Composition for detecting Tannerella forsythia and uses thereof
Patent Information
- Application Number
- KR1020240062776
- Authority / Receiving Office
- KR · KR
- Patent Type
- Patents
- Current Assignee / Owner
- Filing Date
- 2024-05-13
- Publication Date
- 2026-09-04
- Estimated Expiration
- 2044-05-13
Smart Images

Figure 112024051881047-PAT00001_ABST
Abstract
Description
Technology Field
[0001] The present invention relates to Tannerella fossitia, a causative agent of periodontal disease ( Tannerella forsythia This invention relates to a primer set for isothermal amplification reaction for detecting strains and the use thereof. Background Technology
[0003] When bacteria in the human oral cavity form clumps to constitute dental plaque (or dental biofilm), they remain and are not removed even by brushing; they act directly on gingival tissue, inducing an immune response or releasing cytotoxic substances that cause inflammation in the gingival tissue.
[0004] Periodontitis is a representative oral disease characterized by a chronic inflammatory condition in which a persistent immune-inflammatory response, resulting from the interaction between periodontal pathogens and the host immune system, causes the destruction of tissues surrounding the teeth, such as the alveolar bone. As a chronic inflammatory disease, periodontal disease is a major oral condition closely related to the oral health of adults. The prevalence of periodontal disease is high, ranging from 10% to 60% globally; an analysis of the global burden of diseases reported that severe periodontitis has the sixth highest prevalence rate (10.8%) worldwide. In particular, as periodontitis progresses, it causes the formation of periodontal pockets, loss of gingival attachment, and the destruction of tooth-supporting tissues such as the periodontal ligament and alveolar bone; therefore, severe periodontitis can lead to tooth loss. Consequently, periodontitis is a major cause of tooth extraction in adults, and it has been found that more than half of permanent tooth extractions in Korea are due to periodontal disease. Therefore, periodontal disease has a strong impact on the decline in oral health-related quality of life in adults and is a disease that also places a significant socioeconomic burden.
[0005] According to reports to date, while factors such as smoking, systemic diseases like diabetes, and diseases accompanied by immunodeficiency influence the onset of periodontal disease, Gram-negative bacterial species present in subgingival plaque are known to be the major pathogens causing periodontal disease. In particular, bacterial colonies in subgingival plaque have been classified according to the extent to which they affect periodontitis, and the species Porphyromonas gingivalis ( Porphyromonas gingivalis ), Treponema denticolla ( Treponema denticola ) or Tannerella pocitia ( Tannerella forsythia The most critical bacterial colony in periodontitis has been named the red complex. These bacteria belonging to the red complex are found more frequently in the oral cavity of people with periodontitis and are known to be closely associated with the progression and severity of periodontitis. They have also been reported to be highly associated with major health risk factors such as obesity, cardiovascular health status, diabetes, and insulin resistance.
[0006] For example, key periodontal pathogens Porphyromonas gingivalis, Treponema denticola, or Tannerella focitia were identified at a higher frequency in obese or diabetic individuals. A study investigating the association between these periodontal pathogens and obesity in healthy Japanese subjects found that these bacteria were significantly associated with obesity status, expressed as body mass index (BMI) or waist circumference, independently of the presence of periodontitis. It was reported that individuals with red complex bacteria had higher levels of obesity, and the number of red complex species found in the oral cavity was also correlated with obesity. Furthermore, it was reported that a quantitative increase in Porphyromonas gingivalis, Treponema denticola, or Tannerella focitia was significantly associated with periodontitis and a decrease in serum HDL-cholesterol levels. In addition, among periodontal pathogens, Pyromonas gingivalis, Treponema denticola, Tannerella forcitia, or Prevotella intermedia ( Prevotella intermedia) possesses an enzyme called PAD (peptidyl arginine deaminase), a type of proteolytic enzyme, which affects p53 point mutations and can act as a risk factor for the development of pancreatic cancer, resulting in much higher antibody titers for Pyromonas gingivalis in pancreatic cancer patients.
[0007] Therefore, there is a need to develop a system capable of detecting the causative bacterial species of the aforementioned bacterial oral diseases using an efficient and highly sensitive method, particularly for epidemiological studies to identify the causative bacterial species of periodontal diseases and for assessing the prevention, risk of onset, and prognosis after treatment of periodontal disease. Although technologies for the rapid identification of oral disease-causing microorganisms have been continuously developed and are currently being sold, including PCR, Real-time PCR, and detection techniques using DNA chips, these methods have disadvantages such as the need for complex nucleic acid isolation and amplification processes, expensive equipment, and specialized knowledge and technical skills. In other words, despite various demands, they are not widely used due to a lack of user convenience. Prior art literature
[0009] Xiong et al., B.J.O.G. 2006 Feb;113(2):135-43. doi: 10.1111 / j.1471-0528.2005.00827.x.Kassebaum et al., J Dent Res. 2014 Nov; 93(11): 1045-1053. Socransky, SS, et al., Periodontal microbial ecology. Periodontology 2000, 38(1), 135-187.Socransky, SS, et al., Microbial complexes in subgingival plaque. Journal of clinical periodontology 1998, 25(2), 134-144.Kato, T., et al., Oral Administration of Porphyromonas gingivalis Alters the Gut Microbiome and Serum Metabolome 2018. mSphere, 3(5), e00460-18.Matsushita, K., et al., Journal of clinical biochemistry and nutrition 2015. 57(2), 135-139. The problem to be solved
[0010] The inventors intended to provide a method for detecting the causative bacteria of periodontitis by a color change of the reaction product without the need for pure purification of the sample, so that even non-experts can simply determine the presence of infection and diagnose periodontitis without expensive specialized equipment.
[0011] Therefore, the objective of the present invention is to [describe] the periodontal disease-causing bacteria Tannerella fossitia ( Tannerella forsythiaThe present invention provides a novel primer set for detecting the causative agent of periodontal disease, *Tannerella focitia* strain, using Loop-Mediated Isothermal Amplification (LAMP), which can rapidly and specifically detect the strain without complex nucleic acid purification and without expensive equipment, and provides the use thereof. means of solving the problem
[0013] The present invention relates to a periodontal disease causative agent Tannerella focitia comprising a primer represented by the nucleotide sequence of SEQ ID NO. 1, a primer represented by the nucleotide sequence of SEQ ID NO. 2, a primer represented by the nucleotide sequence of SEQ ID NO. 3, a primer represented by the nucleotide sequence of SEQ ID NO. 4, and a primer represented by the nucleotide sequence of SEQ ID NO. 5 ( Tannerella forsythia ) provides a composition for detection.
[0014] According to a preferred embodiment of the present invention, the composition is used for loop-mediated isothermal amplification.
[0015] According to a preferred embodiment of the present invention, the composition detects the GroEL gene of the Tannerella focitia strain.
[0016] The present invention also comprises Tannerella fossitia comprising the composition of claim 1 ( Tannerella forsythia Provides a detection kit.
[0017] According to a preferred embodiment of the present invention, the kit comprises a lysis buffer, Bst DNA polymerase, 0.2 to 20 mM Tris-HCl, 1 to 20 mM Ammonium Acetate, 10 to 80 mM KCl, 2 to 10 mM MgSO4, 0.02 to 0.5% Tween-20, and 1.0 to 2.0 mM dNTPs.
[0018] According to a preferred embodiment of the present invention, the kit additionally comprises one or more selected from the group consisting of fluorescent dyeing materials, pH indicators (pH-sensitive dyes), and indigo, alcian, methylene blue, azure II, toluidine blue, and mixtures thereof.
[0019] According to a preferred embodiment of the present invention, the kit can confirm a color reaction within one hour using a single volume pipette.
[0020] The present invention also comprises the step of (a) releasing a sample separated from an individual into a lysis buffer and then reacting at 90 to 98°C to elute nucleic acids;
[0021] (b) a step of performing an isothermal amplification reaction using the above-described eluted nucleic acid as a template and the composition of claim 1; and
[0022] (c) a step of detecting the amplified product according to the above isothermal amplification reaction;
[0023] Tannerella pocitia including ( Tannerella forsythia ) Provides a method for detecting strains.
[0024] According to a preferred embodiment of the present invention, the sample of step (a) is one or more selected from the group consisting of urine, feces, saliva, body fluids, blood, skin, dental plaque, cells, and tissues.
[0025] According to a preferred embodiment of the present invention, the isothermal amplification reaction of step (b) is performed at 55 to 68°C.
[0026] According to a preferred embodiment of the present invention, the isothermal amplification reaction of step (b) is performed for 10 to 40 minutes. Effects of the invention
[0028] When using the novel primer set for detecting the Tannerella forsythias strain, a causative agent of periodontal disease, according to the present invention, even unskilled workers can detect the Tannerella forsythias strain very quickly and easily. Therefore, the present invention is useful for on-site diagnosis where expensive equipment, reagents, and specialized personnel are not available, and it is expected to promote patient health and revitalize the hospital economy through rapid diagnosis and prescription for infected patients. Brief explanation of the drawing
[0030] Figure 1 shows a schematic diagram of the process from sample collection to detection of periodontitis causative bacteria and result interpretation. FIG. 2 shows (a) Tannerella fossitia in the present invention ( Tannerella forsythia To design a strain-specific LAMP primer set, Treponema denticola, a causative agent of periodontitis ( Treponema denticola ), Porphyromonas gingivalis( Porphyromonas gingivalis ) and Streptococcus mutans, a representative cavity-causing bacterium ( Streptococcus mutans (b) Shows the results of a multiple sequence alignment for the range from 950 bp to 1250 bp, which has high discriminative power, by analyzing the GroEL gene region of ) and Escherichia coli. (b) Shows the amplification region of the LAMP primer set specific to the Tannerella fossitias strain of the present invention. FIG. 3 shows (a) the primer set of the present invention, Tannerella forsythias ( Tannerella forsythia ) Indicates strain-specific amplification. (b) Detection of up to 10 fg of Tannerella fossitiar strain gDNA was confirmed by color change and agarose electrophoresis. Figure 4 shows the minimum amplification limit that the primer set of the present invention can detect without additional nucleic acid purification. Figure 5 shows that the primer set of the present invention was detected within 40 minutes in a real-time PCR instrument using a fluorescent substance. Specific details for implementing the invention
[0031] The present invention will be described in more detail below.
[0033] The term 'detection' in the present invention refers to determining the presence or absence of chemical species or microorganisms in a sample during chemical analysis, and in the present invention, it may refer to detecting the Tannerella fossitia strain, which is a causative agent of periodontitis.
[0034] In the present invention, the LAMP primers consist of six types as follows. FIP (Forward Inner Primer) and BIP (Backward Inner Primer) are the main primers that form amplification monomers (amplicons) and are involved in the initiation of the amplification reaction and the formation of ring structures. In addition, F3 (Forward 3) and B3 (Backward 3) cause a polymerization reaction that induces a strand displacement phenomenon in which the polymer produced from the FIP / BIP primers separates from the initial template. LF (Loop Forward) and LB (Loop Backward) play a role in forming more products by binding to the ring structure of the amplification monomer.
[0035] The 'dental biofilm' of the present invention is a representative oral biofilm, also known as 'dental plaque' or 'plaque,' and may refer to a 'film of bacterial mass' in which oral bacteria adhere to a thin, sticky residue of fine food glycoproteins attached to the surface of teeth after eating.
[0037] The present invention relates to Treponema denticola, a causative agent of periodontal disease ( Treponema denticolaThe present invention relates to a LAMP primer set for detection and its use, and enables the detection of pathogens from a sample with high sensitivity and specificity without the need for pure purification of nucleic acids. Ultimately, in order to allow even non-experts to perform the experiment using only a single-volume pipette, the kit is configured so that the sample and the primer set are placed in equal volumes into individual tubes of pre-dispensed reaction products. Therefore, it can be effectively utilized even in sites where expensive equipment, reagents, and specialized personnel are not available.
[0039] Accordingly, the present invention relates to a periodontal disease causative agent Tannerella focitia comprising a primer represented by the nucleotide sequence of SEQ ID NO. 1, a primer represented by the nucleotide sequence of SEQ ID NO. 2, a primer represented by the nucleotide sequence of SEQ ID NO. 3, a primer represented by the nucleotide sequence of SEQ ID NO. 4, a primer represented by the nucleotide sequence of SEQ ID NO. 5, and a primer represented by the nucleotide sequence of SEQ ID NO. 6 ( Tannerella forsythia A composition for detection can be provided.
[0040] The primer represented by the nucleotide sequence of SEQ ID NO. 1 and the primer represented by the nucleotide sequence of SEQ ID NO. 2 may be an outer primer pair, the primer represented by the nucleotide sequence of SEQ ID NO. 3 and the primer represented by the nucleotide sequence of SEQ ID NO. 4 may be a loop primer pair, and the primer represented by the nucleotide sequence of SEQ ID NO. 5 and the primer represented by the nucleotide sequence of SEQ ID NO. 6 may be an inner primer pair.
[0041] According to a preferred embodiment of the present invention, the composition may be used for loop-mediated isothermal amplification.
[0042] The above isothermal amplification (LAMP) may be a colorimetric LAMP (Colorimetric Loop Mediated Isothermal Amplification) and / or a fluorescence-based LAMP (Fluorescence-based Real-time Loop Mediated Isothermal Amplification). Additionally, the isothermal amplification product may be detected by a lateral flow assay using a gold nanoparticle probe or a fluorescence probe.
[0043] According to a preferred embodiment of the present invention, the composition may detect the GroEL gene of a Tannerella focitia strain. The GroEL gene may detect the region from 996 bp to 1196 bp of the GroEL gene sequence according to GeneBank access number AJ006516.1 of the Tannerella focitia strain gene sequence.
[0044] The above Tannerella pocitia ( Tannerella forsythia The GroEL gene of ) is selected from the genetic information of GeneBank accession number AJ006516.1, AP013044.1, CP003191.1, or AP013045.1 so that the GroEL gene detection site selected from GeneBank accession number AJ006516.1, AP013044.1, CP003191.1, or AP013045.1 can be selected as a specific site for other periodontal disease causative bacteria and E. coli, in order to ( Treponema denticola The corresponding gene sequences were compared based on the GroEL gene sequence region GeneBank accession number CP038801.1, CP051302.1, CP051303.1, CP058347.1, or AE017226.1 sequences, and Porphyromonas gingivalis ( Porphyromonas gingivalisThe corresponding genes were compared based on the GroEL gene sequence GeneBank accession number CP025930.1, CP024596.1, CP073348.1, CP025931.1, or CP024598.1, and Streptococcus mutans, a representative caries-causing bacterium ( Streptococcus mutans The GroEL gene sequence region of ) was compared based on the GeneBank accession number, CP003686.1, CP082153.1, CP044492.1, CP044221.1, or CP050962.1 sequences, and E. coli ( Escherichia coli It was selected through sequence analysis with the GeneBank accession number, LR134191.1, LR134247.1, CP121157.1, or AP027424.1, corresponding to the GroEL of ).
[0046] The present invention also comprises Tannerella fossitia comprising the composition of claim 1 ( Tannerella forsythia A detection kit can be provided.
[0047] According to a preferred embodiment of the present invention, the kit may comprise a lysis buffer, Bst DNA polymerase, 0.2 to 20 mM Tris-HCl (pH 8.8), 1 to 20 mM Ammonium Acetate, 10 to 80 mM KCl, 2 to 10 mM MgSO4, 0.02 to 0.5% Tween-20, and 1.0 to 2.0 mM dNTPs.
[0048] The above kit may additionally contain 0.02 to 0.5 mM phenol red, but is not limited thereto.
[0049] The above lysis buffer may be provided by dispensing 150 µl to 250 µl containing 5% to 10% Chelex100 for dissolving the sample into a 1.5 ml tube.
[0050] The above Bst DNA polymerase may be used to amplify the sample. Colorimetric LAMP Master Mix (Product Name: BioFACT™2X Colorimetric LAMP Master Mix (DNA & RNA), Cat. No. RL351-10h) and BioFACT™Bst DNA Polymerase, Large Fragment (Cat. No. BP101-16h) developed by BioFACT Inc. were primarily used. However, any polymerase used in the LAMP reaction may be used without restriction as long as it possesses strand displacement activity and can carry out a polymerization reaction at a temperature (generally between 60°C and 72°C) where thermodynamic activity is maintained to allow the polymer, the reaction product, to form a ring structure.
[0051] The above Tris-HCl may have a pH of 8 to 9, and preferably a pH of 8.5 to 8.8.
[0052] According to a preferred embodiment of the present invention, the kit may additionally include one or more selected from the group consisting of fluorescent dyeing materials, pH indicators (pH-sensitive dyes), and indigo, alcian, methylene blue, azure II, toluidine blue, and mixtures thereof.
[0053] The above fluorescent dyeing material may be a SyGeen fluorescent dye.
[0054] According to a preferred embodiment of the present invention, the kit may be capable of confirming a color reaction within one hour using a single volume pipette.
[0055] The kit of the present invention may be composed of one or more other component compositions, solutions, or devices suitable for commonly used expression level analysis methods. For example, a kit for measuring protein expression levels may include a substrate, a suitable buffer solution, a secondary antibody labeled with a chromogenic enzyme or fluorescent substance, a chromogenic substrate, etc., for the immunological detection of antibodies.
[0056] The kit of the present invention may include a sample extraction means for obtaining a sample from an evaluation subject. The sample extraction means may include a needle, a syringe, or a dermal curette, etc. The kit may include a sample collection container for receiving the extracted sample, which may be a liquid, a gas, or a semi-solid. The kit may further include instructions for use. The sample is Tannerella forsythias ( Tannerella forsythia It may be ) or any body sample in which its gene may be present. For example, the sample may be urine, feces, saliva, body fluids, blood, skin, dental plaque, cells, or tissue. Tannerella forsythias in body samples ( Tannerella forsythia Measurements of ) can be performed on the whole sample or on the processed sample.
[0058] The present invention also comprises the step of (a) releasing a sample separated from an individual into a lysis buffer and then reacting at 90 to 98°C to elute nucleic acids;
[0059] (b) a step of performing an isothermal amplification reaction using the above-described eluted nucleic acid as a template and the composition of claim 1; and
[0060] (c) a step of detecting the amplified product according to the above isothermal amplification reaction;
[0061] Tannerella pocitia including ( Tannerella forsythia ) A method for detecting strains can be provided.
[0062] According to a preferred embodiment of the present invention, the sample in step (a) may be one or more selected from the group consisting of urine, feces, saliva, body fluids, blood, skin, dental plaque, cells, and tissues. Preferably, the sample in step (a) may be saliva and / or dental plaque.
[0063] The dissolution buffer of step (a) above comprises 5% to 10% Chelex 100 resin and sterile water, and may comprise one or more selected from the group consisting of 0.001% to 0.005% sodium azide, 0.01% to 0.05% Triton X100 and 0.01% to 0.05% Tween20.
[0064] Preferably, the dissolution buffer of step (a) may comprise 5% to 10% Chelex 100 resin, sterile water, and 0.01% to 0.05% Triton X100.
[0065] According to a preferred embodiment of the present invention, the isothermal amplification reaction of step (b) may be performed at 55 to 68°C. Preferably, the isothermal amplification reaction of step (b) may be performed at 60 to 66°C using a small heat block, a thermostat, or a water bath.
[0066] According to a preferred embodiment of the present invention, the isothermal amplification reaction of step (b) may be performed for 10 to 40 minutes. Preferably, the isothermal amplification reaction of step (b) may be performed for 30 to 40 minutes using a small heat block, a thermostat, or a water bath.
[0067] According to a preferred embodiment of the present invention, the detection of step (c) may be performed through a DNA chip, gel electrophoresis, capillary electrophoresis, real-time fluorescence detection, or color change, but preferably, the detection of step (c) may be performed by detecting fluorescence and / or color change using real-time PCR simultaneously with the isothermal amplification reaction of step (b).
[0068] Fluorescence analysis, which detects substances through fluorescence, is a chemical analysis method that utilizes the fluorescence of a substance; it refers to the process of converting a non-fluorescent sample into a fluorescent substance through a chemical reaction and analyzing the resulting fluorescence. Colorimetric analysis, which detects substances through color changes, refers to testing or quantifying the concentration of chemical compounds or solutions by observing color changes visually using color reagents or by measuring the absorbance of light at specific wavelengths.
[0070] The present invention will be explained in more detail below through examples. These examples are intended solely to illustrate the present invention, and it is obvious to those skilled in the art that the scope of the present invention is not to be interpreted as being limited by these examples.
[0072] LAMP target substance generation
[0073] Tannerella pocitia from the Korean Collection for Type Cultures (KCTC) Tannerella forsythia ; (KCTC 5666), Porphyromonas gingivalis( Porphyromonas gingivalis ; (KCTC 5352), Treponema denticola( Treponema denticola ; KCTC 15104), Streptococcus mutans( Streptococcus mutansAfter receiving an active culture of the strain (KCTC 3065), genomic DNA was obtained by extracting a portion of the sample using Biofact's HiGene™ Genomic DNA Prep Kit (Cat. No. GD141-050). The groEL, 16S, and 23S gene regions of each strain were PCR amplified and cloned into a Topo-TA vector, and then the sequence information was sequenced to obtain target substances.
[0075] LAMP reaction target selection, primer design and selection
[0076] Sequence information for the groEL, 23S, and 16S genes of each strain for sequence analysis was obtained using the NCBI nucleotide Blast search based on the sequencing results. To design LAMP primers specific to the Tannerella focitia strain, the sequences were compared with those of other periodontitis-causing bacteria, such as Treponema denticola and Porphyromonas gingivalis, as well as the representative caries-causing bacteria, Streptococcus mutans, using the European Bioinformatics Institute (EMBL-EBI) Multiple Sequence Alignment program Clustal Omega (https: / / www.ebi.ac.uk / jdispatcher / msa / clustalo). [Fig. 2] shows the results of a multiple sequence alignment for the range from 950 bp to 1250 bp of the groEL gene, which is selected for the design of LAMP primers specific to Tannerella focitia strains in the present invention among the groEL gene regions of the above comparison strains, and the amplification sites of the Tannerella focitia strain-specific LAMP primer set.
[0077] The reason for comparing the groEL gene to E. coli was to avoid the possibility that the selected LAMP primer set might not be specific to amplification in E. coli-derived genomic DNA, as most DNA polymerases for nucleic acid amplification are produced in E. coli strains. As a result of designing several sets of LAMP primers for the relevant region, a LAMP primer set was selected that was not specifically amplified in E. coli but was specific to the Tannerella forcitia strain (Fig. 2(b), Table 1).
[0079] gene division Sequence (5'→3') Sequence number groEL F3 GGTCACGGTGAACAAAGACA 1 B3 GCGTCGTCTACACGGTCT 2 LF TAGCAGCCTTGTCGCC 3 LB GGAGTCGCCGTGCTCTA 4 FIP GTGCCTTGATCTGGCCGATACGCGACGATCGTGAAAGGGAAC 5 BIP AGTTGCAGGAACGTTTGGCGATTTCCACTTCCGAAGGAGC 6
[0081] Using a selected LAMP primer set, the genomic DNA extracted in [Example 1] was used as a 10 pg template per reaction to test for non-specific amplification of other periodontitis strains and Escherichia coli strains. Reaction tests were performed at 65°C for 40 minutes using our company's BioFACT™2X Colorimetric LAMP Master Mix (DNA & RNA). Specific amplification of the Tannerella forsythias strain was confirmed by color change, and the reaction product was verified by agarose gel electrophoresis (Fig. 3 (a)). To verify the detection limit of the LAMP primer set in this invention, the genomic DNA of the Tannerella forsythias strain extracted in [Example 1] was sequentially diluted and tested. As a result, detection up to 10 fg was confirmed by color change and agarose gel electrophoresis after a reaction at 65°C for 40 minutes (Fig. 3 (b)).
[0083] Design of isothermal amplification conditions without nucleic acid purification
[0084] In point-of-care diagnostics, rapid test results for samples are required without expensive equipment or complex extraction processes. Therefore, in this invention, to confirm by isothermal amplification without pure purification of nucleic acids, a method was selected in which a collected sample is dissolved in 150 µl to 250 µl of 5% to 10% Chelex 100 resin (BIO-RAD), reacted for 10 minutes in a heating block set to a temperature of 95–98°C, and the supernatant containing eluted gDNA is used immediately. Tannerella focitia ( Tannerella forsythia After calculating the number of cells based on the measurement value at OD600 and performing serial dilution of the cultured strain suspension to test the minimum detection limit, it was confirmed that up to 166 cells were detected per reaction, and it was found that the color change and the results of the agarose electrophoresis were consistent (Fig. 4).
[0086] Detection using fluorescence
[0087] In the present invention, Tannerella fossitia ( Tannerella forsythia A total of 25 μl of reaction solution, consisting of BioFACT™ Bst DNA Polymerase and Large Fragment, 1.6 μM FIP and BIP, 0.4 μM F3 and B3, 0.2 μM LF and LB, 1 x polymerase buffer, 1.8 mM dNTP, 8 mM MgSO4, 0.25 x SyGreen fluorescent dye, and 8 U Bst DNA Polymerase, was used with a LAMP primer set for strain detection and was reacted using a BIO-RAD CFX96 real-time PCR instrument at 65°C for 60 minutes.
[0088] As a result, it was confirmed that a 10fg Tannerella fossitia strain gDNA template was stably amplified within 30 minutes in real-time fluorescence (Fig. 5).
[0090] Design of customized on-site diagnostic kits
[0091] The objective of the present invention is to ultimately provide a kit for detecting the Tannerella fossitis strain, a causative agent of periodontitis, even for unskilled workers without the need for expensive equipment or specialized technical expertise.
[0093] <5-1> Sample Preparation
[0094] A (dental) plaque sample collected from the patient's interdental space or tooth surface with a brush was dissolved in a 150 µl solution of lysis buffer containing 5% Chelex 100 resin and 0.05% Triton X100, and then boiled for 10 minutes in a heating block set to a temperature of 95 to 98°C.
[0096] <5-2> Preparation of reaction solution
[0097] The process of preparing existing LAMP reaction compositions requires mixing various reaction volumes, and in most cases, the volume of the mold is designed not to exceed 10% of the reaction volume. When taking a volume of 1 µl to 2 µl and adding it to the reaction solution, it is difficult for an inexperienced user to obtain the exact volume. In addition, most commercially available LAMP reaction composition kits are set with a reaction volume of 15 µl to 25 µl, so the amount of mold used for the reaction cannot exceed 1.5 µl to 2.5 µl, requiring various types of pipettes (Table 2).
[0098] In the LAMP reaction kit of the present invention, the reaction is induced with a volume of 50 µl, and a composition containing 40 µl of Bst DNA polymerase and reaction buffer is provided in a pre-dispensed state in a PCR tube, 5 µl is taken from the sample prepared above as a template and added, and 5 µl of the LAMP primer set for detecting Tannerella fossitias strain of the present invention is added to complete the reaction composition (Table 3).
[0100] Contents DNA Target RNA Target 2X LAMP Master Mix (DNA & RNA) 12.5㎕ 12.5㎕ LAMP Primer Mixture (10X) 2.5 ㎕ 2.5 ㎕ Target DNA 1㎕ - Target RNA - 1㎕ DW 9㎕ 9㎕ Total Vol. 25㎕ 25㎕
[0102] PCR Mixture (Reaction volume: 50 ㎕) Condition Colorimetric LAMP Pre-Mix 40㎕Pri-M2( T. forsythia ) 5㎕Template DNA(Sample / NTC / PC) 5㎕ 65℃40min Total Vol. 25 µl
[0104] <5-3> LAMP Reaction and Result Reading
[0105] The PCR tube containing the reaction solution prepared above was placed in a heating block set to 65°C for 40 minutes to determine the presence or absence of infection based on a change in color. The entire process and interpretation method are as shown in the schematic diagram of [Figure 1].
Claims
Claim 1 Tannerella forcitia, a causative agent of periodontal disease, comprising a primer represented by the nucleotide sequence of SEQ ID NO. 1, a primer represented by the nucleotide sequence of SEQ ID NO. 2, a primer represented by the nucleotide sequence of SEQ ID NO. 3, a primer represented by the nucleotide sequence of SEQ ID NO. 4, a primer represented by the nucleotide sequence of SEQ ID NO. 5, and a primer represented by the nucleotide sequence of SEQ ID NO. 6 ( Tannerella forsythia A composition for on-site detection, wherein the composition is used for colorimetric loop mediated isothermal amplification, and the composition is characterized by detecting the GroEL gene of a Tannerella focitia strain. Claim 2 delete Claim 3 delete Claim 4 Tannerella fossitia comprising the composition of claim 1 ( Tannerella forsythia A kit for on-site detection, wherein the kit is used for Colorimetric Loop Mediated Isothermal Amplification, and the kit is characterized by detecting the GroEL gene of a Tannerella focitia strain. Claim 5 In claim 4, the kit is characterized by comprising a lysis buffer, Bst DNA polymerase, 0.2 to 20 mM Tris-HCl, 1 to 20 mM Ammonium Acetate, 10 to 80 mM KCl, 2 to 10 mM MgSO4, 0.02 to 0.5% Tween-20, and 1.0 to 2.0 mM dNTPs. Claim 6 In claim 4, the kit is characterized by additionally comprising one or more selected from the group consisting of pH indicators (pH-sensitive dyes) and indigo, alcian, methylene blue, azure II, toluidine blue, and mixtures thereof. Claim 7 In claim 4, the kit is characterized by being able to confirm a color reaction within one hour using a single volume pipette. Claim 8 (a) a step of releasing a sample isolated from an organism into a lysis buffer and reacting at 90 to 98°C to elute nucleic acid; (b) a step of performing a Colorimetric Loop Mediated Isothermal Amplification reaction using the eluted nucleic acid as a template and the composition of claim 1; and (c) a step of detecting an amplified product resulting from the isothermal amplification reaction; comprising Tannerella focitia ( Tannerella forsythia A method for on-site detection of a strain, wherein the composition is characterized by detecting the GroEL gene of the Tannerella focitia strain. Claim 9 A method according to claim 8, wherein the sample of step (a) is one or more selected from the group consisting of urine, feces, saliva, body fluids, blood, skin, dental plaque, cells, and tissues. Claim 10 A method according to claim 8, characterized in that the isothermal amplification reaction of step (b) is performed at 55 to 68°C. Claim 11 A method according to claim 8, characterized in that the isothermal amplification reaction of step (b) is performed for 10 to 40 minutes.