and 3' ends, respectively, of the amplified AOX1 promoter-Dasher GFP-FDH1 termination factor DNA fragments. Using these restriction sites, Dasher GFP and the sequence required for its expression were cloned into the pIL75 episome vector. The pIL75 vector contains a panARS autonomous replication sequence (Liachko & Dunham, 2014, FEMS Yeast Res., 14:364-7) that enables the maintenance of the plasmid vector without integration into the genome of transformed cells, and a kanMX marker for the selection of transformants by the antibiotic G418. Both the amplified Dasher GFP expression DNA fragment and the pIL75 vector DNA were digested with 10 units of BamHI and 10 units of XbaI restriction endonuclease (New England Biolabs) in 1x CutSmart buffer (New England Biolabs) at 37°C for 1 hour. BamHI-XbaI-digested DNA fragments were separated by electrophoresis on a 1% agarose gel in 1xTBE buffer, visualized using SYBR Safe DNA gel staining, the target DNA fragments were cut from the agarose gel, and the DNA was recovered using a Zimoclean gel DNA recovery kit.

[0305] DNA fragments containing the p. Pastoris AOX1 promoter, the Dasher GFP open reading frame, and the p. Pastoris FDH1 termination factor were introduced into a pIL75 vector similarly digested by ligation. A mixture containing 48 ng of a BamHI-XbaI-digested DNA fragment containing the sequence for Dasher GFP expression and 15 ng of BamHI-XbaI-digested pIL75 DNA was incubated in 20 μl of 1x T4 DNA ligase reaction buffer with 400 units of T4 DNA ligase (New England Biolabs) at 16°C for 2 hours. Electroqualified E. coli DH10B cells were transformed with 2 μl of ligation reaction mixture, and antibiotic-resistant transformants were selected on LSB agar plates supplemented with 100 μg / μl ampicillin. The plates were incubated overnight at 37°C. Colonies were screened for the presence of inserts by PCR using primers MxO0513 and MxO0514. The sequence of the final vector was confirmed by DNA sequencing. The generated episomal vector containing the sequence encoding a Darsher GFP variant whose expression is under the control of the AOX1 promoter was designated as pMx0379.

[0306] Example 7

[0307] Construction of strain MxY0270

[0308] The pMx0379 vector, containing a Dasher GFP reporter under the control of the AOX1 promoter, was introduced into the Pichia pastoris host strain MxY0051 by transformation. The MxY0051 strain is a MutS strain but does not contain other modifications. Transformers were selected and maintained by growing the plasmid on a medium containing the antibiotic G418. The plates were incubated at 30°C for 48 hours. Individual clones were patched onto YPD plates containing the antibiotic G418, and the patches were used to inoculate the cultures for subsequent experiments.

[0309] Example 8

[0310] Error-induced mutagenesis of the AOX1 promoter

[0311] The pMx0369 vector was used as a template for error-induced PCR amplification of the AOX1 promoter. Error-induced PCR was performed as described in the literature [McCullum, et al., (2010, Methods in Molecular Biology, 634:103-9)]. The pAOX1 promoter was amplified using primers MxO0569 (TCCTGCAGCCCGGGGGATCCAACATCCAAAGA; SEQ ID No.: 34) and MxO0570 (CTTCAGTTAAAGCTGTCATCGTTTCGAATAATTAGT; SEQ ID No.: 35) in a reaction mixture containing 1 μM of each primer in 1X reaction buffer (Invitrogen), 50 ng of template DNA, 1 mM dCTP and dTTP, 0.2 mM dATP and dGTP, 5.5 mM MgCl2, 0.5 mM MnCl2, and 5 U Taq DNA polymerase. The reaction conditions for error-induced amplification were as follows:

[0312]

[0313] The pMx0379 vector, excluding the pAOX1 promoter sequence, was amplified under standard PCR amplification conditions as described in Example 1 using primers MxO0571 (AACAACTAATTATTCGAAACGATGACAGCTTTAACT; sequence identification number: 36) and MxO0572 (ACCTTTCGTCTTTGGATGTTGGATCCCCCGGG; sequence identification number: 37).

[0314] The pAOX1 promoter generated by error-induced amplification and the amplified pMx0379 vector DNA were separated by electrophoresis on a 1% agarose gel in 1xTBE buffer, respectively, and visualized using SYBR Safe DNA gel staining. The target DNA fragment was cut from the agarose gel, and the DNA was recovered using the Zimoclean™ gel DNA recovery kit as described herein. The pAOX1 promoter sequence (600 ng) and vector DNA (200 ng) were assembled using the Gibson assembly reaction (New England Biolabs). Electromax DH10B qualified cells were transformed using the assembly reaction product as described in Example 3. After growing overnight on LB agar plates containing ampicillin, the transformants were pooled into 50 ml of LB liquid medium containing 100 μg / ml of ampicillin and grown at 37°C for 4 hours while shaking at 250 rpm. After growth, the plasmid DNA was recovered using the Qiagen Plasmid Midi Kit (Qiagen Inc.). The resulting DNA consisted of the pMx0379 vector containing various mutated pAOX1 promoter sequences.

[0315] Example 9

[0316] Screening of the pAOX1 mutant library

[0317] A pAOX1 promoter library consisting of a pAOX1 promoter generated by error-induced PCR driving GFP reporter expression was introduced into strain MxY0051 by transformation. Transformers were selected and maintained by growth on YPD plates containing the antibiotic G418. Plates were incubated at 30°C for 72 hours, and colonies were screened for fluorescence using the Li-Cor Odyssey Fc imaging system (Li-Cor Biosciences, Lincoln, Nebraska). Colonies exhibiting significant fluorescence on YPD were identified. These colonies were subcultured on fresh YPD plates with strain MxY0270 as a wild-type pAOX1 reference, and were confirmed to exhibit increased GFP expression compared to the reference. This strain was designated as MxY0279.

[0318] Example 10

[0319] Recovery of mutated plasmid from MxY0279

[0320] Plasmid DNA was recovered from transformed P. Pastoris cells by resuspending MxY0279 colonies in 100 μl of lysis buffer (200 mM Li acetate, 1% SDS) and heating the suspension at 70°C for 5 minutes. After adding 300 μl of 100% ethanol, DNA was precipitated from the lysate by centrifugation at 15,000 xg for 3 minutes. The recovered material was washed with 1 ml of 70% ethanol and centrifuged. The precipitated DNA was dissolved in 100 μl of DNA elution buffer (5 mM Tris / HCl, pH 8.5). Bacterial transformants were recovered by transforming Electromax DH10B eligible cells as described in Example 3 using a 2 μl volume of recovered DNA solution and plating them on LB plates containing 100 μg / ml of ampicillin. Plasmid DNA was isolated from the bacterial transformants using the QIAprep Spin Miniprep Kit, and the sequence of the mutated promoter was determined by sequencing the plasmid DNA using MxO0569 and MxO0570 primers. The recovered plasmid vector containing the mutant pAOX1 promoter driving GFP expression was designated as pMx0414. The sequence is presented as shown in Figure 2 under sequence identification number: 29, where 19 mutant sites are indicated by double underlines.

[0321] Example 11

[0322] Confirmation that improved GFP expression in MxY0279 originates from pMx0414

[0323] The MxY0051 strain of P. Pastoris was transformed with the recovered pMx0414 plasmid as described in Example 3. Transformers and the MxY0270 control strain were streaked onto YPD agar plates and incubated at 30°C for 3 days. Fluorescence from these cells was measured using the Re-Cor Odyssey Fc imaging system as described in Example 9. Transformers showed significant expression from the mutant pAOX1 promoter on YPD medium lacking the inducer methanol, whereas the MxY0270 control strain, which possessed a plasmid containing GFP driven by the wild-type pAOX1 promoter, showed significantly reduced fluorescence or no fluorescence (Fig. 3). These results confirm that the improved GFP expression observed in the original MxY0279 strain was due to a mutation in the pMx0414 plasmid rather than the host strain genome.

[0324] Example 12

[0325] Shaking flask culture of transformants and measurement of GFP expression

[0326] Strains MxY0270 and MxY0279 harboring the pMx0379 and pMx0414 GFP expression plasmids as described herein were inoculated into growth medium containing antibiotic G418 (1% yeast extract supplemented with 1% glycerol, 2% peptone) to maintain the plasmids, and grown overnight at 30°C with shaking at 200 rpm. On the following day, the overnight cultures were diluted to an OD600 of 0.5–0.7 in YP medium supplemented with 1% dextrose, 1% glycerol, 1% methanol, or both 1% methanol and 1% dextrose. All media contained antibiotic G418.

[0327] GFP fluorescence was measured at an excitation wavelength of 485 nm and an emission wavelength of 525 nm in cultures expressing the reporter protein using a SpectraMax M2 microplate reader and SoftMax Pro 6.1 software (Molecular Devices, San Jose, California). Fluorescence in the shaken flask cultures was measured 48 hours after dilution with the relevant carbon source. GFP fluorescence in relative fluorescence units (RFU) was normalized to the OD of the culture (see Fig. 4).

[0328] Example 13

[0329] Evaluation of mutation sets

[0330] In a combination promoter library containing mutations present in the plasmid along with all 19 mutations in pAOX1 (the promoter designated as MxG0038; see, e.g., Sequence Identification No. 29), each mutated position in MxG0038 was a wild-type or mutant nucleotide. A group of five mutations from the MxG0038 mutants conferring an improved expression phenotype was identified. A mutant AOX1 promoter containing the mutations T688C, A696T, T702C, A712G, and T714G was designated as MxG0220. A portion of the sequences of MxG0038 and MxG0020 is compared in Figure 5.

[0331] Figure 6 shows the relative expression of GFP using a wild-type pAOX1 promoter, a pAOX1 promoter containing all 19 mutations (promoter designated as MxG0038 in strain MxY965), and a pAOX1 promoter containing 5 selected mutations (promoter designated as MxG0220).

[0332] Other embodiments

[0333] Although the present invention has been described in conjunction with its detailed description, it should be understood that such description is intended to illustrate, not limit, the scope of the invention as defined by the scope of the appended claims. Other aspects, advantages, and variations are within the scope of the following claims.

Claims

Claim 1 A nucleic acid construct comprising a first alcohol oxidase promoter element, wherein the first alcohol oxidase promoter element comprises mutations T688C, A696T, T702C, A712G, and T714G relative to sequence identification number: 28, and wherein the nucleic acid construct is capable of expressing a coding sequence operably linked to the first alcohol oxidase promoter element in the absence of methanol. Claim 2 A nucleic acid construct according to claim 1, wherein the first alcohol oxidase promoter element has at least 90% sequence identity with respect to sequence identification number:

28. Claim 3 A nucleic acid construct according to claim 1, further comprising a nucleotide sequence, said nucleotide sequence being operably linked to a first alcohol oxidase promoter element. Claim 4 In paragraph 3, a nucleic acid construct in which the nucleotide sequence codes for a first protein. Claim 5 A nucleic acid construct according to claim 4, wherein the first protein is selected from the group consisting of an antibody or a fragment thereof, an enzyme, a regulatory protein, a peptide hormone, a blood coagulation protein, a cytokine, a cytokine inhibitor, and a heme-binding protein. Claim 6 In paragraph 4, the nucleic acid construct in which the first protein is a heme-binding protein. Claim 7 In claim 6, the nucleic acid construct in which the heme-binding protein is leghemoglobin. Claim 8 A nucleic acid construct according to claim 6, wherein the heme-binding protein comprises an amino acid sequence having at least 90% sequence identity with respect to the amino acid sequence of any of sequence identification numbers: 1-27. Claim 9 A nucleic acid construct according to claim 6, wherein the heme-binding protein comprises an amino acid sequence identical to the amino acid sequence of any of sequence identification numbers: 1-27. Claim 10 A cell comprising a first nucleic acid construct, wherein the first nucleic acid construct is the nucleic acid construct of claim 1 or claim 2. Claim 11 A cell according to claim 10, further comprising a second nucleic acid construct comprising a second nucleotide sequence, wherein the second nucleotide sequence is operably linked to a first alcohol oxidase promoter element or a second promoter element. Claim 12 A method for producing a protein in a cell, comprising expressing the nucleic acid construct of claim 1 or 2, wherein the first alcohol oxidase promoter element is operably linked to a nucleotide sequence encoding the protein. Claim 13 A method performed in the absence of added methanol in paragraph 12. Claim 14 A method performed in the presence of added methanol in paragraph 12. Claim 15 delete Claim 16 delete Claim 17 delete Claim 18 delete Claim 19 delete Claim 20 delete Claim 21 delete Claim 22 delete Claim 23 delete Claim 24 delete Claim 25 delete Claim 26 delete Claim 27 delete Claim 28 delete Claim 29 delete Claim 30 delete Claim 31 delete Claim 32 delete Claim 33 delete Claim 34 delete Claim 35 delete Claim 36 delete

Citation Information

Patent Citations

  • Tools for multiprotein complex expression in pichia pastoris

    EP3128006A1

  • Expression constructs and methods of genetically engineering methylotrophic yeast

    KR1020170138543A

  • Expression of group b neisseria meningitidis outer membrane (MB3) protein from yeast and vaccines

    WO1997028273A1