Novel Saccharomyces cerevisiae strain with acid-resistance, bile tolerance, and microplastic adhesion ability and uses thereof

KR103014228B1Active Publication Date: 2026-09-04KOREA FOOD RES INST
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
KR1020230158103
Authority / Receiving Office
KR · KR
Patent Type
Patents
Current Assignee / Owner
Filing Date
2023-11-15
Publication Date
2026-09-04
Estimated Expiration
2043-11-15

Smart Images

  • Figure 112023126370682-PAT00001_ABST
    Figure 112023126370682-PAT00001_ABST
Patent Text Reader

Abstract

The present invention relates to a strain of Saccharomyces cerevisiae that possesses conditions as a prebiotic, such as acid resistance and bile resistance, and has excellent adhesion ability to microplastics, thereby having an effect of removing microplastics in the environment and in vivo.
Need to check novelty before this filing date? Find Prior Art

Description

Technology Field

[0001] The present invention relates to a strain of Saccharomyces cerevisiae, and more specifically, to a strain of Saccharomyces cerevisiae having acid resistance, bile resistance, and microplastic adhesion ability. Background Technology

[0002] Plastics, possessing excellent properties such as plasticity, flexibility, thermal and electrical insulation, and corrosion resistance, are also inexpensive to produce. As a result, their usage is gradually increasing across all aspects of daily life, and consequently, the amount of discarded plastic is also rising.

[0003] Discarded plastics break down into tiny fragments due to factors such as ultraviolet rays and weathering, decomposing to the point where they are invisible to the naked eye. These fragments remain extensively in the natural environment, including soil, air, and oceans. Furthermore, they are absorbed by animals and plants, accumulating within their bodies without decomposing, and exert a significant impact on marine life, humans, and the global ecosystem itself that consume them. In particular, microplastics often exist combined with various toxins (heavy metals, PAHs, PCBs, OCPs, PBDEs, etc.) and harmful microorganisms (such as Vibrio parahaemolyticus), thus posing a risk of toxicity within the body.

[0004] Although the need to control these microplastics is continuously being raised, they are difficult to detect and separate due to their extremely small size. Consequently, recent efforts have focused on developing new biodegradable microplastics or discovering new microorganisms capable of degrading them.

[0005] Patent Document 1 (Published Document No. 10-2023-0012307) discloses a strain of the genus Enterobacter that has polyethylene degradation activity, but the effect has not reached a level sufficient for commercial success, and there is a problem that it cannot be applied to microplastics that have already entered the body from landfills or are present in food.

[0006] Therefore, continuous research is needed on new strains that are stable within the body and can inhibit the absorption of microplastics. Prior art literature

[0007] Patent Document 1. Korean Published Patent Application No. 10-2023-0012307 The problem to be solved

[0008] This invention has been devised in consideration of the above-mentioned problems, and the objective of the present invention is to provide a Saccharomyces cerevisiae having acid resistance, bile resistance, and microplastic adhesion ability. Saccahromyces cerevisiae ) It provides ReY29-4_P16 KCCM 13340P.

[0009] More specifically, another objective of the present invention is Saccharomyces cerevisiae ( Saccahromyces cerevisiae The present invention provides a food composition for inhibiting microplastic absorption containing ReY29-4_P16 KCCM 13340P as an active ingredient.

[0010] More specifically, another objective of the present invention is Saccharomyces cerevisiae ( Saccahromyces cerevisiae The present invention provides a composition for adsorbing microplastics comprising ReY29-4_P16 KCCM 13340P. means of solving the problem

[0011] To achieve the above objective, the present invention relates to a Saccharomyces cerevisiae having acid resistance, bile resistance, and microplastic adhesion ability ( Saccahromyces cerevisiae ) Provides ReY29-4_P16 KCCM 13340P.

[0012] The above strain is FLO11 Genes and FLO10 Part of the gene sequence may be deleted or substituted.

[0013] By the above deletion or substitution, the above Saccharomyces cerevisiae ( Saccahromyces cerevisiae The ReY29-4_P16 KCCM13340 strain may have reduced biofilm formation ability.

[0014] The above strain is Saccharomyces cerevisiae ( Saccahromyces cerevisiae ) S288C of Chromosome IX FLO11 In the gene sequence (position NC_001141.2), the sequence from the 390973rd base to the 391033rd base may have been deleted and replaced with T.

[0015] The above strain is Saccharomyces cerevisiae ( Saccahromyces cerevisiae ) S288C of Chromosome IX FLO10 In the gene sequence (position NC_001143.9), the sequence from the 647797th base to the 647906th base may have been deleted and replaced with CC.

[0016] The above microplastics may be 1 to 500 nm.

[0017] In order to achieve the above other objectives, the present invention (Saccharomyces cerevisiae) Saccahromyces cerevisiae ) Provides a food composition for inhibiting microplastic absorption containing ReY29-4_P16 KCCM 13340P as an active ingredient.

[0018] In order to achieve the above other objectives, the present invention (Saccharomyces cerevisiae) Saccahromyces cerevisiae ) Provides a feed composition for inhibiting microplastic absorption containing ReY29-4_P16 KCCM 13340P as an active ingredient.

[0019] In order to achieve the above other objectives, the present invention (Saccharomyces cerevisiae) Saccahromyces cerevisiae A composition for adsorbing microplastics comprising ReY29-4_P16 KCCM 13340P is provided. Effects of the invention

[0020] Saccharomyces cerevisiae of the present invention ( Saccahromyces cerevisiae The ReY29-4_P16 KCCM 13340P strain possesses the characteristics of a prebiotic, such as acid resistance and bile resistance, and has excellent adhesion to microplastics, thus having an effect on removing microplastics in the environment and in the body.

[0021] Also, Saccharomyces cerevisiae ( Saccahromyces cerevisiae The ReY29-4_P16 KCCM 13340P strain has a deletion or substitution of the gene that forms biofilms, so it does not form colonies (biofilms) in biological organ tissues and is easily expelled to the outside, making it biocompatible and usable as a functional strain for removing microplastics in the intestines. Brief explanation of the drawing

[0022] Figure 1 is a graph showing the polystyrene (PS) adhesion ability of 36 acid-resistant yeast strains selected in the first round. In this case, as a negative control S. cerevisiae S288c (indicated as S288c on the drawing) was used. Figure 2 is S. cerevisiae ReY29-4_P16 strain and negative control S. cerevisiae This is a graph showing the polystyrene (PS) adhesion ability of the S288c strain according to viable cell count. Fig. 3 is S. cerevisiae ReY29-4_P16 strain and negative control S. cerevisiae This is a graph showing the polypropylene (PP) adhesion ability of the S288c strain according to viable cell count. Figure 4 shows fluorescently labeled polystyrene (PS) beads (ultrafine plastics) by size. S. cerevisiae ReY29-4_P16 strain and negative control S. cerevisiae This is a graph showing the analysis of the adhesion ability of the S288c strain. Fig. 5 is S. cerevisiae of the ReY29-4_P16 strain FLO11 This is a graph showing the results of confirming gene expression levels by RT-PCR, and the gene expression levels are S. cerevisiae It was expressed as the relative gene expression level compared to the FLO11 gene expression level of the S288c strain. Specific details for implementing the invention

[0023] Below, various aspects and embodiments of the present invention will be examined in more detail.

[0024] The objects, other objects, features, and advantages of the present invention will be easily understood through the following preferred embodiments associated with the accompanying drawings. However, the present invention is not limited to the embodiments described herein and may be embodied in other forms. Rather, the embodiments introduced herein are provided to ensure that the disclosed content is thorough and complete and that the spirit of the invention is sufficiently conveyed to a person skilled in the art.

[0025] In this specification, terms such as “comprising” or “having” are intended to specify the existence of the features, numbers, steps, actions, components, parts, or combinations thereof described in the specification, and should not be understood as precluding the existence or addition of one or more other features, numbers, steps, actions, components, parts, or combinations thereof.

[0026] In this specification, where a range is described for a variable, it will be understood that the variable includes all values ​​within the described range, including the described endpoints of the range. For example, the range “5 to 10” will be understood to include not only the values ​​5, 6, 7, 8, 9, and 10, but also any sub-ranges such as 6 to 10, 7 to 10, 6 to 9, 7 to 9, etc., and any values ​​between integers valid for the category of the described range, such as 5.5, 6.5, 7.5, 5.5 to 8.5, and 6.5 to 9. Also, for example, the range “10% to 30%” will be understood to include all integers including values ​​such as 10%, 11%, 12%, 13%, etc. and up to 30%, as well as any sub-range such as 10% to 15%, 12% to 18%, 20% to 30%, etc., and any value between valid integers within the stated range category such as 10.5%, 15.5%, 25.5%, etc.

[0027] The present invention will be described in detail below.

[0028] One aspect of the present invention is a Saccharomyces cerevisiae having acid resistance, bile resistance and microplastic adhesion ability ( Saccahromyces cerevisiae This concerns ReY29-4_P16 KCCM 13340P.

[0029] The present invention relates to a strain isolated from traditional nuruk, which is a strain that is safe for ingestion. Among the strains mentioned above, Saccharomyces cerevisiae, which possesses bile resistance and acid resistance and excellent adhesion ability to plastics such as polystyrene and polypropylene ( Saccahromyces cerevisiae ) strain was identified, and this Saccharomyces cerevisiae ( Saccahromyces cerevisiae It was identified as the ReY29-4_P16 strain and deposited with the Korean Culture Collection Center (KCCM) on March 30, 2023, and assigned the deposit number "KCCM 13340P".

[0030] The above strain contains a gene sequence encoding the 18S rRNA of SEQ ID NO. 1. Specifically, it was identified as 18S NS1 and NS24.

[0031] Saccharomyces cerevisiae according to the present invention ( Saccahromyces cerevisiae ) ReY29-4_P16 KCCM 13340P may have acid resistance and bile resistance.

[0032] Saccharomyces cerevisiae according to the present invention ( Saccahromyces cerevisiae ) ReY29-4_P16 KCCM 13340P may have microplastic adhesion capabilities.

[0033] In this specification, 'acid resistance' indicates that it can exhibit a survival rate of 50% or more for 3 days even under conditions of pH 2 to 3, and 'bile resistance' means that it can exhibit a survival rate of 50% or more for 24 hours in an environment similar to human bile.

[0034] In this specification, "microplastic" refers to plastic particles (or fragments) with a length or diameter of 5 mm or less that are generated during the process of plastic products decomposing due to ultraviolet rays, weathering, waves, etc. Due to their small size, these microplastics are difficult to recover from the natural environment and are gradually accumulating in the natural world (marine and soil ecosystems). In addition to entering animals and plants through the food chain and reaching humans, microplastics can also be exposed through drinking water, food, and air; as they adsorb various toxic elements during this process, the issue of adverse effects caused by microplastics has been raised. Recently, it has been revealed that microplastics accumulate in the fetal brain through the maternal mammary glands, causing abnormal behaviors such as anxiety and depressive disorders and social deficits. This confirms that microplastics pose a risk to brain health not only during neurodevelopmental stages but throughout the entire lifespan, leading to a growing concern regarding microplastics.

[0035] In this specification, 'microplastic adhesion' refers to the activity of adhering to microplastics and not detaching, and is also referred to as microplastic adsorption ability. The strain according to the present invention (Saccharomyces cerevisiae ( Saccahromyces cerevisiae When the strain of ReY29-4_P16 KCCM 13340P) proliferates stably in the internal digestive tract, it adsorbs and attaches to microplastics entering the digestive tract, thereby preventing the microplastics from being absorbed into the body through blood vessels from the digestive tract. In addition, since the strain of the present invention forms less biofilm, it is easily expelled from the body to the outside, thereby easily removing adsorbed microplastics from the body.

[0036] In other words, since microplastic adhesion allows the material to adhere to any plastic material regardless of charge type or surface functional groups, thereby inhibiting absorption into the body, highly effective microplastic removal is possible.

[0037] The above microplastics are not particularly limited as long as they are generated by abrasion from general plastics due to physical, chemical, biological, and weathering processes, or generated during industrial processing, and specifically, they may be one or more selected from the group consisting of polyethylene (PE), polypropylene (PP), polystyrene (PS), polyethylene terephthalate (PET), polyvinyl chloride (PVC), polyvinyl alcohol (PVA), and mixtures thereof.

[0038] The size of the microplastics is not particularly limited, but may be 5 mm or less, preferably may have an average diameter of 1 to 1000 nm, and more preferably may have an average diameter of 1 to 500 nm.

[0039] Saccharomyces cerevisiae according to the present invention ( Saccahromyces cerevisiae ReY29-4_P16 KCCM 13340P can be used without limitation in fields where adsorption and / or removal of microplastics is required, such as soil, rivers, or seas contaminated with microplastics, but preferably may include food compositions, feed compositions, or pharmaceutical compositions.

[0040] At this time, Saccharomyces cerevisiae according to the present invention ( Saccahromyces cerevisiae ) ReY29-4_P16 KCCM 13340P is a gene that forms biofilms inhibiting in vivo immune function ( FLO11 , FLO10 Some parts of the sequence are deleted or substituted, resulting in a decrease and reduction in the overall ability to form biofilms.

[0041] Among the technologies for removing microplastics, techniques utilizing microbial biofilms have been mentioned; however, microbial biofilms can cause problems, such as interfering with the action of immune cells or antibiotics within the body, thereby delaying the healing process and increasing susceptibility to bacterial and fungal infections. Furthermore, since microplastics are adsorbed onto biofilms after microbial colonies form within organ tissues, the microplastics remain in the tissues instead of being expelled from the body, leading to the problem of sustained and prolonged accumulation.

[0042] On the other hand, Saccharomyces cerevisiae according to the present invention ( Saccahromyces cerevisiae ReY29-4_P16 KCCM 13340P has excellent adhesion to microplastics but reduced and degraded biofilm-forming ability, so it is easily excreted from the body, effectively preventing and blocking the absorption of microplastics into the body.

[0043] According to one embodiment of the present invention, the strain is Saccharomyces cerevisiae ( Saccahromyces cerevisiae ) S288C of Chromosome IX FLO11 In the gene sequence (position NC_001141.2), the base sequence from the 390973rd to the 391033rd base sequence may have been deleted and replaced with T.

[0044] According to one embodiment of the present invention, the strain is Saccharomyces cerevisiae ( Saccahromyces cerevisiae ) S288C of Chromosome IX FLO10 In the gene sequence (position NC_001143.9), the 647797th to 647906th base sequences may have been deleted and replaced with CC.

[0045] Another aspect of the present invention is Saccharomyces cerevisiae ( Saccahromyces cerevisiae This invention relates to a food composition for inhibiting microplastic absorption containing ReY29-4_P16 KCCM 13340P as an active ingredient.

[0046] The above food composition is Saccharomyces cerevisiae ( Saccahromyces cerevisiae It utilizes the probiotic properties of ReY29-4_P16 KCCM 13340P, such as microplastic adhesion, acid resistance, and bile resistance.

[0047] Regarding the food composition of the present invention, the microplastic may be introduced into or present in the body through the consumption of drinking water, food, food ingredients, etc., preferably may be a microplastic introduced into or present in the digestive system, and most preferably may be a microplastic introduced into or present in the intestines.

[0048] The above Saccharomyces cerevisiae ( Saccahromyces cerevisiae ) ReY29-4_P16 KCCM 13340P is the same as previously described. In this case, the strain may be live or dead, and preferably may be live. Also, Saccharomyces cerevisiae ( Saccahromyces cerevisiae ) ReY29-4_P16 KCCM 13340P may or may not contain culture.

[0049] Saccharomyces cerevisiae, the active ingredient, relative to the total weight of the above composition ( Saccahromyces cerevisiae ) ReY29-4_P16 KCCM 13340P is included at a therapeutically effective dose or nutritionally effective concentration, 10 4 to 10 16 CFU / g, preferably 10 6 to 10 12 It contains at a content of CFU / g or contains a culture with an equivalent number of viable bacteria. Generally, for adult patients, 1×10 6 Viable bacteria of CFU / g or more, preferably 1×10 8 Up to 1×10 12 Live bacteria at a rate of CFU / g can be administered once or in divided doses.

[0050] In this specification, 'microplastic absorption' may refer to the absorption and accumulation of microplastics in the body through the digestive system via oral ingestion, or it may refer to the accumulation of microplastics in the body causing human health problems (inflammation, absorption of toxic substances, metabolic disorders, endocrine disorders, deterioration of organ or tissue function, respiratory problems, etc.) or causing damage to cells, tissues, or organs in the body.

[0051] In this specification, "inhibition of microplastic absorption" may refer to protecting against damage to one or more cells or tissues selected from the brain, heart, lungs, liver, and kidneys from absorption or accumulation in the body within the digestive tract when microplastics enter the body orally. Additionally, it may refer to inhibiting the accumulation of microplastics in one or more cells or tissues selected from the brain, heart, lungs, liver, and kidneys.

[0052] According to one embodiment of the present invention, the strain can inhibit the absorption of orally administered microplastics from the digestive tract into the bloodstream and their accumulation in organ tissues within the body. Specifically, when microplastics were orally administered to a mouse model that had ingested the strain of the present invention, the concentration of microplastics entering the bloodstream of the mouse model was significantly reduced. On the other hand, when microplastics were orally administered to a mouse model that had not ingested anything, the concentration of microplastics in the bloodstream of the mouse model increased twofold. Through this, it was confirmed that the strain inhibits the accumulation of microplastics within the body.

[0053] The above 'food composition' is an active ingredient Saccharomyces cerevisiae ( Saccahromyces cerevisiae In addition to ReY29-4_P16 KCCM 13340P, it includes food raw materials that can be used as food as listed in the standards and specifications for food commonly used in food manufacturing ('Food Code'), and food additives listed in the Food Additives Code.

[0054] Although not specifically limited, it includes, for example, proteins, carbohydrates, fats, nutrients, seasonings, and flavorings. The carbohydrates may be monosaccharides, for example, glucose, fructose, etc.; disaccharides, for example, maltose, sucrose, lactose, etc.; oligosaccharides or polysaccharides, for example, dextrin, starch syrup, cyclodextrin, etc.; sugar alcohols, for example, xylitol, sorbitol, erythritol, etc. The flavorings may be natural flavorings [taumatin, stevia extract (e.g., rebaudioside A, glycyrrhizin, etc.)] and synthetic flavorings (saccharin, aspartame, etc.).

[0055] The above Saccharomyces cerevisiae ( Saccahromyces cerevisiae When preparing a food composition using ) ReY29-4_P16 KCCM 13340P as an active ingredient, Saccharomyces cerevisiae ( Saccahromyces cerevisiae ) ReY29-4_P16 KCCM 13340P may be included in an amount that inhibits microplastic absorption or exhibits microplastic adsorption efficacy, although there is no need to be specifically limited, for example, 0.1 to 99 wt%, 0.5 to 95 wt%, 1 to 90 wt%, 2 to 80 wt%, 3 to 70 wt%, 4 to 60 wt%, or 5 to 50 wt%.

[0056] Saccharomyces cerevisiae, which is the active ingredient in the above food composition ( Saccahromyces cerevisiae ReY29-4_P16 KCCM 13340P may be appropriately selected by a person skilled in the art, depending on the condition, weight, presence or severity and duration of disease of the ingestor. For example, based on a daily dosage, it may be 1 to 5,000 mg, preferably 5 to 2,000 mg, more preferably 10 to 1,000 mg, even more preferably 20 to 800 mg, and most preferably 50 to 500 mg. The frequency of administration does not need to be specifically limited, but may be adjusted by a person skilled in the art within the range of 3 times a day to once a week. In the case of long-term intake for the purpose of health and hygiene or health control, it may be less than the above range.

[0057] The above food composition does not need to be specifically limited, but may be, for example, a powder, granule, tablet, capsule, pill, extract, jelly, tea bag, or beverage.

[0058] In addition, to inhibit the absorption of microplastics into general food, the above Saccharomyces cerevisiae ( Saccahromyces cerevisiae ReY29-4_P16 KCCM 13340P may be added. Foods to which it may be added are not specifically limited, but may be added to, for example, confectionery, bread or rice cakes, cocoa products or chocolates, meat or egg products, fish products, tofu or jelly products, noodles, tea, coffee, beverages, special purpose foods, sauces, seasonings, dressings, kimchi, salted seafood, pickled foods, stewed foods, alcoholic beverages, dried fruits, and other foods as exemplified in the standards and specifications for livestock products pursuant to Article 7 of the Food Sanitation Act ('Food Code'). In addition, it may be added to dairy products, meat products and packaged meat, and egg products as exemplified in the processing standards and ingredient specifications for livestock products pursuant to Article 4 of the Livestock Product Sanitation Management Act ('Livestock Product Code').

[0059] Meanwhile, the above-mentioned Saccharomyces cerevisiae ( Saccahromyces cerevisiaeA food composition containing ReY29-4_P16 KCCM 13340P as an active ingredient can be used alone as a "health functional food for inhibiting microplastic absorption" and can be used as a "health functional food for reducing the absorption or accumulation of microplastics in the body."

[0060] The aforementioned "health functional food" refers to a food manufactured (including processed) in accordance with legal standards using raw materials or ingredients that possess functional properties beneficial to the human body (Article 3, Paragraph 1 of the Act on Health Functional Foods). While the terminology and scope may vary by country, the aforementioned "health functional food" may correspond to "Dietary Supplement" in the United States, "Food Supplement" in Europe, "Health Functional Food" or "Food for Special Health Use (FoSHU)" in Japan, and "Health Food" in China, etc.

[0061] The above food composition or health functional food may additionally include food additives, and unless otherwise specified, the suitability as a food additive shall be determined in accordance with the specifications and standards for the relevant item in accordance with the general provisions and general test methods, etc., of the 'Food Additives Codex'.

[0062] In addition, the above health functional food contains the above Saccharomyces cerevisiae ( Saccahromyces cerevisiae A health functional food material that can promote the adsorption of microplastics from the body or inhibit the absorption of microplastics into the body can be used in combination with ReY29-4_P16 KCCM 13340P.

[0063] Another aspect of the present invention is that Saccharomyces cerevisiae ( Saccahromyces cerevisiae ) Provides a feed composition for inhibiting microplastic absorption or adsorbing microplastics comprising ReY29-4_P16 KCCM 13340P.

[0064] The above Saccharomyces cerevisiae ( Saccahromyces cerevisiae) ReY29-4_P16 KCCM 13340P is the same as described above.

[0065] The above feed composition for inhibiting microplastic absorption or adsorbing microplastics contains Saccharomyces cerevisiae ( Saccahromyces cerevisiae It can be manufactured by adding ReY29-4_P16 KCCM 13340P.

[0066] Another aspect of the present invention is that Saccharomyces cerevisiae ( Saccahromyces cerevisiae ) Provides a composition for preventing or treating microplastic-related diseases of ReY29-4_P16 KCCM 13340P.

[0067] At this time, the above Saccharomyces cerevisiae ( Saccahromyces cerevisiae ) ReY29-4_P16 KCCM 13340P is the same as described above.

[0068] When microplastics are absorbed orally, they travel through the intestinal cells into the bloodstream and then move through the blood to various organs and tissues, including the lymphatic and hepatobiliary systems. These transported microplastics cause one or more diseases selected from the group consisting of cardiovascular and cerebrovascular diseases, endocrine diseases, inflammatory diseases, obesity, and metabolic diseases.

[0069] The composition of the present invention can prevent or treat microplastic-related diseases by adsorbing or attaching microplastics to prevent the incoming microplastics from being absorbed into the bloodstream.

[0070] The above cardiovascular diseases may be one or more selected from the group consisting of myocardial infarction, atherosclerosis, atherothrombosis, coronary artery disease, stable and unstable angina pectoris, stroke, vascular stenosis, vascular restenosis, aortic aneurysm, and acute ischemic arteriovascular event.

[0071] The above endocrine system disease may be any one selected from the group consisting of diabetes, thyroid diseases (hypothyroidism and hyperthyroidism, thyroiditis, thyroid nodules), Cushing's syndrome, insulin resistance, and growth hormone deficiency.

[0072] The above inflammatory disease may be any one selected from the group consisting of sepsis, septic shock, inflammatory bowel disease (IBD), peritonitis, nephritis, acute bronchitis, chronic bronchitis, osteoarthritis, intestinal spondylitis, chronic obstructive pulmonary disease (COPD), rheumatoid arthritis, acute lung injury, and bronchopulmonary dysplasia.

[0073] The above inflammatory bowel disease (IBD) may be ulcerative colitis (UC) or Crohn's disease.

[0074] The above metabolic disease may be any one selected from the group consisting of obesity, hypertension, arteriosclerosis, hyperlipidemia, fatty liver, non-alcoholic fatty liver disease, hyperinsulinemia, diabetes, and insulin resistance syndrome.

[0075] The above pharmaceutical composition may further include a suitable carrier, excipient, or diluent according to conventional methods. Carriers, excipients, and diluents that may be included in the pharmaceutical composition of the present invention may include, but are not limited to, lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinylpyrrolidone, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, and mineral oil.

[0076] In addition, the pharmaceutical composition according to the present invention may be formulated and used in the form of oral formulations such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, and aerosols, as well as external preparations, suppositories, or sterile injectable solutions, according to conventional methods. Specifically, when formulating, it may be prepared using diluents or excipients such as commonly used fillers, extenders, binders, wetting agents, disintegrants, and surfactants. Solid formulations for oral administration include tablets, pills, powders, granules, and capsules, and such solid formulations may be prepared by mixing at least one excipient, for example, starch, calcium carbonate, sucrose, lactose, gelatin, etc., with the pharmaceutical composition of the present invention. In addition, lubricants such as magnesium stearate and talc may also be used in addition to simple excipients. Liquid formulations for oral administration include suspensions, oral liquids, emulsions, and syrups; in addition to commonly used simple diluents such as water and liquid paraffin, they may contain various excipients, such as humectants, sweeteners, flavorings, and preservatives. Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized formulations, and suppositories. Non-aqueous solvents and suspensions may include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate. Bases for suppositories may include Witepsol, Macrogol, Tween 61, cocoa paste, laurin paste, and glycerogelatin.

[0077] The pharmaceutical composition of the present invention can be administered to mammals such as rats, mice, livestock, and humans via various routes.

[0078] The pharmaceutical composition of the present invention may be in any form suitable for the intended method of administration. In the pharmaceutical composition of the present invention, administration means introducing a specific substance to a patient by any appropriate method, and the route of administration of said pharmaceutical composition may be administered through any general route as long as the drug can reach the target tissue.

[0079] The route of administration of the pharmaceutical composition according to the present invention may be oral or parenteral, although not limited to these, and the parenteral administration may include the oral cavity, intravenous, intramuscular, intra-arterial, intramedullary, intra-articular, intra-synovial, intrasternal, intradural, intracardiac, transdermal, subcutaneous, intradermal, intraperitoneal, intranasal, intestinal, local, intracranial, intracerebroventricular, intrauterine, intrauterine dura mater, sublingual, or rectum. The pharmaceutical composition of the present invention may be administered by any device capable of delivering the active ingredient to a target site, but preferably may be administered orally.

[0080] The content of the active ingredient in the above pharmaceutical composition can be appropriately adjusted according to the purpose of use of the pharmaceutical composition, the form of the dosage form, etc., and, for example, may be 0.001 to 99% by weight, 0.001 to 90% by weight, 0.001 to 50% by weight, 0.01 to 50% by weight, 0.1 to 50% by weight, or 1 to 50% by weight based on the total weight of the pharmaceutical composition, but is not limited thereto.

[0081] The pharmaceutical composition of the present invention may vary depending on various factors including the activity of the active ingredient used, age, body weight, general health, gender, diet, time of administration, route of administration, release rate, drug combination, and the severity of the specific disease to be prevented or treated, and the dosage of the pharmaceutical composition may be appropriately selected by a person skilled in the art, depending on the patient's condition, body weight, degree of disease, drug form, route of administration, and duration, and may be administered at a dose of 0.0001 to 50 mg / kg or 0.001 to 50 mg / kg per day. Administration may be administered once a day or divided into several doses. The dosage does not limit the scope of the present invention in any way. The pharmaceutical composition according to the present invention may be formulated as a pill, coated tablet, capsule, liquid, gel, syrup, slurry, or suspension.

[0082] Another aspect of the present invention is Saccharomyces cerevisiae ( Saccahromyces cerevisiae This relates to a composition for adsorbing microplastics containing ReY29-4_P16 KCCM 13340P.

[0083] The above composition may adsorb microplastics present in the natural environment. The natural environment is not particularly limited as long as it is contaminated with microplastics, but preferably may be one or more selected from the group consisting of soil, seawater, drinking water, and groundwater.

[0084] To determine whether the above strain exhibits microplastic adhesion ability, the strain was incubated with microplastics; as a result, it was confirmed that the strain was adsorbed onto the microplastics, thereby confirming that the strain of the present invention possesses microplastic adhesion or adsorption ability. Furthermore, it was found that this microplastic adhesion ability exhibited excellent adsorption efficiency in live bacteria.

[0085] The present invention is to be explained in more detail below through examples, etc.; however, the scope and content of the present invention shall not be interpreted as being narrowed or limited by the examples, etc. below. Furthermore, based on the disclosure of the present invention including the examples below, it is evident that a person skilled in the art can easily practice the present invention even without specific experimental results presented, and it is natural that such variations and modifications fall within the scope of the appended claims.

[0086] <Experimental Example 1> Selection of strains with excellent acid resistance and PS attachment ability from traditional foods

[0087] Isolation and culture of yeast strains

[0088] Approximately 200 colonies of the genus Saccharomyces were isolated from 60 types of traditional nuruk prepared and collected according to ancient literature preparation methods (Lee JE, Lee AR, Kim HR, Lee E, Kim TW, Shin WC, et al. Restoration of traditional Korean nuruk and analysis of the brewing characteristic. J Microbiol Biotechnol. 2017. 27:896-908). The isolated 200 yeast colonies were stored on YM agar (yeast malt extract agar) and cultured on PDB (potato dextrose agar, Becton Dickinson and Company, Sparks, MD, USA) medium at 25°C for 48 hours for screening analysis to select yeast.

[0089] 1st Selection (Acid-resistant strains)

[0090] separated SaccharomycesThe growth of genus colonies at pH 2.0 was investigated. To confirm acid resistance, 100 µl of selected yeast colonies were inoculated into YM medium adjusted to pH 2.0 by adding 0.1 M HCl, cultured at 37°C for 3 days, and then plated onto PDA agar medium to check for colony formation. Through the above process, 36 candidate strains with excellent acid resistance were initially selected.

[0091] 2nd Selection (Plastic Surface Adhesion Ability)

[0092] We aimed to conduct a second selection of candidate strains with excellent adhesion ability to polystyrene. To this end, the 36 strains selected in the first round were prepared and verified using a crystal violet staining assay (refer to Reynolds, Todd B., and Gerald R. Fink. "Bakers' yeast, a model for fungal biofilm formation." Science 291.5505 (2001): 878-881). In summary, each yeast strain was cultured in SC medium containing 2% (w / v) glucose (Synthetic complete media and plates and YPD plates were made as described [C. Guthrie, GR Fink, Methods Enzymol. 194, 12 (1991)] with the exception of the altered agar or glucose concentrations, which are specified in the text), and OD 600 They were harvested at 1.5 days. Then, the harvested cells were washed with H2O, and the OD was tested in SC medium containing 2% glucose. 600After resuspending to 1.0, the cells were transferred to each well of a 96-well polystyrene plate (Falcon Microtest flat bottom plate, 35-1172; Becton-Dickinson Lab-ware) using a 100 µL pipette. Cells attached to the polystyrene were confirmed by staining with crystal violet. Crystal violet staining was performed to visualize the cells attached to each well of the polystyrene plate (GA O'Toole et al. [Methods Enzymol. 310, 91 (1999)]). Crystal violet solution was added to each well and left for 15 minutes, after which the cells were washed with H2O, and the absorbance (Abs) was measured at 595 nm (Fig. 1).

[0093] As a negative control group for comparing plastic adhesion ability (polystyrene (PS) adhesion ability) S. cerevisiae S288c (strain ATCC 204508) was selected and performed. S. cerevisiae The S288c (strain ATCC 204508) strain is FLO11 It is a standard strain that possesses the ability to adhere to microplastics despite not expressing a gene (Reference: The Flo11p-deficient Saccharomyces cerevisiae strain background S288c can adhere to plastic surfaces. Colloids and Surfaces B: Biointerfaces Volume 60, Issue 1, 15 October 2007, Pages 131-134).

[0094] Statistical analysis

[0095] The experimental results were calculated as mean ± standard deviation, and the significance was verified at the p<0.001 level by conducting a one-way ANOVA on the analyzed experimental data obtained from the negative control group and each sample.

[0096] Experimental results

[0097] Figure 1 is a graph showing the polystyrene (PS) adhesion ability of 36 acid-resistant yeast strains selected in the first round. In this case, as a negative control S. cerevisiae S288c (indicated as S288c on the drawing) was used.

[0098] As shown in Fig. 1, the negative control group S. cerevisiae Four strains (P16, P17, P18, P19) were identified as having significantly higher plastic adhesion ability compared to S288c, and in the present invention, strain 'P16' was finally selected.

[0099] 18S rRNA gene sequencing analysis was performed to identify the finally selected 'P16' strain. Universal bacterial primer pairs NS1 (sequence 2:5'-GTAGTCATATGCTTGTCTC-3') and NS24 (sequence 3:5'-AAACCTTGTTACGACTTTTA-3') were used to amplify the gene. Subsequently, the gene sequence was verified using BLAST (Basic Local Alignment Search Tool) from the National Center for Biotechnology Information (NCBI; http: / / www.ncbi.nlm.nih.gov / BLAST / ). The results of the 18S rRNA gene sequencing analysis showed that Saccharomyces cerevisiae ( Saccahromyces cerevisiae It was confirmed that it is ).

[0100] The finally selected 'P16' strain is Saccharomyces cerevisiae ( Saccahromyces cerevisiae It was named ReY29-4_P16 and deposited with the Korean Culture Collection Center (KCCM), an internationally accredited depositary of microorganisms under the Treaty of Budapest, and was assigned deposit number KCCM 13340P on March 30, 2023.

[0101] [Sequence No. 1]

[0102]

[0103] <Experimental Example 1-2> Final selected S. cerevisiae Acid and Bile Resistance Analysis of ReY29-4_P16

[0104] The final selected S. cerevisiae We aimed to verify the acid and bile resistance of ReY29-4_P16 colonies. To confirm acid resistance, 100 µl of the selected yeast colonies were inoculated into YM medium adjusted to pH 2.0 by adding 0.1 M HCl, incubated at 37°C for 3 days, and then plated onto PDA agar to check for colony formation. Additionally, to confirm bile resistance, 100 µl of the selected yeast colonies were inoculated into YM medium containing 1% bile salts, incubated at 37°C for 24 hours, and then plated onto PDA agar to check for colony formation. As a positive control, a commercially available acid-resistant yeast, S. boulardii It was compared with three commercially available strains.

[0105] Strain Resistance to acid (pH 2.0) Resistance to bile acid (1%) S. cerevisiae ReY29-4_P16 + + S.boulardii 1 + ++ S.boulardii 2 + + S.boulardii 3 ++ + S. cerevisiae S288c - -

[0106] -, no survival rate; +, low-survival rate; ++, high-survival rate

[0107] According to Table 1, Saccharomyces cerevisiae present in traditional nuruk ( S. cerevisiae ...is a safe microorganism that has been used for food and in food products for a long time. In this invention, the finally selected through the first and second selection processes S. cerevisiae Since the ReY29-4_P16 strain possesses excellent characteristics of not only acid resistance but also microplastic adhesion ability, it survives until it reaches the intestines without losing activity upon oral administration; thus, it can demonstrate a significant effect in that it prevents microplastics from being absorbed into the body by adsorbing microplastics present in the intestines.

[0108] <Experimental Example 2> Analysis of adhesion ability to polystyrene and polypropylene

[0109] The final selected S. cerevisiae Verification of plastic adhesion ability of ReY29-4_P16 strain by viable cell count

[0110] The final selected S. cerevisiae The plastic adhesion ability of the ReY29-4_P16 strain was confirmed through a crystal violet staining assay (see Reynolds, Todd B., and Gerald R. Fink. "Bakers' yeast, a model for fungal biofilm formation." Science 291.5505 (2001): 878-881).

[0111] On a 96-well polystyrene plate (Falcon Microtest flat bottom plate, 35-1172; Becton-Dickinson Lab-ware) or a 96-well polypropylene plate (96 well plate, deep, plate-dome, 90063; Bioneer) S. cerevisiae ReY29-4_P16 strain 2.5 × 10 5 cells / well (viable cell count 98% or higher), 5.0 × 10⁻⁶ 5 cells / well (viable cell count 98% or higher), 1.0 × 10⁻⁶ 6 cells / well (viable cell count 98% or higher) and 2.0 × 10⁶ 6 Each well was inoculated at a concentration of cells / well (viable cell count of 98% or higher) and cultured for 1 hour. Cells attached to polystyrene were confirmed by staining with crystal violet (GA O'Toole et al. [Methods Enzymol. 310, 91 (1999)]). Crystal violet solution was added to each well and left for 15 minutes, after which it was washed with H2O, and the absorbance (Abs) was measured at 595 nm. S. cerevisiae S288c was used as a negative control (Figs. 2, 3).

[0112] Statistical analysis

[0113] The experimental results were calculated as mean ± standard deviation, and the significance was verified at the p<0.001 level by conducting a one-way ANOVA on the analyzed experimental data obtained from the negative control group and each sample.

[0114] Figure 2 is S. cerevisiae ReY29-4_P16 strain and negative control S. cerevisiae This is a graph showing the polystyrene (PS) adhesion ability of the S288c strain according to viable cell count.

[0115] As shown in Fig. 2, S. cerevisiae The ReY29-4_P16 strain showed a significant increase in plastic (polystyrene, PS) adhesion ability as the viable cell count increased, and the adhesion ability for each viable cell count S. cerevisiae It was confirmed that it is significantly superior to S288c.

[0116] Fig. 3 is S. cerevisiae ReY29-4_P16 strain and negative control S. cerevisiae This is a graph showing the polypropylene (PP) adhesion ability of the S288c strain according to viable cell count.

[0117] As shown in FIG. 3, according to the present invention S. cerevisiae It was confirmed that the ReY29-4_P16 strain possesses excellent adhesion ability not only to polystyrene but also to polypropylene, a representative non-biodegradable plastic. In particular, the negative control S. cerevisiae It was confirmed that it has superior adhesion ability compared to the S288c strain.

[0118] <Experimental Example 3> Adhesion ability according to microplastic size

[0119] The final selected S. cerevisiae We aimed to verify the adhesion ability of the ReY29-4_P16 strain according to microplastic size (size less than ~1,000 nm).

[0120] Four sizes of polystyrene beads (PS beads) (20, 50, 500, 1000 nm) labeled with FITC, Rhodamine, and Cy5 fluorescence were prepared. S. cerevisiaeReY29-4_P16 strain and negative control S. cerevisiae After culturing the S288c strain in SC medium containing 2% (w / v) glucose (Synthetic complete media and plates and YPD plates were made as described [C. Guthrie, GR Fink, Methods Enzymol. 194, 12 (1991)] with the exception of the altered agar or glucose concentrations, which are specified in the text.), 2 × 10 7 A culture medium was prepared at a concentration of cells / ml, and then 100 μg of the polystyrene beads (PS beads) were added and cultured for 3 hours. The cell culture medium was centrifuged to remove the supernatant and recover the pellet; after returbining with PBS, the fluorescence was measured (FITC, 495 / 519; Rhodamine, 546 / 568; Cy5, 651 / 670). For accurate comparison, Comparison Group 1 (only beads) containing only fluorescently labeled PS beads and Comparison Group 2 (only yeast) containing the same number of yeast without PS beads were prepared and measured using the same procedure as described above.

[0121] Figure 4 shows fluorescently labeled polystyrene (PS) beads (ultrafine plastics) by size. S. cerevisiae ReY29-4_P16 strain and negative control S. cerevisiae This is a graph showing the analysis of the adhesion ability of the S288c strain.

[0122] As shown in Fig. 4 S. cerevisiae Although no significant adhesion ability was observed for the ReY29-4_P16 strain on plastics larger than 1000 nm, for ultrafine plastics smaller than 500 nm, the gender control S. cerevisiae It was confirmed that it has significantly superior adsorption / binding ability compared to the S288c strain.

[0123] <Experimental Example 4> Presence or absence of biofilm-forming genes

[0124] Summary of the experiment

[0125] It is known that a protein called flocculin, which belongs to the cell membrane glycoproteins of yeast, is involved in plastic adhesion. Flocculin is FLO11 It is encoded by a gene (Reynolds, Todd B., and Gerald R. Fink. "Bakers' yeast, a model for fungal biofilm formation." Science 291.5505 (2001): 878-881).

[0126] FLO11 The transcriptional level of genes is related to yeast biofilm formation, specifically FLO11 This means that the higher the transcription level of the gene, the higher the likelihood of forming a biofilm in yeast (Zara, Giacomo, et al. " FLO11 gene length and transcriptional level affect biofilm-forming ability of wild flor strains of Saccharomyces cerevisiae." Microbiology 155.12 (2009): 3838-3846).

[0127] A biofilm is a three-dimensional structure formed within a polymeric substrate secreted by microorganisms, referring to its formation as a membrane on solid surfaces and living biological tissues. Therefore, while the excellent biofilm-forming ability of yeast provides strengths in terms of environmental resistance, it can interfere with the action of immune cells or antibiotics within the body, delaying the healing process and exposing the yeast to vulnerability to bacterial and fungal infections. In particular, if the yeast has the ability to adhere to plastic, it may not be expelled from the body but instead form biofilm colonies on tissues, leading to the continuous accumulation of plastic on the walls of the digestive tract and potentially causing organ damage caused by plastic.

[0128] That is, according to the present invention S. cerevisiae of the ReY29-4_P16 strain FLO11 Gene expression levels with real-time PCR and FLO11 We intended to confirm this using gene-specific primers.

[0129] Isolation of genomic DNA and FLO11 gene sequence amplification

[0130] S. cerevisiae ReY29-4_P16 strain and S. cerevisiae S288c strains were each OD in SC medium containing 2% (w / v) glucose 600 The sample was cultured until it reached 1.5, and after recovering the pellet by centrifugation, Total RNA was extracted using an RNA extraction kit (RNeasy, qiagen).

[0131] SuperScript to synthesize the above Total RNA into cDNA TM III Forst-strand (Invitrogen, USA) was used, and the procedure was performed according to the manufacturer's manual. cDNA was stored frozen at -20 ℃ until RT-PCR was performed.

[0132] The above cDNA was diluted 10-fold with DEPC-water. The diluted cDNA was mixed with Fast SYBER® Green Supermix (Thermo Fisher, USA), forward primers and reverse primers diluted to a concentration of 10 pM, and DEPC-water to make the reaction volume 20 µl. Real-time PCR was performed using StepOnePlus (Thermo Fisher, USA) by repeating a maintenance interval of 95°C for 3 seconds and 60°C for 30 seconds for 40 cycles.

[0133] FLO11 primer Forward서열 4 5'-CCTCCGAAGGAACTAGCTGTAATT-3' Reverse서열 5 5'-AGTCACATCCAAAGTATACTGCATGAT-3'

[0134] Fig. 5 is S. cerevisiae of the ReY29-4_P16 strain FLO11 This is a graph showing the results of confirming gene expression levels by RT-PCR, and the gene expression levels are S. cerevisiae It was expressed as the relative gene expression level compared to the FLO11 gene expression level of the S288c strain.

[0135] As shown in Fig. 5, S. cerevisiae The ReY29-4_P16 strain is a negative control. S. cerevisiae S288c strain and FLO11 It was confirmed that there was no significant difference in gene expression levels.

[0136] <세호예 5> 선별불 S. cerevisiae ReY29-4_P16 gene analysis

[0137] Saccharomyces cerevisiae ( Saccharomyces cerevisiae ) possesses genetic diversity among intraspecific strains, and the same Saccharomyces cerevisiae ( Saccharomyces cerevisiae Even so, there are significant differences in activity such as acid resistance and plastic adhesion ability.

[0138] The final selection from the aforementioned experimental results S. cerevisiaeWhole genome resequencing was performed on the ReY29-4_P16 strain (KCCM 13340P), and Saccharomyces cerevisiae ( Saccharomyces cerevisiae Among ) known to have plastic adhesion ability S. cerevisiae Genomic differences with S288c were analyzed.

[0139] Selected in this application S. cerevisiae With the ReY29-4_P16 strain and standard strain S. cerevisiae Genes with mutations were selected and analyzed based on comparison with the gene sequence of S288C. The results are shown in Table 2 below.

[0140] Chromosome SV start SV end SV type Ref (in S288c) Alt (in yeast sample) Gene Name NC_001141.2 390973 391033 Deletion TGATGGAGTGACAGTAGTGCCAGTAGAAAAGCTTTCAGTAGTAGAGCTGAATGGAATTGAA:서열 6 T FLO11 NC_001143.9 647797 647906 Deletion CTAGCTCTTCCTCGTCGTCCAGTGAAGTCTGTACAGAGTGCACCGAGACCGAGCTACCAGTTATGTGACACCATATGTCAGCTCGTCTACTGCTGCCGCAAACTACACT:서열 7 CC FLO10

[0141] As shown in Table 2, S. cerevisiae The ReY29-4_P16 strain is FLO11 It was confirmed that the sequence from the 390973rd base to the 391033rd base (61 bp) at the NC_001141.2 position (S288C Chromosome IX) encoding the gene was deleted and replaced with T.

[0142] also S. cerevisiae The ReY29-4_P16 strain is FLO10 A deletion was confirmed in which the sequence (110 bp) from the 647797th base to the 647906th base at the NC_001143.9 position (S288C Chromosome IX) encoding the gene is replaced with CC.

[0143] in other words, S. cerevisiae It was confirmed that the ReY29-4_P16 strain exhibits acid resistance at pH 2.0, allowing it to successfully colonize the digestive tract upon oral administration, and has excellent adhesion to the surface of microplastics smaller than 1000 nm that are orally administered into the body, thereby effectively inhibiting the absorption of microplastics into the body.

[0144] Furthermore S. cerevisiaeAlthough the ReY29-4_P16 strain does not express FLO11, a gene associated with biofilm formation, it exhibits excellent adhesion to microplastics; therefore, when used as an active ingredient, it can be utilized to inhibit the bioabsorption of microplastics by being consumed as a probiotic composition or food, and can also be utilized for the adsorption and removal of microplastics in the environment.

[0145] Depository Name: Korean Culture Collection Center (KCCM) Trustee Number: KCCM13340P Date of Deposit: 2023-03-30

Claims

Claim 1 It has acid resistance, bile resistance, and microplastic adhesion ability, FLO11 Genes and FLO10 Saccharomyces cerevisiae characterized by a deletion or substitution of part of the gene sequence ( Saccahromyces cerevisiae ) ReY29-4_P16 KCCM 13340P. Claim 2 delete Claim 3 In paragraph 1, by means of the above deletion or substitution, the Saccharomyces cerevisiae ( Saccahromyces cerevisiae The ReY29-4_P16 KCCM13340P strain is a Saccharomyces cerevisiae characterized by reduced biofilm-forming ability ( Saccahromyces cerevisiae ) ReY29-4_P16 KCCM13340P. Claim 4 In paragraph 1, the above Saccharomyces cerevisiae ( Saccahromyces cerevisiae ) The ReY29-4_P16 KCCM13340P strain is Saccharomyces cerevisiae( Saccahromyces cerevisiae ) S288C of Chromosome IX FLO11 Saccharomyces cerevisiae characterized by the deletion of the sequence from the 390973rd base to the 391033rd base in the gene sequence (position NC_001141.2) and the substitution with T ( Saccahromyces cerevisiae ) ReY29-4_P16 KCCM 13340P. Claim 5 In paragraph 1, the above Saccharomyces cerevisiae ( Saccahromyces cerevisiae ) The ReY29-4_P16 KCCM13340P strain is Saccharomyces cerevisiae( Saccahromyces cerevisiae ) S288C of Chromosome IX FLO10 Saccharomyces cerevisiae characterized by the deletion of the sequence from the 647797th base to the 647906th base in the gene sequence (position NC_001143.9) and the substitution with CC ( Saccahromyces cerevisiae ) ReY29-4_P16 KCCM 13340P. Claim 6 Saccharomyces cerevisiae according to claim 1, characterized in that the microplastic is 1 to 500 nm ( Saccahromyces cerevisiae ) ReY29-4_P16 KCCM 13340P. Claim 7 Saccharomyces cerevisiae according to Paragraph 1 ( Saccahromyces cerevisiae A food composition for inhibiting microplastic absorption containing ReY29-4_P16 KCCM 13340P as an active ingredient. Claim 8 Saccharomyces cerevisiae according to Paragraph 1 ( Saccahromyces cerevisiae ) Feed composition for inhibiting microplastic absorption containing ReY29-4_P16 KCCM 13340P as an active ingredient. Claim 9 Saccharomyces cerevisiae according to Paragraph 1 ( Saccahromyces cerevisiae A composition for adsorbing microplastics comprising ReY29-4_P16 KCCM 13340P.

Citation Information

Patent Citations

  • Probiotics comprising novel lactic acid bacteria and yeast

    KR1020210063000A