Pharmaceutical Composition for Preventing or Treating Cardiovascular Diseases containing Sodium-Glucose Cotransporter-2 Inhibitor and Angiotensin Ⅱ Receptor Blocker

Abstract

The present invention relates to a pharmaceutical composition for the prevention or treatment of cardiovascular disease containing a sodium glucose transporter-2 inhibitor and an angiotensin II receptor blocker, which has no drug interaction issues and exhibits a synergistic effect in the prevention or treatment of cardiovascular disease, and can be effectively applied to patients with cardiovascular disease, particularly patients with heart failure.

Description

Technology Field

[0001] The present invention relates to a pharmaceutical composition for the prevention or treatment of cardiovascular disease containing a sodium glucose transporter-2 inhibitor and an angiotensin II receptor blocker. Background Technology

[0002] Hypertensive vascular disease is one of the major causes of death and is a multifactorial disease resulting from the complex interaction of various risks, such as smoking and obesity, as well as various chronic diseases. In particular, the prevalence of hypertension accompanied by diabetes in Korea has been reported to be approximately 26% (Korean Society of Hypertension, 2020 Hypertension Fact Sheet), and the number of patients with hypertension accompanied by diabetes is continuously increasing. It is known that the incidence of hypertension is about twice as high in diabetic patients compared to non-diabetics, and that hypertension can develop or worsen due to microvascular and macrovascular complications caused by diabetes. Furthermore, it is known that individuals with hypertension are at a high risk of developing diabetes, and diabetic patients have been reported to have a cardiovascular disease mortality rate 2 to 4 times higher than non-diabetics.

[0003] Therefore, hypertensive patients with diabetes are prone to exhibiting different pathophysiological mechanisms or drug treatment responses compared to hypertensive patients without diabetes, and conventional drug treatments may fail to control blood pressure or yield poor results. Furthermore, since hypertensive patients with diabetes must take multiple medications, they often fail to achieve targeted therapeutic effects due to poor administration convenience and low drug adherence. Accordingly, there is a need to develop combination therapies and combination agents suitable for the treatment of hypertensive patients with diabetes.

[0004] Sodium-glucose cotransporter-2 (SGLT-2) inhibitors are used in the treatment of cardiovascular diseases such as type 2 diabetes and heart failure because they inhibit the reabsorption of glucose in the blood, thereby lowering blood glucose levels and suppressing the secretion of inflammatory cytokines. Known SGLT-2 inhibitors developed to date include dapagliflozin, empagliflozin, ipragliflozin, canagliflozin, luseogliflozin, and tofogliflozin.

[0005] Unlike angiotensin-converting enzyme inhibitors, angiotensin II receptor blockers (ARBs) primarily affect smooth muscle and the adrenal glands. They are used as antihypertensive agents because they lower blood pressure by selectively interfering with the binding of angiotensin II to AT1R (angiotensin II receptor type 1). ARBs developed to date include valsartan, candesartan, irbesartan, telmisartan, eprosartan, and olmesartan.

[0006] Meanwhile, cardiovascular disease is multifactorial. Under specific circumstances, drugs with various mechanisms of action are combined. However, when considering any combination of drugs with different modes of action, beneficial effects are not necessarily induced in combination. Therefore, combination therapies that cause fewer harmful side effects are required.

[0007] Accordingly, the inventors conducted research to develop a combination therapy that can be effectively applied to the treatment of cardiovascular diseases such as heart failure, and completed the present invention. Prior art literature

[0008] Republic of Korea Patent Registration No. 10-0984939 The problem to be solved

[0009] One object of the present invention is to provide a pharmaceutical composition for the prevention or treatment of cardiovascular disease comprising, as a first pharmacological component, an angiotensin II receptor blocker or a pharmaceutically acceptable salt thereof; and as a second pharmacological component, a sodium-glucose cotransporter-2 (SGLT-2) inhibitor or a pharmaceutically acceptable salt thereof. means of solving the problem

[0010] One aspect of the present invention provides a pharmaceutical composition for the prevention or treatment of cardiovascular disease comprising, as a first pharmacological component, an angiotensin II receptor blocker or a pharmaceutically acceptable salt thereof; and as a second pharmacological component, a sodium-glucose cotransporter-2 (SGLT-2) inhibitor or a pharmaceutically acceptable salt thereof.

[0011] In the present invention, a combination of sodium-glucose cotransporter-2 (SGLT-2) and an angiotensin II receptor blocker (ARB), which were conventionally taken separately, showed a synergistic effect in the treatment of heart failure. By performing a compatibility test between the drugs and deriving the optimal combination of SGLT-2 and ARB, it was confirmed that a pharmaceutical composition according to one embodiment of the present invention can be effectively applied to the prevention or treatment of cardiovascular diseases such as hypertension, hypertension accompanied by diabetes, and heart failure.

[0012] The SGLT-2 inhibitor included in the pharmaceutical composition of the present invention may be any one substance selected from the group consisting of dapagliflozin, empagliflozin, ipragliflozin, canagliflozin, luseogliflozin, and tofogliflozin, but it is preferable that it be dapagliflozin or empagliflozin in terms of compatibility and synergistic effect.

[0013] The dosage of a pharmaceutical composition according to one embodiment of the present invention may be, for example, within the range of about 0.001 mg / kg to about 100 mg / kg, about 0.01 mg / kg to about 10 mg / kg, or about 0.1 mg / kg to about 1 mg / kg based on an adult, and may be administered once a day, multiple times a day, once a week, once every two weeks, once every three weeks, or once every four weeks to once a year, and may be divided into one or several doses per day at regular intervals according to the judgment of a doctor or pharmacist.

[0014] The pharmaceutical composition of the present invention may be prepared by mixing an angiotensin II receptor blocker as a first pharmacological component and an SGLT-2 inhibitor as a second pharmacological component, and the mixing may be performed simultaneously or sequentially and may be performed using methods known in the art.

[0015] The pharmaceutical composition of the present invention may, for example, be a double tablet comprising an angiotensin II receptor blocker as a first pharmacological component and an SGLT-2 inhibitor as a second pharmacological component, or may be an inner core tablet structure comprising telmisartan as a first pharmacological component and an SGLT-2 inhibitor as a second pharmacological component and an outer layer surrounding an inner core layer, but is not limited thereto.

[0016] The composition of the present invention may include a pharmaceutically acceptable carrier. The pharmaceutically acceptable carrier included in the composition of the present invention is one commonly used in the manufacture of pharmaceuticals and includes, but is not limited to, lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia gum, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methyl cellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, and mineral oil. In addition to the above components, the pharmaceutical composition of the present invention may further include lubricants, humectants, sweeteners, flavorings, emulsifiers, suspending agents, preservatives, etc. Suitable pharmaceutically acceptable carriers and formulations are described in detail in Remington: the science and practice of pharmacy 22nd edition (2013).

[0017] A pharmaceutical composition according to one embodiment of the present invention may be administered together with one or more substances exhibiting pharmacological activity against type 2 diabetes, hypertension, hypertension accompanied by diabetes, and / or heart failure.

[0018] In addition, a pharmaceutical composition according to one embodiment of the present invention may be used alone or in combination with methods using surgery, hormone therapy, drug therapy and / or biological response modulators for the prevention or treatment of hypertension, hypertension accompanied by diabetes, and / or heart failure.

[0019] The composition of the present invention may include various bases and / or additives that are necessary and appropriate for the formulation of the formulation, and may be prepared by further including known compounds such as nonionic surfactants, silicone polymers, extender pigments, fragrances, preservatives, fungicides, oxidation stabilizers, organic solvents, ionic or nonionic thickeners, emollients, antioxidants, free radical destroyers, opacifiers, stabilizers, emollients, silicones, α-hydroxy acids, defoaming agents, moisturizers, vitamins, insect repellents, fragrances, preservatives, surfactants, anti-inflammatory agents, substance P antagonists, fillers, polymers, propellants, basicizing or acidifying agents, or coloring agents, to the extent that the effect is not reduced.

[0020] Suitable dosages of the composition of the present invention may be prescribed in various ways depending on factors such as the formulation method, mode of administration, age, body weight, sex, pathological condition, food, time of administration, route of administration, excretion rate, and response sensitivity. The dosage of the composition of the present invention may be 0.001 to 1000 mg / kg based on an adult.

[0021] The composition of the present invention can be administered orally.

[0022] The composition of the present invention may be administered in various formulations when administered orally, such as tablets, pills, hard / soft capsules, liquids, suspensions, emulsifiers, syrups, granules, elixirs, troches, etc., and may further include various excipients, such as humectants, sweeteners, flavorings, preservatives, etc. Specifically, when the composition of the present invention is formulated into an oral administration formulation, it may further include suitable carriers, excipients, and diluents commonly used in its manufacture. The above carrier, excipient, and diluent may include, but are not limited to, lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, and / or mineral oil. Additionally, it may be prepared by including diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrants, and surfactants that are commonly used in formulations, and may further include a lubricant such as magnesium stearate or talc in addition to the above excipients.

[0023] According to one embodiment of the present invention, the sodium-glucose cotransporter-2 (SGLT-2) inhibitor may be dapagliflozin or empagliflozin.

[0024] As used herein, the term "Dapagliflozin" refers to (1S)-1,5-anhydro-1-C-{4-chloro-3-[(4-ethoxyphenyl)methyl]phenyl}-D-glucitol, and "Empagliflozin" refers to It refers to (1S)-1,5-Anhydro-1-C-[4-chloro-3-[[4-[[(3S)-tetrahydro-3-furanyl]oxy]phenyl]methyl]phenyl]-D-glucitol.

[0025] According to one embodiment of the present invention, the angiotensin II receptor blocker may be telmisartan.

[0026] The term “Telmisartan” as used in this specification refers to 4′-[(1,4′-Dimethyl-2′-propyl[2,6′-bi-1H-benzimidazol]-1′-yl)methyl][1,1′-biphenyl]-2-carboxylic acid.

[0027] In the present invention, it was confirmed that telmisartan has superior angiotensin-converting enzyme inhibitory activity compared to olmesartan, and among ARBs, telmisartan has superior compatibility with SGLT-2 inhibitors, particularly dapagliflozin and empagliflozin, and formulation stability compared to olmesartan and valsartan.

[0028] The above-mentioned dapagliflozin, empagliflozin, or telmisartan may be referred to to include both their active metabolites and prodrugs. The "metabolite" refers to each active derivative that may be produced when dapagliflozin, empagliflozin, or telmisartan is metabolized, and the "prodrug" refers to a compound that is metabolized into dapagliflozin, empagliflozin, or telmisartan, or metabolized into the same metabolite(s) as dapagliflozin, empagliflozin, or telmisartan. Additionally, dapagliflozin, empagliflozin, or telmisartan may include all of their pharmaceutically acceptable salts, crystalline forms, hydrates, solvates, diastereomers, or enantiomers.

[0029] For example, the term "Dapagliflozin propanediol hydrate" used in the present invention is used with the same meaning as "Dapagliflozin propanediol hydrate."

[0030] According to one embodiment of the present invention, the first pharmacological component may be 40 mg to 80 mg, and the second pharmacological component may be 10 mg.

[0031] If the first pharmacological component is included in an amount of less than 40 mg, and / or the second pharmacological component is included in an amount of less than 10 mg, appropriate therapeutic effects for diabetes and hypertension cannot be expected due to low blood drug concentrations and the resulting low pharmacological effects. On the other hand, if the first pharmacological component is included in an amount of more than 80 mg, and / or the second pharmacological component is included in an amount of more than 10 mg, problems such as high blood drug concentrations, resulting side effects and toxicity, and the induction of hypoglycemia and hypotension due to excessive therapeutic effects may occur, and appropriate therapeutic effects cannot be expected. In one embodiment, the tablet may include the first pharmacological component and the second pharmacological component in amounts of 40 mg and 10 mg, or 80 mg and 10 mg, respectively.

[0032] Meanwhile, 12.3 mg of dapagliflozin propanediol hydrate corresponds to 10 mg of the pharmacological component dapagliflozin.

[0033] According to one embodiment of the present invention, the cardiovascular disease may be hypertension, hypertension accompanied by diabetes, or heart failure.

[0034] Another aspect of the present invention provides a method for preventing or treating hypertension, hypertension accompanied by diabetes, or heart failure, comprising the step of administering the pharmaceutical composition to a subject.

[0035] The angiotensin II receptor blocker or a pharmaceutically acceptable salt thereof and the SGLT-2 inhibitor or a pharmaceutically acceptable salt thereof included in the pharmaceutical composition of the present invention may be administered orally as intended, in an amount effective for the treatment or prevention of an individual or patient. It should be understood that the dosage for a specific individual or patient should be determined based on various relevant factors such as the patient's body weight, age, race, gender, health status, diet, time of administration, method of administration, and severity of the disease, and may be appropriately adjusted by a professional. For example, a physician may start the dosage of the pharmaceutical composition of the present invention at a level lower than that required to achieve the desired therapeutic effect and gradually increase the dosage until the desired effect is achieved, and may easily determine and prescribe the dosage as necessary. Effects of the invention

[0036] According to a pharmaceutical composition for the prevention or treatment of cardiovascular disease containing a sodium glucose transporter-2 inhibitor and an angiotensin II receptor blocker, there are no problems with drug interactions and it exhibits a synergistic effect in the prevention or treatment of cardiovascular disease, so it can be effectively applied to patients with cardiovascular disease, especially patients with heart failure. Brief explanation of the drawing

[0037] Figure 1 is a graph showing the results of measuring cell viability after 24 hours (A) and 48 hours (B) after treating A549 cells with telmisartan or olmesartan. Figure 2 is a graph showing the results of measuring cell viability after 24 hours (A) and 48 hours (B) of treating MDCK cells with telmisartan or olmesartan. Figure 3 is a graph showing the results of evaluating the inhibitory activity of angiotensin converting enzyme (ACE) after treating LPS (Lipopolysaccharide)-induced cardiac muscle cell line H9c2 with telmisartan or olmesartan. Figure 4 is a graph showing the results of evaluating the ACE mRNA expression inhibitory activity after treating LPS-induced inflammation-cardiac muscle cell line H9c2 with telmisartan or olmesartan. Figure 5 shows the results of evaluating the ACE mRNA expression inhibitory activity after treating LPS-induced inflammation-cardiac muscle cell line H9c2 with various sodium glucose transporter-2 inhibitors and / or angiotensin II receptor blockers. Figure 6 is a graph showing the results of evaluating the ACE mRNA expression inhibitory activity after treating LPS-induced inflammation-cardiac muscle cell line H9c2 with various sodium glucose transporter-2 inhibitors and / or angiotensin II receptor blockers. Figure 7 is a graph showing the results of evaluating the ACE protein expression inhibitory activity after treating LPS-induced inflammation-cardiac muscle cell line H9c2 with various sodium glucose transporter-2 inhibitors and / or angiotensin II receptor blockers. Figure 8 shows the results of evaluating the body weight and heart weight reduction effects of the dapagliflozin and telmisartan combination 1 / 8 mg / kg / day (low-dose group, G2), 3 / 24 mg / kg / day (medium-dose group, G3), and 9 / 72 mg / kg / day (high-dose group, G4), as well as the monotherapy groups of dapagliflozin 9 mg / kg / day (G5) and telmisartan 72 mg / kg / day (G6) and the control group (0.5% MC aqueous solution, G1) in male rats (A) and female rats (B). Specific details for implementing the invention

[0038] The present invention will be explained in more detail below through one or more embodiments. However, these embodiments are intended to illustrate the invention and the scope of the invention is not limited to these embodiments.

[0040] Experimental Example 1. Selection of angiotensin II receptor blockers for use in combination drugs for the treatment of heart failure

[0041] 1-1. Evaluation of Cell Viability

[0042] Cell viability was evaluated to select an angiotensin II receptor blocker (ARB) for use in a combination of an angiotensin II receptor blocker and a sodium-glucose cotransporter-2 (SGLT-2) inhibitor for the treatment of heart failure.

[0043] Specifically, A549 cells were obtained from the Korean Cell Line Bank (KCLB) and subcultured in RPMI-1640 medium supplemented with 10% FBS (fetal bovine serum) and 1% penicillin, while MDCK cells were obtained from ATCC and subcultured in DMEM medium supplemented with 10% FBS. A549 and MDCK cells cultured in an incubator at 37°C and 5% CO2 were each divided into 2×10⁶ cells. 4After dispensing 200 µL of cell / well into 96-well plates, 100 µL of medium was added to the control group, while the experimental groups were treated with telmisartan or olmesartan at concentrations of 1.25, 25, 50, and 100 µM, respectively. After 24 and 48 hours, 50 µL of 2 mg / ml MTT reagent was added to every well and incubated in an incubator for 3 hours. Subsequently, 500 µL of DMSO was added to each well, the plates were wrapped in foil and stirred at room temperature for 30 minutes, and cell viability was obtained by measuring absorbance at 570 nm.

[0044] As a result, it was confirmed that both telmisartan and olmesartan had no effect on cell viability up to a concentration of 25 μM (Figs. 1 and 2).

[0046] 1-2. Evaluation of Angiotensin-Converting Enzyme Inhibitory Activity

[0047] To confirm the therapeutic effect of angiotensin II receptor blockers (ARBs) on heart failure, angiotensin converting enzyme (ACE) inhibitory activity was evaluated.

[0048] Specifically, human heart cell line H9c2 cells were obtained from the Korean Cell Line Bank (KCLB 40071, Korea) and prepared by culturing them in DMEM medium supplemented with 10% FBS and 1% antibiotic-antimycotic (10 units / ml penicillin, 100 µg / ml streptomycin, 0.25 µg / ml amphotericin) under conditions of 37℃ and 5% CO2.

[0049] To determine the effect on ACE activity, optimized conditions for confirming ACE expression were established by inducing inflammation in prepared H9c2 cells through treatment with 2.5 μg / ml of LPS (Lipopolysaccharide), which is 2.5 times the amount used in conventional inflammation-related experiments. LPS-induced H9c2 cells were treated with telmisartan or olmesartan at concentrations of 10, 25, and 50 μm, respectively, and the cells were harvested to proceed with the ELISA assay. Proteins were extracted by adding 1 ml of RIPA buffer to the harvested cells and stirring at 4°C for 30 minutes. Subsequently, the cells were centrifuged at 10,000 rpm at 4°C for 20 minutes, and the supernatant was transferred to a sterile tube, stored at -80°C, and used for the ELISA assay.

[0050] To perform the ELISA assay, 0.1 mL of Human ACE standard solutions at concentrations of 10,000 pg / mL, 5,000 pg / mL, 2,500 pg / mL, 1,250 pg / mL, 625 pg / mL, 312 pg / mL, and 156 pg / mL, along with standard dilution buffer, were added to each well of an antibody-coated 96-well plate. Subsequently, 0.1 mL of ACE protein extracted from H9c2 cells was added to each well, the plate was sealed with a cover, and incubated at 37°C for 90 minutes. In this experiment, 20 µg of ACE protein was added to the 0.1 mL of the solution, followed by the addition of 0.08 mL of sample dilution buffer, to achieve a final dilution ratio of 1:5. After incubation, the cover was removed and the contents of the plate were cleared. Residue was then removed using a paper towel or other absorbent material, ensuring that the wells did not dry completely. After washing, 0.1 mL of the Biotinylated Anti-Human ACE antibody solution included in the Human ACE ELISA kit was added to each well, and the plate was incubated at 37°C for 60 minutes. After incubation, the plate was washed three times with 0.01 M PBS, and any remaining PBS solution was removed using a paper towel or other absorbent material. After washing, 0.1 mL of the ABC solution included in the Human ACE ELISA kit was added to each well and incubated at 37°C for 30 minutes, after which the plate was washed five additional times with 0.01 M PBS. After that, 90 µl of the prepared TMB solution was added to each well and incubated in a dark room at 37°C for 20 to 25 minutes. Then, 0.1 ml of the prepared TMB stop solution was added to each well to stop the ACE ELISA reaction, the OD absorbance at 450 nm was read using a microplate reader within 30 minutes, and the relative OD450 was derived using the following formula.

[0052] The relative OD450 = (the OD450 of each well) - (the OD450 of Zero well)

[0054] As a result, it was confirmed that the ACE expression inhibitory effect of telmisartan was superior to that of olmesartan at all treatment concentrations, and the ACE expression inhibitory effect was found to be best in the telmisartan 25μM treatment group (Fig. 3).

[0056] 1-3. Evaluation of Angiotensin-Converting Enzyme Gene Expression

[0057] To confirm the therapeutic effect of angiotensin II receptor blockers (ARBs) on heart failure, we checked whether the mRNA expression of angiotensin converting enzyme (ACE) was inhibited.

[0058] Specifically, in Experimental Examples 1-2, LPS inflammation-induced H9c2 cells were treated with 10 or 25 μM of telmisartan and 10 or 50 μM of olmesartan, then 200 μL of chloroform was added along with 1 mL of TRIZol (Sigma, USA), and the mixture was gently mixed and separated for 10 minutes, followed by centrifugation at 4°C and 10,000 rpm for 10 minutes. After centrifugation, only the supernatant from the tube was taken and transferred to a new sterile tube, and 500 μL of isopropanol was added to the supernatant to precipitate RNA. The precipitated RNA was centrifuged at 4°C and 10,000 rpm for 10 minutes, after which all the supernatant was removed except for the pellet inside the tube, and the RNA pellet was thoroughly washed with 500 µl of 75% ethyl alcohol. The washed pellet was centrifuged at 4°C and 10,000 rpm for 5 minutes, and all the supernatant was removed except for the pellet. The tube containing the pellet from which the supernatant had been cleanly removed was treated with DEPC (diethyl pyrocarbonate)-water and stored at -80°C for use in RT-PCR experiments.

[0059] RT-PCR was performed by synthesizing cDNA from mRNA using an RT-PCR kit containing DNA polymerase, buffer, dNTPs, and tracking dye, and then repeating the conditions in Table 2 35 times using the ACE primers in Table 1. The PCR products were electrophoresed on a 15% agarose gel and verified using a UV transilluminator; for quantitative comparison, the results were standardized to GAPDH.

[0061] Primer name Nucleic acid sequence (5'→3') Sequence number ACE(510bp) forward CAACGCCCTGCTAAGCAAC Sequence No. 1 reverse ACTGGTGACATCGAGGTTGG Sequence No. 2 GAPDH(274bp) forward CAGTCAACGGATTTGGTCGT Sequence No. 3 reverse TTGATTTTGCAGGGATCTCG Sequence No. 4

[0063] division temperature hour denaturation 94℃ 30 seconds annealing 55℃-62℃ 30 seconds elongation 72℃ 60 seconds

[0065] As a result, it was confirmed that the mRNA expression inhibitory effect of telmisartan was superior to that of olmesartan at all treatment concentrations, and that mRNA expression was mostly inhibited in the telmisartan 25μM treatment group (Fig. 4).

[0067] Through these results, it was confirmed that telmisartan is more effective than olmesartan as an angiotensin II receptor blocker for use in combination drugs of an angiotensin II receptor blocker and sodium glucose transporter-2 inhibitor for the treatment of heart failure.

[0069] Experimental Example 2. Confirmation of angiotensin-converting enzyme inhibitory activity resulting from inhibition of mRNA expression by an ARB and SGLT-2 inhibitor combination

[0070] To confirm the therapeutic effect of the combination of the angiotensin II receptor blocker (ARB) and sodium-glucose cotransporter-2 (SGLT-2) inhibitor of the present invention on heart failure, it was confirmed whether the mRNA expression of angiotensin converting enzyme (ACE) was inhibited.

[0071] Specifically, the experimental samples were prepared as shown in Table 3.

[0073] division Experimental sample ARB SGLT-2 inhibitors Example 1 Telmisartan 10μM Empagliflozin 5μM Example 2 Telmisartan 10μM Dapagliflozin 5μM Comparative Example 1 Olmesartan 10μM Empagliflozin 5μM Comparative Example 2 Olmesartan 10μM Dapagliflozin 5μM Comparative Example 3 Telmisartan 10μM Canagliflozin 5μM Comparative Example 4 Valsartan 10μM Empagliflozin 5μM Comparative Example 5 - Empagliflozin 2.5μM Comparative Example 6 - Empagliflozin 5μM Comparative Example 7 - Empagliflozin 10μM Comparative Example 8 - Empagliflozin 15μM Comparative Example 9 - Dapagliflozin 2.5μM Comparative Example 10 - Dapagliflozin 5μM Comparative Example 11 - Dapagliflozin 10μM Comparative Example 12 - Dapagliflozin 15μM Comparative Example 13 Telmisartan 10μM - Comparative Example 14 Telmisartan 15μM - Comparative Example 15 - Canagliflozin 5μM

[0075] To determine the effect of each combination or single substance on the mRNA expression of ACE, the experimental samples of Table 3 were each treated to LPS-inflammated H9c2 cells in Experimental Examples 1-2, and then the mRNA expression of ACE was evaluated in the same manner as in Experimental Examples 1-3.

[0076] As a result, in the groups administered telmisartan, empagliflozin, and dapagliflozin alone, ACE mRNA expression did not decrease to normal levels in the low-concentration groups of 2.5 μM to 10 μM, whereas in the high-concentration group of 15 μM (Comparative Examples 8, 12, and 14), ACE mRNA expression was found to decrease below normal levels. Meanwhile, among the combination groups, in Example 2, which was treated with telmisartan 10 μM and dapagliflozin 5 μM, ACE mRNA expression was found to be significantly inhibited compared to other combination groups (Figs. 5 and 6).

[0077] Through these results, it was confirmed that the combination of telmisartan and dapagliflozin is the most effective combination of ARB and SGLT-2 inhibitor for inhibiting ACE expression.

[0079] Experimental Example 3. Confirmation of angiotensin-converting enzyme inhibitory activity resulting from the inhibition of protein expression by an ARB and SGLT-2 inhibitor combination

[0080] To confirm the therapeutic effect of the combination of the angiotensin II receptor blocker (ARB) and sodium-glucose cotransporter-2 (SGLT-2) inhibitor of the present invention on heart failure, it was confirmed whether the protein expression of angiotensin converting enzyme (ACE) was inhibited.

[0081] Specifically, in Experimental Example 1-2, LPS-inflammated H9c2 cells were treated with the experimental samples in Table 3, and the H9c2 cells were harvested to proceed with the ELISA assay. Subsequently, 1 ml of RIPA buffer was added to the harvested cells, and proteins were extracted by stirring at 4°C for 30 minutes. Afterward, the cells were centrifuged at 4°C and 10,000 rpm for 20 minutes, and the supernatant was transferred to a sterile tube and stored at -80°C for use in the ELISA assay. The ELISA assay was performed in the same manner as in Experimental Example 1-2.

[0082] As a result, among all monotherapy and combination therapy groups, it was confirmed that the expression of ACE protein was significantly suppressed in Example 2, which was the telmisartan 10μM and dapagliflozin 5μM therapy group, followed by the telmisartan 10μM and empagliflozin 5μM therapy group (Fig. 7).

[0083] Through these results, it was confirmed that the combination of telmisartan and dapagliflozin, or the combination of telmisartan and empagliflozin, is the most effective combination of ARB and SGLT-2 inhibitor for inhibiting ACE expression, and can be effectively applied to reduce side effects caused by the use of high doses of ARB or SGLT-2 inhibitors.

[0085] Experimental Example 4. Toxicity evaluation of an ARB and SGLT-2 inhibitor combination

[0086] 4-1. Single-dose toxicity assessment

[0087] The single-dose toxicity of the telmisartan and dapagliflozin combination, identified as the most effective combination of ARB and SGLT-2 inhibitor for inhibiting ACE expression, and the telmisartan and empagliflozin combination was evaluated.

[0088] Specifically, the group composition consisted of groups administered with a combination of dapagliflozin (Dapagliflozin propanediol hydrate) and telmisartan at 3.1 / 20 mg / kg / day (low-dose group), 6.2 / 40 mg / kg / day (medium-dose group), and 12.3 / 80 mg / kg / day (high-dose group); groups administered with dapagliflozin 12.3 mg / kg / day and telmisartan 80 mg / kg / day as monotherapy groups; groups administered with an empagliflozin and telmisartan combination at 6.25 / 20 mg / kg / day (low-dose group), 12.5 / 40 mg / kg / day (medium-dose group), and 25 / 80 mg / kg / day (high-dose group); groups administered with empagliflozin 25 mg / kg / day and telmisartan 80 mg / kg / day as monotherapy groups; and a control group (0.5% MC aqueous solution). A single oral dose was administered to 5 males and 5 females of 6-week-old Sprague-Dawley rats per group. General symptoms were observed and body weight was measured for 15 days after administration, and the rats were euthanized and necropsied after the end of the observation period.

[0089] As a result, no deaths were observed in any of the treatment groups during the observation period. In addition, based on the observation of general symptoms, body weight measurements, and autopsy results, no results attributed to the ARB and SGLT-2 inhibitor combination were found in any of the treatment groups.

[0090] Through these results, it was confirmed that the approximate lethal doses of a single oral administration of the combination of dapagliflozin (dapagliflozin propanediol monohydrate) and telmisartan, and the combination of empagliflozin and telmisartan, exceeded 12.3 / 80 mg / kg and 25 / 80 mg / kg for both sexes, respectively.

[0092] 4-2. Evaluation of 4-Week Repeated Oral Toxicity and Determination of Dosage

[0093] The dosage was determined by evaluating the toxicity of four repeated oral administrations of the telmisartan and dapagliflozin combination and the telmisartan and empagliflozin combination, which were identified as the most effective combination of ARB and SGLT-2 inhibitor for inhibiting ACE expression.

[0094] Specifically, the group composition was the same as in Experimental Example 4-1, and 6-week-old Sprague-Dawley rats, 5 males and 5 females per group, were orally administered daily for 4 weeks. During the experiment, general symptoms were observed, blood tests were performed, and body weight was measured. After the observation period ended, the rats were euthanized and necropsied.

[0095] As a result of body weight measurements, a tendency for weight gain to be suppressed was observed in the high-dose group and the telmisartan monotherapy group. Blood test results showed that BUN increased depending on the dose, GLU decreased in the dapagliflozin monotherapy group and all high-dose groups, and RBC, HGB, and HCT decreased in all high-dose groups. Absolute and relative renal weight increased in all low, medium, and high-dose groups, while absolute and relative cardiac weight decreased in all medium and high-dose groups. Meanwhile, lesions in the gastric gland were identified in one male individual in the high-dose group and one female individual in the medium-dose group.

[0096] This trend was determined to be due to the excessive pharmacological action of dapagliflozin and the class effect caused by ARB drugs, so the high dose of dapagliflozin (Dapagliflozin propanediol monohydrate) and telmisartan for the 13-week repeated-dose toxicity study was set to 9.2 / 60 mg / kg / day (multiple of 45), and the medium and low doses were set to 3.1 / 20 mg / kg / day and 1 / 6.7 mg / kg / day, respectively, by applying a common ratio of 3.0.

[0098] Experimental Example 5. Confirmation of body weight and heart weight reduction effects of an ARB and SGLT-2 inhibitor combination

[0099] We evaluated the effects of the combination of telmisartan and dapagliflozin, which was identified as the most effective combination of ARB and SGLT-2 inhibitor for inhibiting ACE expression, on weight loss and heart weight reduction.

[0100] Specifically, the groups consisted of groups administered a combination of dapagliflozin and telmisartan at 1 / 8 mg / kg / day (low-dose group, G2), 3 / 24 mg / kg / day (medium-dose group, G3), and 9 / 72 mg / kg / day (high-dose group, G4), as well as groups administered dapagliflozin 9 mg / kg / day (G5) and telmisartan 72 mg / kg / day (G6) alone, and a control group (0.5% MC aqueous solution, G1). The dosage for each group was set at 10 mL / kg after dilution with 0.5% MC aqueous solution. Repeated oral administration was performed for 13 weeks on 10 male and 10 female 6-week-old Sprague-Dawley rats per group. General symptoms were observed and body weight was measured after administration, and at the end of the observation period, the rats were euthanized and necropsied to measure heart weight.

[0101] As a result, significant weight loss and heart weight reduction were observed in the low-dose, medium-dose, and high-dose groups of the dapagliflozin and telmisartan combination, and in particular, significant weight loss and heart weight reduction were observed in the low-dose and medium-dose groups of the dapagliflozin and telmisartan combination in female rats (Fig. 8).

[0102] Through these results, it was confirmed that cardiac hypertrophy associated with heart failure can be reduced by the combination of dapagliflozin and telmisartan.

[0104] Experimental Example 6. Confirmation of the optimal combination of an angiotensin II receptor blocker and sodium glucose transporter-2 complex

[0105] By evaluating drug-drug compatibility, the optimal combination of an angiotensin II receptor blocker (ARB) and a sodium-glucose cotransporter-2 (SGLT-2) inhibitor combination that does not degrade even after long-term storage and has high stability was identified.

[0106] Specifically, after storing a mixture of ARB and SGLT-2 inhibitor for 2 weeks under accelerated stability test conditions (40±2℃ / 75±5% relative humidity), changes in the content and appearance (color, clumping, etc.) of each component and impurity were analyzed. Olmesartan, Valsartan, and Telmisartan were used as ARBs, and Empagliflozin, Dapagliflozin propanediol monohydrate, and Canagliflozin were used as SGLT-2 inhibitors, and the content of each component was composed as shown in Table 4.

[0108] division ingredient ARB SGLT-2 inhibitors Example 3 Telmisartan 40 mg Empagliflozin 40 mg Example 4 Telmisartan 40 mg Dapagliflozin 40 mg Comparative Example 16 Telmisartan 80 mg - Comparative Example 17 - Empagliflozin 80 mg Comparative Example 18 - Dapagliflozin 80 mg Comparative Example 19 Olmesartan 80 mg - Comparative Example 20 Valsartan 80 mg - Comparative Example 21 - Canagliflozin 80 mg Comparative Example 22 Telmisartan 40 mg Canagliflozin 40 mg Comparative Example 23 Olmesartan 40 mg Empagliflozin 40 mg Comparative Example 24 Olmesartan 40 mg Dapagliflozin 40 mg Comparative Example 25 Valsartan 40 mg Empagliflozin 40 mg Comparative Example 26 Valsartan 40 mg Dapagliflozin 40 mg

[0110] To analyze the content of the main component and the degree of formation of related substances, 10 tablets of mixtures of ARB and SGLT-2 inhibitor stored for 1 week and 2 weeks were placed in each of three 100 mL flasks, and a solution of 0.01 M aqueous hydrochloric acid and acetonitrile mixed in an appropriate ratio was added to extract the main component, stirred, and then analyzed by HPLC.

[0111] To observe the appearance and viscosity of the active ingredients, 10g of a mixture of ARB and SGLT-2 inhibitor stored for 1 week and 2 weeks was taken and exposed to 100ml of purified water at room temperature for 10 minutes, after which the appearance and viscosity were checked.

[0113] As a result, in the 2nd week of acceleration, all indicators in Comparative Examples 22 to 26, which are mixtures of ARB and SGLT-2 inhibitor, were found to be unsuitable, whereas the content of the mixture of telmisartan and empagliflozin (Example 3) and the mixture of telmisartan and dapagliflozin (Example 4) was 99.4% / 95.1% and 99.2% / 99.2%, respectively, showing content changes within 10%, and the total amount of impurities was also found to be suitable, confirming that the combination of drugs was the most suitable (Table 5).

[0115] division Test items Initial Acceleration 1 week Acceleration 2 weeks Example 3 Content 99.9 / 100 99.5 / 97.6 99.4 / 95.1 flexible materials 0.1 or less 1.0 or higher 1.0 or higher Saint fitness fitness fitness Example 4 Content 99.9 / 100.1 99.4 / 99.9 99.2 / 99.2 flexible materials 0.1 or less 0.1 or more 0.1 or more Saint fitness fitness fitness Comparative Example 16 Content 100.1 100.1 100 flexible materials 0.1 or less 0.1 or less 0.1 or less Saint fitness fitness fitness Comparative Example 17 Content 99.9 97.3 95.1 flexible materials 0.1 or less 1.0 or less 1.0 or higher Saint fitness fitness fitness Comparative Example 18 Content 100.3 100.1 100.2 flexible materials 0.1 or less 0.1 or less 0.1 or less Saint fitness fitness fitness Comparative Example 19 Content 99.9 99.7 99.7 flexible materials 0.1 or less 0.1 or more 0.1 or more Saint fitness fitness fitness Comparative Example 20 Content 99.7 99.4 99.2 flexible materials 0.1 or less 0.1 or more 0.1 or more Saint fitness fitness fitness Comparative Example 21 Content 99.5 95.2 89.2 flexible materials 0.1 or less 1.0 or less 5.0 or higher Saint fitness Non-conforming Non-conforming Comparative Example 22 Content 99.5 / 92.1 99.1 / 89.1 98.9 / 82.3 flexible materials 0.1 or less 5.0 or higher 5.0 or higher Saint fitness Non-conforming Non-conforming Comparative Example 23 Content 100.1 / 99.9 99.1 / 90 95.4 / 84.6 flexible materials 0.1 or less 5.0 or higher 5.0 or higher Saint fitness fitness Non-conforming Comparative Example 24 Content 100.1 / 100 97.8 / 89.1 95 / 79.7 flexible materials 0.1 or less 5.0 or higher 5.0 or higher Saint fitness fitness Non-conforming Comparative Example 25 Content 100.2 / 99.9 95.5 / 95.4 93.3 / 90.1 flexible materials 0.1 or less fitness 5.0 or higher Saint fitness Non-conforming Non-conforming Comparative Example 26 Content 100.3 / 99.7 95.5 / 95.7 91.1 / 92.3 flexible materials 0.1 or less 1.0 or higher 1.0 or higher Saint fitness Non-conforming Non-conforming

[0117] Experimental Example 7. Phase 1 Clinical Trial Summary (Clinical Research Information Service / CRIS: PRE20230908-003, Clinicaltrials.gov / NCT06063109)

[0118] 7-1. Research Title

[0119] A two-intervention, open-label, single-sequence, repeated oral crossover clinical trial to evaluate the safety and pharmacokinetic interactions of THP-00101 and THP-00102 administration in healthy adult volunteers

[0121] 7-2. Research Objectives

[0122] We intend to investigate interactions between the two investigational medicinal products by comparing and analyzing the pharmacokinetics and safety at steady state when THP-00101 (telmisartan 80 mg) and THP-00102 (dapagliflozin 10 mg (12.3 mg as dapagliflozin propanediol hydrate)) are administered repeatedly orally alone or in combination, respectively, in healthy adult volunteers.

[0124] 7-3. Types of Research

[0125] As an intervention study, it is conducted with a two-intervention-group, open-label, single-sequence, repeated oral administration crossover design.

[0127] 7-4. Number of subjects

[0128] 50 people

[0130] 7-5. Results

[0131] As a result of the drug interaction study between the active ingredients of this drug, telmisartan 80 mg (THP-00102) and dapagliflozin 10 mg (THP-00101), it was confirmed that in the presence of dapagliflozin, the Cmax of telmisartan was approximately 1.19 times (T / R ratio 1.19, 90% confidence interval 0.99–1.43) and the AUC was approximately 1.09 times (T / R ratio 1.09, 90% confidence interval 1.01–1.18); meanwhile, in the presence of telmisartan, the Cmax of dapagliflozin was approximately 1.02 times (T / R ratio 1.02, 90% confidence interval 0.93–1.12) and the AUC was approximately 1.00 times (T / R ratio 1.00, 90% confidence interval 0.97–1.03). It has been confirmed.

[0133] The present invention has been described above with reference to its embodiments. Those skilled in the art will understand that the present invention may be embodied in modified forms without departing from the essential characteristics of the invention. Therefore, the disclosed embodiments should be considered in an illustrative rather than a restrictive sense. The scope of the invention is defined by the claims, not by the foregoing description, and all variations within the scope of equivalents should be interpreted as being included in the invention.

Claims

Claim 1 A pharmaceutical composition for the prevention or treatment of cardiovascular disease, wherein the composition comprises, as a first pharmacological component, an angiotensin II receptor blocker or a pharmaceutically acceptable salt thereof; and as a second pharmacological component, a sodium-glucose cotransporter-2 (SGLT-2) inhibitor or a pharmaceutically acceptable salt thereof, wherein the angiotensin II receptor blocker is telmisartan and the sodium-glucose cotransporter-2 inhibitor is dapagliflozin, the formulation of the composition is a tablet, and the cardiovascular disease is heart failure. Claim 2 A pharmaceutical composition for the prevention or treatment of cardiovascular disease according to claim 1, wherein the first pharmacological component is 40 mg to 80 mg and the second pharmacological component is 10 mg.

Images