DNA aptamer specifically binding to DNA polymerase and using the same

Abstract

The present invention relates to a DNA aptamer that specifically binds to a DNA polymerase and its uses. Specifically, the DNA aptamer according to the present invention specifically and strongly binds to a DNA polymerase, particularly a Bst polymerase, and can be usefully used for amplifying a target sequence by significantly increasing the amplification efficiency of the Bst polymerase during the base sequence amplification process.

Description

Technology Field

[0001] The present invention relates to a DNA aptamer that specifically binds to a DNA polymerase and its uses. Background Technology

[0003] DNA polymerase is an enzyme that synthesizes DNA complementary to a template in the 5'→3' direction and plays an important role in DNA replication and repair in living organisms. DNA polymerases are classified into six families (Families A, B, C, D, X, and Y) based on their amino acid sequences. Most DNA polymerases belonging to Family B possess 3'→5' exonuclease activity, known as proofreading activity, which enables replication with high accuracy. With the development of PCR technology using heat-resistant DNA polymerases, these polymerases began to receive attention, and heat-resistant DNA polymerases were developed from various thermophilic and hyperthermophilic bacteria.

[0004] Among them, Bst polymerase is a DNA polymerase used in loop-mediated isothermal amplification. Compared to the generally known polymerase chain reaction (PCR), loop-mediated isothermal amplification has the advantage of not requiring expensive equipment such as gene amplifiers or specialized personnel, as it proceeds at a single temperature. Furthermore, not only is the amplification speed fast and specificity high, but loop-mediated isothermal amplification also allows for the visual observation of the reaction products to determine whether the target gene has been amplified, enabling the diagnosis of pathogens or diseases in the field.

[0005] In this regard, Korean registered patent No. 10-2453357 relates to a set of simultaneous multiplex isothermal amplification primers capable of detecting Candida albicans, Candida auris, and Candida glabrata using a fluorescent probe. The primer set, based on an 18s-28s rRNA gene sequence containing an ITS2 region, does not require temperature changes during the electrophoresis or detection process compared to conventional PCR methods, thereby enabling the economical detection of the strains.

[0006] Meanwhile, Bst polymerase unwinds the DNA double helix structure through strand substitution without a separate denaturation step, while simultaneously replicating the template DNA. Bst polymerase exhibits optimal activity at 60 to 65°C. Prior art literature

[0008] Republic of Korea Registered Patent No. 10-2453357 The problem to be solved

[0009] The object of the present invention is to provide a DNA aptamer that specifically binds to a DNA polymerase and its uses. means of solving the problem

[0011] To achieve the above objective, the present invention provides a DNA aptamer that specifically binds to a DNA polymerase, comprising a nucleotide sequence selected from the group consisting of nucleotide sequences described in SEQ ID NOs 1 to 12.

[0012] In addition, the present invention provides a composition or kit for detecting DNA polymerase comprising the above DNA aptamer.

[0013] In addition, the present invention provides a method for detecting DNA polymerase comprising the step of reacting a DNA aptamer with a sample.

[0014] In addition, the present invention provides a composition or kit for base sequence amplification comprising the above DNA aptamer.

[0015] Furthermore, the present invention provides a method for amplifying a base sequence, comprising the step of amplifying a base sequence by adding the DNA aptamer. Effects of the invention

[0017] The DNA aptamer according to the present invention specifically and strongly binds to DNA polymerase, particularly Bst polymerase, and significantly increases the amplification efficiency of Bst polymerase during the base sequence amplification process, thereby being useful for amplifying a target base sequence. Brief explanation of the drawing

[0019] Figure 1 is a diagram showing the result of confirming the PCR product amplified from a random DNA library in one embodiment of the present invention through agarose gel electrophoresis. Figure 2 is a graph showing the results of confirming the binding strength of DNA aptamers and Bst polymerase obtained in one embodiment of the present invention by nanodrop analysis according to the number of times SELEX is performed. Figure 3 is a graph showing the results of confirming the binding strength of DNA aptamers and Bst polymerase obtained in one embodiment of the present invention using a real-time PCR method according to the number of times SELEX is performed. Figures 4 and 5 are diagrams showing the results of confirming the structures of 12 DNA aptamers selected in one embodiment of the present invention. Figures 6 and 7 are result diagrams predicting the binding structure of 12 DNA aptamers selected in one embodiment of the present invention and Bst polymerase. Figure 8 is a diagram showing the results of confirming the effect of enhancing the reverse transcription reaction by three DNA aptamers selected in one embodiment of the present invention. Specific details for implementing the invention

[0020] The present invention will be described in detail below.

[0021] The present invention provides a DNA aptamer that specifically binds to a DNA polymerase, comprising a nucleotide sequence selected from the group consisting of nucleotide sequences described in SEQ ID NOs 1 to 12.

[0022] As used herein, the term "DNA polymerase" refers to an enzyme involved in the process of synthesizing DNA by combining four nucleotides, which are components of DNA. The DNA polymerase reads an existing DNA strand and synthesizes new DNA that is complementary to it. In this process, the DNA polymerase can add new nucleotides only to the 3' end of the existing DNA strand and, accordingly, extend the DNA in the 5'→3' direction.

[0023] The above DNA polymerase may include all types of DNA polymerase known in the ordinary art. In one embodiment of the present invention, the DNA polymerase may be a Bst polymerase. The Bst polymerase may be a polypeptide composed of the amino acid sequence described in SEQ ID NO. 17. The polypeptide may include variants having different sequences by inserting, deleting, substituting, or combining the insertion, deletion, or substitution of one or more residues within a range that maintains the activity of the protein. Amino acid exchange in proteins or peptides that does not alter the overall activity of the molecule is well known in the ordinary art. Furthermore, the polypeptide may have 70%, 80%, 90%, 95%, or 97% or more homology with the amino acid sequence constituting it. Additionally, the polypeptide may be modified, depending on the case, by phosphorylation, sulfation, acrylation, glycosylation, methylation, farnesylation, etc.

[0024] In addition, the nucleotide sequence encoding the above Bst polymerase may also be included within the scope of the present invention.

[0025] As used herein, the term "aptamer" refers to a nucleic acid molecule capable of binding to a specific substance with high affinity and specificity. The aptamer may be prepared by methods well known in the ordinary art, and said methods may be appropriately modified as necessary.

[0026] The DNA aptamer according to the present invention may be selected from the group consisting of nucleotide sequences described in SEQ ID NOs 1 to 12. As long as the DNA aptamer maintains the characteristic of specifically binding to Bst polymerase, it may have 80% or more, 90% or more, 95% or more, 97% or more, or 99% or more homology with the nucleotide sequences described in SEQ ID NOs 1 to 12.

[0027] To enhance the binding affinity and stability of the above DNA aptamer to a target substance, the sugar residues of each nucleotide, specifically ribose or deoxyribose, may be modified. The modification may involve substituting one or more oxygen atoms selected from the group consisting of the 2', 3', and 4' positions of the sugar residue with other atoms. Examples of modifications may include fluorination, O-alkylation, O-allylation, S-alkylation, S-allylation, amination, etc. Such modification of the sugar residues may be performed by conventional methods.

[0028] In addition, the DNA aptamer may have its nucleic acid bases modified to increase binding affinity to a target substance. The modification of the nucleic acid bases may include modification of the pyrimidine at the 5 position, modification of the purine at the 6 position, modification of the purine at the 8 position, modification at an exocyclic amine, substitution with 4-thiouridine, substitution with 5-bromo, or substitution with 5-iodone-urisyl.

[0029] In addition, the phosphate group of the DNA aptamer may be modified to have resistance to nucleases and hydrolases, etc. For example, the phosphate group may be substituted with thioate, dithioate, amidate, formacetal, 3'-amine, etc. Furthermore, the DNA aptamer may include modifications to the 3' end or 5' end, and said modifications may be capping or the addition of biotinyl, polyethyl glycol, amino acid, peptide, nucleic acid, nucleoside, myristoyl, lithocolic-oleyl, docosanyl, lauroyl, stearoyl, palmitoyl, oleoyl, linoleoyl, lipid, steroid, cholesterol, caffeine, vitamin, pigment, fluorescent substance, anticancer agent, toxin, enzyme, radioactive material, biotin, etc.

[0031] In addition, the present invention provides a composition or kit for detecting DNA polymerase comprising the above DNA aptamer.

[0032] The DNA aptamer included in the composition and kit for detecting DNA polymerase according to the present invention may have the characteristics described above. For example, the DNA aptamer may be selected from the group consisting of nucleotide sequences described in SEQ ID NOs 1 to 12.

[0033] The DNA aptamer included in the composition for detecting DNA polymerase according to the present invention may be a conjugate labeled with a detection agent such as a chromogenic enzyme, a fluorescent substance, a radioactive isotope, or a colloid. The chromogenic enzyme may be peroxidase, alkaline phosphatase, or acidic phosphatase, and the fluorescent substance may be thiourea (FTH), 7-acetoxycoumarin-3-yl, fluorescein-5-yl, fluorescein-6-yl, 2',7'-dichlorofluorescein-5-yl, 2',7'-dichlorofluorescein-6-yl, dihydrotetramethyllosamine-4-yl, tetramethylrhodamine-5-yl, tetramethylrhodamine-6-yl, 4,4-difluoro-5,7-dimethyl-4-violet-3a,4a-diaza-s-indacene-3-ethyl or 4,4-difluoro-5,7-diphenyl-4-violet-3a,4a-diaza-s-indacene-3-ethyl, Cy3, Cy5, poly L-lysine-fluorescein It may be isothiocyanate (FITC), rhodamine-B-isothiocyanate (RITC), PE (Phycoerythrin), or rhodamine.

[0034] Additionally, the DNA aptamer may include a ligand capable of specifically binding to the DNA aptamer. The ligand may be a conjugate labeled with a detector such as a chromogenic enzyme, a fluorescent substance, a radioisotope, or a colloid, and a ligand treated with streptavidin or avidin. In addition to the reagents described above, the detection composition of the present invention may further include distilled water or a buffer solution that maintains the structure of the reagents stably.

[0035] A kit comprising a detection composition according to the present invention may be bound to a solid substrate to facilitate subsequent steps, such as washing the DNA aptamer included therein or separating the complex. In this case, the solid substrate may be a synthetic resin, nitrocellulose, a glass substrate, a metal substrate, a glass fiber, a microsphere, or a microbead. Additionally, the synthetic resin may be polyester, polyvinyl chloride, polystyrene, polypropylene, PVDF, or nylon.

[0036] In addition, the above kit may be manufactured by a conventional manufacturing method known to those skilled in the art and may further include a buffer, a stabilizer, an inert protein, etc. The above kit may utilize a high throughput screening (HTS) system through a fluorescence method performed by detecting the fluorescence of a fluorescent substance attached as a detector to detect the amount of reagent, or a radiation method performed by detecting the radiation of a radioisotope attached as a detector, a surface plasmon resonance (SPR) method that measures changes in surface plasmon resonance in real time without labeling of the detector, or a surface plasmon resonance imaging (SPRI) method that visualizes and confirms the SPR system.

[0038] In addition, the present invention provides a method for detecting DNA polymerase comprising the step of reacting a DNA aptamer with a sample.

[0039] The DNA aptamer used in the DNA polymerase detection method according to the present invention may have the characteristics described above. For example, the DNA aptamer may be selected from the group consisting of nucleotide sequences described in SEQ ID NOs 1 to 12.

[0040] The above sample may include any sample for which DNA polymerase is to be detected. In addition, the above sample may be pretreated using methods such as anion exchange chromatography, affinity chromatography, size exclusion chromatography, liquid chromatography, serial extraction, centrifugation, or gel electrophoresis.

[0042] In addition, the present invention provides a composition or kit for base sequence amplification comprising the above DNA aptamer.

[0043] The DNA aptamer included in the composition and kit for detecting base sequence amplification according to the present invention may have the characteristics described above. For example, the DNA aptamer may be selected from the group consisting of base sequences described in SEQ ID NOs 1 to 12.

[0044] The above amplification may include all types of amplification methods known in the ordinary art. For example, the above amplification may include polymerase chain reaction or isothermal amplification reaction. The term "isothermal amplification" refers to an amplification method that does not require separate special equipment because, unlike conventional polymerase chain reaction (PCR), where the denaturation, annealing, and stretching steps are performed under different temperature conditions, the DNA amplification reaction is performed under a single temperature condition. Generally, isothermal amplification methods can amplify 10 target nucleic acids within one hour within a specific temperature range. 9 It can amplify up to [number] units and can be performed with only a thermostatic device capable of maintaining the aforementioned temperature. Furthermore, the isothermal amplification method allows for the convenient amplification and verification of DNA due to its short execution time and visual observation capabilities.

[0045] The above isothermal amplification may be a loop-mediated isothermal amplification method. The term "loop-mediated isothermal amplification (LAMP)" refers to an amplification method performed using an inner primer (FIB / BIF) and an outer primer (B3 / F3c). In the loop-mediated isothermal amplification method, the inner primer first binds to the template and is elongated, and then the outer primer binds to the outside of each DNA helix and is elongated. At this time, strand displacement occurs due to the elongation of the outer primer, and consequently, the first synthesized strand detaches from the template. The detached synthetic strand forms a loop structure starting from the 5' end, and subsequently, a loop structure is formed at the 3' end through the same process, and an amplification reaction occurs through this.

[0046] In addition, the above composition or kit may further include dNTPs, primers, buffers, etc., necessary for the amplification of a target gene, as needed. In this case, primers composed of appropriate sequences according to the sequence of bases to be amplified may be used.

[0048] Furthermore, the present invention provides a method for amplifying a base sequence, comprising the step of amplifying a base sequence by adding the DNA aptamer.

[0049] The DNA aptamer used in the base sequence amplification method according to the present invention may have the characteristics described above. For example, the DNA aptamer may be selected from the group consisting of base sequences described in SEQ ID NOs 1 to 12. The amplification may have the characteristics described above, and as long as the sequence of the target base is known, the conditions for amplifying it may be appropriately controlled by a person skilled in the art.

[0051] The present invention is described in detail below by way of the following examples. However, the following examples are merely illustrative of the present invention and do not limit the present invention. Any configuration having substantially the same structure as the technical concept described in the claims of the present invention and achieving the same functional effect is included within the technical scope of the present invention.

[0053] Example 1. Amplification of a random DNA library

[0054] To select DNA aptamers that specifically bind to Bst polymerase, a DNA library was first prepared as described below.

[0055] Specifically, 40 random nucleotide sequences (N) containing dA:dG:dC:dT in a ratio of 1.5:1.15:1.25:1 40 76 bp template DNA containing ) (Sequence No. 13: 5'-ATACCAGCTTATTCAATTN 40 AGATAGTAAGTGCAATCT-3') and its corresponding forward primer (SEQ No. 14: 5'-ATACCAGCTTATTCAATT-3') and 5'-terminally biotinylated reverse primer (SEQ No. 15: 5'-AGATAGTAAGTGCAATCT-3') were custom-made by Bionia (Korea). A PCR reaction mixture was prepared by mixing 1 µl of template DNA, 5 µl of 10x PCR buffer, 4 µl of 2.5 mM dNTP mixture, 2 µl of 25 μM forward primer, 2 µl of 25 μM biotinylated reverse primer, 0.25 µl of ExTaq polymerase (Takara, Japan) (1 unit / µl), and 35.75 µl of distilled water. PCR was performed on the prepared reaction mixture under the conditions described in Table 1 below. The obtained PCR product was verified by 2% agarose gel electrophoresis, and the results are shown in Figure 1.

[0056] Initial degeneration stage 95℃, 5 minutes 1 time denaturation stage 95℃, 30 seconds 20th time annealing stage 55℃, 30 seconds elongation stage 72℃, 30 seconds Post-review stage 72℃, 7 minutes 1 time

[0058] As shown in Figure 1, the PCR product was identified and purified using a PCR purification kit (Qiagen, USA).

[0060] Example 2. Amplification of single-stranded DNA

[0061] To prepare a DNA aptamer from the above-mentioned 76 bp PCR product, single-strand DNA (ssDNA) was amplified using an asymmetric PCR method.

[0062] First, a PCR reaction mixture was prepared by mixing 7 µl of the PCR product obtained in Example 1, 10 µl of 10× PCR buffer, 8 µl of dNTP mixture, 10 µl of 25 µM forward primer (SEQ No. 14), 2 µl of 25 µM biotinylated reverse primer (SEQ No. 15), 0.5 µl of ExTaq polymerase (Takara, Japan) (1 unit / µl), and 62.5 µl of distilled water. PCR was performed on the prepared reaction mixture under the conditions described in Table 2 below. The obtained PCR product was verified by 2% agarose gel electrophoresis.

[0063] Initial degeneration stage 95℃, 5 minutes 1 time denaturation stage 95℃, 30 seconds 16th episode annealing stage 55℃, 30 seconds elongation stage 72℃, 30 seconds Post-review stage 72℃, 7 minutes 1 time

[0065] To the identified PCR product, an equal volume of PCI solution prepared by mixing phenol:chloroform:isoamyl alcohol in a volume ratio of 25:24:1 was added, and the mixture was vigorously stirred. After stirring, the mixture was centrifuged at 4°C and 13,000 rpm for 15 minutes to obtain the supernatant. To the obtained supernatant, 1 / 100th of its volume of tRNA (Sigma Aldrich, USA) and 3 volumes of 100% ethanol were added, and the mixture was reacted at -70°C for at least 1 hour. After the reaction, the mixture was centrifuged at 4°C and 13,000 rpm for 20 minutes to obtain a pellet. The obtained pellet was dried at 65°C and suspended in 50 µl of distilled water to obtain DNA. The obtained DNA was verified by 2% agarose gel electrophoresis.

[0067] Example 3. Recovery of ssDNA

[0068] In order to remove biotin-bound double-stranded DNA (dsDNA) and ssDNA from the ssDNA obtained above and to obtain pure forward ssDNA, a heating-cooling technique was performed as follows.

[0069] Specifically, 50 µl of distilled water was added to the ssDNA obtained in Example 2, and the mixture was reacted at 85°C for 5 minutes to denature the dsDNA into ssDNA, after which it was cooled to 4°C to obtain the ssDNA. The obtained ssDNA was immediately cooled to 4°C. 50 µl of streptavidin agarose resin (Pierce, USA) was added to the cooled ssDNA and reacted at room temperature for 1 hour. Subsequently, the reaction mixture was centrifuged at 4°C and 13,000 rpm for 10 minutes, and only the supernatant was collected. To obtain the ssDNA from the obtained supernatant, extraction using a PCI solution and ethanol precipitation were performed as described above. As a result, the obtained pellet was dried at 65°C and suspended in 50 µl of distilled water to obtain ssDNA. The obtained ssDNA was confirmed by 2% agarose gel electrophoresis.

[0071] Example 4. Production of three-dimensional DNA aptamers

[0072] 60 µl of distilled water and 100 µl of SELEX buffer (20 mM Tris-HCl, 150 mM NaCl, 2 mM MgCl2, 5 mM KCl and 1 mM CaCl2, pH 7.5) were added to 40 µl of ssDNA obtained in Example 3. The mixture was boiled at 85°C for 5 minutes to denature it, and then left at room temperature for more than 1 hour to cool slowly, thereby constructing a DNA aptamer with a three-dimensional structure from the ssDNA.

[0074] Example 5. Selection of DNA aptamers that specifically bind to Bst polymerase

[0076] 5-1. Selection of DNA aptamers that specifically bind to Bst polymerase

[0077] DNA aptamers that specifically bind to Bst polymerase were selected using the SELECT technique.

[0078] First, sequence information for Bst polymerase derived from the Geobacillus stearothermophilus strain was obtained from NCBI (Sequence No. 16), and recombinant Bst polymerase with a histidine label attached to the end of the gene was prepared by a conventional method. Subsequently, 10 µl of recombinant Bst polymerase was added to the aptamer prepared in Example 4 and reacted at 4°C for 12 hours. Meanwhile, 500 µl of SELEX buffer was added to 200 µl of Ni-NTA agarose resin (QIAGEN, Germany) and stirred. The mixture was centrifuged at 13,000 rpm for 10 minutes at 4°C to remove the supernatant, after which the reaction mixture of the aptamer and Bst polymerase was added and reacted at 4°C. After 1 hour, the supernatant was removed by centrifugation at 13,000 rpm at 4°C for 10 minutes, and the resin was washed three times with SELEX buffer. Elution buffer (10 mM Tris-HCl, 0.1 mM EDTA, pH 8.0) was added to the washed resin and reacted at 85°C for 5 minutes, after which the denatured DNA aptamers were obtained by centrifugation again at 13,000 rpm at 4°C for 10 minutes; this process was repeated twice. Subsequently, the obtained pellet was subjected to PCI extraction and ethanol precipitation as described above to finally recover the DNA aptamers suspended in 50 µl of distilled water.

[0080] 5-2. Removal of non-specifically binding DNA aptamers

[0081] The following experiment was performed to remove non-specific DNA aptamers binding to Ni-NTA agarose resin rather than Bst polymerase, while simultaneously enhancing the specificity of DNA aptamers binding to Bst polymerase.

[0082] First, using the DNA aptamers obtained in Example 5-1, the process of Example 5-1 was repeated 7 times to select DNA aptamers with improved specificity. Using the selected DNA aptamers, a negative SELEX was performed to select DNA aptamers that bind to Ni-NTA agarose resin to which Bst polymerase is not bound. The experiment was conducted under the same conditions and methods as in Example 5-1, except that Ni-NTA agarose resin not containing Bst polymerase was used. At this time, only aptamers that did not bind to Ni-NTA agarose resin were obtained. Using the obtained aptamers, the process of Example 5-1 was repeated 4 more times to perform a total of 11 SELEXs, thereby finally obtaining aptamers that specifically bind to Bst polymerase.

[0084] Example 6. Selection of a high-affinity DNA aptamer pool

[0086] 6-1. Nanodrop Analysis

[0087] The affinity of DNA aptamers obtained in each round for Bst polymerase was confirmed by the nanodrop method through 11 rounds of SELEX.

[0088] Specifically, in Example 5, the concentration of the DNA aptamer samples obtained for each run was measured using a Nanodrop (Nanodrop 2000 Micro spectrophotometer, Thermo Scientific) according to the manufacturer's protocol.

[0089] As a result, as shown in Figure 2, the concentration of DNA aptamers obtained in 10 trials was highest at 1164.8 ng / µl.

[0091] 6-2. Real-time PCR Analysis

[0092] Real-time PCR was performed using the 8 to 11 pools confirmed to have bound to Bst polymerase with high binding affinity as described above to reconfirm the binding affinity to Bst polymerase.

[0093] Specifically, DNA aptamers from pools subjected to SELEX 8 to 11 times in Example 5 were each amplified by a conventional method, and ssDNA was obtained using a heat-cooling technique. The obtained ssDNA was prepared to have the same concentration, and 100, 10 -1 or 10 -2 It was diluted and used as a template for real-time PCR. Real-time PCR was performed using the conventional method with iQ SYBR Green Supermix (Bio-rad, USA). As a result, the graph of the real-time PCR results is shown in Figure 3.

[0094] As shown in Figure 3, the DNA aptamer pool obtained after performing SELEX 9 times exhibited the lowest C(t) value, confirming that it binds most specifically to Bst polymerase.

[0096] Example 7. Confirmation of DNA aptamer sequence

[0097] The sequence of the DNA aptamer obtained through 9 SELEX trials, which were confirmed to have the highest affinity for Bst polymerase as described above, was verified by the following method.

[0098] First, double-stranded DNA was obtained by performing PCR using the DNA aptamer obtained by performing SELEX 9 times as described above as a template. The obtained dsDNA was cloned into a T-vector according to the manufacturer's protocol using a T-blunt cloning kit (SolGent, Korea).

[0099] Specifically, 1 µl of T-vector (10 ng / µl), 4 µl of PCR product (20 ng / µl), and 1 µl of 6x T-blunt buffer were reacted at 25°C for 5 minutes. The reaction mixture was mixed with 100 µl of DH5α water-soluble strain and transformed by applying heat shock at 42°C for 30 seconds. The mixture was left on ice for 2 minutes, and 900 µl of SOC medium (2% tryptone, 0.5% yeast extract, 10 mM NaCl, 2.5 mM KCl, 10 mM MgCl2, 10 mM MgSO4, and 20 mM glucose) was added and incubated at 37°C for 40 minutes. 200 µl of culture medium was spread onto an LB culture plate containing 50 µg / ml ampicillin (Sigma Aldrich, USA), 50 µg / ml kanamycin (Sigma Aldrich, USA), 50 µg / ml X-gal (Sigma Aldrich, USA), and 5 µg / ml IPTG (Thermo Scientific, USA). After incubating at 37°C for 15 hours, only white colonies were selected from the resulting colonies, DNA was extracted using conventional methods, and the base sequences were sent to Solgent (Korea) to confirm a total of 12 DNA aptamer sequences as shown in Table 3 below.

[0100] clone Sequence (5'→3') Size (bp) Sequence number Bst1 CGCACGTCTCGCCAATAGTGGCCGTAACAGGATTGGCTGA 40 Sequence No. 1 Bst2 CCGGCAATGCATCAGGGCTTTGGCTAATCTTGGCGCTGGG 40 Sequence No. 2 Bst3 CGTGGCTTATGAAATAGAGGCCGTAATCGGACGCATGGTG 40 Sequence No. 3 Bst4 ACTTGCACACGTTGTTTTAAGCCCTATGGCTTCTGGTGTG 40 Sequence No. 4 Bst5 CGCACGTCTCGCTAATAGTGGCCGTAACAGGATTGGCTGA 40 Sequence No. 5 Bst6 CGTAGGCCGTAACTATGAATATGTGCTGCACAGTGGCGGTT 40 Sequence number 6 Bst7 GCGAACCGTTGAGCAATGGCTTTAGCGCTTTCGCCTGATA 40 Sequence number 7 Bst8 CACACAGGATAAGCGTTGGTCGAGCAGTTGCGTGTGGAAA 40 Sequence number 8 Bst9 CGGAGCGTTGTTGGGTCCTAGGGAGCGTAAAGCTTGTCG 40 Sequence number 9 Bst10 GCAGATGGTTGTGCGAGAGGTACGAGTGTGAATCTTTATG 40 Sequence number 10 Bst11 GGCCGTAACATATGGAATAGCCTCATTTGGCTTACATCTG 40 Sequence number 11 Bst12 GGCCAGGACTAGGAGGGGTGTGGCGTAGAAACGACATTGCA 40 Sequence No. 12

[0102] Example 8. Confirmation of DNA Aptamer Structure

[0103] Figures 4 and 5 show the results of imaging the structures of 12 DNA aptamers that bind with high affinity to Bst polymerase using the DNA mfold program (Rensselear Polytechnic Institute).

[0105] Example 9. Prediction of the binding structure of Bst polymerase and DNA aptamer

[0106] First, based on the two-dimensional structures of the 12 DNA aptamers identified in the above example, the three-dimensional structures were predicted using the RNAcomposer website (http: / / rnacomposer.cs.put.poznan.pl / ). Meanwhile, the Bst polymerase structure was obtained using the PDB code 1njz provided by the RCSB PDB website (https:www.rcsb.org / ). The combined structure using the obtained DNA aptamer and Bst polymerase structures was analyzed using MOE (molecular operating environment) software. Before structure prediction, the DNA aptamer and histamine structures were prepared with all energy minimized, and the interactions were analyzed using the triangle matcher method. All structures were repeated 10 times, and the result with the highest prediction was plotted using the Pymol structure program and is shown in Figures 6 and 7.

[0108] Example 10. Confirmation of the affinity of DNA aptamers for Bst polymerase

[0110] 10-1. Fabrication of Bst Polymerase-Coated Sensor Chip

[0111] To quantitatively verify the binding strength of DNA aptamers selected through surface plasmon resonance (SPR) experiments, a sensor chip coated with DNA aptamers was fabricated in the following manner.

[0112] First, the surface of sensor chip CM5 (Cytiva, UK), whose surface was coated with carboxyl groups, was activated to NHS-ester (N-hydroxysuccinimide ester) by flowing a mixture of 0.1 M NHS (N-hydroxysuccinimide) and 0.4 M EDC (Nethyl-N'-(dimethylaminopropy 1) carbodiimide) at a rate of 5 µl / min for 10 minutes. Meanwhile, a sensor chip CM5 coated with DNA aptamers on its surface was fabricated by flowing a 10 mM sodium acetate buffer (pH 4.5), in which Bst_4, Bst_6, or Bst_7 DNA aptamers were diluted to a concentration of 60 µg / ml, onto the surface of the activated sensor chip CM5 at a rate of 5 µl / min for 10 minutes. Afterwards, 1 M ethanolamine hydrochloride (pH 8.5) was flowed through the sensor chip CM5 at a rate of 5 μL / min for 10 minutes to inactivate the carboxyl reactive groups remaining on the surface of the sensor chip.

[0114] 10-2. Confirmation of DNA Aptamer Affinity

[0115] The affinity of the above-selected DNA aptamers for Bst polymerase was quantitatively confirmed using the SPR method.

[0116] First, Bst polymerase was prepared by suspending it in HBS-EP buffer (GE Healthcare, UK) at concentrations of 300, 500, 700, or 1,000 nM. The experiment was performed using BIAcore 3000 (BIACORE) according to the manufacturer's protocol, and the difference in binding affinity of Bst polymerase to sensor chip CM5 coated with the DNA aptamer prepared in Experimental Example 10-1 and to sensor chip CM5 without any coating was confirmed. At this time, rate variables were obtained and quantified using the BIA evaluation program (BIACORE), and the results are shown in Table 4.

[0117] clone K D Value (M) Bst_4 4.139 -8 Bst_6 5.769 -9 Bst_7 1.066 -8

[0119] As shown in Table 4, the DNA aptamer according to the present invention bound to Bst polymerase with high affinity.

[0121] Example 11. Enhancement of reverse transcription reaction by DNA aptamers

[0122] It was confirmed using a real-time PCR method whether the above-mentioned DNA aptamer binds to Bst polymerase and enhances the reverse transcription reaction.

[0123] First, a reaction product was prepared by a conventional method using an RNA template (SEQ No. 18: 5'-GGCACGCAACGCCUACGACUGGACGGCCGAGUCGACCGUGUACGUCUCCCCCCGCCACCAGCGGACGGGACUGGGCUCCACGCUCUACACCCACCUGCUGAAGUCCCUGGAGGCACAGGGCUUCAAGAGCGUGGUCGCUGUCAUCGGGCUGCCCAACGACCCGAGCGUGCGCAUGCACGAGGCGCUCGGAUAUGCCCCCCGCGGCAUGCUGCGGGCGGCCGGCUUCAAGCACGGGAACU-3') and a forward primer-2 (SEQ No. 19: 5'-TAATACGACTCACTATAGGCACGCAACGCCTACGA-3') and a reverse primer-2 (SEQ No. 20: 5'-AGTTCCCGTGCTTGAAGC-3') for the same. At this time, Bst_4, Bst_6, or Bst_7 DNA aptamers were added in an amount of 1 pmol, and only Bst polymerase was used as a control. The prepared reaction mixture was reacted at 62°C for 1 hour, and then reacted at 95°C for 15 minutes to inactivate the enzyme. Subsequently, real-time PCR was performed using the iQ CYBR Green Supermix (iQ CYBR Green Supermix, Bio-rad, USA) with the synthesized cDNA as a template in a conventional manner, and the results are shown in Figure 8.

[0124] As shown in Figure 8, when the DNA aptamer according to the present invention was added, a significantly lower Ct value was observed compared to the control group, confirming that the DNA aptamer enhances the activity of Bst polymerase.

Claims

Claim 1 A DNA aptamer that specifically binds to Bst polymerase, consisting of the nucleotide sequence described as SEQ ID NO.

7. Claim 2 delete Claim 3 In claim 1, the Bst polymerase is a DNA aptamer that specifically binds to the Bst polymerase, which is a polypeptide composed of the amino acid sequence described in SEQ ID NO.

17. Claim 4 A composition for detecting Bst polymerase comprising the DNA aptamer of claim 1. Claim 5 A kit for detecting Bst polymerase comprising the DNA aptamer of claim 1. Claim 6 A method for detecting Bst polymerase comprising the step of reacting the DNA aptamer of claim 1 with a sample. Claim 7 A composition for enhancing a reverse transcription reaction comprising the DNA aptamer of claim 1. Claim 8 A kit for enhancing reverse transcription reaction comprising the DNA aptamer of claim 1. Claim 9 A method for enhancing a reverse transcription reaction comprising the step of performing a reverse transcription reaction by adding the DNA aptamer of claim 1.

Images