A prolyl isomerase variant and glutamate-based product production method using the same

Abstract

The present application relates to a variant prolyl isomerase and a method for producing glutamic acid-based amino acids using the same.

Description

Technology Field

[0001] The present application relates to a variant prolyl isomerase and a method for producing glutamic acid-based amino acids using the same. Background Technology

[0003] Glutamate is one of the proteinaceous amino acids widely found in plants, animals, and microorganisms, and is converted and metabolized into ornithine (L-ornithine), citrulline (L-citrulline), arginine (L-arginine), glutamine (L-glutamine), etc. in organs of the body.

[0004] Glutamic acid possesses a distinctive, unique taste and is widely used in the food industry, as well as in the pharmaceutical and animal feed sectors. Additionally, ornithine is used as a nutritional supplement because it is effective for muscle growth and body fat reduction, and it is also utilized as a pharmaceutical to improve liver cirrhosis and liver dysfunction. Citrulline is known for its physiological effects, such as promoting ammonia metabolism, improving blood flow through vasodilation, lowering blood pressure, neurotransmission, boosting immunity, and scavenging free radicals. Furthermore, arginine is used for medicinal purposes, such as as a liver function enhancer, brain function enhancer, and comprehensive amino acid preparation, and is also utilized in food applications, such as as an additive for fish paste, health drinks, and as a salt substitute for patients with hypertension.

[0005] Enhancement of the glutamic acid biosynthetic pathway can enhance not only glutamic acid but also glutamic acid-family amino acids such as ornithine, citrulline, arginine, and glutamine. Methods for producing such glutamic acid include fermentation using Corynebacterium or Corynebacterium species and their variants (Amino Acid Fermentation, Gakkai Shuppan Center: 195-215, 1986), as well as methods using microorganisms such as Escherichia coli, Bacillus, Streptomyces, Penicillium species, Klebsiella, Erwinia, and Pantoea species (U.S. Patent Publication No. 6682912). The problem to be solved

[0007] The present application provides a variant prolyl isomerase in which the amino acid corresponding to the 95th position in the amino acid sequence of SEQ ID NO. 1 is substituted with another amino acid.

[0008] The present application provides a polynucleotide encoding the variant prolyl isomerase of the present application.

[0009] The present application provides a microorganism comprising the variant prolyl isomerase of the present application; or a polynucleotide encoding the same.

[0010] The present application provides a method for producing glutamic acid-based amino acids, comprising the step of culturing a microorganism in a medium that comprises the variant prolyl isomerase of the present application or a polynucleotide encoding the same. means of solving the problem

[0012] This is explained in detail as follows. Meanwhile, each description and embodiment disclosed in this application may be applied to other descriptions and embodiments. That is, all combinations of the various elements disclosed in this application fall within the scope of this application. Furthermore, the scope of this application should not be considered limited by the specific descriptions provided below. Additionally, numerous papers and patent documents are referenced and cited throughout this specification. The disclosures of the cited papers and patent documents are incorporated by reference into this specification in their entirety to more clearly explain the level of the art to which this application pertains and the content of this application.

[0014] One aspect of the present application provides a variant prolyl isomerase in which the amino acid corresponding to the 95th position in the amino acid sequence of SEQ ID NO. 1 is substituted with another amino acid.

[0016] In this application, the term "variant prolyl isomerase" refers to any polypeptide or prolyl isomerase having a function of regulating prolyl isomerase activity, comprising a substitution of the amino acid corresponding to the 95th position from the N-terminus of SEQ ID NO. 1 with another amino acid. The "variant prolyl isomerase" may also be referred to as "prolyl isomerase variant," "fkpA variant," "variant fkpA," "FkpA variant," "variant FkpA," "PPIase variant," "variant PPIase," etc.

[0018] The protein subject to the mutation introduction of the present application may be a protein having prolyl isomerase activity. Specifically, the protein may include the amino acid sequence of SEQ ID NO. 1 and have prolyl isomerase activity, but is not limited thereto. This does not exclude meaningless sequence additions before or after the amino acid sequence of SEQ ID NO. 1, naturally occurring mutations, or silent mutations thereof; any protein that has the same or corresponding activity as the protein containing the amino acid sequence of SEQ ID NO. 1 may be the protein subject to the mutation introduction of the present application. For example, the protein subject to the mutation introduction of the present application may be a protein composed of the amino acid sequence of SEQ ID NO. 1 or an amino acid sequence having 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or more homology or identity therewith. Furthermore, it is obvious that if an amino acid sequence possesses such homology or identity and exhibits efficacy corresponding to the said protein, a protein having an amino acid sequence in which some sequences are deleted, modified, substituted, or added is also included within the scope of the protein subject to modification in this application.

[0020] In this application, the term "prolyl isomerase (prolyl cis / trans isomerase)" refers to an enzyme that is expressed in clusters with citrate synthase (CS) within microorganisms and delays the aggregation of citrate synthase. In addition, it is known that the N-terminal domain of the prolyl isomerase, which has a chaperone function, performs an effective chaperone function within microorganisms under high-temperature conditions. The prolyl isomerase may be used interchangeably with "peptidyl-prolyl cis-trans isomerase," "FKBP-type peptidyl-prolyl cis-trans isomerase," "FkpA," or "PPIase." The amino acid sequence of the above FkpA can be obtained from known databases such as NCBI's Genebank.

[0021] For example, the FkpA protein of the present application may be of microbial origin, specifically may be of prokaryotic or eukaryotic origin, and more specifically the genus of Corynebacterium Corynebacterium It may originate from microorganisms, etc., but is not limited thereto.

[0022] As another example, the FkpA protein may be NCgl0796 (Cg0950) derived from microorganisms of the genus Corynebacterium, but it is evident that it includes proteins of various origins with prolyl isomerase activity.

[0023] In the present application, the amino acid corresponding to the 95th of SEQ ID NO. 1 in the amino acid sequence of the FkpA protein to be modified may be tyrosine (Y).

[0025] The variant prolyl isomerase of the present application may be one in which the amino acid at the position corresponding to the 95th position in the amino acid sequence of SEQ ID NO. 1 is substituted with an amino acid different from the amino acid before substitution.

[0026] For example, the above-mentioned variant prolyl isomerase may be in which the amino acid corresponding to the 95th position in the amino acid sequence of SEQ ID NO. 1 is substituted with one or more amino acids selected from the group consisting of methionine, serine, threonine, asparagine, cysteine, histidine, lysine, aspartic acid, alanine, valine, leucine, glutamine, glycine, proline, glutamic acid, arginine, isoleucine, phenylalanine, and tryptophan. For another example, the above-mentioned variant prolyl isomerase may be in which the amino acid corresponding to the 95th position in the amino acid sequence of SEQ ID NO. 1 is substituted with one or more amino acids selected from the group consisting of methionine, serine, threonine, asparagine, cysteine, histidine, lysine, aspartic acid, alanine, valine, leucine, glutamine, glycine, proline, and glutamic acid. As another example, the above variant prolyl isomerase may be in which the amino acid corresponding to the 95th position in the amino acid sequence of SEQ ID NO. 1 is substituted with an amino acid other than an aromatic amino acid. As another example, the above variant prolyl isomerase may be in which the amino acid corresponding to the 95th position in the amino acid sequence of SEQ ID NO. 1 is substituted with an amino acid having a nonpolar, polar, and charged side chain.

[0027] As another example, the variant prolyl isomerase of the present application may have, include, be composed of, or essentially consist of the amino acid sequence described as SEQ ID NO. 3 or SEQ ID NO. 5 or SEQ ID NO. 7 or SEQ ID NO. 9 or SEQ ID NO. 11 or SEQ ID NO. 13 or SEQ ID NO. 15 or SEQ ID NO. 17 or SEQ ID NO. 19 or SEQ ID NO. 21 or SEQ ID NO. 23 or SEQ ID NO. 25 or SEQ ID NO. 27 or SEQ ID NO. 29 or SEQ ID NO. 31.

[0029] The variant prolyl isomerase of the present application may include an amino acid sequence in which the amino acid at the position corresponding to the 95th position based on the amino acid sequence of SEQ ID NO. 1 is an amino acid other than tyrosine, for example, methionine, serine, threonine, asparagine, cysteine, histidine, lysine, aspartic acid, alanine, valine, leucine, glutamine, glycine, proline, or glutamic acid, and has at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 99.1% or more homology or identity with the amino acid sequence described in SEQ ID NO. 1. Furthermore, it is obvious that a variant prolyl isomerase having an amino acid sequence having such homology or identity and exhibiting efficacy corresponding to the variant prolyl isomerase of the present application, wherein some sequences are deleted, modified, substituted, conservatively substituted, or added, is also included within the scope of the present application.

[0030] For example, this includes cases where the amino acid sequence has sequence additions or deletions, naturally occurring mutations, silent mutations, or conservative substitutions at the N-terminus, C-terminus, and / or within it that do not alter the function of the variant prolyl isomerase of the present application.

[0031] The aforementioned "conservative substitution" refers to the substitution of one amino acid with another amino acid having similar structural and / or chemical properties. Such amino acid substitutions can generally occur based on similarities in the polarity, charge, solubility, hydrophobicity, hydrophilicity, and / or amphipathic nature of the residues. Typically, conservative substitutions have little to no effect on the activity of a protein or polypeptide.

[0032] For example, among amino acids having electrically charged side chains, positively charged (basic) amino acids include arginine, lysine, and histidine, and negatively charged (acidic) amino acids include glutamic acid and aspartic acid; amino acids having nonpolar side chains (nonpolar amino acids) include glycine, alanine, valine, leucine, isoleucine, methionine, phenylalanine, tryptophan, and proline; Amino acids having polar or hydrophilic side chains (polar amino acids) can be classified to include serine, threonine, cysteine, tyrosine, asparagine, and glutamine, and amino acids having uncharged side chains can be classified to include glycine, alanine, valine, leucine, isoleucine, methionine, phenylalanine, tryptophan, proline, serine, threonine, cysteine, tyrosine, asparagine, and glutamine. Additionally, aromatic amino acids can be classified to include phenylalanine, tryptophan, and tyrosine.

[0034] In this application, the terms “variant protein” or “variant” refer to a polypeptide in which one or more amino acids are conservatively substituted and / or modified, resulting in a sequence of amino acids different from that of the variant prior to modification, while retaining functions or properties. Such a variant can generally be identified by modifying one or more amino acids in the amino acid sequence of the polypeptide and evaluating the properties of the modified polypeptide. That is, the capabilities of the variant may be increased, unchanged, or decreased compared to the polypeptide prior to modification. Additionally, some variants may include variants in which one or more parts, such as an N-terminal leader sequence or a transmembrane domain, have been removed. Other variants may include variants in which a portion of the N- and / or C-terminus of a mature protein has been removed. The above term "variant protein" may be used interchangeably with terms such as variant, modification, variant polypeptide, mutated protein, mutation, and variant (in English expressions, modification, modified polypeptide, modified protein, mutant, mutein, divergent, etc.), and is not limited thereto if the term is used in the sense of being mutated. For example, the above variant may be a polypeptide in which the amino acid corresponding to the 95th position of the amino acid sequence of SEQ ID NO. 1 is substituted with methionine, serine, threonine, asparagine, cysteine, histidine, lysine, aspartic acid, alanine, valine, leucine, glutamine, glycine, proline, glutamic acid, arginine, isoleucine, phenylalanine, or tryptophan.As another example, the variant may be a polypeptide in which the amino acid corresponding to the 95th position of the amino acid sequence of SEQ ID NO. 1 is substituted with methionine, serine, threonine, asparagine, cysteine, histidine, lysine, aspartic acid, alanine, valine, leucine, glutamine, glycine, proline, or glutamic acid. As yet another example, the variant may be a polypeptide comprising the amino acid sequence described as SEQ ID NO. 3, SEQ ID NO. 5, SEQ ID NO. 7, SEQ ID NO. 9, SEQ ID NO. 11, SEQ ID NO. 13, SEQ ID NO. 15, SEQ ID NO. 17, SEQ ID NO. 19, SEQ ID NO. 21, SEQ ID NO. 23, SEQ ID NO. 25, SEQ ID NO. 27, SEQ ID NO. 29, or SEQ ID NO. 31, but is not limited thereto.

[0035] Additionally, the variant may include deletions or additions of amino acids that have minimal effect on the properties and secondary structure of the polypeptide. For example, a signal (or leader) sequence involved in co-translational or post-translational protein translocation may be conjugated to the N-terminus of the variant. Additionally, the variant may be conjugated with another sequence or linker to enable identification, purification, or synthesis.

[0037] In this application, the terms 'homology' or 'identity' refer to the degree of similarity between two given amino acid sequences or base sequences and may be expressed as a percentage. The terms homology and identity may often be used interchangeably.

[0038] Sequence homology or identity of conserved polynucleotides or polypeptides is determined by standard arrangement algorithms, and a default gap penalty established by the program used may be utilized. Practically, homologous or identical sequences can generally be hybridized with the entire sequence or a part thereof under moderate or high stringent conditions. It is evident that hybridization also includes hybridization with polynucleotides containing common codons or codons that account for codon degeneracy.

[0039] Whether any two polynucleotide or polypeptide sequences have homology, similarity, or identity can be determined using a known computer algorithm, such as the “FASTA” program, using default parameters as in, for example, Pearson et al (1988) [Proc. Natl. Acad. Sci. USA 85]: 2444. Alternatively, it can be determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453), as performed in the Needleman program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277) (version 5.0.0 or later) (GCG program package (Devereux, J., et al, Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [ET AL, J MOLEC BIOL 215]: 403 (1990); Guide to Huge Computers, Martin J. Bishop, [ED.,] Homology, similarity, or identity can be determined using, for example, Academic Press, San Diego, 1994, and [CARILLO et al](1988) SIAM J Applied Math 48: 1073). For example, homology, similarity, or identity can be determined using BLAST from the National Biotechnology Information Database Center or ClustalW.

[0040] The homology, similarity, or identity of polynucleotides or polypeptides can be determined by comparing sequence information using a GAP computer program, such as that described in, for example, Smith and Waterman, Adv. Appl. Math (1981) 2:482, or Needleman et al. (1970), J Mol Biol. 48:443. In summary, a GAP program can be defined as the total number of symbols in the shorter of the two sequences divided by the number of similarly arranged symbols (i.e., nucleotides or amino acids). The default parameters for a GAP program are (1) a unitary matrix (containing values ​​of 1 for identity and 0 for non-identity) and, as disclosed by Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp. 353-358 (1979), or Gribskov et al. (1986) Nucl. Acids Res. 14: A weighted comparison matrix of 6745 (or an EDNAFULL (EMBOSS version of NCBI NUC4.4) substitution matrix); (2) a penalty of 3.0 for each gap and an additional penalty of 0.10 for each symbol in each gap (or a gap opening penalty of 10, a gap extension penalty of 0.5); and (3) no penalty for terminal gaps.

[0041] As an example of the present application, the variant prolyl isomerase of the present application may have an activity that increases the production capacity of glutamic acid series amino acids compared to a wild-type polypeptide having prolyl isomerase activity.

[0043] In this application, the term “corresponding to” refers to an amino acid residue at a position listed in the polypeptide, or an amino acid residue that is similar, identical, or homologous to a residue listed in the polypeptide. Identifying the amino acid at the corresponding position may involve determining a specific amino acid of a sequence that references a specific sequence. As used in this application, “corresponding region” generally refers to a similar or corresponding position in a related protein or a reference protein.

[0044] For example, any amino acid sequence can be aligned with sequence number 1, and based on this, each amino acid residue of the said amino acid sequence can be numbered by referring to the numerical position of the amino acid residue corresponding to the amino acid residue of sequence number 1. For example, a sequence alignment algorithm such as that described in the present application can identify the position of an amino acid, or the position where modifications such as substitution, insertion, or deletion occur, by comparing with a query sequence (also referred to as a "reference sequence").

[0045] For such alignment, examples such as the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453), the Needleman program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000), Trends Genet. 16: 276-277) can be used, but are not limited thereto, and sequence alignment programs and pairwise sequence comparison algorithms known in the art can be appropriately used.

[0047] Another aspect of the present application is to provide a polynucleotide encoding a variant prolyl isomerase of the present application.

[0048] The FkpA protein of the present application is fkpA It may be coded by genes.

[0049] For example, fkpA The gene may be, but is not limited to, a polynucleotide encoding NCgl0796 (Cg0950) derived from a microorganism of the genus Corynebacterium. As another example, fkpA The gene is of microorganisms of the genus Corynebacterium. fkpA It may be a gene, but is not limited to it, of various origins encoding a protein having FkpA protein activity fkpA It is self-evident that it includes genes.

[0050] In this application, the term "polynucleotide" refers to a polymer of nucleotides in which nucleotide monomers are linked together in a long chain by covalent bonds, such as a DNA or RNA strand of a certain length or longer, and more specifically, to a polynucleotide fragment encoding the variant prolyl isomerase.

[0051] The polynucleotide encoding a variant prolyl isomerase of the present application may include a nucleotide sequence encoding a variant prolyl isomerase in which the amino acid corresponding to the 95th position in the amino acid sequence of SEQ ID NO. 1 is substituted with another amino acid, or may include a nucleotide sequence in which the codon corresponding to the 283rd to 285th positions in the nucleotide sequence of SEQ ID NO. 2 is substituted with a codon encoding another amino acid. As an example, the polynucleotide of the present application may include a nucleotide sequence encoding an amino acid sequence described as SEQ ID NO. 3, SEQ ID NO. 5, SEQ ID NO. 7, SEQ ID NO. 9, SEQ ID NO. 11, SEQ ID NO. 13, SEQ ID NO. 15, SEQ ID NO. 17, SEQ ID NO. 19, SEQ ID NO. 21, SEQ ID NO. 23, SEQ ID NO. 25, SEQ ID NO. 27, SEQ ID NO. 29, or SEQ ID NO. 31. As a more specific example of the present application, the polynucleotide of the present application may have or include the sequence of SEQ ID NO. 4, SEQ ID NO. 6, SEQ ID NO. 8, SEQ ID NO. 10, SEQ ID NO. 12, SEQ ID NO. 14, SEQ ID NO. 16, SEQ ID NO. 18, SEQ ID NO. 20, SEQ ID NO. 22, SEQ ID NO. 24, SEQ ID NO. 26, SEQ ID NO. 28, SEQ ID NO. 30, or SEQ ID NO. 32. Additionally, the polynucleotide of the present application may be composed of or essentially constitute the sequence of SEQ ID NO. 4, SEQ ID NO. 6, SEQ ID NO. 8, SEQ ID NO. 10, SEQ ID NO. 12, SEQ ID NO. 14, SEQ ID NO. 16, SEQ ID NO. 18, SEQ ID NO. 20, SEQ ID NO. 22, SEQ ID NO. 24, SEQ ID NO. 26, SEQ ID NO. 28, SEQ ID NO. 30, or SEQ ID NO. 32.

[0052] The polynucleotide of the present application may have various modifications made to its coding region within a range that does not alter the amino acid sequence of the variant prolyl isomerase of the present application, taking into account the degeneracy of the codons or the codons preferred by the organism intended to express the variant prolyl isomerase of the present application. Specifically, the polynucleotide of the present application may have or include a nucleotide sequence having homology or identity with the sequence of SEQ ID NO. 2 of 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, and less than 100%, or may be composed of or essentially composed of a nucleotide sequence having homology or identity with the sequence of SEQ ID NO. 2 of 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, and less than 100%, but is not limited thereto. At this time, in the sequence having the above homology or identity, the codon coding for the amino acid corresponding to the 95th position of sequence number 1 may be one of the codons coding for an amino acid other than tyrosine, for example, methionine, serine, threonine, asparagine, cysteine, histidine, lysine, aspartic acid, alanine, valine, leucine, glutamine, glycine, proline, or glutamic acid.

[0053] Additionally, the polynucleotide of the present application may be included without limitation as long as it is a probe that can be prepared from known gene sequences, for example, a sequence that can be hybridized under stringent conditions with a sequence that is complementary to all or part of the polynucleotide sequence of the present application. The "stringent condition" means a condition that enables specific hybridization between polynucleotides. Such conditions are specifically described in the literature (see J. Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; FM Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York, 9.50-9.51, 11.7-11.8). For example, conditions may be listed in which polynucleotides with high homology or identity are hybridized with each other, with homology or identity of 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more, and polynucleotides with lower homology or identity are not hybridized with each other, or conditions in which washing is performed once, specifically two to three times, at a salt concentration and temperature equivalent to the washing conditions of conventional southern hybridization, such as 60°C, 1 χSSC, 0.1% SDS, specifically 60°C, 0.1 χSSC, 0.1% SDS, more specifically 68°C, 0.1 χSSC, 0.1% SDS.

[0054] Hybridization requires that two nucleic acids have complementary sequences, even though a mismatch between bases may be possible depending on the degree of hybridization. The term "complementary" is used to describe the relationship between nucleotide bases that can hybridize with each other. For example, regarding DNA, adenine is complementary to thymine, and cytosine is complementary to guanine. Accordingly, the polynucleotides of this application may also include isolated nucleic acid fragments that are complementary to the entire sequence, as well as substantially similar nucleic acid sequences.

[0055] Specifically, a polynucleotide having homology or identity with the polynucleotide of the present application can be detected using hybridization conditions including a hybridization step at a Tm value of 55°C and using the conditions described above. Additionally, the Tm value may be 60°C, 63°C, or 65°C, but is not limited thereto and can be appropriately adjusted by a person skilled in the art according to the purpose.

[0056] The appropriate strictness for hybridizing the above polynucleotides depends on the length and degree of complementarity of the polynucleotides, and the variables are well known in the art (e.g., J. Sambrook et al., i.e.).

[0058] Another aspect of the present application is to provide a vector comprising the polynucleotide of the present application.

[0059] The above vector may be an expression vector for expressing the above polynucleotide in a host cell, but is not limited thereto.

[0060] The vector of the present application may comprise a DNA product comprising a sequence of a polynucleotide encoding said target polypeptide, which is operably linked to a suitable expression control region (or expression control sequence) to enable the expression of said target polypeptide within a suitable host. The expression control region may comprise a promoter capable of initiating transcription, any operator sequence for regulating such transcription, a sequence coding for a suitable mRNA ribosome binding site, and a sequence regulating the termination of transcription and translation. After being transformed into a suitable host cell, the vector may replicate or function independently of the host genome and may be incorporated into the genome itself.

[0061] The vectors used in this application are not particularly limited, and any vector known in the art may be used. Examples of commonly used vectors include plasmids, cosmids, viruses, and bacteriophages in their natural or recombinant state. For example, pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, and Charon21A may be used as phage vectors or cosmid vectors, and pDZ-based, pBR-based, pUC-based, pBluescriptII-based, pGEM-based, pTZ-based, pCL-based, and pET-based vectors may be used as plasmid vectors. Specifically, pDZ, pDC, pDCM2, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC vectors may be used.

[0062] For example, a polynucleotide encoding a target polypeptide can be inserted into a chromosome using a vector for intracellular chromosome insertion. The insertion of said polynucleotide into the chromosome may be achieved by any method known in the art, for example, homologous recombination, but is not limited thereto. A selection marker may be additionally included to confirm whether the chromosome insertion has occurred. The selection marker is intended to select cells transformed by the vector, that is, to confirm whether the target nucleic acid molecule has been inserted, and markers conferring selectable phenotypes such as drug resistance, nutritional requirements, resistance to cytotoxic agents, or expression of surface polypeptides may be used. Since only cells expressing the selection marker survive or exhibit other phenotypes in an environment treated with a selective agent, the transformed cells can be selected.

[0063] In this application, the term "transformation" means introducing a vector containing a polynucleotide encoding a target polypeptide into a host cell or microorganism so that the polypeptide encoded by said polynucleotide can be expressed within the host cell. The transformed polynucleotide may include both inserted into and located within the chromosomes of the host cell and extrachromosomally, as long as it can be expressed within the host cell. Additionally, said polynucleotide includes DNA and / or RNA encoding the target polypeptide. said polynucleotide may be introduced in any form that can be introduced into and expressed within the host cell. For example, said polynucleotide may be introduced into the host cell in the form of an expression cassette, which is a genetic structure containing all the elements necessary for self-expression. said expression cassette may typically include a promoter, a transcription termination signal, a ribosome binding site, and a translation termination signal operably linked to said polynucleotide. said expression cassette may be in the form of a self-replicating expression vector. In addition, the polynucleotide may be introduced into a host cell in its own form and operably linked to a sequence required for expression in the host cell, but is not limited thereto.

[0064] In addition, the term "operably connected" as described above means that a promoter sequence and a polynucleotide sequence are functionally connected to initiate and mediate the transcription of a polynucleotide encoding the variant prolyl isomerase of the purpose of this application.

[0066] Another aspect of the present application is to provide a microorganism comprising the variant prolyl isomerase of the present application or the polynucleotide of the present application.

[0067] The strain of the present application may include the variant prolyl isomerase of the present application, a polynucleotide encoding said polypeptide, or a vector comprising the polynucleotide of the present application.

[0068] In this application, the term “microorganism (or strain)” includes both wild-type microorganisms and microorganisms that have undergone natural or artificial genetic modification, and may be microorganisms in which specific mechanisms are weakened or strengthened due to causes such as the insertion of external genes or the enhancement or inactivation of the activity of endogenous genes, and may be microorganisms that include genetic modification for the production of a desired polypeptide, protein, or product.

[0069] The strain of the present application may be a strain that naturally possesses the ability to produce glutamic acid-based amino acids, or a microorganism in which the ability to produce glutamic acid-based amino acids is conferred upon a strain that does not possess the ability to produce glutamic acid-based amino acids. For example, it may be a microorganism in which the ability to produce glutamic acid-based amino acids is increased by introducing the variant prolyl isomerase of the present application or a polynucleotide encoding it, but is not limited thereto.

[0070] In this application, the term "glutamic acid-based amino acid" may include all L-amino acids that can be biosynthesized using glutamic acid as a precursor, including glutamic acid. For example, L-amino acids that can be produced through the glutamic acid biosynthetic pathway using glutamic acid as a precursor include glutamine, ornithine, citrulline, and arginine, and any other L-amino acid that can be biosynthesized using glutamic acid as a precursor may be included within the scope of this application. Furthermore, glutamic acid that can be produced with the involvement of the prolyl isomerase of this application and substances synthesized using it as a precursor may be included without limitation.

[0071] Meanwhile, in this application, the term "L-amino acid" includes both proteinaceous and non-proteinaceous amino acids.

[0072] The strain of the present application may be a microorganism with increased glutamic acid-based amino acid production capacity compared to a parent strain or wild-type Corynebacterium strain that does not contain the variant prolyl isomerase of the present application. The microorganism may have improved glutamic acid-based amino acid production capacity through the introduction of the variant prolyl isomerase of the present application.

[0073] For example, the prolyl isomerase-unmodified microorganism, which is a control strain used to compare whether the production capacity of the aforementioned glutamic acid-based amino acids increases, C. glutamicum It may be ATCC 13869 strain, C. gl::argR*_argG* strain producing citrulline, KFCC10680 strain producing glutamine, C. gl::argR*_argF* strain producing ornithine, or C. gl::argR* strain producing arginine, but is not limited thereto.

[0074] For example, the recombinant strain with increased production capacity is about 1% or more, specifically about 2% or more, about 5% or more, about 10% or more, about 15% or more, about 20% or more, about 25% or more, about 30% or more, about 31% or more, about 31.9% or more, about 32% or more, about 32.9% or more, about 33% or more, about 33.8% or more, about 34% or more, about 35% or more, about 36% or more, about 36.4% or more, about 37% or more, about 37.2% or more, about 38% or more, about 38.8% or more, about 39% or more, or about 39.5% or more (there is no specific restriction on the upper limit, for example, about 200% or less, about 150% or less, about It may be increased by 100% or less or about 50% or less, but is not limited thereto as long as it has a positive increase compared to the production capacity of the parent strain before mutation, the non-modified microorganism, or the prolyl isomerase non-modified microorganism. In another example, the recombinant strain with increased glutamic acid-based amino acid production capacity, compared to the parent strain before mutation, the unmodified microorganism, or the prolyl isomerase-unmodified microorganism, showed glutamic acid-based amino acid production capacity of about 1.01 times or more, about 1.02 times or more, about 1.05 times or more, about 1.1 times or more, about 1.15 times or more, about 1.2 times or more, about 1.25 times or more, about 1.3 times or more, about 1.31 times or more, about 1.319 times or more, about 1.32 times or more, about 1.329 times or more, about 1.33 times or more, about 1.338 times or more, about 1.34 times or more, about 1.35 times or more, about 1.36 times or more, about 1.364 times or more, about 1.37 times or more, about 1.372 times or more, and about 1.38 times. It may be increased by more than, about 1.388 times, about 1.39 times, or about 1.395 times (there is no special limit on the upper limit, for example, it may be about 10 times or less or about 5 times or less), but is not limited thereto.

[0075] In this application, the term "non-modified microorganism" does not exclude strains containing mutations that may naturally occur in microorganisms, and may refer to wild-type or natural-type strains themselves, or strains prior to genetic mutations caused by natural or artificial factors. Additionally, the term "prolyl isomerase non-modified microorganism" in this application may refer to strains in which the prolyl isomerase variant described herein has not been introduced or prior to its introduction. The prolyl isomerase non-modified microorganism in this application does not exclude strains containing modifications to proteins or other genes other than modifications to prolyl isomerase or the polynucleotide encoding it.

[0076] In this application, the term "non-mutated microorganism" may be used interchangeably with "pre-mutation strain," "pre-mutation microorganism," "non-mutated strain," "non-mutated strain," "non-mutated microorganism," or "reference microorganism."

[0077] The microorganisms of the present application may be microorganisms comprising a variant prolyl isomerase or a polynucleotide encoding the same; or microorganisms genetically modified to include a variant prolyl isomerase or a polynucleotide encoding the same (e.g., recombinant microorganisms), but are not limited thereto. The term "intrinsic activity" refers to the activity of a specific polypeptide originally possessed by the parent strain, wild-type, or non-modified microorganism prior to the change in traits caused by genetic mutation due to natural or artificial factors. This term may be used interchangeably with "activity prior to modification."

[0079] As another example of the present application, the microorganism of the present application is Corynebacterium glutamicum ( Corynebacterium glutamicum ), Corynebacterium stationaryis( Corynebacterium stationis ), Corynebacterium crudilactis( Corynebacterium crudilactis ), Corynebacterium deserti( Corynebacterium deserti ), Corynebacterium epiphysiens( Corynebacterium efficiens ), Corynebacterium calunae( Corynebacterium callunae ), Corynebacterium singulare( Corynebacterium singulare ), Corynebacterium halotolerans( Corynebacterium halotolerans ), Corynebacterium striatum ( Corynebacterium striatum ), Corynebacterium ammoniagenes( Corynebacterium ammoniagenes ), Corynebacterium pollatisoli ( Corynebacterium pollutisoli ), Corynebacterium imitans( Corynebacterium imitans ), Corynebacterium testudinoris( Corynebacterium testudinoris ) or Corynebacterium flavescens ( Corynebacterium flavescens It may be, specifically, Corynebacterium glutamicum, but is not limited thereto.

[0081] As another example of the present application, the recombinant microorganism of the present application may be a microorganism in which the activity of a portion of a protein in the glutamic acid-based amino acid biosynthetic pathway is further enhanced, or the activity of a portion of a protein in the glutamic acid-based amino acid degradation pathway is weakened, thereby increasing the glutamic acid-based amino acid production capacity.

[0082] As another example of the present application, the recombinant microorganism of the present application may be a strain with increased production capacity of ornithine, one of the glutamic acid-based amino acids.

[0083] In any one of the embodiments described above, the recombinant microorganism of the present application comprises, to enhance the biosynthetic pathway from glutamate to ornithine, an acetylglutamate synthase that converts glutamate to acetylglutamate (N-acetylglutamate), an ornithine acetyltransferase (ArgJ) that converts acetylornithine to ornithine, an acetylglutamate kinase (ArgB) that converts acetylglutamate to acetylglutamyl phosphate (N-acetylglutamyl phosphate), an acetyl-gamma-glutamyl phosphate reductase (ArgC) that converts acetylglutamate phosphate to acetylglutamate semialdehyde (N-acetylglutamate semialdehyde), and an acetylornithine that converts acetylglutamate semialdehyde to acetylornithine (N-acetylornithine). The ornithine production capacity may be enhanced by modifying one or more activities selected from the group consisting of aminotransferase (ArgD) to be enhanced relative to the intrinsic activity.

[0084] As another example of the present application, the recombinant microorganism of the present application may be a strain with increased production capacity of citrulline among glutamic acid-based amino acids.

[0085] In any one of the embodiments described above, the recombinant microorganism of the present application may be modified such that the activity of ornithine carbamoyltransferase (ArgF), which converts ornithine to citrulline, is enhanced relative to its intrinsic activity in order to enhance the biosynthetic pathway from ornithine to citrulline, thereby enhancing the production capacity of citrulline. Alternatively, the recombinant microorganism of the present application may be further modified as described above so that the biosynthetic pathway from glutamic acid to ornithine is enhanced, thereby enhancing the production capacity of ornithine, which is a precursor of citrulline, and thus enhancing the production capacity of citrulline.

[0086] As another example of the present application, the recombinant microorganism of the present application may be a strain with increased production capacity of arginine, one of the glutamic acid-based amino acids.

[0087] In any one of the embodiments described above, the recombinant microorganism of the present application may be modified such that, in order to enhance the biosynthetic pathway from ornithine to arginine, the activity of one or more selected from the group consisting of argininosuccinate synthase (argG), argininosuccinate degradase (argH), aspartate ammonia lyase (aspA), and aspartate aminotransferase (aspB) involved in arginine synthesis is enhanced relative to the intrinsic activity, thereby improving the production capacity of arginine. Alternatively, the recombinant microorganism of the present application may be further modified as described above to enhance the biosynthetic pathway from glutamic acid to ornithine, so that the production capacity of ornithine, which is a precursor of citrulline, is enhanced, and thus the production capacity of arginine is improved.

[0088] As another example of the present application, the recombinant microorganism of the present application may be a strain with increased production capacity of glutamine, one of the glutamic acid-based amino acids.

[0089] In any one of the embodiments described above, the recombinant microorganism of the present application may be modified such that the activity of glutamine synthetase involved in glutamine synthesis is enhanced relative to its intrinsic activity in order to enhance the biosynthetic pathway from glutamic acid to glutamine, thereby improving the glutamine production capacity. Alternatively, the recombinant microorganism of the present application may be further modified as described above so that the biosynthetic pathway from glutamic acid to glutamine is enhanced, and thus the glutamine production capacity is improved by enhancing the production capacity of glutamic acid, which is a precursor of glutamine.

[0091] In this application, the term "weakening" of the activity of a polypeptide (including, for example, proteins specified by the name of each enzyme) is a concept that encompasses both a decrease in activity and the absence of activity relative to the intrinsic activity. The term "weakening" may be used interchangeably with terms such as inactivation, deficiency, down-regulation, decrease, reduce, and attenuation.

[0092] The above weakening may include cases where the activity of the polypeptide itself is reduced or eliminated compared to the polypeptide activity originally possessed by the microorganism due to mutations in the polynucleotide encoding the polypeptide, etc.; cases where the overall degree and / or concentration (expression amount) of polypeptide activity within the cell is lower than that of the natural strain due to inhibition of gene expression of the polynucleotide encoding it or inhibition of translation into polypeptide, etc.; cases where the expression of the polynucleotide does not occur at all; and / or cases where there is no polypeptide activity even if the polynucleotide is expressed. The statement that the polypeptide activity is "inactivated, deficient, reduced, downregulated, lowered, or attenuated" compared to the intrinsic activity means that it has become lower than the activity of a specific polypeptide originally possessed by the parent strain or the non-modified microorganism prior to transformation.

[0093] The attenuation of the activity of such polypeptides can be performed by any method known in the art, but is not limited thereto, and can be achieved by the application of various methods well known in the art (e.g., Nakashima N et al., Bacterial cellular engineering by genome editing and gene silencing. Int J Mol Sci. 2014;15(2):2773-2793, Sambrook et al. Molecular Cloning 2012 et al.).

[0095] Specifically, the weakening of the activity of the polypeptide of the present application is

[0096] 1) Deletion of all or part of a gene encoding a polypeptide;

[0097] 2) Modification of the expression regulatory region (or expression regulatory sequence) to reduce the expression of the gene encoding the polypeptide;

[0098] 3) Modification of the amino acid sequence constituting the polypeptide so as to remove or weaken the activity of the polypeptide (e.g., deletion / substitution / addition of one or more amino acids in the amino acid sequence);

[0099] 4) Modification of the gene sequence encoding the polypeptide so as to remove or weaken the activity of the polypeptide (e.g., deletion / substitution / addition of one or more nucleotides on the nucleotide sequence of the polypeptide gene to code for a polypeptide modified so as to remove or weaken the activity of the polypeptide);

[0100] 5) A modification of the nucleotide sequence encoding the start codon or the 5'-UTR region of the gene transcript encoding the polypeptide;

[0101] 6) Introduction of an antisense oligonucleotide (e.g., antisense RNA) that binds complementarily to the transcript of the gene encoding the polypeptide;

[0102] 7) Addition of a sequence complementary to the Shine-Dalgarno sequence to the upstream end of the Shine-Dalgarno sequence of a polypeptide-coding gene to form a secondary structure incapable of ribosome attachment;

[0103] 8) Addition of a reverse-transcribed promoter to the 3' end of the open reading frame (ORF) of a gene sequence encoding a polypeptide (Reverse transcription engineering, RTE); or

[0104] 9) It may be a combination of two or more selected from 1) to 8) above, but is not specifically limited thereto.

[0105] for example,

[0106] The deletion of part or all of the gene encoding the polypeptide mentioned above 1) may be the removal of the entire polynucleotide encoding the intrinsic target polypeptide within the chromosome, replacement with a polynucleotide in which some nucleotides have been deleted, or replacement with a marker gene.

[0107] Additionally, modification of the expression regulatory region (or expression regulatory sequence) described in 2) above may be a deletion, insertion, non-conservative or conservative substitution, or a combination thereof, resulting in a mutation on the expression regulatory region (or expression regulatory sequence), or replacement with a sequence having weaker activity. The expression regulatory region includes, but is not limited to, a promoter, an operator sequence, a sequence encoding a ribosome binding site, and a sequence regulating the termination of transcription and translation.

[0108] The modification of the amino acid sequence or polynucleotide sequence of 3) and 4) above may be a sequence variation occurring by deletion, insertion, non-conservative or conservative substitution, or a combination thereof, of the amino acid sequence of the polypeptide or the polynucleotide sequence encoding the polypeptide to weaken the activity of the polypeptide, or a replacement with an amino acid sequence or polynucleotide sequence modified to have weaker activity or an amino acid sequence or polynucleotide sequence modified to have no activity, but is not limited thereto. For example, gene expression may be inhibited or weakened by introducing a variation within the polynucleotide sequence to form a stop codon, but is not limited thereto.

[0109] The above 5) modification of the nucleotide sequence encoding the start codon or 5'-UTR region of the gene transcript encoding the polypeptide may, for example, be a substitution with a nucleotide sequence encoding another start codon that has a lower polypeptide expression rate compared to the intrinsic start codon, but is not limited thereto.

[0110] For the introduction of an antisense oligonucleotide (e.g., antisense RNA) that binds complementarily to the transcript of the gene encoding the polypeptide 6) mentioned above, refer to the literature [Weintraub, H. et al., Antisense-RNA as a molecular tool for genetic analysis, Reviews - Trends in Genetics, Vol. 1(1) 1986].

[0111] 7) Adding a sequence complementary to the Shine-Dalgarno sequence to the front of the Shine-Dalgarno sequence of a polypeptide-coding gene to form a secondary structure in which ribosome attachment is impossible may make mRNA translation impossible or slow it down.

[0112] In addition, the addition of a promoter that is transcribed in the opposite direction to the 3' end of the ORF (open reading frame) of the gene sequence encoding the polypeptide (8) above (reverse transcription engineering, RTE) may weaken the activity by creating an antisense nucleotide complementary to the transcript of the gene encoding the polypeptide.

[0114] In this application, the term "enhancement" of the activity of a polypeptide means that the activity of the polypeptide is increased relative to its intrinsic activity. The term enhancement may be used interchangeably with terms such as activation, up-regulation, overexpression, and increase. Here, activation, enhancement, up-regulation, overexpression, and increase may include exhibiting activity that was not originally possessed, or exhibiting improved activity compared to the intrinsic activity or activity prior to modification. The statement that the activity of a polypeptide is "enhanced," "up-regulated," "overexpressed," or "increased" relative to its intrinsic activity means that it is improved compared to the activity and / or concentration (expression amount) of a specific polypeptide originally possessed by the parent strain or non-modified microorganism prior to transformation.

[0115] The above enhancement can be achieved by introducing an exogenous polypeptide or by enhancing the activity and / or concentration (expression amount) of the intrinsic polypeptide. Whether the activity of the polypeptide is enhanced can be confirmed by an increase in the activity level, expression amount, or amount of product released from the polypeptide.

[0116] The enhancement of the activity of the above polypeptide may be achieved by applying various methods well known in the art, and is not limited to, as long as the activity of the target polypeptide can be enhanced compared to that of the microorganism before modification. Specifically, it may utilize, but is not limited to, gene engineering and / or protein engineering known to a person skilled in the art, which are routine methods of molecular biology (e.g., Sitnicka et al. Functional Analysis of Genes. Advances in Cell Biology. 2010, Vol. 2. 1-16, Sambrook et al. Molecular Cloning 2012, etc.).

[0117] Specifically, the enhancement of the activity of the polypeptide of the present application is

[0118] 1) Increase in the intracellular copy number of polynucleotides encoding polypeptides;

[0119] 2) Replace the chromosomal gene expression regulatory region encoding a polypeptide with a potent sequence;

[0120] 3) A modification of the nucleotide sequence encoding the start codon or the 5'-UTR region of the gene transcript encoding the polypeptide;

[0121] 4) Modification of the amino acid sequence of the polypeptide to enhance polypeptide activity;

[0122] 5) Modification of the polynucleotide sequence encoding the polypeptide to enhance polypeptide activity (e.g., modification of the polynucleotide sequence of the polypeptide gene to code for a polypeptide modified to enhance polypeptide activity);

[0123] 6) Introduction of an exogenous polypeptide exhibiting polypeptide activity or an exogenous polynucleotide encoding the same;

[0124] 7) Codon optimization of polynucleotides encoding polypeptides;

[0125] 8) Analyze the tertiary structure of the polypeptide to select and modify or chemically modify the exposed sites; or

[0126] 9) It may be a combination of two or more selected from 1) to 8) above, but is not specifically limited thereto.

[0127] More specifically,

[0128] The increase in the intracellular copy number of the polynucleotide encoding the above 1) polypeptide may be achieved by introducing into a host cell a vector to which the polynucleotide encoding the said polypeptide is operably linked, which can replicate and function independently of the host. Alternatively, it may be achieved by introducing one or more copies of the polynucleotide encoding the said polypeptide into the chromosomes within the host cell. The introduction into the chromosomes may be performed by introducing into the host cell a vector capable of inserting said polynucleotide into the chromosomes within the host cell, but is not limited thereto. The said vector is as described above.

[0129] Replacing the gene expression regulatory region (or expression regulatory sequence) on the chromosome encoding the polypeptide mentioned in 2) above with a sequence having potent activity may, for example, involve deletion, insertion, non-conservative or conservative substitution, or a combination thereof, to further enhance the activity of the expression regulatory region, or may involve a sequence mutation, or replacement with a sequence having stronger activity. The expression regulatory region may include, but is not limited to, a promoter, an operator sequence, a sequence encoding a ribosome binding site, and a sequence regulating the termination of transcription and translation. As an example, the original promoter may be replaced with a potent promoter, but is not limited thereto.

[0130] Examples of known strong promoters include, but are not limited to, CJ1 to CJ7 promoters (US Patent No. 7662943 B2), lac promoter, trp promoter, trc promoter, tac promoter, lambda phage PR promoter, PL promoter, tet promoter, gapA promoter, SPL7 promoter, SPL13(sm3) promoter (US Patent No. 10584338 B2), O2 promoter (US Patent No. 10273491 B2), tkt promoter, yccA promoter, etc.

[0131] The above 3) modification of the nucleotide sequence encoding the start codon or 5'-UTR region of the gene transcript encoding the polypeptide may, for example, be a substitution with a nucleotide sequence encoding another start codon that has a higher polypeptide expression rate compared to the intrinsic start codon, but is not limited thereto.

[0132] The modification of the amino acid sequence or polynucleotide sequence of 4) and 5) above may be a sequence variation occurring by deletion, insertion, non-conservative or conservative substitution, or a combination thereof, of the amino acid sequence of the polypeptide or the polynucleotide sequence encoding the polypeptide to enhance the activity of the polypeptide, or a replacement with an amino acid sequence or polynucleotide sequence modified to have stronger activity or an amino acid sequence or polynucleotide sequence modified to increase activity, but is not limited thereto. Specifically, the replacement may be performed by inserting the polynucleotide into the chromosome by homologous recombination, but is not limited thereto. The vector used in this case may additionally include a selection marker to confirm whether the chromosome is inserted.

[0133] The introduction of an exogenous polynucleotide exhibiting the activity of the polypeptide mentioned in 6) above may be the introduction into a host cell of an exogenous polynucleotide encoding a polypeptide that exhibits the same or similar activity as the polypeptide. As long as the exogenous polynucleotide exhibits the same or similar activity as the polypeptide, there are no restrictions on its origin or sequence. The method used for the introduction may be performed by a person skilled in the art by appropriately selecting a known transformation method, and the polypeptide may be generated and its activity increased by the expression of the introduced polynucleotide within the host cell.

[0134] The above 7) codon optimization of a polynucleotide encoding a polypeptide may be a codon optimization of the intrinsic polynucleotide such that transcription or translation increases within the host cell, or a codon optimization of the extrinsic polynucleotide such that optimized transcription or translation occurs within the host cell.

[0135] 8) Analyzing the tertiary structure of the polypeptide above to select and modify or chemically modify an exposed site may, for example, involve determining a template protein candidate based on the degree of sequence similarity by comparing the sequence information of the polypeptide to be analyzed with a database in which sequence information of known proteins is stored, and confirming the structure based on this to select and modify or chemically modify an exposed site.

[0136] Such enhancement of polypeptide activity may involve increasing the activity or concentration of the corresponding polypeptide based on the activity or concentration of the polypeptide expressed in the wild-type or pre-modification microbial strain, or increasing the amount of the product produced from said polypeptide, but is not limited thereto.

[0138] Modification of part or all of a polynucleotide in the microorganism of the present application may be induced by (a) homologous recombination using a vector for chromosome insertion within the microorganism or genome editing using engineered nucleases (e.g., CRISPR-Cas9) and / or (b) treatment by light and / or chemicals such as ultraviolet rays and radiation, but is not limited thereto. The method of modifying part or all of the gene may include methods using DNA recombination technology. For example, deletion of part or all of the gene may be achieved by inducing homologous recombination by injecting a nucleotide sequence or vector containing a nucleotide sequence homologous to the target gene into the microorganism. The injected nucleotide sequence or vector may include a dominant selection marker, but is not limited thereto.

[0140] In the microorganism of the present application, variant prolyl isomerase, polynucleotide, and glutamic acid-based amino acids, etc., are as described in the other embodiments above.

[0142] Another aspect of the present application provides a method for producing glutamic acid-based amino acids, comprising the step of culturing a microorganism containing the variant prolyl isomerase of the present application or the polynucleotide of the present application in a medium.

[0143] The method for producing glutamic acid-based amino acids of the present application may include the step of culturing a microorganism comprising the variant prolyl isomerase of the present application, the polynucleotide of the present application, or the vector of the present application in a medium.

[0144] In this application, the term "culture" means growing the microorganism of this application under appropriately controlled environmental conditions. The culture process of this application may be carried out according to suitable media and culture conditions known in the art. Such a culture process can be easily adjusted and used by those skilled in the art depending on the microorganism selected. Specifically, the culture may be batch, continuous, and / or fed-batch, but is not limited thereto.

[0145] In this application, the term "medium" refers to a substance mixed with nutrients as the main component required to culture the microorganism of this application, and supplies nutrients and growth factors, including water, which is indispensable for survival and growth. Specifically, the medium and other culture conditions used for culturing the microorganism of this application may be any medium used for culturing ordinary microorganisms without special limitations; however, the microorganism of this application may be cultured under aerobic conditions while controlling the temperature, pH, etc., in a conventional medium containing a suitable carbon source, nitrogen source, phosphorus, inorganic compounds, amino acids, and / or vitamins.

[0146] Specifically, culture media for microorganisms of the genus Corynebacterium can be found in the literature ["Manual of Methods for General Bacteriology" by the American Society for Bacteriology (Washington DC, USA, 1981)].

[0147] In the present application, the carbon source may include carbohydrates such as glucose, saccharose, lactose, fructose, sucrose, maltose, etc.; sugar alcohols such as mannitol, sorbitol, etc.; organic acids such as pyruvate, lactic acid, citric acid, etc.; and amino acids such as glutamic acid, methionine, lysine, etc. Additionally, natural organic nutrient sources such as starch hydrolysate, molasses, blackstrap molasses, rice winter, cassava, sugarcane residue, and corn steeping liquid may be used. Specifically, carbohydrates such as glucose and sterilized pre-treated molasses (i.e., molasses converted into reducing sugars) may be used, and other carbon sources in appropriate amounts may be used in various ways without limitation. These carbon sources may be used individually or in combination of two or more types, but are not limited thereto.

[0148] The above nitrogen sources may include inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, ammonium carbonate, ammonium nitrate, etc.; and organic nitrogen sources such as amino acids such as glutamic acid, methionine, glutamine, etc., peptone, NZ-amine, meat extract, yeast extract, malt extract, corn steep liquid, casein hydrolysate, fish or its decomposition products, defatted soybean cake or its decomposition products, etc. These nitrogen sources may be used alone or in combination of two or more types, but are not limited thereto.

[0149] The above ingredients may include monopotassium phosphate, dipotassium phosphate, or corresponding sodium-containing salts. Inorganic compounds may include sodium chloride, calcium chloride, iron chloride, magnesium sulfate, iron sulfate, manganese sulfate, calcium carbonate, etc., and may also include amino acids, vitamins, and / or suitable precursors. These components or precursors may be added to the culture medium in a batch or continuous manner. However, they are not limited thereto.

[0150] In addition, during the cultivation of the microorganism of the present application, compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, sulfuric acid, etc., may be added to the medium in an appropriate manner to adjust the pH of the medium. In addition, during cultivation, an antifoaming agent such as fatty acid polyglycol ester may be used to suppress the formation of bubbles. Furthermore, to maintain an aerobic state of the medium, oxygen or an oxygen-containing gas may be injected into the medium, or nitrogen, hydrogen, or carbon dioxide gas may be injected without gas injection to maintain an anaerobic and microaerobic state, but is not limited thereto.

[0151] In the culture of the present application, the culture temperature may be maintained at 20 to 45 ℃, specifically 25 to 40 ℃, and culture may be carried out for about 10 to 160 hours, but is not limited thereto.

[0152] The glutamic acid-based amino acids produced by the culture of the present application may be secreted into the culture medium or remain within the cell. At this time, the glutamic acid-based amino acids are as described above.

[0154] The method for producing glutamic acid-based amino acids of the present application may additionally include, for example, the step of preparing a microorganism of the present application, the step of preparing a medium for culturing said microorganism, or a combination thereof (in any order), prior to the culturing step.

[0155] The method for producing glutamic acid-based amino acids according to the present application may further include a step of recovering glutamic acid-based amino acids from a culture medium (a culture medium in which the culture is performed) or a Corynebacterium glutamicum strain. The recovery step may be additionally included after the culture step.

[0156] The above recovery may involve collecting the desired glutamic acid-based amino acid using a suitable method known in the art according to the culture method of the microorganism of the present application, such as a batch, continuous, or fed-batch culture method. For example, various chromatographs such as centrifugation, filtration, treatment with a crystallizing protein precipitating agent (salting out method), extraction, ultrasonic disruption, ultrafiltration, dialysis, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, affinity chromatography, HPLC, or a combination thereof may be used, and the desired glutamic acid-based amino acid may be recovered from the culture medium or microorganism using a suitable method known in the art.

[0157] In addition, the method for producing glutamic acid-based amino acids of the present application may additionally include a purification step. The purification may be performed using a suitable method known in the art. In one example, where the method for producing glutamic acid-based amino acids of the present application includes both a recovery step and a purification step, the recovery step and the purification step may be performed continuously or discontinuously regardless of the order, or simultaneously or integrated into a single step, but are not limited thereto.

[0158] In the method of the present application, the variant prolyl isomerase, polynucleotide, vector, strain, and glutamic acid-based amino acid, etc., are as described in the other embodiments above.

[0160] Another aspect of the present application is to provide a composition for producing glutamic acid-based amino acids comprising a variant prolyl isomerase of the present application, a polynucleotide encoding the same, a vector comprising said polynucleotide, or a microorganism comprising the polynucleotide of the present application; a culture medium in which the same is cultured; or a combination of two or more of these.

[0161] The composition of the present application may further include any suitable excipients commonly used in compositions for producing L-amino acids, and such excipients may be, for example, preservatives, wetting agents, dispersants, suspending agents, buffers, stabilizers, or isotonic agents, but are not limited thereto.

[0163] Another aspect of the present application provides a use for the production of glutamic acid-based amino acids in a microorganism comprising the variant prolyl isomerase of the present application, a polynucleotide encoding the same, a vector comprising said polynucleotide, or the polynucleotide of the present application.

[0165] The above prolyl isomerase, variant prolyl isomerase, polynucleotide, vector, strain, medium, and glutamic acid-based amino acids, etc. are as described in the other embodiments above. Effects of the invention

[0167] When a microorganism that produces glutamic acid-based amino acids is cultured using the variant prolyl isomerase of the present application, it is possible to produce glutamic acid-based amino acids including ornithine, citrulline, arginine, and glutamine in high yield compared to a microorganism having the existing wild-type prolyl isomerase. Specific details for implementing the invention

[0169] The present application will be explained in more detail below through examples. However, the following examples are merely preferred embodiments for illustrating the present application and are therefore not intended to limit the scope of the rights of the present application. Meanwhile, technical matters not described in this specification can be fully understood and easily implemented by a person skilled in the art who is proficient in the technical field of the present application or a similar technical field.

[0171] Example 1: Construction of a variant prolyl isomerase expression vector

[0173] Coded for prolyl isomerase (FkpA) in wild-type Corynebacterium glutamicum fkpAVector was constructed to introduce Y95M, Y95S, Y95T, Y95N, Y95C, Y95H, Y95K, Y95D, Y95A, Y95V, Y95L, Y95Q, Y95G, Y95P, and Y95E point mutations into the gene.

[0174] To construct vectors for introducing each variant, the homologous recombinant A arm and homologous recombinant B arm were amplified using the genome of wild-type Corynebacterium glutamicum ATCC 13869 as a template, and the primer pairs used for each substitution residue are as shown in Table 1 below.

[0175] Substitution residue Primer pairs used for homologous recombinant A arm amplification Primer pairs used for homologous recombinant B arm amplification Methionine (Met) Sequence numbers 33 and 34 Sequence numbers 35 and 50 Serin Sequence numbers 33 and 34 Sequence numbers 36 and 50 Threonine (Thr) Sequence numbers 33 and 34 Sequence numbers 37 and 50 Asparagine (Asn) Sequence numbers 33 and 34 Sequence numbers 38 and 50 Cysteine ​​(Cys) Sequence numbers 33 and 34 Sequence numbers 39 and 50 Histidine (His) Sequence numbers 33 and 34 Sequence numbers 40 and 50 Lysine (Lys) Sequence numbers 33 and 34 Sequence numbers 41 and 50 Aspartic acid (Asp) Sequence numbers 33 and 34 Sequence numbers 42 and 50 Alanine (Ala) Sequence numbers 33 and 34 Sequence numbers 43 and 50 Valin Sequence numbers 33 and 34 Sequence numbers 44 and 50 Leucine Sequence numbers 33 and 34 Sequence numbers 45 and 50 Glutamine (Gln) Sequence numbers 33 and 34 Sequence numbers 46 and 50 Glycine Sequence numbers 33 and 34 Sequence numbers 47 and 50 Proline (Pro) Sequence numbers 33 and 34 Sequence numbers 48 and 50 Glutamic acid (Glu) Sequence numbers 33 and 34 Sequence numbers 49 and 50

[0176] The PCR conditions involved denaturation at 95°C for 5 minutes, followed by 30 cycles of denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, and polymerization at 72°C for 1 minute, followed by polymerization at 72°C for 5 minutes. Subsequently, PCR fragments were extracted using a gel purification kit (QIAGEN). The homologous recombinant A arm and B arm gene fragments obtained above were linked to the vector pDCM2 (Korean Patent Publication No. 10-2020-0136813), which had been cleaved with BamHI and XbaI restriction enzymes, using the Gibson assembly method (DG Gibson et al., NATURE METHODS, VOL.6 NO.5, MAY 2009, NEBuilder HiFi DNA Assembly Master Mix). These were each transformed into E. coli DH5α and plated on LB solid medium containing 25 mg / L of kanamycin. PCR was performed using the primer pair of SEQ ID NOs 51 and 52 to select transformed colonies. Plasmids are obtained from selected colonies using a commonly known plasmid extraction method, and the obtained plasmids are respectively pDCM2-fkpA(Y95M), pDCM2-fkpA(Y95S), pDCM2-fkpA(Y95T), pDCM2-fkpA(Y95N), pDCM2-fkpA(Y95C), pDCM2-fkpA(Y95H), pDCM2-fkpA(Y95K), pDCM2-fkpA(Y95D), pDCM2-fkpA(Y95A), pDCM2-fkpA(Y95V), pDCM2-fkpA(Y95L), pDCM2-fkpA(Y95Q), pDCM2-fkpA(Y95G), pDCM2-fkpA(Y95P), and It was named pDCM2-fkpA(Y95E).

[0177] The primer sequences used here are as shown in Table 2 below.

[0178] Sequence number Ranking name Sequence(5' -> 3') 33 primer 1 TCGGTACCCGGGGATCCGTATTGTTCGCAATCG 34 primer 2 AGCAGCCTCTGGCGGAATGGTCAGC 35 primer 3 TCCGCCAGAGGCTGCTATGGGCCCTGAGGGTTCCG 36 primer 4 TCCGCCAGAGGCTGCTTCCGGCCCTGAGGGTTCCG 37 primer 5 TCCGCCAGAGGCTGCTACCGGCCCTGAGGGTTCCG 38 primer 6 TCCGCCAGAGGCTGCTAACGGCCCTGAGGGTTCCG 39 primer 7 TCCGCCAGAGGCTGCTTGCGGCCCTGAGGGTTCCG 40 primer 8 TCCGCCAGAGGCTGCTCACGGCCCTGAGGGTTCCG 41 primer 9 TCCGCCAGAGGCTGCTAAGGGCCCTGAGGGTTCCG 42 primer 10 TCCGCCAGAGGCTGCTGATGGCCCTGAGGGTTCCG 43 primer 11 TCCGCCAGAGGCTGCTGCAGGCCCTGAGGGTTCCG 44 primer 12 TCCGCCAGAGGCTGCTGTGGGCCCTGAGGGTTCCG 45 primer 13 TCCGCCAGAGGCTGCTCTGGGCCCTGAGGGTTCCG 46 primer 14 TCCGCCAGAGGCTGCTCAGGGCCCTGAGGGTTCCG 47 primer 15 TCCGCCAGAGGCTGCTGGCGGCCCTGAGGGTTCCG 48 primer 16 TCCGCCAGAGGCTGCTCCAGGCCCTGAGGGTTCCG 49 primer 17 TCCGCCAGAGGCTGCTGAAGGCCCTGAGGGTTCCG 50 primer 18 TGCAGGTCGACTCTAGACTGCCGATCGTGTCCATC 51 primer 19 TATTACGCCAGCTGGCGAAA 52 primer 20 GCTTTACACTTTATGCTTCC

[0180] Example 2: Evaluation of L-citrulline production capacity

[0182] Example 2-1. Preparation of the control group

[0183] To construct a control strain for the L-citrulline production evaluation experiment, a vector was designed by replacing the glutamic acid at position 47 of the argR(ANU33619.1) protein sequence with a stop codon. Wild type C. glutamicum Using the genome of ATCC 13869 as a template, the homologous recombinant A arm was amplified using the primer pair of SEQ ID NOs 53 and 54, and the homologous recombinant B arm was amplified using the primer pair of SEQ ID NOs 55 and 56. Subsequently, a plasmid was obtained in the same manner as in Example 1, and this plasmid was named pDCM2-argR(E47*).

[0184] In addition, to produce a microorganism with enhanced L-citrulline production capacity, a vector was constructed by replacing the phenylalanine located at protein sequence 68 of argG (ANU33620.1) with a stop codon. Using the genome of C. glutamicum ATCC13869 as a template, the homologous recombinant A arm was amplified using primers SEQ ID NOs 57 and 58, and the homologous recombinant B arm was amplified using primers SEQ ID NOs 59 and 60. Subsequently, a plasmid was obtained using the method described in Example 1, and this plasmid was named pDCM2-argG(F68*).

[0185] The primer sequences used here are as shown in Table 3 below.

[0186] Sequence number Ranking name Sequence(5' -> 3') 53 primer 21 CGGTACCCGGGGATCCCTCGTGCGGAATTCGTGGAG 54 primer 22 ATCCAGCAGCAATTCAGACA 55 primer 23 CTGAATTGCTGCTGGATTAAGGCATCGATTCACCCCA 56 primer 24 ATGCCTGCAGGTCGACCCTTCATTTTAAGTTCCTTG 57 primer 25 CGGTACCCGGGGATCCTTCATCGATAGGGTGGG 58 primer 26 GTACTCCTCCAGCTTACTCATCCTTTGCATCAACA 59 primer 27 AGTAAGCTGAGGAGTACTGCCTGCCAACCATCAA 60 primer 28 ATGCCTGCAGGTCGACCGACTGGCTTTGCCACCCT

[0187] Using the generated pDCM2-argR(E47*) vector, the wild type C. glutamicumAfter transforming ATCC 13869 by electroporation (Appl. Microbiol. Biotechnol. (1999) 52:541-545), a strain was obtained through a secondary crossover process in which the 139th nucleotide sequence of argR was replaced from guanine (g) to thymine (t) and the 47th protein sequence was replaced with a stop codon. PCR and sequencing analysis were performed using primer pairs of SEQ ID NOs 53 and 56, which can amplify adjacent regions including the site where the gene was inserted, and the genetic manipulation was confirmed. The microorganism obtained in this way was named C. gl::argR*.

[0188] To construct a microorganism with enhanced citrulline production from the C. gl::argR* obtained above, the microorganism was obtained in the same manner using the pDCM2-argG(F68*) vector. PCR and sequencing analysis were performed using the primer pair of SEQ ID NOs 57 and 60, which can amplify adjacent regions including the site where the gene was inserted, and the genetic manipulation was confirmed. The microorganism obtained in this way was named C. gl::argR*_argG*.

[0190] 실시예 2-2. 변이형 프롤릴 이성화효소 발현 균주의 제작

[0191] To construct mutant strains with point mutations introduced into prolyl isomerase based on the C. gl::argR*_argG* strain obtained in Example 2-1, the pDCM2-fkpA(Y95M), pDCM2-fkpA(Y95S), pDCM2-fkpA(Y95T), pDCM2-fkpA(Y95N), pDCM2-fkpA(Y95C), pDCM2-fkpA(Y95H), pDCM2-fkpA(Y95K), pDCM2-fkpA(Y95D), pDCM2-fkpA(Y95A), pDCM2-fkpA(Y95V), pDCM2-fkpA(Y95L), and pDCM2-fkpA(Y95Q) of Example 1 After transforming the C. gl::argR*_argG* strain by electroporation using pDCM2-fkpA(Y95G), pDCM2-fkpA(Y95P), and pDCM2-fkpA(Y95E), strains were obtained in which tyrosine, the 95th amino acid from the N-terminus of prolyl isomerase, was substituted with methionine, serine, threonine, asparagine, cysteine, histidine, lysine, aspartic acid, alanine, valine, leucine, glutamine, glycine, proline, or glutamic acid, respectively, through a secondary crossover process. From the genome of the obtained strain, a DNA fragment containing the fkpA gene within the chromosome was PCR amplified using the primer pair of SEQ ID NOs. 33 and 50. The PCR conditions involved denaturation at 95°C for 10 minutes, followed by 30 cycles of denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, and polymerization at 72°C for 2 minutes, after which the polymerization reaction was performed at 72°C for 10 minutes. As a result of analyzing the nucleotide sequences of the amplified genes, in each strain fkpA It was confirmed that a mutation was introduced into the 283rd–285th lower nucleotide sequence from the ORF start codon of the gene (Table 4).

[0192] 치환 전 아미노산(염기서열) 치환 후 아미노산(염기서열) Tyr(TAC) Met(ATG) Ser(TCC) Thr(ACC) Asn(AAC) Cys(TGC) His(CAC) Lys(AAG) Asp(GAT) Ala(GCA) Val(GTG) Leu(CTG) Gln(CAG) Gly(GGC) Pro(CCA) Glu(GAA)

[0193] Accordingly, mutant strains were obtained based on the C. gl::argR*_argG* strain in which tyrosine, the 95th amino acid from the N-terminus of prolyl isomerase, was substituted with methionine, serine, threonine, asparagine, cysteine, histidine, lysine, aspartic acid, alanine, valine, leucine, glutamine, glycine, proline, or glutamic acid, respectively, and the obtained mutant strains were respectively C. gl::argR*_argG*_fkpA(Y95M), C. gl::argR*_argG*_fkpA(Y95S), C. gl::argR*_argG*_fkpA(Y95T), C. gl::argR*_argG*_fkpA(Y95N), C. gl::argR*_argG*_fkpA(Y95C), C. gl::argR*_argG*_fkpA(Y95H), C. gl::argR*_argG*_fkpA(Y95K), C. gl::argR*_argG*_fkpA(Y95D), C. gl::argR*_argG*_fkpA(Y95A), C. gl::argR*_argG*_fkpA(Y95V), C. gl::argR*_argG*_fkpA(Y95L), C. gl::argR*_argG*_fkpA(Y95Q), C. gl::argR*_argG*_fkpA(Y95G), C. It was named gl::argR*_argG*_fkpA(Y95P), C. gl::argR*_argG*_fkpA(Y95E).

[0195] 실시예 2-3. 시트룰린 생산능 평가

[0196] C. gl::argR*_argG*_fkpA(Y95M), C. gl::argR*_argG*_fkpA(Y95S), C. gl::argR*_argG*_fkpA(Y95T), C. gl::argR*_argG*_fkpA(Y95N) of Example 2-2, C. gl::argR*_argG*_fkpA(Y95C), C. gl::argR*_argG*_fkpA(Y95H), C. gl::argR*_argG*_fkpA(Y95K), C. gl::argR*_argG*_fkpA(Y95D), C. gl::argR*_argG*_fkpA(Y95A), C. The L-citrulline production capacity of strains gl::argR*_argG*_fkpA(Y95V), C. gl::argR*_argG*_fkpA(Y95L), C. gl::argR*_argG*_fkpA(Y95Q), C. gl::argR*_argG*_fkpA(Y95G), C. gl::argR*_argG*_fkpA(Y95P), and C. gl::argR*_argG*_fkpA(Y95E) and the control strain C. gl::argR*_argG* was compared by culturing them in the production medium as described below. Each strain was inoculated into a 250 mL corner-baffle flask containing 25 mL of production medium and cultured at 33°C for 48 hours with shaking at 200 rpm. After the culture was finished, the concentration of citrulline was measured using HPLC, and the results are shown in Table 5 below.

[0198] Production Medium

[0199] Raw sugar 50 g, (NH4)2SO4 30 g, yeast extract 1 g, KH2PO4 1.1 g, MgSO4·7H2O 1.2 g, L-arginine 0.2 g, biotin 1 mg, thiamine hydrochloride 5 mg, calcium-pantothenic acid 5 mg, nicotinamide 15 mg, MnSO4 10 mg, FeSO4 10 mg, ZnSO4 0.5 mg, CuSO4 0.5 mg, CaCO3 30 g, pH 7.2 (based on 1 liter of distilled water)

[0200] 균주 L-시트룰린 농도 (g / L) C. gl::argR*_argG* 3.0 C. gl::argR*_argG*_fkpA(Y95M) 4.8 C. gl::argR*_argG*_fkpA(Y95S) 4.7 C. gl::argR*_argG*_fkpA(Y95T) 4.8 C. gl::argR*_argG*_fkpA(Y95N) 4.8 C. gl::argR*_argG*_fkpA(Y95C) 4.7 C. gl::argR*_argG*_fkpA(Y95H) 4.2 C. gl::argR*_argG*_fkpA(Y95K) 4.3 C. gl::argR*_argG*_fkpA(Y95D) 4.4 C. gl::argR*_argG*_fkpA(Y95A) 4.2 C. gl::argR*_argG*_fkpA(Y95V) 4.9 C. gl::argR*_argG*_kpA(Y95L) 4.4 C. gl::argR*_argG*_fkpA(Y95Q) 4.4 C. gl::argR*_argG*_fkpA(Y95G) 4.6 C. gl::argR*_argG*_fkpA(Y95P) 4.4 C. gl::argR*_argG*_fkpA(Y95E) 4.4

[0201] As a result, as shown in Table 5 above, all strains in which tyrosine, the 95th amino acid from the N-terminus of prolyl isomerase, was substituted with methionine, serine, threonine, asparagine, cysteine, histidine, lysine, aspartic acid, alanine, valine, leucine, glutamine, glycine, proline, or glutamic acid, respectively, showed increased citrulline production and yield compared to the control strain C. gl::argR*_argG*.

[0203] 실시예 3: L-글루타민 생산능 평가

[0205] Example 3-1. Establishment of control group and preparation of variant prolyl isomerase-expressing strain

[0206] KFCC10680 (Korean Patent No. 10-0048440) was used as a control strain for evaluating L-glutamine production capacity.

[0207] In order to construct a mutant strain in which a point mutation is introduced into the prolyl isomerase based on the above KFCC10680 strain, pDCM2-fkpA(Y95M), pDCM2-fkpA(Y95S), pDCM2-fkpA(Y95T), pDCM2-fkpA(Y95N), pDCM2-fkpA(Y95C), pDCM2-fkpA(Y95H), pDCM2-fkpA(Y95K), pDCM2-fkpA(Y95D), pDCM2-fkpA(Y95A), pDCM2-fkpA(Y95V), pDCM2-fkpA(Y95L), pDCM2-fkpA(Y95Q), pDCM2-fkpA(Y95G) of Example 1 Among pDCM2-fkpA (Y95P) and pDCM2-fkpA (Y95E), the KFCC10680 strain was transformed by electroporation using pDCM2-fkpA (Y95V) substituted with a nonpolar amino acid, pDCM2-fkpA (Y95T) substituted with a polar amino acid, and pDCM2-fkpA (Y95D) substituted with a charged amino acid. After undergoing a secondary crossover process, strains were obtained in which tyrosine, the 95th amino acid from the N-terminus of prolyl isomerase, was substituted with valine, threonine, and aspartic acid, respectively. From the genome of the obtained strain, DNA fragments containing the fkpA gene within the chromosome were PCR amplified using the primer pair of SEQ ID NOs. 33 and 50. The PCR conditions involved denaturation at 95°C for 10 minutes, followed by 30 cycles of denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, and polymerization at 72°C for 2 minutes, after which the polymerization reaction was performed at 72°C for 10 minutes. As a result of analyzing the nucleotide sequences of the amplified genes, in each strain fkpA It was confirmed that a mutation was introduced into the 283rd–285th lower nucleotide sequence from the ORF start codon of the gene (Table 6).

[0208] amino acids (base sequences) before substitution Amino acid (base sequence) after substitution Tyr(TAC) Val(GTG) Thr(ACC) Asp(GAT)

[0209] Accordingly, mutant strains were obtained based on the KFCC10680 strain in which tyrosine, the 95th amino acid from the N-terminus of prolyl isomerase, was substituted with valine, threonine, and aspartic acid, respectively, and the obtained mutant strains were named KFCC10680::fkpA(Y95V), KFCC10680::fkpA(Y95T), and KFCC10680::fkpA(Y95D), respectively.

[0211] Example 3-2. Evaluation of Glutamine Production Capacity

[0212] The L-glutamine production ability of the KFCC10680::fkpA(Y95V), KFCC10680::fkpA(Y95T), and KFCC10680::fkpA(Y95D) strains of Example 3-1 above and the control strain KFCC10680 was compared by culturing them in the production medium as described below. Each strain was inoculated into a 250 mL corner-baffle flask containing 25 mL of production medium and cultured at 32°C for 48 hours with shaking at 200 rpm. After the culture was completed, the concentration of glutamine was measured using HPLC, and the results are shown in Table 7 below.

[0214] Production Medium

[0215] Raw sugar 60 g, (NH4)2SO4 30 g, yeast extract 1 g, KH2PO 40.6 g, MgSO4·7H2O 0.6 g, biotin 0.8 mg, thiamine hydrochloride 4 mg, calcium-pantothenic acid 4 mg, nicotinamide 20 mg, MnSO 48 mg, FeSO 48 mg, ZnSO 40.4 mg, CuSO 40.4 mg, CaCO3 30 g, pH 6.8 (based on 1 liter of distilled water)

[0216] strain L-glutamine production (g / L) KFCC10680 13.2 KFCC10680::fkpA(Y95V) 16.6 KFCC10680::fkpA(Y95T) 16.5 KFCC10680::fkpA(Y95D) 15.5

[0217] As a result, as shown in Table 7 above, all strains in which tyrosine, the 95th amino acid from the N-terminus of prolyl isomerase, was substituted with valine, threonine, and aspartic acid, respectively, showed increased glutamine production and yield compared to the control strain KFCC10680.

[0219] Example 4: Evaluation of L-Ornithine Production Capacity

[0221] Example 4-1. Preparation of the control group

[0222] To construct a control strain for the L-ornithine production capacity evaluation experiment, a vector was constructed by replacing the serine located at protein sequence 55 of ArgF (ANU33618.1) with a stop codon. Using the genome of wild-type C. glutamicum ATCC13869 as a template, the homologous recombinant A arm was amplified using the primer pair of SEQ ID NOs 61 and 62, and the homologous recombinant B arm was amplified using the primer pair of SEQ ID NOs 63 and 64. Subsequently, a plasmid was obtained in the same manner as in Example 1 and named pDCM2-argF(S55*).

[0223] In addition, to produce a microorganism with enhanced L-ornithine production capacity, a vector was constructed by replacing the glutamic acid located at protein sequence 47 of ArgR (ANU33619.1) with a stop codon. Using the genome of wild-type C. glutamicum ATCC 13869 as a template, the homologous recombinant A arm was amplified using the primer pair of SEQ ID NOs 53 and 54, and the homologous recombinant B arm was amplified using the primer pair of SEQ ID NOs 55 and 56. Subsequently, a plasmid was obtained in the same manner as in Example 1, and this plasmid was named pDCM2-argR(E47*).

[0224] The primer sequences used here are as shown in Table 8 below.

[0225] Sequence number Ranking name Sequence(5' -> 3') 53 primer 21 CGGTACCCGGGGATCCCTCGTGCGGAATTCGTGGAG 54 primer 22 ATCCAGCAGCAATTCAGACA 55 primer 23 CTGAATTGCTGCTGGATTAAGGCATCGATATCACCCA 56 primer 24 ATGCCTGCAGGTCGACCCTTCATTTTAAGTTCCTTG 61 primer 29 CGGTACCCGGGATCCTGACCCCAGGCAAGCACGG 62 primer 30 GAAGCGAGTACGAGTTTAAGTCTTATC 63 primer 31 AAACTCGTACTCGCTTCTCC 64 primer 32 ATGCCTGCAGGTCGACCGGCGCCGGCAACCTCGTC

[0226] Using the generated pDCM2-argF(S55*) vector, the wild type C. glutamicumAfter transforming ATCC 13869 by electroporation (Appl. Microbiol. Biotechnol. (1999) 52:541-545), a microorganism was obtained in which the 164th nucleotide sequence of argF was substituted from cytosine (c) to adenine (a) and the 55th protein sequence was substituted with a stop codon through a secondary crossover process. PCR and sequencing analysis were performed using primer pairs of SEQ ID NOs 61 and 64, which can amplify adjacent regions including the site where the gene was inserted, and the genetic manipulation was confirmed. The microorganism obtained in this way was named C. gl::argF*.

[0227] To construct a microorganism with enhanced ornithine production from the C. gl::argF* obtained above, the microorganism was obtained using the pDCM2-argR(E47*) vector in the same manner as above. PCR and sequencing analysis were performed using the primer pair of SEQ ID NOs 53 and 56, which can amplify adjacent regions including the site where the gene was inserted, and the genetic manipulation was confirmed. The microorganism obtained in this way was named C. gl::argR*_argF*.

[0229] Example 4-2. Preparation of a variant prolyl isomerase-expressing strain

[0230] To construct a mutant strain in which a point mutation was introduced into the prolyl isomerase based on the C. gl::argR*_argF* strain obtained in Example 4-1, the C. gl::argR*_argF* strain was transformed by electroporation using pDCM2-fkpA(Y95V), pDCM2-fkpA(Y95T), and pDCM2-fkpA(Y95D) from Example 1, and then a secondary crossover process was performed to obtain strains in which tyrosine, the 95th amino acid from the N-terminus of the prolyl isomerase, was substituted with valine, threonine, and aspartic acid, respectively. From the genome of the obtained strain, a DNA fragment containing the fkpA gene within the chromosome was PCR amplified using the primer pair of SEQ ID NOs. 33 and 50. The PCR conditions involved denaturation at 95°C for 10 minutes, followed by 30 cycles of denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, and polymerization at 72°C for 2 minutes, after which the polymerization reaction was performed at 72°C for 10 minutes. As a result of analyzing the nucleotide sequences of the amplified genes, in each strain fkpA It was confirmed that a mutation was introduced into the 283rd–285th lower nucleotide sequence from the ORF start codon of the gene (Table 9).

[0231] amino acids (base sequences) before substitution Amino acid (base sequence) after substitution Tyr(TAC) Val(GTG) Thr(ACC) Asp(GAT)

[0232] Accordingly, mutant strains were obtained based on the C. gl::argR*_argF* strain in which tyrosine, the 95th amino acid from the N-terminus of prolyl isomerase, was substituted with valine, threonine, and aspartic acid, respectively, and the obtained mutant strains were named C. gl::argR*_argF*_fkpA(Y95V), C. gl::argR*_argF*_fkpA(Y95T), and C. gl::argR*_argF*_fkpA(Y95D), respectively.

[0234] Example 4-3. Evaluation of Ornithine Production Capacity

[0235] The L-ornithine production ability of the strains C. gl::argR*_argF*_fkpA (Y95V), C. gl::argR*_argF*_fkpA (Y95T), and C. gl::argR*_argF*_fkpA (Y95D) from Example 4-2 above and the control strain C. gl::argR*_argF* was compared by culturing them in the production medium as described below. Each strain was inoculated into a 250 mL corner-baffle flask containing 25 mL of production medium and cultured at 32°C for 48 hours with shaking at 200 rpm. After the culture was completed, the concentration of ornithine was measured using HPLC, and the results are shown in Table 10 below.

[0237] Production Medium

[0238] Raw sugar 50 g, (NH4)2SO4 30 g, yeast extract 1 g, KH2PO4 1.1 g, MgSO4·7H2O 1.2 g, L-arginine 0.2 g, biotin 1 mg, thiamine hydrochloride 5 mg, calcium-pantothenic acid 5 mg, nicotinamide 15 mg, MnSO4 10 mg, FeSO4 10 mg, ZnSO4 0.5 mg, CuSO4 0.5 mg, CaCO3 30 g, pH 7.2 (based on 1 liter of distilled water)

[0239] strain L-ornithine production (g / L) C. gl::argR*_argF* 15.7 C. gl::argR*_argF*_fkpA(Y95V) 16.4 C. gl::argR*_argF*_fkpA(Y95T) 16.3 C. gl::argR*_argF*_fkpA(Y95D) 16.1

[0240] As a result, as shown in Table 10 above, all strains in which tyrosine, the 95th amino acid from the N-terminus of prolyl isomerase, was substituted with valine, threonine, and aspartic acid, respectively, showed increased ornithine production and yield compared to the control strain C. gl::argR*_argF*.

[0242] Example 5: Evaluation of L-arginine production capacity

[0244] Example 5-1. Preparation of the control group

[0245] To construct a control strain for the evaluation of L-arginine production capacity, a vector was constructed by replacing the glutamic acid located at protein sequence 47 of ArgR (ANU33619.1) with a stop codon. Using the genome of wild-type C. glutamicum ATCC 13869 as a template, the homologous recombinant A arm was amplified using the primer pair of SEQ ID NOs 53 and 54, and the homologous recombinant B arm was amplified using the primer pair of SEQ ID NOs 55 and 56. Subsequently, a plasmid was obtained using the same method as above and named pDCM2-argR(E47*).

[0246] The primer sequences used here are as shown in Table 11 below.

[0247] Sequence number Ranking name Sequence(5' -> 3') 53 primer 21 CGGTACCCGGGGATCCCTCGTGCGGAATTCGTGGAG 54 primer 22 ATCCAGCAGCAATTCAGACA 55 primer 23 CTGAATTGCTGCTGGATTAAGGCATCGATATCACCCA 56 primer 24 ATGCCTGCAGGTCGACCCTTCATTTTAAGTTCCTTG

[0248] Using the generated pDCM2-argR(E47*) vector, the wild type C. glutamicum After transforming ATCC 13869 by electroporation (Appl. Microbiol. Biotechnol. (1999) 52:541-545), a strain was obtained through a secondary crossover process in which the 139th nucleotide sequence of argR was replaced from guanine (g) to thymine (t) and the 47th protein sequence was replaced with a stop codon. PCR and sequencing analysis were performed using primer pairs of SEQ ID NOs 53 and 56, which can amplify adjacent regions including the site where the gene was inserted, and the genetic manipulation was confirmed. The microorganism obtained in this way was named C. gl::argR*.

[0250] Example 5-2. Preparation of a variant prolyl isomerase-expressing strain

[0251] To construct a mutant strain in which a point mutation was introduced into the prolyl isomerase based on the C. gl::argR* strain obtained in Example 5-1, the C. gl::argR* strain was transformed by electroporation using pDCM2-fkpA(Y95V), pDCM2-fkpA(Y95T), and pDCM2-fkpA(Y95D) from Example 1, and then a secondary crossover process was performed to obtain strains in which tyrosine, the 95th amino acid from the N-terminus of the prolyl isomerase, was substituted with valine, threonine, and aspartic acid, respectively. From the genome of the obtained strain, a DNA fragment containing the fkpA gene within the chromosome was PCR amplified using the primer pair of SEQ ID NOs. 33 and 50. The PCR conditions involved denaturation at 95°C for 10 minutes, followed by 30 cycles of denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, and polymerization at 72°C for 2 minutes, after which the polymerization reaction was performed at 72°C for 10 minutes. As a result of analyzing the nucleotide sequences of the amplified genes, in each strain fkpA It was confirmed that a mutation was introduced into the 283rd–285th lower nucleotide sequence from the ORF start codon of the gene (Table 12).

[0252] amino acids (base sequences) before substitution Amino acid (base sequence) after substitution Tyr(TAC) Val(GTG) Thr(ACC) Asp(GAT)

[0253] Accordingly, mutant strains were obtained based on the C. gl::argR* strain in which tyrosine, the 95th amino acid from the N-terminus of prolyl isomerase, was substituted with valine, threonine, and aspartic acid, respectively, and the obtained mutant strains were named C. gl::argR*_ fkpA(Y95V), C. gl::argR*_fkpA(Y95T), and C. gl::argR*_fkpA(Y95D), respectively.

[0255] Example 5-3. Evaluation of Arginine Production Capacity

[0256] The L-arginine production capacity of the strains C. gl::argR*_fkpA(Y95V), C. gl::argR*_fkpA(Y95T), and C. gl::argR*_(Y95D) from Example 5-2 above and the control strain C. gl::argR* was compared by culturing them in the production medium as described below. Each strain was inoculated into a 250 mL corner-baffle flask containing 25 mL of production medium and cultured at 32 °C for 48 hours with shaking at 200 rpm. After the culture was completed, the concentration of arginine was measured using HPLC, and the results are shown in Table 13 below.

[0258] Production Medium

[0259] Raw sugar 50 g, (NH4)2SO4 30 g, yeast extract 1 g, KH2PO4 1.1 g, MgSO4·7H2O 1.2 g, L-arginine 0.2 g, biotin 1 mg, thiamine hydrochloride 5 mg, calcium-pantothenic acid 5 mg, nicotinamide 15 mg, MnSO4 10 mg, FeSO4 10 mg, ZnSO4 0.5 mg, CuSO4 0.5 mg, CaCO3 30 g, pH 7.2 (based on 1 liter of distilled water)

[0260] strain L-arginine production (g / L) C. gl::argR* 1.3 C. gl::argR*_fkpA(Y95V) 3.0 C. gl::argR*_fkpA(Y95T) 3.1 C. gl::argR*_fkpA(Y95D) 2.7

[0261] As shown in Table 13 above, strains in which tyrosine, the 95th amino acid from the N-terminus of prolyl isomerase, was substituted with valine, threonine, and aspartic acid, respectively, all showed increased arginine production and yield compared to the control strain C. gl::argR*.

[0263] From the foregoing description, those skilled in the art to which this application pertains will understand that this application may be implemented in other specific forms without altering its technical concept or essential features. In this regard, the embodiments described above should be understood as illustrative in all respects and not restrictive. The scope of this application should be interpreted as including all modifications or variations derived from the meaning and scope of the claims set forth below and their equivalents, rather than from the detailed description above.

Claims

Claim 1 A variant prolyl isomerase in which the amino acid corresponding to the 95th position in the amino acid sequence of SEQ ID NO. 1 is substituted with another amino acid, wherein the other amino acid is one or more selected from the group consisting of methionine, serine, threonine, asparagine, cysteine, histidine, lysine, aspartic acid, alanine, valine, leucine, glutamine, glycine, proline, and glutamic acid. Claim 2 delete Claim 3 Polynucleotide encoding the variant prolyl isomerase of claim 1. Claim 4 A microorganism comprising: a variant prolyl isomerase in which the amino acid corresponding to the 95th position in the amino acid sequence of SEQ ID NO. 1 is substituted with another amino acid; a polynucleotide encoding the same; and one or more selected from a vector comprising said polynucleotide, wherein said other amino acid is one or more selected from the group consisting of methionine, serine, threonine, asparagine, cysteine, histidine, lysine, aspartic acid, alanine, valine, leucine, glutamine, glycine, proline, and glutamic acid. Claim 5 In paragraph 4, the microorganism is a microorganism having increased production capacity of glutamic acid-based amino acids compared to a Corynebacterium microorganism containing a wild-type prolyl isomerase having the amino acid sequence of SEQ ID NO. 1 or a polynucleotide encoding the same. Claim 6 A microorganism according to claim 5, wherein the glutamic acid-based amino acid is one or more selected from the group consisting of glutamic acid, citrulline, glutamine, ornithine, and arginine. Claim 7 In paragraph 4, the microorganism is a microorganism of the genus Corynebacterium. Claim 8 In claim 7, the microorganism of the genus Corynebacterium is Corynebacterium glutamicum. Claim 9 A method for producing glutamic acid-based amino acids, comprising the step of culturing a microorganism in a medium comprising: a variant prolyl isomerase in which the amino acid corresponding to the 95th position in the amino acid sequence of SEQ ID NO. 1 is substituted with another amino acid; or a polynucleotide encoding the same, wherein the other amino acid is one or more selected from the group consisting of methionine, serine, threonine, asparagine, cysteine, histidine, lysine, aspartic acid, alanine, valine, leucine, glutamine, glycine, proline, and glutamic acid. Claim 10 A method according to claim 9, wherein the glutamic acid-based amino acid is one or more selected from the group consisting of glutamic acid, citrulline, glutamine, ornithine, and arginine.

Images