A marker to check a seed group of Chinese cabbage(Brassica rapa spp. pekinensis) and use thereof
Patent Information
- Application Number
- KR1020230116324
- Authority / Receiving Office
- KR · KR
- Patent Type
- Patents
- Current Assignee / Owner
- Filing Date
- 2023-09-01
- Publication Date
- 2026-09-01
- Estimated Expiration
- 2043-09-01
Smart Images

Figure 112023096947037-PAT00009_ABST
Abstract
Description
Technology Field
[0001] The present invention relates to an SNP marker composition for testing cabbage lineages, a composition for testing lineages, a kit, and a method for testing cabbage lineages using the same. Background Technology
[0003] Napa cabbage is a biennial leafy vegetable cultivated in fields and is widely used worldwide as both a main and auxiliary ingredient in food. Depending on the cultivation period, Napa cabbage is broadly classified into early, mid-season, and late varieties, and according to head formation, it is categorized into heading, semi-heading, and non-heading varieties. As such, since there are various strains and varieties within Napa cabbage, it is necessary to selectively cultivate high-quality Napa cabbage to produce high-quality Napa cabbage.
[0004] In the identification of biological species and lineages, morphological and physicochemical methods have traditionally been used. However, because the chromosomal structure of Brassica crops is complex, it is difficult to establish analytical indicators, leading to subjective identification of lineages and species. Furthermore, some methods suffered from the disadvantage of being inconsistent due to environmental influences. With the recent advancement of molecular biology, technologies that explore specific DNA sequence polymorphisms and utilize them as markers are being applied in various fields, such as gene mapping, as they are unaffected by environmental factors and exhibit minimal year-to-year variation. While such technologies have been applied to purity testing for various plants, including cabbage (Korean Registered Patent No. 10-1690067), there have been no reports of their use for verifying Brassica lineages.
[0005] Against this backdrop, the inventors made diligent efforts to select elite lines of cabbage unaffected by environmental factors and to develop a method for verifying cabbage lineages in order to shorten the cultivation period and time within cabbage. As a result, they discovered lineage-specific SNP markers through the analysis of genomic variations of elite cabbage lines and confirmed that cabbage lineages can be clearly verified using said SNP markers, thereby completing the present invention. The problem to be solved
[0007] One objective of the present invention is to provide an SNP marker composition for testing cabbage lineages.
[0008] Another objective of the present invention is to provide a composition for testing cabbage strains.
[0009] Another objective of the present invention is to provide a kit for testing cabbage strains comprising the above composition.
[0010] Another objective of the present invention is to provide a method for testing cabbage lineage groups using the above-mentioned SNP marker. means of solving the problem
[0012] This is explained in detail as follows. Meanwhile, each description and embodiment disclosed in the present invention may be applied to each other description and embodiment. That is, all combinations of the various elements disclosed in the present invention fall within the scope of the present invention. Furthermore, the scope of the present invention should not be considered limited by the specific descriptions provided below.
[0014] One aspect of the present invention provides an SNP marker composition for testing cabbage lineages comprising one or more selected from polynucleotides consisting of 5 to 501 consecutive bases, or a polynucleotide complementary thereto, wherein the 251st base in any one or more selected from SEQ ID NOs 1 to 63 is included as a single nucleotide polymorphism (SNP) site.
[0015] In this invention, the term "cabbage" refers to a biennial leafy-stem vegetable generally grown in fields as a cultivated variety of the genus Cabbage, and the scientific name is Brassica rapa ssp. pekinensis The classification categories of Chinese cabbage can be classified into Korean breeding resources, Korean native varieties, Northern Chinese varieties, Southern Chinese varieties, and Japanese breeding resources, considering the origin and the process of propagation within East Asia. It is also broadly divided into early, mid, and late varieties based on the cultivation period, and classified into heading, semi-heading, and non-heading varieties based on the head formation type. Therefore, within Chinese cabbage, lineages or lineage groups may differ depending on phenotype, characteristics, and genetic traits.
[0016] In this invention, the term "lineage" refers to each resulting product obtained by improving or modifying genetic traits within a population of animals or plants that share the same genetic traits. In this invention, individuals (lineages) that have been purified through self-pollination and haploid doubling are utilized. The said lineage may be expressed as a resource name, lineage name, or variety name, and the said resource name may be used interchangeably with the lineage ID for the purposes of this invention.
[0017] In the present invention, the term "lineage group" refers to a core population established for genetic research and breeding of crops, classified based on its origin, use, and breeding period, and can be divided into non-pekinensis cabbage subspecies, Chinese lines, early introduced cabbage breeding materials, and Korean breeding lines.
[0018] As an example of implementation, the above-mentioned lineage testing may be a purity test for a cabbage lineage, and may distinguish between a Chinese line and a cabbage subspecies, a cabbage breeding material and a cabbage subspecies, a domestically bred line and a cabbage subspecies, a cabbage breeding material and a Chinese line, a domestically bred line and a Chinese line, and / or a domestically bred line and a cabbage breeding material.
[0019] As an example of implementation, the above system and system group may be as shown in Table 1 below.
[0021]
[0022]
[0024] In one embodiment, the cabbage subspecies lineage of the present invention may include one or more selected from the group consisting of RcBr, 27090, CNU_28069, CNU_11473, CNU_11479, CNU_11480, CNU_28073, 120031, CNU_28062, CNU_11481, CNU_11735, CNU_28064, CNU_28072, 25079, 25082, 25083, 25084, 120012, CNU_28070, and CNU_28063. In one exemplary embodiment, the Chinese lineage group of the present invention is 10073, CNU_11418, CNU_11482, 10066, 28060, 28054, 12013, 12015, 26013, 26014, 26016, 26017, 26018, 26019, 26021, 26022, CNU_11602, CNU_11610, CNU_11636, CNU_11637, CNU_11638, CNU_11639, CNU_11641, CNU_11642, CNU_11644, CNU_11652, CNU_11677, CNU_11678, CNU_11699, It may include any one or more selected from the group consisting of CNU_12239, CNU_12243, CNU_28065, CNU_28067, CNU_11712, CNU_11714, CNU_11682, CNU_11684, CNU_11685, CNU_11696, 101048, CNU_11592, CNU_11600, CNU_11635, CNU_28025, CNU_11503, CNU_11509, CNU_11577, CNU_11586, and 28052.In one embodiment, the lineage of the cabbage breeding material of the present invention is 28053, CNU_11381, CNU_11384, CNU_11395, CNU_11412, CNU_11419, CNU_11716, CNU_11721, 10067, 10068, 271002KS, 28055, 10071, 10070, CNU_11729, CNU_11730, CNU_11731, CNU_11732, CNU_11733, 10072, 28061, 10069, 12014, 26015, 26020, CNU_11397, CNU_12240, CNU_28066, It may include any one or more selected from the group consisting of CNU_28028, CNU_28026, chiifu, 28058, and 28057. As an example of implementation, the above domestically bred lineage group is CNU_11377, CNU_11378, CNU_11379, CNU_11380, CNU_11383, CNU_11385, CNU_11386, CNU_11387, CNU_11388, CNU_11389, CNU_11390, CNU_11391, CNU_11392, CNU_11393, CNU_11394, CNU_11396, CNU_11398, CNU_11399, CNU_11400, CNU_11401, CNU_11402, CNU_11403, CNU_11405, CNU_11406, CNU_11407, CNU_11410, It may include any one or more selected from the group consisting of CNU_11411, CNU_11413, CNU_11416, CNU_11417, CNU_11420, CNU_11471, CNU_11472, CNU_11474, CNU_11475, CNU_11476, CNU_11477, CNU_11478, CNU_11715, CNU_11717, CNU_11718, CNU_11719, CNU_11720, CNU_11722, CNU_11723, CNV, CR, DMR, DMS, CNU_11734, CNU_11736, 28059, CNU_12242, and CNU_28027.
[0025] In another embodiment, the cabbage subspecies lineage of the present invention may include one or more selected from the group consisting of RcBr, R-O18, ZS072620, 11su-3, 11su-9, 11su-10, ZB080872, NLDCGN_CGN06790, ZM071224, 11su-11, Wonkyo 20040, ZS072773, Z062044, Waegakhwang, tetraploid Waegakhwang, Sojucheong, Sangjuotapcha, NLDCGN_CGN06817, ZM070523, and ZM070001 listed in Table 1. In one embodiment, the Chinese lineage group of the present invention may include one or more selected from the group consisting of Kaesong cabbage, HKC-005, 11su-12, 09-FK05, Seoul cabbage, Uiseong Cheongbang, Wm, FT-50, A1, A2, B2, C1, C2, D1, E1, E2, Pungyeong, Pungyeong, Cheonhamussang, Daesajadu, Jungsajadu, Sosajadu, Nokhang S5, Geum 424-S8, Gyeongchuyeo, 501, Baekbang, ZS072518, Z062282, Gyeongnok 60, Gonggwan No. 1, Beijing Xin No. 3, Jingwan 75, Cheonjinrok Cheongmayeop, Cheongmayeop, Chuok No. 1 F1, Chuok No. 3, and Jikei. In one embodiment, the cabbage breeding material line group of the present invention may include one or more selected from the group consisting of 50-il, GWGP, MP, GRYR2, C-34, HKC-006, CHW-1, Tro-St-A, 09-FK08, 09-FK15, Gwonsim, Naebyeongjakryeol 2, Nobaek 3, Daeyanggarak, Wonkyo 20034, Wonkyo 20035, Wonkyo 20036, Wonkyo 20037, Wonkyo 20038, Kyoto 2, Matsushima Shin 2, Chunpanozaki, PG-2, B1, D2, WWH2, 601, Z062280, Gaeryang Cheongjap 3 / F7-8, Bukgyeongguk Hongsim, Jibu, Cheongbang, and Nucleus Cabbage.In one embodiment, the domestically bred line group of the present invention includes CR702, BA1, CR-GJ1, CR-GJ2, DP, CHBC, CG2, OHCR, GNJ*NRB, CR-NRIB, CRWDD, HDJG, DI065A, GRYR1, CR-AS, CR-SRN, C-09, C-13, C-16, C-20, C-21, C-22, C-25, C-26, C-27, C-31, C-33, C-35, HKC-003, HKC-004, HKC-007, 11su-1, 11su-2, 11su-4, 11su-5, 11su-6, 11su-7, 11su-8, S538-C, S55, S50-A, CRSK-A, It may include one or more selected from the group consisting of Ud-W, Tro-Jb, TR-3, 94SK, CR, DMR, DMS, Wonkyo 20039, Wonkyo 20041, Hiratsuka 1, Cheongbaekbang, and Geumchuhwangsim.
[0027] In one exemplary implementation, the above line or lineage group may be for precision breeding, but is not limited thereto.
[0028] In this invention, the term "precision breeding" refers to a breeding method that targets specific parts of genes to achieve individual breeding objectives, and is the opposite of random crop breeding. Various technologies such as SNP markers, genome editing, and gene scissors may be used in precision breeding; in this invention, SNP markers were used as a representative method, but the method is not limited thereto.
[0030] In the present invention, the term "SNP marker" refers to a single nucleotide polymorphism (SNP) allele base pair on a DNA sequence. The SNP refers to a case where only a single nucleotide differs at a polymorphic site where two or more alleles exist at a single gene locus. Specifically, the polymorphic marker has two or more alleles exhibiting an occurrence frequency of 1% or more, more specifically 5% or more, and even more specifically 10% or more in a selected population. The SNP has a relatively high frequency, is stable, and is distributed throughout the genome, thereby generating genetic diversity in the individual. Additionally, the SNP may include phenotypic changes generally associated with single nucleotide polymorphisms. The SNP marker of the present invention may be used to test lineages in Brassica pekinensis, but is not limited thereto.
[0031] The SNP marker for testing cabbage lineage groups of the present invention may be one or more selected from polynucleotides composed of 5 to 501 consecutive bases, comprising the 251st base in any one or more selected from SEQ ID NOs 1 to 63 as an SNP site, or a polynucleotide complementary thereto.
[0032] The inventors confirmed that core lines can be classified into lineage groups such as cabbage subspecies, Chinese lines, cabbage breeding materials, and domestically bred lines, and accordingly, by constructing comparison combinations as shown in Table 3 below, they developed SNP markers of sequence numbers 1 to 63 that can test the said lineage groups.
[0033] In one embodiment of the present invention, it was confirmed that the polynucleotides of SEQ ID NOs 1 to 63 can test a specific cabbage lineage by including the 251st base as an SNP (Example 2).
[0035] In the present invention, a nucleotide sequence or polynucleotide is interpreted to include a sequence that exhibits substantial identity with a sequence listed in the sequence list, provided that variations having biologically equivalent activity are taken into account. The term "substantial identity" means a sequence that exhibits at least 60% homology, more specifically 70% homology, even more specifically 80%, and particularly specifically 90% homology when any other sequence is aligned with the sequence of the present invention to correspond as much as possible and the aligned sequence is analyzed using an algorithm commonly used in the art.
[0036] Accordingly, as long as the sequence of the SNP position, which is the 251st nucleotide sequence in each of the above sequences consisting of sequence numbers 1 to 63, is identical, the other regions should be interpreted as having high homology with the nucleotide sequences represented by sequence numbers 1 to 63, for example, nucleotide sequences having high homology of 70% or more, more specifically 80% or more, and even more specifically 90% or more, and such high homology should also be included within the scope of the present invention.
[0038] For example, among one or more polynucleotides selected from SEQ ID NOs 1 to 63, the polynucleotide described as SEQ ID NOs 5, 18, 22, 41, 43, 48, 52, and 55 comprises a 251st base that is G or A; the polynucleotide described as SEQ ID NOs 8, 11, 20, 30, 32, 35, 40, 53, and 57 comprises a 251st base that is A or G; the polynucleotide described as SEQ ID NOs 2, 4, 12, 15, 21, 29, 36, 44, 56, 58, and 62 comprises a 251st base that is C or T; the polynucleotide described as SEQ ID NOs 1, 6, 14, and 17 comprises a 251st base that is T or C; Polynucleotides described in SEQ ID NOs 16, 19, and 31, comprising a 251st base that is G or C; polynucleotides described in SEQ ID NOs 50 and 51, comprising a 251st base that is C or G; polynucleotides described in SEQ ID NOs 10, 26, and 61, comprising a 251st base that is G or T; polynucleotides described in SEQ ID NOs 34, 42, 45, and 60, comprising a 251st base that is T or G; polynucleotides described in SEQ ID NOs 3, 9, 23, 25, 27, 37, and 39, comprising a 251st base that is C or A; polynucleotides described in SEQ ID NOs 33, 38, 49, 54, and 63, comprising a 251st base that is A or C; The polynucleotides described in SEQ ID NOs. 7, 24, 46, and 59 may be one or more selected from polynucleotides consisting of 5 to 501 consecutive bases, including a 251st base that is A or T; and the polynucleotides described in SEQ ID NOs. 13, 28, and 47, including a 251st base that is T or A.
[0039] For example, an SNP marker comprising a polynucleotide composed of one or more of SEQ ID NOs 1 to 26 or a polynucleotide complementary thereto may be a marker for testing cabbage subspecies; an SNP marker comprising a polynucleotide composed of one or more of SEQ ID NOs 1 to 12 and 27 to 51 or a polynucleotide complementary thereto may be a marker for testing Chinese lines; an SNP marker comprising a polynucleotide composed of one or more of SEQ ID NOs 13 to 18, 27 to 37, and 52 to 63 or a polynucleotide complementary thereto may be a marker for testing cabbage breeding materials; and an SNP marker comprising a polynucleotide composed of one or more of SEQ ID NOs 19 to 26 and 38 to 63 or a polynucleotide complementary thereto may be a marker for testing domestic breeding lines, but is not limited thereto.
[0040] As a specific example of the aforementioned example, an SNP marker comprising a polynucleotide composed of one or more of SEQ ID NOs. 1 to 12 or a polynucleotide complementary thereto is a marker for testing Brassica radica subspecies and Chinese lineage groups; an SNP marker comprising one or more of SEQ ID NOs. 13 to 18 or a polynucleotide complement thereto is a marker for testing Brassica radica subspecies and Brassica breeding materials; an SNP marker comprising one or more of SEQ ID NOs. 19 to 26 or a polynucleotide complement thereto is a marker for distinguishing Brassica radica subspecies and domestically bred lines; an SNP marker comprising one or more of SEQ ID NOs. 27 to 37 or a polynucleotide complement thereto is a marker for distinguishing Chinese lines and Brassica breeding materials; an SNP marker comprising one or more of SEQ ID NOs. 38 to 51 or a polynucleotide complement thereto is a marker for distinguishing Chinese lines and domestically bred lines; An SNP marker comprising a polynucleotide composed of any one or more of SEQ ID NOs 52 to 63 or a polynucleotide complementary thereto may be a marker for distinguishing between cabbage breeding materials and domestic breeding lines, but is not limited thereto.
[0041] In one embodiment, if the 251st base of the polynucleotide composed of SEQ ID NO. 1 is T, it is a Chinese lineage and if it is C, it is a cabbage subspecies; if the 251st base of the polynucleotide composed of SEQ ID NO. 2 is C, it is a Chinese lineage and if it is T, it is a cabbage subspecies; if the 251st base of the polynucleotide composed of SEQ ID NO. 3 is C, it is a Chinese lineage and if it is A, it is a cabbage subspecies; if the 251st base of the polynucleotide composed of SEQ ID NO. 4 is C, it is a Chinese lineage and if it is T, it is a cabbage subspecies; if the 251st base of the polynucleotide composed of SEQ ID NO. 5 is G, it is a Chinese lineage and if it is A, it is a cabbage subspecies; if the 251st base of the polynucleotide composed of SEQ ID NO. 6 is T, it is a Chinese lineage and if it is C, it is a cabbage subspecies; if the 251st base of the polynucleotide composed of SEQ ID NO. 7 is A, it is a Chinese lineage and if it is T, it is a cabbage subspecies; If the 251st base of the polynucleotide composed of SEQ ID NO. 8 is A, it is a Chinese lineage; if it is G, it is a cabbage subspecies; if the 251st base of the polynucleotide composed of SEQ ID NO. 9 is C, it is a Chinese lineage; if it is A, it is a cabbage subspecies; if the 251st base of the polynucleotide composed of SEQ ID NO. 10 is G, it is a Chinese lineage; if it is T, it is a cabbage subspecies; if the 251st base of the polynucleotide composed of SEQ ID NO. 11 is A, it is a Chinese lineage; if it is G, it is a cabbage subspecies; if the 251st base of the polynucleotide composed of SEQ ID NO. 12 is C, it is a Chinese lineage; if it is T, it is a cabbage subspecies; if the 251st base of the polynucleotide composed of SEQ ID NO. 13 is T, it is a cabbage breeding material; if it is A, it is a cabbage subspecies; if the 251st base of the polynucleotide composed of SEQ ID NO. 14 is T, it is a cabbage breeding material; if it is C, it is a cabbage subspecies; If the 251st base of the polynucleotide composed of SEQ ID NO. 15 is C, it is a cabbage breeding material; if it is T, it is a cabbage subspecies; if the 251st base of the polynucleotide composed of SEQ ID NO. 16 is G, it is a cabbage breeding material; if it is C, it is a cabbage subspecies;If the 251st base of the polynucleotide composed of SEQ ID NO. 17 is T, it is a cabbage breeding material; if it is C, it is a cabbage subspecies; if the 251st base of the polynucleotide composed of SEQ ID NO. 18 is G, it is a cabbage breeding material; if it is A, it is a cabbage subspecies; if the 251st base of the polynucleotide composed of SEQ ID NO. 19 is G, it is a domestically bred line; if it is C, it is a cabbage subspecies; if the 251st base of the polynucleotide composed of SEQ ID NO. 20 is A, it is a domestically bred line; if it is G, it is a cabbage subspecies; if the 251st base of the polynucleotide composed of SEQ ID NO. 21 is C, it is a domestically bred line; if it is T, it is a cabbage subspecies; if the 251st base of the polynucleotide composed of SEQ ID NO. 22 is G, it is a domestically bred line; if it is A, it is a cabbage subspecies; If the 251st base of the polynucleotide composed of SEQ ID NO. 23 is C, it is a domestic breeding line; if it is A, it is a Brassica cabbage subspecies; if the 251st base of the polynucleotide composed of SEQ ID NO. 24 is A, it is a domestic breeding line; if it is T, it is a Brassica cabbage subspecies; if the 251st base of the polynucleotide composed of SEQ ID NO. 25 is C, it is a domestic breeding line; if it is A, it is a Brassica cabbage subspecies; if the 251st base of the polynucleotide composed of SEQ ID NO. 26 is G, it is a domestic breeding line; if it is T, it is a Brassica cabbage subspecies; if the 251st base of the polynucleotide composed of SEQ ID NO. 27 is C, it is a Brassica cabbage breeding material; if it is A, it is a Chinese line; if the 251st base of the polynucleotide composed of SEQ ID NO. 28 is T, it is a Brassica cabbage breeding material; if it is A, it is a Chinese line; if the 251st base of the polynucleotide composed of SEQ ID NO. 29 is C, it is a Brassica cabbage breeding material; if it is T, it is a Chinese line; If the 251st base of the polynucleotide composed of SEQ ID NO. 30 is A, it is a cabbage breeding material; if it is G, it is a Chinese line; if the 251st base of the polynucleotide composed of SEQ ID NO. 31 is G, it is a cabbage breeding material; if it is C, it is a Chinese line; if the 251st base of the polynucleotide composed of SEQ ID NO. 32 is A, it is a cabbage breeding material; if it is G, it is a Chinese line;If the 251st base of the polynucleotide composed of SEQ ID NO. 33 is A, it is a cabbage breeding material; if it is C, it is a Chinese line; if the 251st base of the polynucleotide composed of SEQ ID NO. 34 is T, it is a cabbage breeding material; if it is G, it is a Chinese line; if the 251st base of the polynucleotide composed of SEQ ID NO. 35 is A, it is a cabbage breeding material; if it is G, it is a Chinese line; if the 251st base of the polynucleotide composed of SEQ ID NO. 36 is C, it is a cabbage breeding material; if it is T, it is a Chinese line; if the 251st base of the polynucleotide composed of SEQ ID NO. 37 is C, it is a cabbage breeding material; if it is A, it is a Chinese line; if the 251st base of the polynucleotide composed of SEQ ID NO. 38 is A, it is a domestically bred line; if it is C, it is a Chinese line; if the 251st base of the polynucleotide composed of SEQ ID NO. 39 is C, it is a domestically bred line; if it is A, it is a Chinese line; If the 251st base of the polynucleotide composed of SEQ ID NO. 40 is A, it is a domestic breeding line; if it is G, it is a Chinese line; if the 251st base of the polynucleotide composed of SEQ ID NO. 41 is G, it is a domestic breeding line; if it is A, it is a Chinese line; if the 251st base of the polynucleotide composed of SEQ ID NO. 42 is T, it is a domestic breeding line; if it is G, it is a Chinese line; if the 251st base of the polynucleotide composed of SEQ ID NO. 43 is G, it is a domestic breeding line; if it is A, it is a Chinese line; if the 251st base of the polynucleotide composed of SEQ ID NO. 44 is C, it is a domestic breeding line; if it is T, it is a Chinese line; if the 251st base of the polynucleotide composed of SEQ ID NO. 45 is T, it is a domestic breeding line; if the 251st base of the polynucleotide composed of SEQ ID NO. 46 is A, it is a domestic breeding line; if it is T, it is a Chinese line; If the 251st base of the polynucleotide composed of SEQ ID NO. 47 is T, it is a domestically bred line; if it is A, it is a Chinese line; if the 251st base of the polynucleotide composed of SEQ ID NO. 48 is G, it is a domestically bred line; if it is A, it is a Chinese line;If the 251st base of the polynucleotide composed of SEQ ID NO. 49 is A, it is a domestic breeding line; if it is C, it is a Chinese line; if the 251st base of the polynucleotide composed of SEQ ID NO. 50 is C, it is a domestic breeding line; if it is G, it is a Chinese line; if the 251st base of the polynucleotide composed of SEQ ID NO. 51 is C, it is a domestic breeding line; if it is G, it is a Chinese line; if the 251st base of the polynucleotide composed of SEQ ID NO. 52 is G, it is a domestic breeding line; if it is A, it is a cabbage breeding material; if the 251st base of the polynucleotide composed of SEQ ID NO. 53 is A, it is a domestic breeding line; if it is G, it is a cabbage breeding material; if the 251st base of the polynucleotide composed of SEQ ID NO. 54 is A, it is a domestic breeding line; if it is C, it is a cabbage breeding material; If the 251st base of the polynucleotide composed of SEQ ID NO. 55 is G, it is a domestic breeding line; if it is A, it is a cabbage breeding material; if the 251st base of the polynucleotide composed of SEQ ID NO. 56 is C, it is a domestic breeding line; if it is T, it is a cabbage breeding material; if the 251st base of the polynucleotide composed of SEQ ID NO. 57 is A, it is a domestic breeding line; if it is G, it is a cabbage breeding material; if the 251st base of the polynucleotide composed of SEQ ID NO. 58 is C, it is a domestic breeding line; if it is T, it is a cabbage breeding material; if the 251st base of the polynucleotide composed of SEQ ID NO. 59 is A, it is a domestic breeding line; if it is T, it is a cabbage breeding material; if the 251st base of the polynucleotide composed of SEQ ID NO. 60 is T, it is a domestic breeding line; if it is G, it is a cabbage breeding material; It may be a classification test in which the 251st base of the polynucleotide composed of SEQ ID NO. 61 is G if it is a domestic breeding line and a cabbage breeding material if it is T; the 251st base of the polynucleotide composed of SEQ ID NO. 62 is C if it is a domestic breeding line and a cabbage breeding material if it is T; and / or the 251st base of the polynucleotide composed of SEQ ID NO. 63 is A if it is a domestic breeding line and a cabbage breeding material if it is C, but is not limited thereto.;
[0043] Another aspect of the present invention provides a composition for testing cabbage lineages, comprising a preparation capable of detecting the SNP marker for testing cabbage lineages of the present application.
[0044] In the present invention, the term "detectable agent" includes any agent generally used in the art to detect a marker. In the present invention, the detectable agent may be any one selected from the group consisting of probes, primers, primer pairs, antibodies, aptamers, and oligonucleotides capable of amplifying or detecting the marker of the present invention, but is not limited thereto.
[0045] In the present invention, the term “probe” may be included without limitation within the scope of the present invention as long as it is a probe that can be prepared from a specific nucleotide sequence by known methods, for example, one that can be hybridized under stringent conditions with a sequence complementary to all or part of said nucleotide sequence. The “stringent condition” means a condition that enables specific hybridization between polynucleotides. Such conditions are specifically described in the literature (e.g., J. Sambrook et al., i.e.). For example, conditions may be listed in which genes with high homology or identity are hybridized with each other, with 80% or more, 85% or more, specifically 90% or more, more specifically 95% or more, even more specifically 97% or more, particularly specifically 99% or more homology or identity, and genes with lower homology or identity are not hybridized, or conditions in which washing is performed once, specifically two to three times, at a salt concentration and temperature equivalent to the washing conditions of conventional southern hybridization, such as 60°C 1XSSC, 0.1% SDS, specifically 60°C 0.1XSSC, 0.1% SDS, more specifically 68°C 0.1XSSC, 0.1% SDS.
[0046] Hybridization requires that two nucleic acids have complementary sequences, even though a mismatch between bases may be possible depending on the degree of hybridization. The term "complementary" is used to describe the relationship between nucleotide bases that can hybridize with each other. For example, regarding DNA, adenine is complementary to thymine, and cytosine is complementary to guanine. Accordingly, the present invention may also include substantially similar nucleic acid sequences as well as isolated nucleic acid fragments that are complementary to the entire sequence.
[0047] Specifically, polynucleotides having homology or identity can be detected using hybridization conditions including a hybridization step at a Tm value of 55°C and using the conditions described above. Additionally, the Tm value may be 60°C, 63°C, or 65°C, but is not limited thereto and can be appropriately adjusted by a person skilled in the art according to the purpose.
[0048] The appropriate strictness for hybridizing polynucleotides depends on the length and degree of complementarity of the polynucleotides, and the variables are well known in the field (see Sambrook et al, supra, 950-951, 117-118).
[0050] In the present invention, the term "primer" refers to a single-stranded oligonucleotide sequence complementary to the nucleic acid strand to be detected and may serve as a starting point for the synthesis of a primer extension product. In the present invention, primers may be constructed to detect a marker via a PCR reaction, but are not limited thereto, and the specific length and sequence of the primer may be synthesized by methods known in the art according to usage conditions such as temperature and ionic strength, as well as the required DNA or RNA target complexity.
[0051] In one embodiment, the primer may be a primer set for KASP (competitive allele specific PCR), but is not limited thereto.
[0052] In this invention, the term "KASP (kompetitive allele specific PCR)" refers to a type of PCR-based genotyping method using fluorescent samples, specifically a homogeneous fluorescence-based genotyping technique. KASP is a technique based on fluorescence resonance energy transfer for allele-specific oligo extension and signal generation. Through KASP, two DNA fragments are amplified using two forward primers containing nucleotide sequence differences, such as SNPs, and a reverse primer containing a common nucleotide sequence. Genes can be distinguished based on the phenomenon in which different fluorescent samples react according to the SNP differences. Since KASP can analyze genotypes through differences in fluorescent substances, it enables accurate and economical genotyping.
[0053] For the purposes of the present invention, the primer set for KASP may be a primer set comprising two forward primers having a difference in the SNP position sequence of the present invention and a reverse primer having a common base sequence, and the two forward primers may be combined with fluorescent substances that emit different colors to confirm the presence or absence of the SNP, but are not limited thereto.
[0054] In one embodiment, the KASP primer set comprises: a1) a primer set consisting of the nucleotide sequences of SEQ ID NOs 64 and 66; and a primer set consisting of the nucleotide sequences of SEQ ID NOs 65 and 66; b1) a primer set consisting of the nucleotide sequences of SEQ ID NOs 67 and 69; and a primer set consisting of the nucleotide sequences of SEQ ID NOs 68 and 69; c1) a primer set consisting of the nucleotide sequences of SEQ ID NOs 70 and 72; and a primer set consisting of the nucleotide sequences of SEQ ID NOs 71 and 72; d1) a primer set consisting of the nucleotide sequences of SEQ ID NOs 73 and 75; and a primer set consisting of the nucleotide sequences of SEQ ID NOs 74 and 75; e1) a primer set consisting of the nucleotide sequences of SEQ ID NOs 76 and 78; and a primer set consisting of the nucleotide sequences of SEQ ID NOs 77 and 78; f1) a primer set consisting of the nucleotide sequences of SEQ ID NOs 79 and 81; and a primer set consisting of the nucleotide sequences of SEQ NOs 80 and 81; g1) a primer set consisting of the nucleotide sequences of SEQ NOs 82 and 84; and a primer set consisting of the nucleotide sequences of SEQ NOs 83 and 84; h1) a primer set consisting of the nucleotide sequences of SEQ NOs 85 and 87; and a primer set consisting of the nucleotide sequences of SEQ NOs 86 and 87; i1) a primer set consisting of the nucleotide sequences of SEQ NOs 88 and 90; and a primer set consisting of the nucleotide sequences of SEQ NOs 89 and 90; j1) a primer set consisting of the nucleotide sequences of SEQ NOs 91 and 93; and a primer set consisting of the nucleotide sequences of SEQ NOs 92 and 93; k1) a primer set consisting of the nucleotide sequences of SEQ NOs 94 and 96; and a primer set consisting of the nucleotide sequences of SEQ NOs 95 and 96; l1) a primer set consisting of the nucleotide sequences of SEQ NOs 97 and 99; and a primer set consisting of the nucleotide sequences of SEQ ID NOs 98 and 99; m1) a primer set consisting of the nucleotide sequences of SEQ ID NOs 100 and 102;and a primer set consisting of the nucleotide sequences of SEQ NOs 101 and 102; n1) a primer set consisting of the nucleotide sequences of SEQ NOs 103 and 105; and a primer set consisting of the nucleotide sequences of SEQ NOs 104 and 105; o1) a primer set consisting of the nucleotide sequences of SEQ NOs 106 and 108; and a primer set consisting of the nucleotide sequences of SEQ NOs 107 and 108; p1) a primer set consisting of the nucleotide sequences of SEQ NOs 109 and 111; and a primer set consisting of the nucleotide sequences of SEQ NOs 110 and 111; q1) a primer set consisting of the nucleotide sequences of SEQ NOs 112 and 114; and a primer set consisting of the nucleotide sequences of SEQ NOs 113 and 114; r1) a primer set consisting of the nucleotide sequences of SEQ NOs 115 and 117; and a primer set consisting of the nucleotide sequences of SEQ NOs 116 and 117; s1) a primer set consisting of the nucleotide sequences of SEQ NOs 118 and 120; and a primer set consisting of the nucleotide sequences of SEQ NOs 119 and 120; t1) a primer set consisting of the nucleotide sequences of SEQ NOs 121 and 123; and a primer set consisting of the nucleotide sequences of SEQ NOs 122 and 123; u1) a primer set consisting of the nucleotide sequences of SEQ NOs 124 and 126; and a primer set consisting of the nucleotide sequences of SEQ NOs 125 and 126; v1) a primer set consisting of the nucleotide sequences of SEQ NOs 127 and 129; and a primer set consisting of the nucleotide sequences of SEQ NOs 128 and 129; w1) a primer set consisting of the nucleotide sequences of SEQ NOs 130 and 132; and a primer set consisting of the nucleotide sequences of SEQ NOs 131 and 132; x1) a primer set consisting of the nucleotide sequences of SEQ NOs 133 and 135; and a primer set consisting of the nucleotide sequences of SEQ ID NOs 134 and 135; y1) a primer set consisting of the nucleotide sequences of SEQ ID NOs 136 and 138; and a primer set consisting of the nucleotide sequences of SEQ ID NOs 137 and 138;z1) a primer set consisting of the nucleotide sequences of SEQ NOs 139 and 141; and a primer set consisting of the nucleotide sequences of SEQ NOs 140 and 141; a2) a primer set consisting of the nucleotide sequences of SEQ NOs 142 and 144; and a primer set consisting of the nucleotide sequences of SEQ NOs 143 and 144; b2) a primer set consisting of the nucleotide sequences of SEQ NOs 145 and 147; and a primer set consisting of the nucleotide sequences of SEQ NOs 146 and 147; c2) a primer set consisting of the nucleotide sequences of SEQ NOs 148 and 150; and a primer set consisting of the nucleotide sequences of SEQ NOs 149 and 150; d2) a primer set consisting of the nucleotide sequences of SEQ NOs 151 and 153; and a primer set consisting of the nucleotide sequences of SEQ NOs 152 and 153; e2) a primer set consisting of the nucleotide sequences of SEQ NOs 154 and 156; f2) a primer set consisting of the nucleotide sequences of SEQ NOs 155 and 156; f2) a primer set consisting of the nucleotide sequences of SEQ NOs 157 and 159; and a primer set consisting of the nucleotide sequences of SEQ NOs 158 and 159; g2) a primer set consisting of the nucleotide sequences of SEQ NOs 160 and 162; and a primer set consisting of the nucleotide sequences of SEQ NOs 161 and 162; h2) a primer set consisting of the nucleotide sequences of SEQ NOs 163 and 165; and a primer set consisting of the nucleotide sequences of SEQ NOs 164 and 165; i2) a primer set consisting of the nucleotide sequences of SEQ NOs 166 and 168; and a primer set consisting of the nucleotide sequences of SEQ NOs 167 and 168; j2) a primer set consisting of the nucleotide sequences of SEQ NOs 169 and 171; and a primer set consisting of the nucleotide sequences of SEQ NOs 170 and 171; k2) a primer set consisting of the nucleotide sequences of SEQ ID NOs 172 and 174; and a primer set consisting of the nucleotide sequences of SEQ ID NOs 173 and 174; l2) a primer set consisting of the nucleotide sequences of SEQ ID NOs 175 and 177;and a primer set consisting of the nucleotide sequences of SEQ ID NOs 176 and 177; m2) a primer set consisting of the nucleotide sequences of SEQ ID NOs 178 and 180; and a primer set consisting of the nucleotide sequences of SEQ ID NOs 179 and 180; n2) a primer set consisting of the nucleotide sequences of SEQ ID NOs 181 and 183; and a primer set consisting of the nucleotide sequences of SEQ ID NOs 182 and 183; o2) a primer set consisting of the nucleotide sequences of SEQ ID NOs 184 and 186; and a primer set consisting of the nucleotide sequences of SEQ ID NOs 185 and 186; p2) a primer set consisting of the nucleotide sequences of SEQ ID NOs 187 and 189; and a primer set consisting of the nucleotide sequences of SEQ ID NOs 188 and 189; q2) a primer set consisting of the nucleotide sequences of SEQ ID NOs 190 and 192; and a primer set consisting of the nucleotide sequences of SEQ ID NOs 191 and 192; r2) a primer set consisting of the nucleotide sequences of SEQ NOs 193 and 195; and a primer set consisting of the nucleotide sequences of SEQ NOs 194 and 195; s2) a primer set consisting of the nucleotide sequences of SEQ NOs 196 and 198; and a primer set consisting of the nucleotide sequences of SEQ NOs 197 and 198; t2) a primer set consisting of the nucleotide sequences of SEQ NOs 199 and 201; and a primer set consisting of the nucleotide sequences of SEQ NOs 200 and 201; u2) a primer set consisting of the nucleotide sequences of SEQ NOs 202 and 204; and a primer set consisting of the nucleotide sequences of SEQ NOs 203 and 204; v2) a primer set consisting of the nucleotide sequences of SEQ NOs 205 and 207; and a primer set consisting of the nucleotide sequences of SEQ NOs 206 and 207; w2) a primer set consisting of the nucleotide sequences of SEQ NOs 208 and 210; and a primer set consisting of the nucleotide sequences of SEQ ID NOs 209 and 210; x2) a primer set consisting of the nucleotide sequences of SEQ ID NOs 211 and 213; and a primer set consisting of the nucleotide sequences of SEQ ID NOs 212 and 213;y2) a primer set consisting of the nucleotide sequences of SEQ NOs 214 and 216; and a primer set consisting of the nucleotide sequences of SEQ NOs 215 and 216; z2) a primer set consisting of the nucleotide sequences of SEQ NOs 217 and 219; and a primer set consisting of the nucleotide sequences of SEQ NOs 218 and 219; a3) a primer set consisting of the nucleotide sequences of SEQ NOs 220 and 222; and a primer set consisting of the nucleotide sequences of SEQ NOs 221 and 222; b3) a primer set consisting of the nucleotide sequences of SEQ NOs 223 and 225; and a primer set consisting of the nucleotide sequences of SEQ NOs 224 and 225; c3) a primer set consisting of the nucleotide sequences of SEQ NOs 226 and 228; and a primer set consisting of the nucleotide sequences of SEQ NOs 227 and 228; d3) a primer set consisting of the nucleotide sequences of SEQ NOs 229 and 231; and a primer set consisting of the nucleotide sequences of SEQ NOs 230 and 231; e3) a primer set consisting of the nucleotide sequences of SEQ NOs 232 and 234; and a primer set consisting of the nucleotide sequences of SEQ NOs 233 and 234; f3) a primer set consisting of the nucleotide sequences of SEQ NOs 235 and 237; and a primer set consisting of the nucleotide sequences of SEQ NOs 236 and 237; g3) a primer set consisting of the nucleotide sequences of SEQ NOs 238 and 240; and a primer set consisting of the nucleotide sequences of SEQ NOs 239 and 240; h3) a primer set consisting of the nucleotide sequences of SEQ NOs 241 and 243; and a primer set consisting of the nucleotide sequences of SEQ NOs 242 and 243; i3) a primer set consisting of the nucleotide sequences of SEQ NOs 244 and 246; and a primer set consisting of the nucleotide sequences of SEQ NOs 245 and 246; j3) a primer set consisting of the nucleotide sequences of SEQ ID NOs 247 and 249; and a primer set consisting of the nucleotide sequences of SEQ ID NOs 248 and 249; k3) a primer set consisting of the nucleotide sequences of SEQ ID NOs 250 and 252;and may be a primer set consisting of the nucleotide sequences of SEQ ID NOs 251 and 252, but is not limited thereto.;
[0055] For example, among the above KAPS primer set, a1) to z1) may be markers for testing cabbage subspecies; a1) to l1) and a2) to y2) may be markers for testing Chinese lines; m1) to r1), a2) to k2), and z2) to k3) may be markers for testing cabbage breeding materials; and s1) to z1) and l2) to k3) may be primers capable of detecting markers for testing domestic breeding lines, but are not limited thereto.
[0056] As a specific example of the above example, among the KAPS primer set, a1) to l1) are markers for distinguishing between cabbage subspecies and Chinese lineage groups; m1) to r1) are markers for distinguishing between cabbage subspecies and cabbage breeding materials; s1) to z1) are markers for distinguishing between cabbage subspecies and domestic breeding lines; a2) to k2) are markers for distinguishing between Chinese lines and cabbage breeding materials; l2) to y2) are markers for distinguishing between Chinese lines and domestic breeding lines; and z2) to k3) are primers capable of detecting markers for distinguishing between cabbage breeding materials and domestic breeding lines, but are not limited thereto.
[0058] Another aspect of the present invention provides a kit for testing a cabbage lineage comprising a composition for testing a cabbage lineage according to the present invention. The kit may be used to test a cabbage lineage by including a composition for testing a cabbage lineage and to determine whether a specific lineage exists.
[0059] Specifically, the above kit may be selected from the group consisting of RT-PCR kits, immunostrips, DNA chip kits, protein chip kits, rapid kits or MRM (Multiple reaction monitoring) kits, and ELISA diagnostic kits, but is not limited to its operating principle or form as long as it can test the lineage of cabbage.
[0060] Additionally, the kit of the present invention may include one or more other component compositions, solutions, or devices suitable for testing cabbage lineages, but is not limited thereto. Examples of the other components include, but are not limited to, a suitable carrier, a labeling substance capable of generating a detectable signal, chromophores, a solvent, a cleaning agent, a buffer, a stabilizer, etc. If the labeling substance is an enzyme, it may include a substrate capable of measuring enzyme activity and a reaction stopping agent. The carrier may be a soluble carrier or an insoluble carrier. An example of a soluble carrier is a physiologically acceptable buffer known in the art, e.g., PBS. An example of an insoluble carrier may be a polymer such as polystyrene, polyethylene, polypropylene, polyester, polyacrylonitrile, fluoropolymer, cross-linked dextran, polysaccharide, or latex plated with metal, or other paper, glass, metal, agarose, and combinations thereof, but is not limited thereto.
[0061] In addition, the kit of the present invention may include a primer pair for detecting a marker and a reagent for performing a detection reaction, but is not limited thereto. In addition, the kit of the present invention may further include a reagent required for an amplification reaction performed for marker detection, and the reagent for performing the amplification reaction may include DNA polymerase, dNTPs, and a buffer, and may further include a reagent required for performing and analyzing a real-time PCR reaction.
[0062] In addition, the kit of the present invention may further include a user guide describing optimal reaction execution conditions. The guide is a printed document explaining how to use the kit, for example, a method for preparing PCR buffer, and the presented reaction conditions. The guide includes instructions in the form of a pamphlet or leaflet, a label attached to the kit, and on the surface of a package containing the kit. Additionally, the guide includes information disclosed or provided through electronic media, such as the Internet.
[0064] Another aspect of the present invention provides a method for testing the lineage of cabbage.
[0065] For example, the method for verifying the lineage of the above-mentioned cabbage may be a method for verifying the lineage of cabbage comprising: (a) a step of isolating genomic DNA from cabbage; and (b) a step of detecting a marker using a preparation for detecting the SNP marker of the present invention, using the genomic DNA of step (a) as a template.
[0066] In the present invention, the genomic DNA can be used without limitation regardless of the collection method and location, as long as it can verify the lineage of cabbage, and the method for isolating the genomic DNA can use a method known in the art. In addition, the detection can be performed by a method selected from the group consisting of polymerase chain reaction (PCR), reverse transcriptase polymerase chain reaction (RT-PCR), competitive reverse transcriptase polymerase chain reaction (competitive RT-PCR), real-time polymerase chain reaction (real-time RT-PCR), real-time quantitative RT-PCR, RNase protection method, Northern blotting, gene chip, and combinations thereof, but is not limited thereto.
[0067] For example, the method for verifying the lineage of the above-mentioned cabbage may be a method for verifying the lineage of cabbage comprising: (a) a step of isolating genomic DNA from cabbage; (b) a step of performing KASP using the genomic DNA from step (a) as a template and using one or more of the primer sets of a1) to k3); and (c) a step of analyzing the amplification product of the KASP, but is not limited thereto. In step (c), the lineage of cabbage may be verified based on the degree to which a fluorescent sample attached to a forward primer that binds complementarily to a polynucleotide containing the SNP of the present invention is detected as a result of the amplification of KASP, but is not limited thereto.
[0068] For example, the method for verifying the lineage of the cabbage described above may be a method comprising: (a) a step of amplifying or hybridizing a polymorphic region of the SNP marker of the present invention from the DNA of an isolated sample with a probe; and (b) a step of determining the base of the amplified or hybridized polymorphic region of step (a).
[0069] In the present invention, the method for amplifying target DNA may be a polymerase chain reaction (PCR), ligase chain reaction, real-time PCR, nucleic acid sequence-based amplification, transcription-based amplification system, strand displacement amplification, or amplification via Qβ replicase, or any other suitable method for amplifying nucleic acid molecules known in the art. Among these, PCR is a method of amplifying a target nucleic acid from a primer pair that specifically binds to the target nucleic acid using a polymerase. Such PCR methods are well known in the art, and commercially available kits may also be used.
[0070] Additionally, the amplified target sequence may be labeled with a detectable labeling substance. Specifically, the labeling substance may be a fluorescent substance, but is not limited thereto.
[0071] As an example of one implementation, the method for verifying a lineage of cabbage according to the present invention may be a method for providing information for verifying a lineage of cabbage. Effects of the invention
[0073] By using the cabbage line testing marker of the present invention, it is possible to select elite cabbage lines without being affected by the environment and simultaneously perform mass testing of cabbage seed purity, thereby enabling the selective cultivation of high-quality cabbage as well as the expectation of reducing cabbage cultivation costs and time. Brief explanation of the drawing
[0075] Figure 1 is a figure showing that the core population of cabbage can be broadly classified into four groups through population genetic analysis and literature review of plants. Figure 2 is a diagram illustrating the SNP identification pipeline. Figure 3 is a schematic diagram of the process for separating VCF files and identifying dominant alleles for group-specific SNP identification. Figure 4 shows the top 40 group-specific SNPs (Red: Alternative allele, Blue: Reference allele, Yellow: Heterozygous allele, Grey: missing allele) and group-specific patterns between the non-pekinensis and Chinese groups. Figure 5 shows the top 40 group-specific SNPs (Red: Alternative allele, Blue: Reference allele, Yellow: Heterozygous allele, Grey: missing allele) and group-specific patterns between the cabbage subspecies (Non-pekinensis) and the cabbage breeding material lines (Early introduced group). Figure 6 shows the top 40 group-specific SNPs (Red: Alternative allele, Blue: Reference allele, Yellow: Heterozygous allele, Grey: missing allele) and group-specific patterns between the cabbage subspecies (Non-pekinensis) and the Korean breeding group. Figure 7 shows the top 40 group-specific SNPs (Red: Alternative allele, Blue: Reference allele, Yellow: Heterozygous allele, Grey: missing allele) and group-specific patterns between the Chinese group and the cabbage breeding material group (Early introduced group). Figure 8 shows the top 40 group-specific SNPs (Red: Alternative allele, Blue: Reference allele, Yellow: Heterozygous allele, Grey: missing allele) and group-specific patterns between the Chinese group and the Korean breeding group. Figure 9 shows the top 40 group-specific SNPs (Red: Alternative allele, Blue: Reference allele, Yellow: Heterozygous allele, Grey: missing allele) and group-specific patterns between the cabbage breeding material line (Early introduced) and the domestic breeding line (Korean breeding group). Specific details for implementing the invention
[0076] The present invention will be explained in more detail below through examples. However, these examples are intended to illustrate the invention and the scope of the invention is not limited to these examples.
[0078] Example 1: Development of a pipeline for identifying group-specific variants
[0079] It was confirmed that the core population established for crop genetic research and breeding consisted of various cabbage subspecies, regional traditional varieties, and lines used for breeding. Through population genetic analysis and literature review, it was confirmed that the core population of cabbage could be broadly classified into four groups (Fig. 1). Utilizing 3,834,809 SNPs identified in a population consisting of 156 cabbage lines, we aimed to develop markers capable of verifying the groups for each combination within the six combinations appearing in the four groups. An overview of the aforementioned group-specific SNP development and a schematic diagram of the variant identification pipeline are shown in Fig. 2.
[0080] Using Bcftools software, a new VCF file was constructed by extracting only the variant information of the lines corresponding to two specified groups from a VCF file containing population variant information. A schematic diagram of the process for separating the VCF file for group-specific SNP identification and identifying the dominant allele is shown in Figure 3.
[0081] Using a Perl script, minimum allele frequency, heterozygosity, and missing rate were calculated for two groups of new vcf files, and dominant allele patterns were identified. The group-specific variation statistics reflected for the identification of group-specific SNPs are shown in Table 2 below.
[0083] # Category explanation Value 1 SNP Location on chromosome / scaffold Ex) A01_1024 2 Group name The name of the group entered by the pipeline Input text 3 Major allele Number of dominant alleles within the group Number 4 Minor allele The number of alleles that are a minority within the group Number 5 MAF Minimum Allele Frequency (MAF) Number 6 Missingallele Number of alleles in the population that do not show a genotype Number 7 No. of homozygous line The number of lineages within the population that are homozygous for the corresponding SNP locus Number 8 No. of heterozygous line The number of lineages within the population that are heterozygous at the corresponding SNP location Number 9 No. of missing line The number of lineages in the population that do not show the genotype at the corresponding SNP location Number 10 No. of total line Total number of lines in the VCF file Number 11 Homozygous rate Proportion of lineages with homozygous alleles at the corresponding SNP site L % 12 Heterozygous rate Proportion of lineages with heterozygous alleles at the corresponding SNP site M % 13 Missing rate Proportion of lineages missing at the corresponding SNP location N % 14 Total proportion Total ratio 100 (L+ M + N) % 15 Dominant alternative The result of determining that the major allele is the same as the alternative allele O / X
[0084] SNPs in which the alternative allele is dominant in the target group (10% ≥ MAF, 10% ≥ heterozygosity, 10% ≥ missing rate) and the reference allele is dominant in the control group (20% ≥ MAF, 10% ≥ heterozygosity, 10% ≥ missing rate) were identified as group-specific SNPs.
[0086] Example 2: Identification of group-specific SNPs by combination
[0087] The 156 cabbage strains Brassica rapaIt is classified into lineage groups including the non-pekinensis accession, Chinese germplasm, early introduced accession, and Korean breeding accession. Examples of each lineage included in each lineage group are shown in Table 1. A total of six comparison combinations were constructed from the cabbage population, and group-specific SNPs were identified for each combination. The number of group-specific SNPs identified for each classification combination within the cabbage population is shown in Table 3.
[0089] group Target group control group Number of group-specific SNPs Group 1 Cabbage subspecies (Non-pekinensis) Chinese 2,374 Group 2 Cabbage subspecies (Non-pekinensis) Cabbage breeding material (Early introduced) 4,383 Group 3 Cabbage subspecies (Non-pekinensis) Korean breeding 9,901 Group 4 Chinese Cabbage breeding material (Early introduced) 41 Group 5 Chinese Korean breeding 1,756 Group 6 Cabbage breeding material (Early introduced) Korean breeding 40 *
[0090] For the cabbage breeding material lines and domestically bred lines corresponding to Group 6, no group-specific SNPs appeared in the established pipeline; therefore, the top 40 SNPs were identified from the SNP information aligned with the MAF of the target group and the control group. Between genetically distant cabbage subspecies (Non-pekinensis) and other groups, 2,374 to 9,901 group-specific variants were produced, and it was found that the number of identified group-specific variants increased as the cabbage breeding process progressed. Group-specific patterns in the variant data were confirmed for the top 40 SNPs of each group. The results are shown in Figures 4 to 9, and the identified SNPs are shown in SEQ ID NOs 1 to 63.
[0092] Example 3: Development of KASP markers targeting the top 40 group-specific SNPs by combination
[0093] Primer sequences were constructed using Primer 3 for the top 40 target SNPs across six groups within the core population, ensuring that the corresponding nucleotide positions were fixed at the end positions of the left primer. To maximize the potential for a normal PCR reaction across all lines comprising the cabbage core population, sequences reflecting line-specific variations were constructed using NGS data from each line, targeting a 500 bp region containing the target SNP in the center of the sequence. Subsequently, multiple sequence alignment was performed using ClustalW, and positions showing an agreement rate of less than 90% were masked with 'N' to exclude them during the primer design stage. As a result, primer sequences using Primer 3 could be constructed for a total of 63 SNPs out of approximately 240 candidate SNPs for which the masking process was completed. The KASP primer sequences developed for distinguishing groups within the cabbage population are shown in Table 4. The sequences of Table 4 below are also shown in SEQ ID NOs 64 to 252 in order from left to right and from top to bottom. Specifically, the forward (FAM) primer sequence, forward (HEX) primer sequence, and reverse sequence for SNP location SNP_A01_28209220 are shown in order in SEQ ID NOs 64 to 66; the forward (FAM) primer sequence, forward (HEX) primer sequence, and reverse sequence for SNP_A03_1440680 are shown in order in SEQ ID NOs 67 to 69; and the forward (FAM) primer sequence, forward (HEX) primer sequence, and reverse sequence for SNP_A03_822149 are shown in order in SEQ ID NOs 70 to 72. In the same manner, the remaining sequences of Table 4 are also shown in order in SEQ ID NOs 73 to 252.
[0095] group SNP location Forward (FAM) Forward (Forward; HEX) Reverse Group 1 SNP_A01_28209220 GTTCTGCTACGTCATCAGTGTCTCT GTTCTGCTACGTCATCAGTGTCTCC AACCGGCGGAGGAGTGTC SNP_A03_1440680 GACTAAAGCTTCTACGGGTATAATGC GACTAAAGCTTCTACGGGTATAATGT AGTTACTTACTTTCCCCTCTGCT SNP_A03_822149 TCTTCTTTCTCGATTAACTAGCCCC TCTTCTTTCTCGATTAACTAGCCCA CTGTATGCATTAGATCCAGCATTAT SNP_A03_5083670 ACTTGTTGGTGACTTAGTTCAAAGAC ACTTGTTGGTGACTTAGTTCAAAGAT AGGCTCGTGTCTGATGTTATCA SNP_A03_12209934 ACAAGTGTGTTATCATGTTATCAGTAG ACAAGTGTGTTATCATGTTATCAGTAA AGATGGCTTCACTCTTCTCGT SNP_A03_12214598 GATTATCCGAGTTGAAATCGATGCTT GATTATCCGAGTTGAAATCGATGCTC TGAGAATGTTATGAGCGTTAAGTTCA SNP_A04_12210838 CATTGGCCTACATGGTCTATTTCATA CATTGGCCTACATGGTCTATTTCATT ACCACACATGTAGTAAAAGGTGAC SNP_A06_1346319 AGCAAAAACGGAGGAAAGCTTCTTA AGCAAAAACGGAGGAAAGCTTCTTG GCGTAAGAGGATAGTTGAAAGCG SNP_A07_7621524 TTCAAAGGGCTTCTCTTTCCGTCTC TTCAAAGGGCTTCTCTTTCCGTCTA GAGACTAGGGTCGGAATAAGCT SNP_A07_7630465 GAGTAACAAACTAACATCACATCGAAG GAGTAACAAACTAACATCACATCGAAT TCATTCTAACTTGGTTTTTCGATAACT SNP_A08_2627388 CGCATTTCAGATGGTGGTAAAGTGAA CGCATTTCAGATGGTGGTAAAGTGAG AGTCAAATTTATGTAAAACTTCGGTCA SNP_A09_18791040 AACCCTATTGAAAAGGAAAGACTCC AACCCTATTGAAAAGGAAAGACTCT CATCAACAACAAGATAACTCAGGTCA 그룹2 SNP_A06_21097459 TGTAATAACCAAGGTTTGACCACAATT TGTAATAACCAAGGTTTGACCACAATA TTTATCCGGACAACTTCCATGT SNP_A06_21097595 AACCTGAAACGATTTACTTGGAAGTT AACCTGAAACGATTTACTTGGAAGTC GACTTTTCCTAGACGACTTACACG SNP_A06_21102003 CACTGATACAGCCGTAAATAGTTGC CACTGATACAGCCGTAAATAGTTGT GTAATGTGGTCATATCGAATCACAT SNP_A06_21102006 TGATACAGCCGTAAATAGTTGCGTG TGATACAGCCGTAAATAGTTGCGTC CTAGTAATGTGGTCATATCGAATCACA SNP_A06_21102014 CCGTAAATAGTTGCGTGAACCAAAT CCGTAAATAGTTGCGTGAACCAAAC TGGAGACTCTAGTAATGTGGTCA SNP_A06_21102017 GTAAATAGTTGCGTGAACCAAATGAG GTAAATAGTTGCGTGAACCAAATGAA TGATGGAGACTCTAGTAATGTGGT 그룹3 SNP_A03_5935616 AACTTCATTGAAAGTTGTAAGCAAG AACTTCATTGAAAGTTGTAAGCAAC AACATTGCAGGTTCCTATGACA SNP_A03_5937267 ATAACAAGACAATCTGGATAAGAAACA ATAACAAGACAATCTGGATAAGAAACG TGGAAAATCACTGCAATCATCTCG SNP_A03_11382697 CATGATAAGTGAAAAGACAAGAAAGTC CATGATAAGTGAAAAGACAAGAAAGTT TGGGTTTATCATGGGGTAGTTT SNP_A03_11352762 ACAATATCTCTAAACCAGTATGAACAG ACAATATCTCTAAACCAGTATGAACAA TGATGATGATCCAGTCCTTATGTT SNP_A03_11382508 TGCAACAACGAGAAAATCCTTCAGC TGCAACAACGAGAAAATCCTTCAGA TAGAGTTGCTCTGGTATACTACACT SNP_A04_12210838 CATTGGCCTACATGGTCTATTTCATA CATTGGCCTACATGGTCTATTTCATT ACCACACATGTAGTAAAAGGTGAC SNP_A07_7621524 TTCAAAGGGCTTCTCTTTCCGTCTC TTCAAAGGGCTTCTCTTTCCGTCTA GAGACTAGGGTCGGAATAAGCT SNP_A07_7630465 GAGTAACAAACTAACATCACATCGAAG GAGTAACAAACTAACATCACATCGAAT TCATTCTAACTTGGTTTTTCGATAACT 그룹4 SNP_A01_3301675 ATTACCGATGTGAATGGTCTCTCAC ATTACCGATGTGAATGGTCTCTCAA CAAACGTGATTAAATACATACGTCCA SNP_A02_30651212 ACATCCTCAGCTTCAATCTCTTCAT ACATCCTCAGCTTCAATCTCTTCAA TTGCTAACGTTCCACCGGC SNP_A02_30651232 TCTTCATACAACGCATAGTTAATCCAC TCTTCATACAACGCATAGTTAATCCAT AGAAGTTTACGAGAGGGCTGT SNP_A02_30651277 GTAACATTTCTCATTAGCCGGTGGA GTAACATTTCTCATTAGCCGGTGGG AGAGGAAGAGGTGGCTTCTTC SNP_A02_30651284 TTCTCATTAGCCGGTGGAACGTTAG TTCTCATTAGCCGGTGGAACGTTAC TTAGGTTAGAGGAAGAGGTGGC SNP_A03_18195518 ACACGATTACTCCTAGAGATTCCCA ACACGATTACTCCTAGAGATTCCCG CTCTCTGCACGCAAGCTGC SNP_A03_18195519 CACGATTACTCCTAGAGATTCCCAA CACGATTACTCCTAGAGATTCCCAC GCTCTCTGCACGCAAGCT SNP_A07_19139938 AAACCATGCATCAAACATAAACTAAAT AAACCATGCATCAAACATAAACTAAAG CAACGCAAGAGATTCCCCCT SNP_A07_19140181 AAGTGTGTCGGTGAAGTGGGAATAA AAGTGTGTCGGTGAAGTGGGAATAG CGGAGTCGGATAAAGGCCTA SNP_A07_19140182 AGTGTGTCGGTGAAGTGGGAATAAC AGTGTGTCGGTGAAGTGGGAATAAT TCGGAGTCGGATAAAGGCCT SNP_A07_19173020 CAAGACCTCGAATCGTAATAATCTTTC CAAGACCTCGAATCGTAATAATCTTTA TCCTTGAACACCCTGCAAGC 그룹5 SNP_A07_19156259 GCTTCTCCAAATTGACTCTTATAAGTA GCTTCTCCAAATTGACTCTTATAAGTC CACTGATTTAGAGAGGTTTTGTTCGA SNP_A08_14224373 TCATACAATGAGATTTGTTCCTAGTGC TCATACAATGAGATTTGTTCCTAGTGA CCAAGCCAATTCACATCATCATCA SNP_A08_14224831 ATGCATCTTCCAAATCGGTGAGTTA ATGCATCTTCCAAATCGGTGAGTTG AACATTAGACTCAACAACACATGT SNP_A08_14225137 GTTTGCTATGTGCCTTTGCTTACAG GTTTGCTATGTGCCTTTGCTTACAA AGAAAGAGGTGGAGACGATTCTG SNP_A08_14223077 ACTGACACCTGCAAAAATGTTGACT ACTGACACCTGCAAAAATGTTGACG AGTAAAGTTTCCATCTTTCCAACTCAC SNP_A08_14223929 AGATCCTGTCCAAGTAAGGTCGTGG AGATCCTGTCCAAGTAAGGTCGTGA TAGGAAGTAAAAGTCCCACATCGG SNP_A08_14224023 ACTTCCTAACTTATTAGCTCCTTTTAC ACTTCCTAACTTATTAGCTCCTTTTAT CCATAAGATAAAGCCACTTGTCTTT SNP_A08_14224436 AGGTTTTTCGTTGATGATGATGATGT AGGTTTTTCGTTGATGATGATGATGG TCTTCCAAGTCTCCAACTTCTCT SNP_A08_14224834 CATCTTCCAAATCGGTGAGTTATGA CATCTTCCAAATCGGTGAGTTATGT TTCAACATTAGACTCAACAACACA SNP_A08_14225035 TATGTACTCATGCCCTTTTTAGACT TATGTACTCATGCCCTTTTTAGACA TCAAACTGGGGACTAACACAA SNP_A08_14225072 CATTTACTACAGTTAAGTTCCCCAGG CATTTACTACAGTTAAGTTCCCCAGA TTTACATATCTGTAAGCAAAGGCACA SNP_A08_14225075 TACTACAGTTAAGTTCCCCAGGTTA TACTACAGTTAAGTTCCCCAGGTTC AGTCTTTACATATCTGTAAGCAAAGGC SNP_A08_14225118 GTTAGTCCCCAGTTTGATTGTTTGC GTTAGTCCCCAGTTTGATTGTTTGG TCTGACTGCGTCTCACATCA SNP_A08_14229644 GCTTAAGATTTCGGAAAAGGTAGGATC GCTTAAGATTTCGGAAAAGGTAGGATG TGTTCTGAGTTGAAAGCACATGC 그룹6 SNP_A09_2859289 GCCATTCTATTAACAACTATCGTATCG GCCATTCTATTAACAACTATCGTATCA TCCTTGTCTCGTTGTTCGTGT SNP_A09_2859730 CCAGGGCTTAATCTCGACTTTACAA CCAGGGCTTAATCTCGACTTTACAG CACTGTGACGTGGGCCAA SNP_A09_2859833 AAACAAGTCCTTCCTCGAATACGGA AAACAAGTCCTTCCTCGAATACGGC GAGTCCAAGTTGCGGATTCG SNP_A09_2866527 AAGAGTGAACATAAGAGCGGTGAAG AAGAGTGAACATAAGAGCGGTGAAA GAGATCTCTGTGAATCACTGGAGG SNP_A09_2866578 GGCTTACACTATCTACATACACATGAC GGCTTACACTATCTACATACACATGAT ACCAATCTTGACTTCTCCTTGGT SNP_A09_5862593 GATGGAGGGGTAACGTTGTCAATA GATGAAGGGGTAACGTTGTCAATG GACCAAACTCAAACAAGGCTT SNP_A09_5862617 AGACTCTGCTGATGTTTTGAATAGC AGACTCTGCTGATGTTTTGAATAGT CGACATCGAAACTCGTTTTTGT SNP_A09_5870163 TAAATGAACGGGGAAGAACTTGAAA TAAATGAACGGGGAAGAACTTGAAT TGCTCGATTGAAAAGGGACCT SNP_A09_2852967 CTTCTGTCTTTAAGTTAATATGACCGTT CTCTGTCTTTAAGTTAATATGACCGTG TAATCATACGTAACCAATCCTCTTAGT SNP_A09_2860541 TGATTTTTGAATTTTCTTGGCACACG TGATTTTTGAATTTTCTTGGCACACT TTTTGTCAGCGTTTAATCTGAATAACT SNP_A09_2863077 GATCGACCGAATTAACGTGAAATC GATCGACCGAATTAACGTGAAATT CAACAAAAGGAAATGAAATCACAAGA SNP_A09_37236608 AACACGGATTATTCTTGATTACGTAA AACACGGATTATTCTTGATTACGTAC GTGGCATATATTATAACCACACACT
[0096] From the aforementioned results, it was confirmed that the SNP marker of the present invention and the agent capable of detecting it can distinguish lineage groups of cabbage.
[0098] From the foregoing description, those skilled in the art to which the present invention pertains will understand that the present invention may be implemented in other specific forms without altering its technical concept or essential features. In this regard, the embodiments described above should be understood as illustrative in all respects and not restrictive. The scope of the present invention should be interpreted as including all modifications or variations derived from the meaning and scope of the claims set forth below and their equivalents, rather than from the detailed description above.
Claims
Claim 1 An SNP marker composition comprising an SNP marker for testing cabbage lineage groups, wherein the SNP marker is one or more selected from polynucleotides composed of 5 to 501 consecutive nucleotides, in which the 251st nucleotide in any one or more selected from SEQ ID NOs 1 to 63 is included as a single nucleotide polymorphism (SNP) site, or a polynucleotide complementary thereto. Claim 2 In claim 1, the SNP marker for testing the cabbage lineage comprises, among one or more polynucleotides selected from SEQ ID NOs 1 to 63, the polynucleotide described as SEQ ID NOs 5, 18, 22, 41, 43, 48, 52, and 55, a 251st base that is G or A; the polynucleotide described as SEQ ID NOs 8, 11, 20, 30, 32, 35, 40, 53, and 57, a 251st base that is A or G; and the polynucleotide described as SEQ ID NOs 2, 4, 12, 15, 21, 29, 36, 44, 56, 58, and 62, a 251st base that is C or T; Polynucleotides described by SEQ NOs 1, 6, 14, and 17, comprising a 251st base that is T or C; polynucleotides described by SEQ NOs 16, 19, and 31, comprising a 251st base that is G or C; polynucleotides described by SEQ NOs 50 and 51, comprising a 251st base that is C or G; polynucleotides described by SEQ NOs 10, 26, and 61, comprising a 251st base that is G or T; polynucleotides described by SEQ NOs 34, 42, 45, and 60, comprising a 251st base that is T or G; polynucleotides described by SEQ NOs 3, 9, 23, 25, 27, 37, and 39, comprising a 251st base that is C or A; An SNP marker composition comprising one or more selected from polynucleotides consisting of 5 to 501 consecutive bases, wherein the polynucleotides described in SEQ ID NOs 33, 38, 49, 54, and 63 include a 251st base that is A or C; the polynucleotides described in SEQ ID NOs 7, 24, 46, and 59 include a 251st base that is A or T; and the polynucleotides described in SEQ ID NOs 13, 28, and 47 include a 251st base that is T or A. Claim 3 A composition for testing cabbage lineages comprising a preparation capable of detecting the SNP marker for testing cabbage lineages according to claim 1 or 2. Claim 4 A composition for testing cabbage lineages according to paragraph 3, wherein the above preparation comprises a probe, a primer, or a preparation capable of amplifying the SNP marker. Claim 5 A composition for testing cabbage lineages according to claim 4, wherein the primer is for KASP (competitive allele specific PCR). Claim 6 A composition for testing a cabbage lineage according to claim 5, wherein the primer for KASP comprises one or more selected from the primer sets for KASP of a1) to k3) below: a1) a primer set consisting of the nucleotide sequences of SEQ ID NOs 64 and 66; and a primer set consisting of the nucleotide sequences of SEQ ID NOs 65 and 66; b1) a primer set consisting of the nucleotide sequences of SEQ ID NOs 67 and 69; and a primer set consisting of the nucleotide sequences of SEQ ID NOs 68 and 69; c1) a primer set consisting of the nucleotide sequences of SEQ ID NOs 70 and 72; and a primer set consisting of the nucleotide sequences of SEQ ID NOs 71 and 72; d1) a primer set consisting of the nucleotide sequences of SEQ ID NOs 73 and 75; and a primer set consisting of the nucleotide sequences of SEQ ID NOs 74 and 75; e1) a primer set consisting of the nucleotide sequences of SEQ ID NOs 76 and 78; and a primer set consisting of the nucleotide sequences of SEQ ID NOs 77 and 78; f1) a primer set consisting of the nucleotide sequences of SEQ NOs 79 and 81; and a primer set consisting of the nucleotide sequences of SEQ NOs 80 and 81; g1) a primer set consisting of the nucleotide sequences of SEQ NOs 82 and 84; and a primer set consisting of the nucleotide sequences of SEQ NOs 83 and 84; h1) a primer set consisting of the nucleotide sequences of SEQ NOs 85 and 87; and a primer set consisting of the nucleotide sequences of SEQ NOs 86 and 87; i1) a primer set consisting of the nucleotide sequences of SEQ NOs 88 and 90; and a primer set consisting of the nucleotide sequences of SEQ NOs 89 and 90; j1) a primer set consisting of the nucleotide sequences of SEQ NOs 91 and 93; and a primer set consisting of the nucleotide sequences of SEQ NOs 92 and 93; k1) a primer set consisting of the nucleotide sequences of SEQ NOs 94 and 96; and a primer set consisting of the nucleotide sequences of SEQ NOs 95 and 96; l1) A primer set consisting of the nucleotide sequences of SEQ ID NOs 97 and 99;and a primer set consisting of the nucleotide sequences of SEQ NOs 98 and 99; m1) a primer set consisting of the nucleotide sequences of SEQ NOs 100 and 102; and a primer set consisting of the nucleotide sequences of SEQ NOs 101 and 102; n1) a primer set consisting of the nucleotide sequences of SEQ NOs 103 and 105; and a primer set consisting of the nucleotide sequences of SEQ NOs 104 and 105; o1) a primer set consisting of the nucleotide sequences of SEQ NOs 106 and 108; and a primer set consisting of the nucleotide sequences of SEQ NOs 107 and 108; p1) a primer set consisting of the nucleotide sequences of SEQ NOs 109 and 111; and a primer set consisting of the nucleotide sequences of SEQ NOs 110 and 111; q1) a primer set consisting of the nucleotide sequences of SEQ NOs 112 and 114; and a primer set consisting of the nucleotide sequences of SEQ NOs 113 and 114; r1) a primer set consisting of the nucleotide sequences of SEQ NOs 115 and 117; and a primer set consisting of the nucleotide sequences of SEQ NOs 116 and 117; s1) a primer set consisting of the nucleotide sequences of SEQ NOs 118 and 120; and a primer set consisting of the nucleotide sequences of SEQ NOs 119 and 120; t1) a primer set consisting of the nucleotide sequences of SEQ NOs 121 and 123; and a primer set consisting of the nucleotide sequences of SEQ NOs 122 and 123; u1) a primer set consisting of the nucleotide sequences of SEQ NOs 124 and 126; and a primer set consisting of the nucleotide sequences of SEQ NOs 125 and 126; v1) a primer set consisting of the nucleotide sequences of SEQ NOs 127 and 129; and a primer set consisting of the nucleotide sequences of SEQ NOs 128 and 129; w1) a primer set consisting of the nucleotide sequences of SEQ NOs 130 and 132; and a primer set consisting of the nucleotide sequences of SEQ ID NOs 131 and 132; x1) a primer set consisting of the nucleotide sequences of SEQ ID NOs 133 and 135; and a primer set consisting of the nucleotide sequences of SEQ ID NOs 134 and 135;y1) a primer set consisting of the nucleotide sequences of SEQ NOs 136 and 138; and a primer set consisting of the nucleotide sequences of SEQ NOs 137 and 138; z1) a primer set consisting of the nucleotide sequences of SEQ NOs 139 and 141; and a primer set consisting of the nucleotide sequences of SEQ NOs 140 and 141; a2) a primer set consisting of the nucleotide sequences of SEQ NOs 142 and 144; and a primer set consisting of the nucleotide sequences of SEQ NOs 143 and 144; b2) a primer set consisting of the nucleotide sequences of SEQ NOs 145 and 147; and a primer set consisting of the nucleotide sequences of SEQ NOs 146 and 147; c2) a primer set consisting of the nucleotide sequences of SEQ NOs 148 and 150; and a primer set consisting of the nucleotide sequences of SEQ NOs 149 and 150; d2) a primer set consisting of the nucleotide sequences of SEQ NOs 151 and 153; e2) a primer set consisting of the nucleotide sequences of SEQ NOs 152 and 153; e2) a primer set consisting of the nucleotide sequences of SEQ NOs 154 and 156; and a primer set consisting of the nucleotide sequences of SEQ NOs 155 and 156; f2) a primer set consisting of the nucleotide sequences of SEQ NOs 157 and 159; and a primer set consisting of the nucleotide sequences of SEQ NOs 158 and 159; g2) a primer set consisting of the nucleotide sequences of SEQ NOs 160 and 162; and a primer set consisting of the nucleotide sequences of SEQ NOs 161 and 162; h2) a primer set consisting of the nucleotide sequences of SEQ NOs 163 and 165; and a primer set consisting of the nucleotide sequences of SEQ NOs 164 and 165; i2) a primer set consisting of the nucleotide sequences of SEQ NOs 166 and 168; and a primer set consisting of the nucleotide sequences of SEQ NOs 167 and 168; j2) a primer set consisting of the nucleotide sequences of SEQ ID NOs 169 and 171; and a primer set consisting of the nucleotide sequences of SEQ ID NOs 170 and 171; k2) a primer set consisting of the nucleotide sequences of SEQ ID NOs 172 and 174;l2) a primer set consisting of the nucleotide sequences of SEQ ID NOs 173 and 174; l2) a primer set consisting of the nucleotide sequences of SEQ ID NOs 175 and 177; and a primer set consisting of the nucleotide sequences of SEQ ID NOs 176 and 177; m2) a primer set consisting of the nucleotide sequences of SEQ ID NOs 178 and 180; and a primer set consisting of the nucleotide sequences of SEQ ID NOs 179 and 180; n2) a primer set consisting of the nucleotide sequences of SEQ ID NOs 181 and 183; and a primer set consisting of the nucleotide sequences of SEQ ID NOs 182 and 183; o2) a primer set consisting of the nucleotide sequences of SEQ ID NOs 184 and 186; and a primer set consisting of the nucleotide sequences of SEQ ID NOs 185 and 186; p2) a primer set consisting of the nucleotide sequences of SEQ ID NOs 187 and 189; and a primer set consisting of the nucleotide sequences of SEQ ID NOs 188 and 189; q2) a primer set consisting of the nucleotide sequences of SEQ NOs 190 and 192; and a primer set consisting of the nucleotide sequences of SEQ NOs 191 and 192; r2) a primer set consisting of the nucleotide sequences of SEQ NOs 193 and 195; and a primer set consisting of the nucleotide sequences of SEQ NOs 194 and 195; s2) a primer set consisting of the nucleotide sequences of SEQ NOs 196 and 198; and a primer set consisting of the nucleotide sequences of SEQ NOs 197 and 198; t2) a primer set consisting of the nucleotide sequences of SEQ NOs 199 and 201; and a primer set consisting of the nucleotide sequences of SEQ NOs 200 and 201; u2) a primer set consisting of the nucleotide sequences of SEQ NOs 202 and 204; and a primer set consisting of the nucleotide sequences of SEQ NOs 203 and 204; v2) a primer set consisting of the nucleotide sequences of SEQ NOs 205 and 207; and a primer set consisting of the nucleotide sequences of SEQ ID NOs 206 and 207; w2) a primer set consisting of the nucleotide sequences of SEQ ID NOs 208 and 210; and a primer set consisting of the nucleotide sequences of SEQ ID NOs 209 and 210;x2) a primer set consisting of the nucleotide sequences of SEQ ID NOs 211 and 213; and a primer set consisting of the nucleotide sequences of SEQ ID NOs 212 and 213; y2) a primer set consisting of the nucleotide sequences of SEQ ID NOs 214 and 216; and a primer set consisting of the nucleotide sequences of SEQ ID NOs 215 and 216; z2) a primer set consisting of the nucleotide sequences of SEQ ID NOs 217 and 219; and a primer set consisting of the nucleotide sequences of SEQ ID NOs 218 and 219; a3) a primer set consisting of the nucleotide sequences of SEQ ID NOs 220 and 222; and a primer set consisting of the nucleotide sequences of SEQ ID NOs 221 and 222; b3) a primer set consisting of the nucleotide sequences of SEQ ID NOs 223 and 225; and a primer set consisting of the nucleotide sequences of SEQ ID NOs 224 and 225; c3) a primer set consisting of the nucleotide sequences of SEQ ID NOs 226 and 228; and a primer set consisting of the nucleotide sequences of SEQ NOs 227 and 228; d3) a primer set consisting of the nucleotide sequences of SEQ NOs 229 and 231; and a primer set consisting of the nucleotide sequences of SEQ NOs 230 and 231; e3) a primer set consisting of the nucleotide sequences of SEQ NOs 232 and 234; and a primer set consisting of the nucleotide sequences of SEQ NOs 233 and 234; f3) a primer set consisting of the nucleotide sequences of SEQ NOs 235 and 237; and a primer set consisting of the nucleotide sequences of SEQ NOs 236 and 237; g3) a primer set consisting of the nucleotide sequences of SEQ NOs 238 and 240; and a primer set consisting of the nucleotide sequences of SEQ NOs 239 and 240; h3) a primer set consisting of the nucleotide sequences of SEQ NOs 241 and 243; and a primer set consisting of the nucleotide sequences of SEQ NOs 242 and 243; i3) a primer set consisting of the nucleotide sequences of SEQ ID NOs 244 and 246; and a primer set consisting of the nucleotide sequences of SEQ ID NOs 245 and 246; j3) a primer set consisting of the nucleotide sequences of SEQ ID NOs 247 and 249;and a primer set consisting of the nucleotide sequences of SEQ ID NOs 248 and 249; k3) a primer set consisting of the nucleotide sequences of SEQ ID NOs 250 and 252; and a primer set consisting of the nucleotide sequences of SEQ ID NOs 251 and 252.; Claim 7 A kit for testing cabbage lineages comprising the composition of paragraph 3. Claim 8 A method for testing a cabbage lineage, comprising: (a) a step of isolating genomic DNA from cabbage; and (b) a step of using the genomic DNA of step (a) as a template and detecting SNP markers using a preparation for detecting SNP markers of claim 1. Claim 9 In claim 8, the method wherein the above formulation is a primer for KASP. Claim 10 A method for testing cabbage lineages, comprising: (a) a step of amplifying or hybridizing a polymorphic site of the SNP marker of claim 1 from the DNA of a separated sample with a probe; and (b) a step of determining the base of the amplified or hybridized polymorphic site of step (a).
Citation Information
Patent Citations
Single nucleotide polymorphism marker set for F1 hybrid purity checking in Cabbage and uses thereof
KR101690067B1
Single nucleotide polymorphism probe for high-throughput genotype analysis of Brassica rapa and use thereof
KR1020170048882A
Novel marker based on Single Nucleotide Polymorphism for identification of line of Brassica rapa ssp. pekinensis
KR1020220050296A
Kompetitive Allele Specific PCR (KASP) marker set for seed purity check of Chinese cabbage(Brassica rapa spp. pekinensis) and methods for efficient marker development
KR1020230095709A