A microorganism comprising nicotinamide nucleotide transhydrogenase variant and method for producing L-amino acid using the same

Abstract

The present application relates to a nicotinamide nucleotide transhydrogenase beta-subunit variant polypeptide; a polynucleotide encoding said variant polypeptide; a vector comprising said variant polypeptide; a microorganism comprising said vector; a method for producing L-amino acids comprising the step of culturing said microorganism in a medium; a composition for producing L-amino acids comprising one or more selected from said microorganism, said culture of said microorganism, and said fermented product of said microorganism; and a use of said microorganism for producing L-amino acids.

Description

Technology Field

[0001] The present application relates to a microorganism comprising one or more selected from a nicotinamide nucleotide transhydrogenase beta-subunit variant polypeptide and a polynucleotide encoding said variant polypeptide; a method for producing an L-amino acid or a derivative thereof comprising the step of culturing said microorganism in a medium; a composition for producing an L-amino acid or a derivative thereof comprising one or more selected from said microorganism, a culture of said microorganism, and a fermented product of said microorganism; and a use of said microorganism for producing an L-amino acid or a derivative thereof. Background Technology

[0003] Coryne-type microorganisms are Gram-positive microorganisms frequently used for the industrial production of substances with diverse uses, such as animal feed, pharmaceuticals, and food, containing L-amino acids and various nucleic acids. Recently, diamines and keto acids are also being produced from Coryne-type microorganisms.

[0004] To produce useful products through microbial fermentation, the demand for energy sources or reducing power increases along with the enhancement of the target product's biosynthetic pathways within the microorganisms. Among these, NADPH (nicotinamide adenine dinucleotide phosphate) is an essential element in supplying reducing power. The oxidized form, NADP+, and the reduced form, NADPH, act as electron transfer molecules within the body and are involved in various synthetic processes. Among the central metabolic pathways, NADPH is known to be primarily produced by 1) the oxidative pentose phosphate pathway and 2) NADP-dependent isocitrate dehydrogenase (Icd gene) of the TCA pathway. In addition, various alternative pathways for supplying NADPH in different microorganisms include malate enzymes and glucose dehydrogenases. It has nonphosphorylation glyceraldehyde-3-phosphate dehydrogenase.

[0005] In addition, enzymes that produce NADPH independently of the central metabolic pathway include transhydrogenase and ferredoxin:NADP+oxidoredutase.

[0006] As demands for various pathway enhancements and energy sources or reducing power coexist, there is still a need for methods to increase the production capacity of target L-amino acids or their derivatives. Prior art literature

[0008] 1. Korean Patent Publication KR 10-2006-0084446 A The problem to be solved

[0009] One aspect of the present application provides a nicotinamide nucleotide transhydrogenase beta-subunit variant polypeptide in which the amino acid corresponding to the 289th position of SEQ ID NO. 11 is substituted with alanine; cysteine; isoleucine; methionine; or threonine.

[0010] In one embodiment, the variant polypeptide may be composed of the amino acid sequence of SEQ ID NO. 74, SEQ ID NO. 76, SEQ ID NO. 78, SEQ ID NO. 80, or SEQ ID NO. 82.

[0011] In another embodiment, the nicotinamide nucleotide transhydrogenase beta subunit is pntB It may be coded by genes.

[0012] Another aspect of the present application provides a nicotinamide nucleotide transhydrogenase comprising the variant polypeptide.

[0013] Another aspect of the present application provides a polynucleotide encoding the variant polypeptide.

[0014] Another aspect of the present application provides a microorganism comprising one or more selected from the variant polypeptide; a polynucleotide encoding the variant polypeptide; and a vector comprising the same.

[0015] As a microorganism according to any one of the aforementioned embodiments, the microorganism may be a microorganism of the genus Corynebacterium.

[0016] As a microorganism according to any one of the aforementioned embodiments, the microorganism of the genus Corynebacterium may be Corynebacterium glutamicum.

[0017] A microorganism according to any one of the preceding embodiments may have an increased ability to produce L-amino acids or derivatives compared to a microorganism containing the polypeptide of SEQ ID NO. 11 or a polynucleotide encoding the same.

[0018] As a microorganism according to any one of the aforementioned embodiments, the microorganism may have increased production capacity of L-threonine, L-arginine, or L-homoserine.

[0019] Another aspect of the present application provides a method for producing L-amino acid or a derivative thereof, comprising the step of culturing the microorganism in a medium.

[0020] As one specific example, the method may additionally include the step of recovering L-amino acid or a derivative thereof from the cultured microorganism; the culture of the microorganism; the fermented product of the microorganism; or the culture medium.

[0021] As another specific example, the above method may be a method for producing L-threonine, L-arginine, or L-homoserine.

[0022] Another aspect of the present application provides a composition for producing L-amino acids comprising one or more selected from: a variant polypeptide; a polynucleotide encoding the variant polypeptide; a vector comprising the same; a microorganism comprising the vector; a culture of the microorganism; and a fermented product of the microorganism.

[0023] As one specific example, the composition may be a composition for producing L-threonine, L-arginine, or L-homoserine. means of solving the problem

[0025] This is explained in detail as follows. Meanwhile, each description and embodiment disclosed in this application may be applied to other descriptions and embodiments. That is, all combinations of the various elements disclosed in this application fall within the scope of this application. Furthermore, the scope of this application should not be considered limited by the specific descriptions provided below. Additionally, numerous papers and patent documents are referenced and cited throughout this specification. The disclosures of the cited papers and patent documents are incorporated by reference into this specification in their entirety to more clearly explain the level of the art to which this application pertains and the content of this application.

[0027] One aspect of the present application provides a nicotinamide nucleotide transhydrogenase beta-subunit variant polypeptide in which the amino acid corresponding to the 289th position of SEQ ID NO. 11 is substituted with alanine; cysteine; isoleucine; methionine; or threonine.

[0029] In this application, the term "nicotinamide nucleotide transhydrogenase" refers to [H + + NADP + + NADH ↔ H + + NADPH + NAD +An enzyme that maintains the redox balance of cells through a reaction, existing as a homodimer with each protomer comprising two soluble nucleotide binding domains and a proton-translocating transmembrane domain that mediates the hydride transfer between NAD(H) and NADP(H), and in this application, may refer to a transmembrane pyridine nucleotide transhydrogenase composed of two subunits, alpha and beta, encoded by the pntA and pntB genes, respectively, which catalyzes the reduction of NADP+ to NADPH through the oxidation of NADH to NAD+.

[0030] The nicotinamide nucleotide transhydrogenase of the present application can be used in combination with pntAB. Specifically, the nicotinamide nucleotide transhydrogenase of the present application pntAB ( pntA and pntB ) It may be a protein having nicotinamide nucleotide transhydrogenase activity encoded by a gene, but is not particularly limited to that type as long as it has activity corresponding to nicotinamide nucleotide transhydrogenase.

[0031] The above pntAB Nicotinamide nucleotide transhydrogenase encoded by a gene is known in the art, and the amino acid and polynucleotide sequences of said nicotinamide nucleotide transhydrogenase can be obtained from known data databases (e.g., GenBank), but are not limited thereto.

[0032] For example, the nicotinamide nucleotide transhydrogenase may be composed of an alpha subunit PntA and a beta subunit PntB.

[0034] The above nicotinamide nucleotide transhydrogenase may include the amino acid sequence of SEQ ID NO. 10 or an amino acid sequence having 60% or more homology or identity therewith; and the amino acid sequence of SEQ ID NO. 11 or an amino acid sequence having 60% or more homology or identity therewith, but is not limited thereto as long as it has nicotinamide nucleotide transhydrogenase activity. Specifically, even if the amino acid sequences of SEQ ID NO. 10 and 11 include sequences in which some sequences are deleted, modified, substituted, or added, if the protein exhibits efficacy corresponding to nicotinamide nucleotide transhydrogenase, it may be included in the above nicotinamide nucleotide transhydrogenase. In addition, it may have, include, be composed of, or be essentially composed of the amino acid sequence having at least 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or more homology or identity with the amino acid sequences of SEQ ID NOs 10 and 11.

[0035] The protein subject to the mutation introduction of the present application may have nicotinamide nucleotide transhydrogenase activity. Specifically, it may be composed of or include the amino acid sequence of SEQ ID NO. 11, but is not limited thereto. This does not exclude meaningless sequence additions before or after the amino acid sequence described in SEQ ID NO. 11, naturally occurring mutations, or silent mutations thereof; any protein that has the same or corresponding activity as the protein containing the amino acid sequence of SEQ ID NO. 11 may be the protein subject to the mutation introduction of the present application. For example, the protein subject to the introduction of the mutation in this application may be a protein composed of an amino acid sequence having 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7%, or 99.9% or more homology or identity with the amino acid sequence of SEQ ID NO. 11. Furthermore, it is obvious that a polypeptide having an amino acid sequence in which some sequences are deleted, modified, substituted, conservatively substituted, or added, provided that the nicotinamide nucleotide transhydrogenase beta-subunit has such homology or identity and exhibits an efficacy corresponding to that of the polypeptide, is also included within the scope of the polypeptide subject to the mutation in this application.

[0037] In this application, the terms “variant polypeptide,” “variant protein,” or “variant” refer to a polypeptide in which one or more amino acids are conservatively substituted and / or modified, resulting in a sequence of amino acids different from that of the variant prior to modification, while retaining functions or properties. Such a variant can generally be identified by modifying one or more amino acids in the amino acid sequence of the polypeptide and evaluating the properties of the modified polypeptide. That is, the capabilities of the variant may be increased, unchanged, or decreased compared to the polypeptide prior to modification. Additionally, some variants may include variants in which one or more parts, such as an N-terminal leader sequence or a transmembrane domain, have been removed. Other variants may include variants in which a portion of the N- and / or C-terminus of a mature protein has been removed. The term "variant" mentioned above may be used interchangeably with terms such as variant, variant polypeptide, variant protein, variant polypeptide, variant protein, variant polypeptide, and variant protein (in English expressions such as modified polypeptide, modified protein, mutant, mutein, etc.), and is not limited to these terms as long as they are used with the meaning of being mutated.

[0038] Additionally, variants may include deletions or additions of amino acids that have minimal effect on the properties and secondary structure of the polypeptide. For example, the polypeptide may be conjugated with a signal (or leader) sequence at the N-terminus of a protein involved in the co-translational or post-translational transfer of the protein. Additionally, the polypeptide may be conjugated with another sequence or linker to enable identification, purification, or synthesis of the polypeptide.

[0040] The variant polypeptide of the present application may be one in which the amino acid corresponding to the 289th position from the N-terminus of SEQ ID NO. 11 is substituted with another amino acid.

[0041] The “variant polypeptide” mentioned above may be referred to as “nicotinamide nucleotide transhydrogenase beta-subunit variant polypeptide,” “nicotinamide nucleotide transhydrogenase beta-subunit variant,” “variant pntB,” “pntB variant,” etc. The nicotinamide nucleotide transhydrogenase beta-subunit polypeptide that is the subject of the variant introduction in this application may be used interchangeably with the term “PntB” and is not particularly limited, pntB It can be encoded by a gene and is derived from Corynebacterium variabile pntB It can be coded by genes, but is not limited thereto.

[0043] In the present application, the amino acid sequence before modification of the nicotinamide nucleotide transhydrogenase beta-subunit that is the subject of mutation, that is, the amino acid before modification corresponding to the 289th of SEQ ID NO. 11 in the sequence that can be the parent sequence, may be serine (S), but is not limited thereto.

[0045] The nicotinamide nucleotide transhydrogenase beta-subunit variant polypeptide of the present application may be one in which the amino acid at the position corresponding to the 289th position in the amino acid sequence of SEQ ID NO. 11 is substituted with an amino acid different from the amino acid before substitution.

[0046] In one embodiment, the variant polypeptide may be one in which the amino acid corresponding to the 289th position in the amino acid sequence of SEQ ID NO. 11 is substituted with an amino acid other than serine, which is the amino acid before substitution.

[0048] In another embodiment, the variant polypeptide may be substituted with an amino acid corresponding to the 289th position of SEQ ID NO. 11 selected from the group consisting of asparagine, valine, glycine, leucine, arginine, alanine, methionine, threonine, glutamine, proline, isoleucine, tryptophan, phenylalanine, histidine, cysteine, tyrosine, lysine, aspartate, and glutamic acid.

[0049] In any one of the embodiments described above, the variant polypeptide provided in this application may be one in which the amino acid corresponding to the 289th position from the N-terminus of SEQ ID NO. 11 is substituted with alanine; cysteine; isoleucine; methionine; or threonine.

[0051] For example, the variant polypeptide of the present application may comprise an amino acid sequence in which the amino acid corresponding to the 289th position in the amino acid sequence described in SEQ ID NO. 11 is fixed to alanine; cysteine; isoleucine; methionine; or threonine, and which has at least 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.8% or more homology or identity with SEQ ID NO. 11. Furthermore, it is obvious that a variant polypeptide having an amino acid sequence in which some sequences are deleted, modified, substituted, conservedly substituted, or added is also included within the scope of the present application, provided that such an amino acid sequence has such homology or identity and exhibits efficacy corresponding to the variant polypeptide of the present application.

[0052] Meanwhile, a person skilled in the art can identify the amino acid corresponding to the 289th position of the amino acid sequence of SEQ ID NO. 11 of the present application in any amino acid sequence through sequence alignment known in the art, and it is obvious that when "an amino acid at a specific position in a specific SEQ ID NO" is described in the present application, even if not separately stated, it means including "an amino acid at a corresponding position" in any amino acid sequence.

[0054] In another specific embodiment, the variant polypeptide may be composed of the amino acid sequence of SEQ ID NO. 74, SEQ ID NO. 76, SEQ ID NO. 78, SEQ ID NO. 80, or SEQ ID NO. 82.

[0055] Specifically, the variant polypeptide of the present application may have, include, be composed of, or be essentially composed of the amino acid sequence of SEQ ID NO. 74, SEQ ID NO. 76, SEQ ID NO. 78, SEQ ID NO. 80, or SEQ ID NO. 82, or an amino acid sequence having at least 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or more homology or identity with the amino acid sequence of SEQ ID NO. 74, 76, 78, 80, or 82.

[0056] In addition, the variant polypeptide of the present application may include cases where sequences that do not alter the function of the variant polypeptide are added or deleted at the N-terminus, C-terminus, and / or within the amino acid sequence of the variant polypeptide of the present application, or where there are naturally occurring mutations, silent mutations, or conservative substitutions.

[0058] The above "other amino acid" is not limited to any amino acid different from the amino acid before substitution. Meanwhile, when the expression "a specific amino acid has been substituted" is used in this application, it is self-evident that it is substituted with an amino acid different from the amino acid before substitution, even if it is not separately indicated that it has been substituted with another amino acid.

[0059] Amino acids can generally be classified based on similarities in the polarity, charge, solubility, hydrophobicity, hydrophilicity, and / or amphipathic nature of their residues.

[0060] Examples of this classification include positively charged (basic) amino acids such as arginine, lysine, and histidine; negatively charged (acidic) amino acids such as glutamic acid and aspartic acid; amino acids with nonpolar side chains (nonpolar amino acids) such as glycine, alanine, valine, leucine, isoleucine, methionine, phenylalanine, tryptophan, and proline; and amino acids with polar or hydrophilic side chains (polar amino acids) such as serine, threonine, cysteine, tyrosine, asparagine, and glutamine. As another example, they can be classified into electrically charged amino acids such as arginine, lysine, histidine, glutamic acid, and aspartic acid, and uncharged amino acids (also referred to as neutral amino acids) such as glycine, alanine, valine, leucine, isoleucine, methionine, phenylalanine, tryptophan, proline, serine, threonine, cysteine, tyrosine, asparagine, and glutamine. As another example, phenylalanine, tryptophan, and tyrosine can be classified as aromatic amino acids. As another example, valine, leucine, and isoleucine can be classified as branched amino acids. As another example, the 20 types of amino acids can be classified according to size into five groups, starting with the group of amino acids with the smallest volume: glycine, alanine, serine; cysteine, proline, threonine, aspartic acid, asparagine; valine, histidine, glutamic acid, glutamine; isoleucine, leucine, methionine, lysine, arginine; and phenylalanine, tryptophan, and tyrosine. However, this is not necessarily limited to these groups.

[0061] For example, when stating that "the amino acid corresponding to the 289th position in sequence number 11 has been substituted with another amino acid," it may mean that it has been substituted with asparagine, valine, glycine, alanine, glutamate, phenylalanine, arginine, aspartate, cysteine, glutamine, histidine, proline, isoleucine, tyrosine, lysine, tryptophan, methionine, threonine, or leucine, excluding serine.

[0063] Even if the present application is described as "a protein having an amino acid sequence described by a specific sequence number," it is obvious that a protein having an amino acid sequence in which some sequences are deleted, modified, substituted, conservatively substituted, or added may also be used in the present application if it has the same or corresponding activity as the protein composed of the amino acid sequence number. For example, if it has the same or corresponding activity as the variant protein, it does not exclude the addition of sequences before or after the amino acid sequence that do not alter the function of the protein, naturally occurring mutations, silent mutations, or conservative substitutions, and it is obvious that such addition of sequences or mutations also fall within the scope of the present application.

[0064] The "position N" of the present application may include position N and an amino acid position corresponding to position N. Specifically, it may include an amino acid position corresponding to any amino acid residue in a mature polypeptide disclosed in a specific amino acid sequence. The specific amino acid sequence may be the amino acid sequence of SEQ ID NO. 11.

[0065] In this application, the term “corresponding to” refers to an amino acid residue at a position listed in the polypeptide, or an amino acid residue that is similar, identical, or homologous to a residue listed in the polypeptide. Identifying the amino acid at the corresponding position may involve determining a specific amino acid of a sequence that references a specific sequence. As used in this application, “corresponding region” generally refers to a similar or corresponding position in a related protein or a reference protein.

[0066] For example, any amino acid sequence can be aligned with SEQ ID NO. 11, and based on this, each amino acid residue of said amino acid sequence can be numbered by referring to the numerical position of the amino acid residue corresponding to the amino acid residue of SEQ ID NO. 11. For example, a sequence alignment algorithm such as that described in this application can identify the position of an amino acid, or the location where modifications such as substitution, insertion, or deletion occur, by comparing with a query sequence (also referred to as a “reference sequence”).

[0067] For such alignment, examples such as the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453), the Needleman program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000), Trends Genet. 16: 276-277) can be used, but are not limited thereto, and sequence alignment programs and pairwise sequence comparison algorithms known in the art can be appropriately used.

[0069] In this application, the term “conservative substitution” means substituting one amino acid with another amino acid having similar structural and / or chemical properties. Such amino acid substitutions may generally occur based on similarities in the polarity, charge, solubility, hydrophobicity, hydrophilicity, and / or amphipathic nature of the residues. For example, positively charged (basic) amino acids include arginine, lysine, and histidine; negatively charged (acidic) amino acids include glutamic acid and aspartate; aromatic amino acids include phenylalanine, tryptophan, and tyrosine; and hydrophobic amino acids include alanine, valine, isoleucine, leucine, methionine, phenylalanine, tyrosine, and tryptophan. Additionally, amino acids can be classified into those with electrically charged side chains and those with uncharged side chains; amino acids with electrically charged side chains include astragalus, glutamic acid, lysine, arginine, and histidine; amino acids with uncharged side chains can be further classified into nonpolar or polar amino acids; nonpolar amino acids include glycine, alanine, valine, leucine, isoleucine, methionine, phenylalanine, tryptophan, and proline; and polar amino acids include serine, threonine, cysteine, tyrosine, asparagine, and glutamine. Typically, conservative substitutions have little to no effect on the activity of the resulting polypeptide. Typically, conservative substitutions have little to no effect on the activity of a protein or polypeptide.

[0071] Another aspect of the present application provides a nicotinamide nucleotide transhydrogenase comprising the variant polypeptide.

[0072] The nicotinamide nucleotide transhydrogenase may comprise PntA; and the variant polypeptide PntB.

[0073] That is, the nicotinamide nucleotide transhydrogenase of the present application may be composed of a nicotinamide nucleotide transhydrogenase alpha subunit and a nicotinamide nucleotide transhydrogenase beta subunit variant polypeptide of the present application.

[0075] Another aspect of the present application provides a polynucleotide encoding the variant polypeptide; or a polynucleotide encoding a nicotinamide nucleotide transhydrogenase comprising the variant polypeptide.

[0076] In this application, the term "polynucleotide" refers to a polymer of nucleotides in which nucleotide monomers are linked together in a long chain by covalent bonds, such as a DNA or RNA strand of a certain length or longer, and more specifically, a polynucleotide fragment encoding the variant polypeptide.

[0077] The polynucleotide encoding the nicotinamide nucleotide transhydrogenase beta-subunit variant polypeptide of the present application may be included without limitation as long as it is a polynucleotide sequence encoding a variant polypeptide capable of forming nicotinamide nucleotide transhydrogenase together with an alpha-subunit.

[0078] For example, the polynucleotide encoding the nicotinamide nucleotide transhydrogenase beta-subunit variant polypeptide of the present application may be a polynucleotide sequence encoding an amino acid sequence in which the amino acid corresponding to the 289th position of SEQ ID NO. 11 is substituted with alanine; cysteine; isoleucine; methionine; or threonine, but is not limited thereto.

[0079] For example, the polynucleotide of the present application may include a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO. 74, SEQ ID NO. 76, SEQ ID NO. 78, SEQ ID NO. 80, or SEQ ID NO. 82. Also, as an example, the polynucleotide of the present application may have or include the sequence of SEQ ID NO. 75, SEQ ID NO. 77, SEQ ID NO. 79, SEQ ID NO. 81, or SEQ ID NO. 83. Additionally, the polynucleotide of the present application may be composed of or essentially consist of the sequence of SEQ ID NO. 75, SEQ ID NO. 77, SEQ ID NO. 79, SEQ ID NO. 81, or SEQ ID NO. 83.

[0081] The polynucleotide of the present application may have various modifications made to its coding region within the scope of not altering the amino acid sequence of the variant polypeptide of the present application, taking into account codon degeneracy or the codons preferred by the organism intended to express the variant polypeptide of the present application. Accordingly, it is obvious that the polynucleotide may also include a polypeptide that can be translated into a polypeptide consisting of the amino acid sequence of the variant polypeptide of the present application or a polypeptide having homology or identity therewith due to codon degeneracy. For example, the polynucleotide of the present application may consist of or include the sequences of SEQ ID NO. 75, SEQ ID NO. 77, SEQ ID NO. 79, SEQ ID NO. 81, or SEQ ID NO. 83; or the degenerated sequences thereof.

[0082] For example, the polynucleotide of the present application may comprise, but is not limited to, a base sequence having homology or identity of 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7%, or 99.8% or more with respect to the sequence of SEQ ID NO. 13, wherein the codon corresponding to the codon at the 865th to 867th positions of SEQ ID NO. 13 is substituted with a codon encoding an amino acid selected from the original other amino acids, e.g., alanine, cysteine, isoleucine, methionine, or threonine. In addition, it is obvious that variants having polynucleotide sequences in which some sequences are deleted, modified, substituted, conservatively substituted, or added are included within the scope of this application, provided that such polynucleotide sequences have such homology or identity and code for the amino acid sequence of the nicotinamide nucleotide transhydrogenase beta-subunit variant polypeptide of this application.

[0083] As another example, the polynucleotide of the present application may have or include a nucleic acid sequence having 60% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, and less than 100% homology or identity with the sequences of SEQ ID NO. 75, SEQ ID NO. 77, SEQ ID NO. 79, SEQ ID NO. 81, and SEQ ID NO. 83, or may be composed of, essentially composed of, or include a nucleic acid sequence having 60% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, and less than 100% homology or identity with the sequences of SEQ ID NO. 75, SEQ ID NO. 77, SEQ ID NO. 79, SEQ ID NO. 81, and SEQ ID NO. 83.

[0085] In addition, the polynucleotide of the present application may include, without limitation, probes that can be prepared from known gene sequences, for example, any sequence that can be hybridized under strict conditions with a sequence complementary to all or part of the polynucleotide sequence of the present application.

[0087] The above "stringent condition" refers to a condition that enables specific hybridization between polynucleotides. Such conditions are specifically described in the literature (see J. Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; FM Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York, 9.50-9.51, 11.7-11.8). For example, conditions may be listed in which polynucleotides with high homology or identity are hybridized with each other, with homology or identity of 60% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more, and polynucleotides with lower homology or identity are not hybridized with each other, or conditions in which the polynucleotides are washed once, specifically two to three times, at a salt concentration and temperature equivalent to the washing conditions of conventional southern hybridization, such as 60°C, 1 χSSC, 0.1% SDS, specifically 60°C, 0.1 χSSC, 0.1% SDS, more specifically 68°C, 0.1 χSSC, 0.1% SDS.

[0088] Hybridization requires that two nucleic acids have complementary sequences, even though a mismatch between bases may be possible depending on the degree of hybridization. The term "complementary" is used to describe the relationship between nucleotide bases that can hybridize with each other. For example, regarding DNA, adenine is complementary to thymine, and cytosine is complementary to guanine. Accordingly, the polynucleotides of this application may also include isolated nucleic acid fragments that are complementary to the entire sequence, as well as substantially similar nucleic acid sequences.

[0089] Specifically, a polynucleotide having homology or identity with the polynucleotide of the present application can be detected using hybridization conditions including a hybridization step at a Tm value of 55°C and using the conditions described above. Additionally, the Tm value may be 60°C, 63°C, or 65°C, but is not limited thereto and can be appropriately adjusted by a person skilled in the art according to the purpose.

[0090] The appropriate strictness for hybridizing the above polynucleotides depends on the length and degree of complementarity of the polynucleotides, and the variables are well known in the art (e.g., J. Sambrook et al., i.e.).

[0091] In this application, the terms “homology” or “identity” refer to the degree of similarity between two given amino acid sequences or base sequences and may be expressed as a percentage. The terms homology and identity may often be used interchangeably.

[0092] Sequence homology or identity of conserved polynucleotides or polypeptides is determined by standard arrangement algorithms, and a default gap penalty established by the program used may be utilized. Practically, homologous or identical sequences can generally be hybridized with the entire sequence or a part thereof under moderate or high stringent conditions. It is evident that hybridization also includes hybridization with polynucleotides containing common codons or codons that account for codon degeneracy.

[0093] Whether any two polynucleotide or polypeptide sequences have homology, similarity, or identity can be determined using a known computer algorithm, such as the “FASTA” program, using default parameters as in, for example, Pearson et al (1988) [Proc. Natl. Acad. Sci. USA 85]: 2444. Alternatively, it can be determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453), as performed in the Needleman program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277) (version 5.0.0 or later) (GCG program package (Devereux, J., et al, Nucleic Acids Research 12: 387(1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [ET AL, J MOLEC BIOL 215]: 403 (1990); Guide to Huge Computers, Martin J. Bishop, [ED.,] (Including Academic Press, San Diego, 1994, and [CARILLO ETA / .](1988) SIAM J Applied Math 48: 1073). For example, homology, similarity, or identity can be determined using BLAST from the National Biotechnology Information Database Center or ClustalW.

[0094] The homology, similarity, or identity of polynucleotides or polypeptides can be determined by comparing sequence information using a GAP computer program, such as that described in, for example, Smith and Waterman, Adv. Appl. Math (1981) 2:482, or Needleman et al. (1970), J Mol Biol. 48:443. In summary, a GAP program can be defined as the total number of symbols in the shorter of the two sequences divided by the number of similarly arranged symbols (i.e., nucleotides or amino acids). The default parameters for a GAP program are (1) a binary comparison matrix (containing values ​​of 1 for identity and 0 for non-identity) and, as disclosed by Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp. 353-358 (1979), or Gribskov et al. (1986) Nucl. Acids Res. 14: A weighted comparison matrix of 6745 (or an EDNAFULL (EMBOSS version of NCBI NUC4.4) substitution matrix); (2) a penalty of 3.0 for each gap and an additional penalty of 0.10 for each symbol in each gap (or a gap opening penalty of 10, a gap extension penalty of 0.5); and (3) no penalty for terminal gaps. Thus, the terms “homology” or “identity” as used in this application refer to the relevance between the sequences.

[0096] Another aspect of the present application provides a vector comprising the polynucleotide of the present application. The vector may be an expression vector for expressing the polynucleotide in a microorganism, but is not limited thereto.

[0097] In this application, the term “vector” may comprise a DNA product comprising a sequence of nucleotides of a polynucleotide encoding said target polypeptide, which is operably linked to a suitable expression control region (or expression control sequence) to enable the expression of said target polypeptide within a suitable host. The expression control region may comprise a promoter capable of initiating transcription, any operator sequence for regulating such transcription, a sequence coding for a suitable mRNA ribosome binding site, and a sequence regulating the termination of transcription and translation. After being transformed into a suitable microorganism, the vector may replicate or function independently of the host genome and may be incorporated into the genome itself.

[0098] The vectors used in this application are not particularly limited, and any vector known in the art may be used. Examples of commonly used vectors include plasmids, cosmids, viruses, and bacteriophages in their natural or recombinant state. For example, pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, and Charon21A may be used as phage vectors or cosmid vectors, and pDZ-based, pBR-based, pUC-based, pBluescriptII-based, pGEM-based, pTZ-based, pCL-based, and pET-based vectors may be used as plasmid vectors. Specifically, pDZ, pDC, pDCM2, pDC24, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC vectors may be used.

[0099] For example, a polynucleotide encoding a target polypeptide can be inserted into a chromosome using a vector for intracellular chromosome insertion. The insertion of said polynucleotide into the chromosome may be achieved by any method known in the art, for example, homologous recombination, but is not limited thereto. A selection marker may be additionally included to confirm whether the chromosome insertion has occurred. The selection marker is intended to select cells transformed by the vector, that is, to confirm whether the target nucleic acid molecule has been inserted, and markers conferring selectable phenotypes such as drug resistance, nutritional requirements, resistance to cytotoxic agents, or expression of surface polypeptides may be used. Since only cells expressing the selection marker survive or exhibit other phenotypes in an environment treated with a selective agent, the transformed cells can be selected.

[0100] In this application, the term "transformation" means introducing a vector containing a polynucleotide encoding a target polypeptide into a microorganism or into a microorganism so that the polypeptide encoded by said polynucleotide can be expressed within the microorganism. The transformed polynucleotide may include either inserted into or outside the chromosomes of the microorganism, as long as it can be expressed within the microorganism. Additionally, said polynucleotide includes DNA and / or RNA encoding the target polypeptide. said polynucleotide may be introduced in any form that can be introduced into the microorganism and expressed. For example, said polynucleotide may be introduced into the microorganism in the form of an expression cassette, which is a genetic structure containing all the elements necessary for self-expression. said expression cassette may typically include a promoter, a transcription termination signal, a ribosome binding site, and a translation termination signal operably linked to said polynucleotide. said expression cassette may be in the form of a self-replicating expression vector. In addition, the polynucleotide may be introduced into the microorganism in its own form and operably linked to a sequence required for expression in the microorganism, but is not limited thereto.

[0101] In addition, the term "operably connected" above means that a promoter sequence and a polynucleotide sequence are functionally connected to initiate and mediate the transcription of a polynucleotide encoding the target variant polypeptide of the present application.

[0102] The method of transforming the vector of the present application includes any method of introducing nucleic acid into a cell, and depending on the host cell, a suitable standard technique as known in the art may be selected and performed. Examples include, but are not limited to, electroporation, calcium phosphate (CaPO4) precipitation, calcium chloride (CaCl2) precipitation, microinjection, polyethylene glycol (PEG) method, DEAE-dextran method, cationic liposome method, and lithium acetate-DMSO method.

[0104] Another aspect of the present application provides a microorganism comprising one or more selected from the variant polypeptide; a polynucleotide encoding the variant polypeptide; and a vector comprising the same.

[0105] Another aspect of the present application provides a microorganism further comprising one or more selected from a nicotinamide nucleotide transhydrogenase alpha subunit; a polynucleotide encoding the alpha subunit; and a vector comprising the same.

[0106] In one embodiment, the microorganism of the present application may be a microorganism capable of producing L-amino acid or a derivative thereof.

[0108] In this application, the term "microorganism (or strain)" includes both wild-type microorganisms and microorganisms that have undergone natural or artificial genetic modification. It may be a microorganism in which specific mechanisms are weakened or strengthened due to causes such as the insertion of external genes or the enhancement or inactivation of the activity of endogenous genes, and may be a microorganism that includes genetic modification for the production of a desired polypeptide, protein, or product. In this application, "microorganism," "strain," and "microorganism" may be used interchangeably without limitation as having the same meaning.

[0109] In this application, the term “recombinant microorganism” refers to a microorganism that is genetically modified to exhibit a different genotype and / or phenotype compared to a naturally occurring microorganism (e.g., when the genetic modification affects the nucleic acid sequence coding of the microorganism), and may include both offspring and potential offspring of said microorganism. In this application, the terms “recombinant microorganism,” “genetically modified microorganism,” “recombinant host cell,” “recombinant cell,” and “recombinant strain” may be used interchangeably. The recombinant microorganism may, for example, express a gene not found in its natural (non-recombinant) form; not express a gene expressed in its natural form; or express a natural gene in a manner different from that expressed in its natural form.

[0111] In this application, the term "microorganism producing L-amino acid or its derivative" refers to a prokaryotic or eukaryotic microbial strain capable of producing L-amino acid or its derivative within an organism, and may include both microorganisms in which the ability to produce L-amino acid or its derivative is conferred to a parent strain that lacks the ability to produce L-amino acid or its derivative, and microorganisms that inherently possess the ability to produce L-amino acid or its derivative. The ability to produce L-amino acid or its derivative may be conferred or enhanced by species improvement.

[0112] In one embodiment, the microorganism of the present application may be, but is not limited to, a microorganism that naturally has the ability to produce a nicotinamide nucleotide transhydrogenase beta-subunit variant polypeptide or an L-amino acid or its derivative; or a microorganism in which the variant polypeptide of the present application or a polynucleotide encoding it (or a vector containing said polynucleotide) is introduced into a parent strain that does not have the ability to produce a nicotinamide nucleotide transhydrogenase beta-subunit variant polypeptide or an L-amino acid or its derivative, and / or is conferred the ability to produce an L-amino acid or its derivative.

[0113] In one embodiment, the microorganism of the present application includes, but is not limited to, a microorganism comprising the sequence of the nicotinamide nucleotide transhydrogenase beta-subunit variant polypeptide of the present application, wherein a chromosomal gene encoding the nicotinamide nucleotide transhydrogenase beta-subunit variant polypeptide of the present application is mutated, and / or a microorganism comprising the nicotinamide nucleotide transhydrogenase beta-subunit variant polypeptide of the present application by introducing a polynucleotide encoding the nicotinamide nucleotide transhydrogenase beta-subunit variant polypeptide of the present application or a vector containing the same.

[0114] In this application, the term "non-mutated microorganism" does not exclude strains containing mutations that may naturally occur in microorganisms, and may refer to wild-type strains or natural-type strains themselves, or strains prior to genetic mutations caused by natural or artificial factors. For example, the non-mutated microorganism may refer to a strain in which the nicotinamide nucleotide transhydrogenase beta-subunit variant polypeptide described herein has not been introduced or is prior to being introduced. The term "non-mutated microorganism" may be used interchangeably with "pre-mutation strain," "pre-mutation microorganism," "non-mutated strain," "non-mutated strain," "non-mutated microorganism," or "reference microorganism."

[0116] Microorganisms having the ability to produce L-amino acids or derivatives according to the present application may be, but are not limited to: a microorganism comprising one or more of the variant polypeptide of the present application, the polynucleotide of the present application, and a vector comprising the polynucleotide of the present application; a microorganism modified to express the variant polypeptide of the present application or the polynucleotide of the present application; a microorganism expressing the variant polypeptide of the present application or the polynucleotide of the present application (e.g., a recombinant strain); or a microorganism having the activity of the variant polypeptide of the present application (e.g., a recombinant strain).

[0117] For example, the microorganism of the present application is a cell or microorganism that expresses the variant polypeptide of the present application by being transformed with a polynucleotide encoding the variant polypeptide of the present application or a vector containing the same, and the strain of the present application may include all microorganisms capable of producing L-amino acids or derivatives thereof including the variant polypeptide of the present application. For example, the microorganism of the present application may be a recombinant strain in which the nicotinamide nucleotide transhydrogenase beta-subunit variant polypeptide is expressed or nicotinamide nucleotide transhydrogenase containing the variant polypeptide of the present application is expressed by introducing a polynucleotide encoding the variant polypeptide of the present application into a natural wild-type microorganism or a microorganism capable of producing L-amino acids or derivatives thereof, thereby increasing the ability to produce L-amino acids or derivatives thereof. The recombinant strain with increased production capacity of L-amino acids or their derivatives may be a microorganism with increased production capacity of L-amino acids or their derivatives compared to a natural wild-type microorganism or an unmodified microorganism (e.g., a microorganism expressing wild-type nicotinamide nucleotide transhydrogenase or a microorganism not expressing the variant polypeptide of the present application), but is not limited thereto. As an example, the microorganism with increased production capacity of L-amino acids or their derivatives of the present application may be a microorganism with increased production capacity of L-amino acids or their derivatives compared to a microorganism containing the polypeptide of SEQ ID NO. 11 or a polynucleotide encoding it, but is not limited thereto. As an example, the unmodified microorganism, which is the target strain for comparing whether the production capacity of L-amino acids or their derivatives is increased, is the wild-type Corynebacterium glutamicum strain KCCM 12502P (CA09-0903); It may be CJR2 or KCCM12120P, but is not limited thereto.

[0119] The microorganisms of the present application may include all microorganisms capable of expressing the nicotinamide nucleotide transhydrogenase beta-subunit variant polypeptide of the present application by various known methods in addition to the introduction of the nucleic acid or vector.

[0120] For example, the microorganism with increased production capacity of L-amino acids or their derivatives is about 1% or more, specifically about 1% or more, about 2% or more, about 3% or more, about 4% or more, about 5% or more, about 6% or more, about 7% or more, about 8% or more, about 9% or more, about 10% or more, about 11% or more, about 12% or more, about 13% or more, about 14% or more, about 15% or more, about 16% or more, about 17% or more, about 18% or more, about 19% or more, about 20% or more, about 25% or more, about 30% or more, about 35% or more, about 40% or more, about 50% or more (there is no special limitation on the upper limit, for example, about 200% or less, about 150% It may be increased to about 100% or less, about 90% or less, about 80% or less, about 70% or less, about 60% or less, about 55% or less, or about 50% or less, but is not limited thereto as long as it has a positive increase compared to the production capacity of the parent strain or non-mutated microorganism before mutation. In another example, the recombinant strain with increased L-amino acid or derivative production capacity has, compared to the parent strain before mutation or the non-mutated microorganism, an L-amino acid or derivative production capacity of about 1.01 times or more, about 1.02 times or more, about 1.03 times or more, about 1.04 times or more, 1.05 times or more, 1.06 times or more, 1.07 times or more, 1.08 times or more, 1.09 times or more, about 1.1 times or more, about 1.11 times or more, about 1.12 times or more, about 1.13 times or more, about 1.14 times or more, about 1.15 times or more, about 1.16 times or more, about 1.17 times or more, about 1.18 times or more, about 1.19 times or more, about 1.20 times or more, about 1.25 times or more, about 1.30 times or more, about 1.35 times or more, Approximately 1.40 times or more, approximately 1.45 times or more, or approximately 1.50 times or more (there is no special restriction on the upper limit, for example, approximately 10 times or less, approximately 5 times or less, approximately 3 times or less, approximately 2 times or less, or approximately 1.It may be increased (it may be up to 5 times) but is not limited thereto. The above term “about” is a range that includes all of ±0.5, ±0.4, ±0.3, ±0.2, ±0.1, etc., and includes all values ​​in a range equivalent to or similar to the value following the term “about,” but is not limited thereto.

[0122] As a microorganism according to any one of the prior embodiments, the microorganism of the present application is of the genus Corynebacterium ( Corynebacteria sp .), genus Escherichia ( Escherichia sp .), Erwinia genus( Erwinia sp .), Serratia genus( Serratia sp .), genus Providencia ( Providencia sp .), genus Pseudomonas( Pseudomonas sp .), genus Leptospira ( Leptospira sp. ), Salmonella genus( Salmonella sp .), genus Brevibacteria( Brevibacteria sp .), genus Hypomonas ( Hypomononas sp .), genus Chromobacterium( Chromobacterium sp. ) and the genus Nocardia ( Norcardia sp .), or microorganisms belonging to fungi or yeasts, specifically microorganisms of the genus Corynebacterium, but not limited thereto.

[0123] As an example of the present application, the microorganism of the present application is Corynebacterium glutamicum ( Corynebacterium glutamicum ), Corynebacterium crudilactis( Corynebacterium crudilactis ), Corynebacterium deserti( Corynebacterium deserti ), Corynebacterium epiphysiens( Corynebacterium efficiens ), Corynebacterium calunae( Corynebacterium callunae ), Corynebacterium stationaryis( Corynebacterium stationis ), Corynebacterium singulare( Corynebacterium singulare ), Corynebacterium halotolerans( Corynebacterium halotolerans ), Corynebacterium striatum ( Corynebacterium striatum ), Corynebacterium ammoniagenes( Corynebacterium ammoniagenes ), Corynebacterium pollatisoli ( Corynebacterium pollutisoli), Corynebacterium imitans( Corynebacterium imitans ), Corynebacterium testudinoris( Corynebacterium testudinoris ) or Corynebacterium flavescens ( Corynebacterium flavescens ) may be. Specifically, the microorganism of the present application is a microorganism of the genus Corynebacterium, more specifically Corynebacterium glutamicum ( Corynebacterium glutamicum It may be, but is not limited to.

[0124] Specifically, the microorganism of the present application may be a microorganism of the genus Corynebacterium, more specifically Corynebacterium glutamicum, but is not limited thereto.

[0126] Meanwhile, the Corynebacterium microorganisms of the present application with enhanced L-amino acid or derivative production capabilities may include the natural wild-type microorganisms themselves, Corynebacterium microorganisms that have enhanced L-amino acid or derivative production capabilities by increasing or decreasing the activity of genes related to the L-amino acid or derivative production mechanism, or Corynebacterium microorganisms that have enhanced L-amino acid or derivative production capabilities by introducing or increasing the activity of external genes. In one embodiment, the present invention may include Corynebacterium microorganisms with enhanced L-amino acid or derivative production capabilities by introducing the variant polypeptide or nicotinamide nucleotide transhydrogenase containing it, but is not limited thereto.

[0128] In this application, the term “increase” of protein (polypeptide) activity means that the activity of a protein (polypeptide) within a host cell (microorganism) increases relative to its intrinsic activity. The increase may be used interchangeably with terms such as activation, up-regulation, overexpression, and enhancement. The host cell (microorganism) may be a prokaryotic or eukaryotic microorganism.

[0129] The increase in the above protein (polypeptide) activity may include both the occurrence of protein (polypeptide) activity that the host cell (microorganism) did not inherently possess, and the occurrence of protein (polypeptide) activity that is enhanced compared to the inherent activity or activity prior to modification.

[0130] For example, the above "exhibiting protein (polypeptide) activity that was not inherently possessed" or exhibiting enhanced protein (polypeptide) activity may be due to the "introduction of protein (polypeptide)," but is not limited thereto.

[0131] In this application, the term "introduction" of a protein (polypeptide) means that the activity of a specific protein is exhibited as a result of a gene that was not originally possessed by the microorganism being expressed within the microorganism, or that the polypeptide activity is strengthened, increased, or improved compared to the intrinsic activity of the said protein or its activity prior to modification. For example, this may be due to the introduction of a gene encoding the said protein (polypeptide) into a host cell (microorganism). For example, a polynucleotide encoding a specific protein (polypeptide) may be introduced into a chromosome within the host cell (microorganism), or a vector containing a polynucleotide encoding a specific protein (polypeptide) may be introduced into the host cell (microorganism) to exhibit or improve its activity.

[0132] The above "intrinsic activity" refers to the activity of a specific protein (polypeptide) originally possessed by the host cell (microorganism) prior to transformation or the non-transformed host cell (microorganism) when a trait changes due to genetic variation caused by natural or artificial factors. This term may be used interchangeably with "pre-transformation activity."

[0133] An increase in the activity of a protein (polypeptide) relative to its intrinsic activity means that the activity and / or concentration (expression level) of the protein (polypeptide) in the host cell (microorganism) has been enhanced compared to the activity and / or concentration (expression level) of the said protein (polypeptide) originally possessed by the host cell (microorganism) prior to transformation or the non-transformed host cell (microorganism).

[0134] For example, the above increase may be that the activity of the corresponding protein (polypeptide) was absent, or that the activity or concentration thereof is increased to approximately 1% or more, approximately 10% or more, approximately 25% or more, approximately 50% or more, approximately 75% or more, approximately 100% or more, approximately 150% or more, approximately 200% or more, approximately 300% or more, approximately 400% or more, or approximately 500% or more, up to approximately 1000% or approximately 2000% or more, based on the activity or concentration in the host cell (microorganism) before transformation or in the non-transformed host cell (microorganism), but is not limited thereto.

[0135] An increase in the activity of the above protein (polypeptide) can be achieved by introducing an exogenous protein (polypeptide) or by increasing the activity of the intrinsic protein (polypeptide). Whether the activity of the above protein (polypeptide) has increased can be confirmed from an increase in the degree of activity, expression amount, or amount of product attributable to the activity of the said protein (polypeptide).

[0136] Increased activity of the above protein (polypeptide) can be achieved by various methods well known in the art, and is not limited to, as long as the activity of the target protein (polypeptide) can be increased compared to that of the host cell (microorganism) before modification. Specifically, it may be, but is not limited to, gene engineering and / or protein engineering known to a person skilled in the art, which are routine methods of molecular biology (e.g., Sitnicka et al. Functional Analysis of Genes. Advances in Cell Biology. 2010, Vol. 2. 1-16, Sambrook et al. Molecular Cloning 2012, etc.).

[0137] Specifically, the increase in the activity of the protein (polypeptide) of the present application is

[0138] 1) Increase in the intracellular copy number of polynucleotides encoding proteins (polypeptides);

[0139] 2) Modification of a gene expression regulatory region on a chromosome encoding a protein (polypeptide) (e.g., introduction of a mutation within the expression regulatory region, replacement with a sequence having greater activity, or insertion of a sequence having greater activity);

[0140] 3) A modification of the nucleotide sequence encoding the start codon or the 5'-UTR region of a gene transcript encoding a protein (polypeptide);

[0141] 4) Modification of the amino acid sequence of the protein (polypeptide) to increase protein (polypeptide) activity;

[0142] 5) Modification of the polynucleotide sequence encoding the protein (polypeptide) to increase the activity of the protein (polypeptide) (e.g., modification of the polynucleotide sequence of the protein (polypeptide) coding gene to code for a modified protein (polypeptide) to increase the activity of the protein (polypeptide);

[0143] 6) Introduction of a foreign protein (polypeptide) exhibiting protein (polypeptide) activity or a foreign polynucleotide encoding the same;

[0144] 7) Codon optimization of polynucleotides encoding proteins (polypeptides);

[0145] 8) Analyze the tertiary structure of the protein (polypeptide) to select and modify or chemically modify the exposed site; or

[0146] 9) Regulation of cellular localization of proteins (polypeptides); or

[0147] 10) It may be based on two or more combinations selected from 1) to 9) above, but is not specifically limited thereto.

[0148] for example,

[0149] The increase in the intracellular copy number of the polynucleotide encoding the protein (polypeptide) described in 1) above may be achieved by introducing a vector containing the polynucleotide encoding the protein (polypeptide) operably linked to an appropriate regulatory sequence into a host cell (microorganism). Alternatively, one or more copies of the polynucleotide encoding the protein (polypeptide) operably linked to an appropriate regulatory sequence may be introduced into the chromosomes within the host cell (microorganism). The introduction into the chromosomes may be performed by introducing a vector capable of inserting the polynucleotide into the chromosomes within the host cell (microorganism), but is not limited thereto. The vector is as described above. The regulatory sequence may be a natural form (of the same origin) or a foreign sequence (derived from a different gene) with respect to the polynucleotide sequence, a variant of these, or another artificial sequence, and may induce the expression of the polynucleotide within the host cell (microorganism).

[0150] The replacement of a gene expression regulatory region (or expression regulatory sequence) on a chromosome encoding a protein (polypeptide) in the above 2) with a sequence having greater activity may, for example, involve introducing a sequence variation by deletion, insertion, substitution, or a combination thereof to further increase the activity of the expression regulatory region, or by replacing it with a sequence having greater activity. The expression regulatory region may include, but is not limited to, a promoter, an operator sequence, a sequence encoding a ribosome binding site, and a sequence regulating the termination of transcription and translation. As an example, the original promoter may be replaced with a potent promoter, but is not limited thereto.

[0151] Examples of known strong promoters include, but are not limited to, cj1 to cj7 promoters (US Patent No. 7662943 B2), lac promoter, trp promoter, trc promoter, tac promoter, lambda phage PR promoter, PL promoter, tet promoter, gapA promoter, SPL7 promoter, SPL13(sm3) promoter (US Patent No. 10584338 B2), O2 promoter (US Patent No. 10273491 B2), tkt promoter, and yccA promoter.

[0152] The above 3) modification of the nucleotide sequence of the region coding for the start codon or 5'-UTR of the gene coding for the protein (polypeptide) may be, for example, a modification that codes for another start codon with a higher protein (polypeptide) expression rate compared to the intrinsic start codon, or an RBS sequence with a higher protein (polypeptide) expression rate compared to the intrinsic RBS (ribosome binding site) sequence, but is not limited thereto.

[0153] The modification of the amino acid sequence or polynucleotide sequence of the protein (polypeptide) in 4) and 5) above may be the introduction of a sequence variation by deletion, insertion, substitution, or a combination thereof to the amino acid sequence of the protein (polypeptide) or the polynucleotide sequence encoding the protein (polypeptide) to increase the activity of the protein (polypeptide), or the replacement with an amino acid sequence or polynucleotide sequence modified to increase activity, but is not limited thereto. The replacement may be performed, for example, by inserting the polynucleotide into the chromosome by homologous recombination, but is not limited thereto.

[0154] The introduction of an exogenous polynucleotide exhibiting the activity of the protein (polypeptide) described in 6) above may be the introduction into a host cell (microorganism) of an exogenous polynucleotide encoding a protein (polypeptide) that exhibits the same or similar activity as the protein (polypeptide). As long as the exogenous polynucleotide exhibits the same or similar activity as the protein (polypeptide), there are no restrictions on its origin or sequence. The method used for the introduction may be performed by a person skilled in the art by appropriately selecting a known transformation method, and the protein (polypeptide) may be produced and its activity increased by the expression of the introduced polynucleotide within the host cell.

[0155] The above 7) codon optimization of a polynucleotide encoding a protein (polypeptide) may be a codon optimization of the endogenous polynucleotide so that transcription or translation increases within the host cell (microorganism), or a codon optimization of the exogenous polynucleotide so that optimized transcription and translation occur within the host cell (microorganism).

[0156] 8) Analyzing the tertiary structure of the protein (polypeptide) above to select an exposed site for modification or chemical modification may, for example, involve determining a template protein candidate based on the degree of sequence similarity by comparing the sequence information of the protein (polypeptide) to be analyzed with a database in which sequence information of known proteins is stored, and confirming the structure based on this to select an exposed site to modify or chemically modify.

[0157] The above 9) regulation of the intracellular localization of a protein (polypeptide) may involve targeting the protein (polypeptide) to a specific intracellular organelle or a specific intracellular space. For example, it may involve targeting to the periplasm or cytoplasm through the addition or removal of a leader sequence that functions for the targeting of the protein (polypeptide), but is not limited thereto.

[0158] Such an increase in protein (polypeptide) activity may be an increase in the activity or concentration of the corresponding protein (polypeptide) relative to the activity or concentration of the protein (polypeptide) expressed in the wild-type or pre-modification host cell (microorganism), or an increase in the amount of products attributable to the activity of the said protein (polypeptide), but is not limited thereto.

[0160] Modification of part or all of the polynucleotides in the microorganisms of the present application may be induced by (a) a method using homologous recombination using a vector for chromosome insertion within the microorganism or genome editing using engineered nucleases (e.g., CRISPR-Cas9) and / or (b) treatment by light and / or chemicals such as ultraviolet rays and radiation, but is not limited thereto.

[0162] The microorganism of the present application may have enhanced ability to produce L-amino acids or their derivatives.

[0163] In the present application, "L-amino acid or derivative thereof" includes all L-amino acids or derivatives thereof that can be produced by microorganisms through metabolic processes from various carbon sources, specifically, may include, but is not limited to, L-threonine, L-arginine, and L-homoserine.

[0164] In one embodiment of the present application, the microorganism of the genus Corynebacterium may have an increased ability to produce one or more amino acids selected from L-threonine, L-arginine, and L-homoserine or derivatives thereof compared to a non-modified microorganism.

[0166] Another aspect of the present application provides a method for producing an L-amino acid or a derivative thereof, comprising the step of culturing a microorganism in a medium comprising one or more selected from the variant polypeptide of the present application; a polynucleotide encoding said variant polypeptide; and a vector comprising said polynucleotide.

[0168] The above microorganism is as described in another embodiment.

[0169] In this application, the term "culture" means growing the microorganism of this application under appropriately controlled environmental conditions. In this application, the culture process may be carried out according to suitable media and culture conditions known in the art. Such a culture process can be easily adjusted and used by those skilled in the art depending on the selected strain. Specifically, the culture may be batch, continuous, and / or fed-batch, but is not limited thereto.

[0170] The microorganism of the present application can be cultured under aerobic conditions while controlling the temperature, pH, etc. in a conventional medium containing a suitable carbon source, nitrogen source, phosphorus, inorganic compound, amino acid and / or vitamin, etc.

[0171] In the present application, the carbon source may include carbohydrates such as glucose, saccharose, lactose, fructose, sucrose, maltose, etc.; sugar alcohols such as mannitol, sorbitol, etc.; organic acids such as pyruvate, lactic acid, citric acid, etc.; and amino acids such as glutamic acid, methionine, lysine, etc. Additionally, natural organic nutrient sources such as starch hydrolysate, molasses, blackstrap molasses, rice winter, cassava, sugarcane residue, and corn steeping liquid may be used. Specifically, carbohydrates such as glucose and sterilized pre-treated molasses (i.e., molasses converted into reducing sugars) may be used, and other carbon sources in appropriate amounts may be used in various ways without limitation. These carbon sources may be used individually or in combination of two or more types, but are not limited thereto.

[0172] The above nitrogen sources may include inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, ammonium carbonate, ammonium nitrate, etc.; and organic nitrogen sources such as amino acids such as glutamic acid, methionine, glutamine, etc., peptone, NZ-amine, meat extract, yeast extract, malt extract, corn steep liquid, casein hydrolysate, fish or its decomposition products, defatted soybean cake or its decomposition products, etc. These nitrogen sources may be used alone or in combination of two or more types, but are not limited thereto.

[0173] The above ingredients may include monopotassium phosphate, dipotassium phosphate, or corresponding sodium-containing salts. Inorganic compounds may include sodium chloride, calcium chloride, iron chloride, magnesium sulfate, iron sulfate, manganese sulfate, calcium carbonate, etc., and may also include amino acids, vitamins, and / or suitable precursors. These components or precursors may be added to the culture medium in a batch or continuous manner. However, they are not limited thereto.

[0174] During the cultivation of the microorganism of the present application, compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, sulfuric acid, etc., may be added to the medium in an appropriate manner to adjust the pH of the medium. Additionally, during cultivation, an antifoaming agent such as a fatty acid polyglycol ester may be used to suppress the formation of bubbles. Furthermore, to maintain an aerobic state of the medium, oxygen or an oxygen-containing gas may be injected into the medium, or nitrogen, hydrogen, or carbon dioxide gas may be injected without gas injection to maintain an anaerobic and microaerobic state, but is not limited thereto.

[0175] In addition, the culture medium may contain metal salts, such as magnesium sulfate or iron sulfate, necessary for growth. Finally, in addition to the above materials, essential growth substances such as amino acids and vitamins may be used. Furthermore, suitable precursors may be used in the culture medium. The above-mentioned raw materials may be added to the culture in a batch or continuous manner in a manner appropriate to the culture process, but are not limited thereto.

[0176] In the present application, the pH of the culture may be adjusted by adding compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, sulfuric acid, etc., to the culture in an appropriate manner during the cultivation of microorganisms. Additionally, during cultivation, the formation of bubbles may be suppressed by using an antifoaming agent such as a fatty acid polyglycol ester. Furthermore, to maintain an aerobic state of the culture, oxygen or an oxygen-containing gas may be injected into the culture, or nitrogen, hydrogen, or carbon dioxide gas may be injected without gas injection to maintain an anaerobic and microaerobic state, but is not limited thereto.

[0177] In the culture of the present application, the culture temperature may be maintained at 20 to 35°C, specifically 25 to 35°C, and the culture period may continue until a useful substance is produced, and may be cultured for about 10 to 160 hours, about 20 to 130 hours, about 24 to 120 hours, about 36 to 120 hours, about 48 to 120 hours, about 48 hours or more, or about 48 hours, about 72 hours, or about 120 hours, but is not limited thereto.

[0179] The L-amino acid or its derivative produced by the culture of the present application may be secreted into the culture medium or remain within the cell.

[0180] In one embodiment of the present application, the L-amino acid or its derivative may be one or more selected from L-threonine, L-arginine, and L-homoserine, but is not limited thereto.

[0182] In one embodiment, the method for producing an L-amino acid or its derivative according to the present application may additionally include, for example, the step of preparing a microorganism according to the present application, the step of preparing a medium for culturing said strain, or a combination thereof (in any order), prior to said culturing step.

[0183] The method for producing L-amino acids or derivatives thereof according to the present application may further include a step of recovering a target substance, specifically L-amino acids or derivatives thereof, from the cultured microorganism, the culture of the microorganism, the fermented product of the microorganism, or the culture medium. The recovery step may be additionally included after the culture step.

[0184] The above recovery may involve collecting the desired L-amino acid or its derivatives using a suitable method known in the art according to the culture method of the microorganism of the present application, such as a batch, continuous, or fed-batch culture method. For example, various chromatographic methods such as centrifugation, filtration, treatment with a crystallizing protein precipitating agent (salting out), extraction, ultrasonic disruption, ultrafiltration, dialysis, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, affinity chromatography, HPLC, or a combination thereof may be used, and the target substance, specifically L-amino acid or its derivatives, may be recovered from the culture medium or microorganism using a suitable method known in the art.

[0185] Additionally, the method for producing L-amino acids or their derivatives according to the present application may further include a purification step. The purification may be performed using a suitable method known in the art. In one example, where the method for producing L-amino acids or their derivatives according to the present application includes both a recovery step and a purification step, the recovery step and the purification step may be performed continuously or discontinuously regardless of the order, or simultaneously or integrated into a single step, but are not limited thereto.

[0186] In the method of the present application, the variant polypeptide, the introduction and L-amino acid or its derivative, etc. are as described in the other embodiments above.

[0188] Another aspect of the present application provides a composition for producing an L-amino acid or a derivative thereof, comprising one or more selected from: a variant polypeptide of the present application; a polynucleotide encoding the variant polypeptide; a vector comprising the same; a microorganism comprising the vector; a culture of the microorganism; and a fermented product of the microorganism.

[0189] The composition of the present application may further include any suitable excipients commonly used in compositions for producing L-amino acids or their derivatives, and such excipients may be, for example, preservatives, wetting agents, dispersants, suspending agents, buffers, stabilizers or isotonic agents, but are not limited thereto.

[0190] In one specific example, each component present in the composition of the present application may be included in a microbiologically effective amount or in an amount that can be appropriately present in a composition for production.

[0191] In the composition of the present application, the variant polypeptide, the introduction and L-amino acid or its derivative, etc., are as described in the other embodiments above.

[0193] Another aspect of the present application provides a use for producing L-amino acids or derivatives of microorganisms with enhanced L-amino acid or derivative production capacity, wherein at least one selected from the variant polypeptide of the present application and polynucleotides encoding said variant polypeptide is introduced.

[0194] In the use of the present application, variant polypeptides, introductions and L-amino acids or derivatives thereof, etc. are as described in the other embodiments above.

[0196] Another aspect of the present application provides a method for producing a microorganism with enhanced ability to produce L-amino acids or derivatives, comprising the step of introducing a variant polypeptide of the present application and one or more selected from a polynucleotide encoding said variant polypeptide into a microorganism of the genus Corynebacterium having the ability to produce L-amino acids or derivatives thereof.

[0197] Another aspect of the present application provides a method for increasing the production capacity of L-amino acids or their derivatives, comprising the step of introducing a variant polypeptide of the present application and one or more selected from a polynucleotide encoding said variant polypeptide into a microorganism of the genus Corynebacterium having the production capacity of L-amino acids or their derivatives.

[0198] In the method of the present application, the variant polypeptide, the introduction and L-amino acid or its derivative, etc. are as described in the other embodiments above. Effects of the invention

[0200] When culturing a microorganism containing the nicotinamide nucleotide transhydrogenase beta-subunit variant polypeptide of the present application, it is possible to produce L-amino acids or their derivatives in high yield compared to a microorganism having the existing non-modified polypeptide. Specific details for implementing the invention

[0202] The present application will be explained in more detail below through examples and experimental examples. However, these examples and experimental examples are intended to illustrate the present application, and the scope of the present application is not limited to these examples and experimental examples.

[0204] Example 1: Construction of a recombinant vector for the introduction of exogenous nicotinamide nucleotide transhydrogenase (pntAB)

[0206] Example 1-1: Construction of a plasmid for gene insertion

[0208] To insert the foreign nicotinamide nucleotide transhydrogenase (hereinafter, pntAB) gene into the chromosome of Corynebacterium glutamicum, NCgl1287, known as a gene encoding a transposon, was used as the insertion site (J Bacteriol. 2011 Mar; 193(5): 1237-1249). To replace the NCgl1287 gene with the foreign pntAB, NCgl1287 deletion and target gene insertion vectors were constructed. To construct the vectors, PCR was performed using the chromosomal DNA of Corynebacterium glutamicum ATCC13032 or ATCC13869 as a template, and primer pairs of SEQ ID NO. 1 and SEQ ID NO. 2, and SEQ ID NO. 3 and SEQ ID NO. 4, respectively. The primer sequences used to perform each of the above PCRs are shown in Table 1 below.

[0209] PfuUltra is the polymerase used for the PCR reaction. TM High-reliability DNA polymerase (Stratagene) was used, and the PCR conditions were denaturation at 95°C for 30 seconds; denaturation at 55°C for 30 seconds; and polymerization at 72°C for 1 minute. These cycles of denaturation, annealing, and polymerization were repeated 28 times. As a result, DNA fragments of 720 bp and 854 bp were obtained, respectively. The obtained DNA products were purified using a PCR purification kit (QUIAGEN). The NCgl1287 deletion and target gene insertion vectors pDC24△N1287 (13032) and pDC24△N1287 (13869) were constructed by cloning the pDC24 vector (sequence number 112), which was treated with the purified amplification product and restriction enzyme smaI and then heat-treated at 65°C for 20 minutes, using an Infusion Cloning Kit (TaKaRa) according to the provided manual.

[0211] Sequence number designation order 1 Primer AATTCGAGCTCGGTACCCAATGGAGCTGAAAGAAT 2 Primer CTTCCTGATAGTCCCGGGACATTGTTTTTC 3 Primer GAAAAAACAATGTCCCGGGACTATCAGGAAG 4 Primer GTCGACTCTAGAGGATCCCCATAAAAACAGGCAGAGGA

[0213] Example 1-2: Plasmid construction for pntAB introduction

[0215] To further enhance the activity of the pntAB to be introduced, a plasmid was constructed in which the intrinsic promoter of the pntAB gene to be introduced was replaced with PgapA.

[0216] First, the PgapA promoter fragment was obtained by performing PCR using the primer pair of SEQ ID NO. 5 and SEQ ID NO. 6 with the chromosomal DNA of Corynebacterium glutamicum 13032 as a template. In addition, the amino acid sequence of PntAB derived from Corynebacterium variabile and the nucleotide sequence encoding it were obtained from the National Institutes of Health (NIH) GenBank, and based on this, the pntAB gene derived from Corynebacterium variabile was synthesized using Cosmogenetech's gene synthesis service (Gene-synthesis). PCR was performed using the synthesized pntAB gene as a template and the primers of SEQ ID NO. 7 and SEQ ID NO. 8, respectively. The primer sequences used to perform each of the above PCRs are as shown in Table 2 below.

[0218] Sequence number designation order 5 Primer CCTGAAAAACAATGTCCCAACGACCGAGCCTATTG 6 Primer GTTGTGTCTCCTCTAAAGAT 7 Primer TCTTTAGAGGAGACACAACATGCTTATTGGTATTCCGAG 8 Primer AACCAACTTCCTGATAGTCCCCTACAGGTGGGGAGATGATCT

[0219] PfuUltra is the polymerase for the PCR reaction TM High-reliability DNA polymerase (Stratagene) was used, and the PCR conditions were denaturation at 95°C for 30 seconds; denaturation at 55°C for 30 seconds; and polymerization at 72°C for 1 minute. These denaturation, annealing, and polymerization cycles were repeated 28 times. As a result, a 472 bp DNA fragment of the PgapA promoter region and a 3041 bp DNA fragment of the pntAB gene of Corynebacterium bacteriophilus were obtained, respectively.

[0221] PCR was performed using the primer pair of SEQ ID NO. 5 and SEQ ID NO. 8 with the amplified promoter and the pntAB DNA fragment of Corynebacterium barbarum as templates. The PCR was performed under the conditions of denaturation at 95°C for 5 minutes, followed by denaturation at 95°C for 30 seconds; annealing at 55°C for 30 seconds; and polymerization at 72°C for 2 minutes, repeated 28 times, followed by polymerization at 72°C for 5 minutes.

[0222] As a result, a 3.5 Kb pntAB DNA fragment encoding the nicotinamide nucleotide transhydrogenase of Corynebacterium barbaricilis linked to the PgapA promoter was amplified.

[0223] The amplification product was purified using a PCR purification kit (QUIAGEN) and used as an insert DNA fragment for vector construction. The vectors pDC24△N1287(13032)::PgapA_pntAB and pDC24△N1287(13869)::PgapA_pntAB for introducing the pntAB gene of Corynebacterium barrierbili onto the Corynebacterium glutamicum chromosome were constructed by making the molar (M) ratio of the purified amplification product and the pDC24△N1287(13032) or pDC24△N1287(13869) vectors, which were treated with the restriction enzyme smaI and heat-treated at 65°C for 20 minutes, 2:1 and cloning them according to the provided manual using an Infusion Cloning Kit (TaKaRa).

[0225] Example 2: Construction of a plasmid for introducing the pntAB mutation

[0227] PCR was performed using the primer pairs in Table 3 with pDC24△N1287(13032)::PgapA_pntAB prepared in Examples 1-2 as a template. The PCR was performed under conditions of denaturation at 95°C for 30 seconds, followed by 25 cycles of denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, and polymerization at 68°C for 5 minutes, followed by polymerization at 68°C for 3 minutes.

[0228] Various pntAB variant introduction vectors listed in Table 3 were constructed by purifying the obtained DNA product using a PCR purification kit (QUIAGEN).

[0230] pntAB mutation plasmid Sequence number Ranking name Sequence(5'-> 3') pDC24△N1287(13032)::PgapA_pntA(T458A)B 14 pDC24△N1287 ::PgapA_pntA(T458A)BF GCAAATGCTATTTCTGGCATCATTTTGG 15 pDC24△N1287 ::PgapA_pntA(T458A)BR CCAGAAATAGCATTTGCTTCGGACATGAGTGGGG pDC24△N1287(13032)::PgapA_pntAB(N55T) 16 pDC24△N1287::PgapA_pntAB(N55T) F ACCACCTTCGGTATCGCTGGTATG 17 pDC24△N1287::PgapA_pntAB(N55T) R CAGCGATACCGAAGGTGGTGCCGCGCGC pDC24△N1287(13032)::PgapA_pntAB(N198T) 18 pDC24△N1287::PgapA_pntAB(N198T) F ACCCTCGCAATCATTGTGTTGTCCG 19 pDC24△N1287::PgapA_pntAB(N198T) R ACACAATGATTGCGAGGGTGAGCAGGTTACGGCCG pDC242△N1287(13032)::PgapA_pntAB(S289A) 20 pDC24△N1287::PgapA_pntAB(S289A) F GCATCTGGTGCTTACTTGTCCTATATC 21 pDC24△N1287::PgapA_pntAB(S289A) R AAGTAAGCACCAGATGCACCGACGAGGGCG pDC24△N1287(13032)::PgapA_pntAB(Y296F) 22 pDC24△N1287::PgapA_pntAB(Y296F) F TTCATCATGTGTAAGGCTATGAACCG 23 pDC24△N1287::PgapA_pntAB(Y296F) R TAGCCTTACACATGATGAAGGACAAGTAAGCACCAGAG pDC24△N1287(13032)::PgapA_pntAB(T431C) 24 pDC24△N1287::PgapA_pntAB(T431C) F TGCGTGAATCCAATCGCTGAAGAGC 25 pDC24△N1287::PgapA_pntAB(T431C) R AGCGATTGGATTCACGCAATCGTTTGGCGCCAATAAC pDC24△N1287(13032)::PgapA_pntAB(I435C) 26 pDC24△N1287::PgapA_pntAB(I435C) F TGCGCTGAAGAGCCAGGTTCTCC 27 pDC24△N1287::PgapA_pntAB(I435C) R CCTGGCTCTCAGCGCATGGATTCACGGTATCGTTGG pDC24△N1287(13032)::PgapA_pntAB(I443C) 28 pDC24△N1287::PgapA_pntAB(I443C) F TGCGCGGGTATGCCAGTCTTG 29 pDC24△N1287::PgapA_pntAB(I443C) R GACTGGCATACCCGCGCAAGGAGAACCTGGCTCTTC pDC24△N1287(13032)::PgapA_pntAB(M446C) 30 pDC24△N1287::PgapA_pntAB(M446C) F TGCCCAGTCTTGAAGGTTTGGGACG 31 pDC24△N1287::PgapA_pntAB(M446C) R AACCTTCAAGACTGGGCAACCCGCAATAGGAGAACCTG pDC24△N1287(13032)::PgapA_pntAB(G467C) 32 pDC24△N1287::PgapA_pntAB(G467C) F TGCTACGCTGGCGTTCAAAACC 33 pDC24△N1287::PgapA_pntAB(G467C) R TTGAACGCCAGCGTAGCAGGCGCCCATAGAGCG pDC24△N1287(13032)::PgapA_pntAB(Y468C) 34 pDC24△N1287::PgapA_pntAB(Y468C) F TGCGCTGGCGTTCAAAACCC 35 pDC24△N1287::PgapA_pntAB(Y468C) R GGTTTTGAACGCCAGCGCAGCCGGCGCCCATAG

[0232] Example 3: Construction of L-amino acid strain with introduced pntAB mutation and evaluation of amino acid production capacity

[0234] Example 3-1: Construction of an L-threonine-producing strain with introduced pntAB mutation and evaluation of threonine production capacity

[0236] The pntAB mutation introduction vector prepared in Example 2-2 above was transformed into a threonine-producing strain and cultured, and the threonine production was analyzed. Specifically, each prepared vector was transformed into the threonine-producing strain Corynebacterium glutamicum KCCM 12502P (CA09-0903, Republic of Korea Registered Patent No. 10-2126951) by electroporation to produce strains expressing the pntAB mutation, and cultured as follows.

[0237] First, each strain was inoculated into a 250 ml corner-baffle flask containing 25 ml of seed medium and cultured at 30°C for 20 hours with shaking at 200 rpm. Then, 1 ml of seed culture was inoculated into a 250 ml corner-baffle flask containing 24 ml of production medium and cultured at 32°C for 24 hours with shaking at 200 rpm.

[0238] <Seed medium (pH 7.0)>

[0239] Glucose 20 g, Peptone 10 g, Yeast extract 5 g, Urea 1.5 g, KH2PO4 4 g, K2HPO4 8 g, MgSO4 7H2O 0.5 g, Biotin 100 µg, Thiamine HCl 1000 µg, Calcium-Pantothenic Acid 2000 µg, Nicotinamide 2000 µg (based on 1 liter of distilled water)

[0240] Production Medium (pH 7.2)

[0241] Glucose 30g, KH2PO4 2g, Urea 3g, (NH4)2SO4 40g, Peptone 2.5g, CSL(Sigma) 5g (10 ml), MgSO4.7H2O 0.5g, Leucine 400mg, CaCO3 20g (based on 1 liter of distilled water)

[0243] After the culture was finished, the production of L-threonine was measured using high-performance liquid chromatography (HPLC), and the concentrations are shown in Table 4 below.

[0244] Threonine production capacity of microorganisms expressing the PntAB variant strain name L-Threonine Concentration (g / L) Concentration percentage (%) relative to wild-type pntAB strain CA09-0903 △N1287::PgapA_pntAB 5.6 100 CA09-0903 △N1287::PgapA_pntA(T458A)B 5.0 89 CA09-0903 △N1287::PgapA_pntAB(N55T) 2.8 50 CA09-0903 △N1287::PgapA_pntAB(N198T) 5.5 98 CA09-0903 △N1287::PgapA_pntAB(S289A) 5.9 105 CA09-0903 △N1287::PgapA_pntAB(Y296F) 5.4 96 CA09-0903 △N1287::PgapA_pntAB(T431C) 3.2 57 CA09-0903 △N1287::PgapA_pntAB(I435C) 5.6 100 CA09-0903 △N1287::PgapA_pntAB(I443C) 3.3 59 CA09-0903 △N1287::PgapA_pntAB(M446C) 2.3 41 CA09-0903 △N1287::PgapA_pntAB(G467C) 2.1 38 CA09-0903 △N1287::PgapA_pntAB(Y468C) 3.4 61

[0245] As a result, as shown in Table 4 above, it was confirmed that the parent strain Corynebacterium glutamicum CA09-0903 △N1287::PgapA_pntAB produced approximately 5.6 g / L of threonine. Among the strains expressing the pntAB variant, it was confirmed that the threonine production capacity of CA09-0903 △N1287::PgapA_pntAB(S289A), which expresses pntAB (S289A), increased by 5% compared to the wild-type pntAB (C.va) strain.

[0247] Example 3-2: Preparation of an L-arginine producing strain with the pntAB(S289A) mutation and evaluation of production capacity

[0249] In the above Example 3-1, the pntAB(S289A) variant, which showed excellent improvement in production capacity, was introduced into an arginine-producing strain to confirm whether arginine production capacity was improved. Specifically, similar to the method described in Example 2, the pDC24△N1287(13869)::PgapA_pntAB(S289A) vector was constructed by performing PCR using the primer pair of SEQ ID NO. 20 and SEQ ID NO. 21 with the pDC24△N1287(13869)::PgapA_pntAB vector as a template, and this was transformed into the arginine-producing strain Corynebacterium glutamicum CJR2 (Korean Patent Application No. 10-2023-0048232) by electroporation.

[0250] To confirm the arginine productivity of the above strain, it was cultured in the following manner.

[0251] First, the strain was inoculated into a 250 ml corner-baffle flask containing 25 ml of seed medium and cultured at 30 ℃ for 20 hours with shaking at 200 rpm. Then, 1 ml of the seed culture was inoculated into a 250 ml corner-baffle flask containing 24 ml of production medium and cultured at 30 ℃ for 72 hours with shaking at 200 rpm.

[0253] <Seed medium (pH 7.0)>

[0254] Glucose 20 g, Peptone 10 g, Yeast extract 5 g, Urea 1.5 g, KH2PO4 4 g, K2HPO4 8 g, MgSO4·7H2O 0.5 g, Biotin 100 µg, Thiamine HCl 1000 µg, Calcium-Pantothenic Acid 2000 µg, Nicotinamide 2000 µg (based on 1 liter of distilled water)

[0255] Production Medium (pH 7.0)

[0256] Glucose 6%, Ammonium sulfate 3%, Potassium dihydrogen phosphate 0.1%, Magnesium sulfate heptahydrate 0.2%, CSL (Corn steep extract) 1.5%, NaCl 1%, Yeast extract 0.5%, Biotin 100 mg / L

[0258] After the culture was finished, the L-arginine production was measured using high-performance liquid chromatography (HPLC), and the concentrations are shown in Table 5 below.

[0260] Arginine production capacity of microorganisms expressing the PntAB(S289A) variant strain name L-arginine concentration (g / L) Concentration percentage (%) relative to wild-type pntAB strain CJR2 △N1287::PgapA_pntAB 2.4 100 CJR2△N1287::PgapA_pntAB(S289A) 2.6 108

[0261] As a result, as shown in Table 5 above, it was confirmed that the CJR2△N1287::PgapA_pntAB(S289A) strain with the introduced mutation showed an 8% increase in arginine production capacity compared to the CJR2△N1287::PgapA_pntAB strain.

[0263] Example 3-3: Preparation of an L-homoserin-producing strain with the pntAB(S289A) mutation and evaluation of production capacity

[0265] The pntAB(S289A) variant, which showed excellent production capacity improvement in Example 3-1 above, was introduced into a homoserine-producing strain. Specifically, the pDC24△N1287(13032)::PgapA_pntAB vector produced in Example 2 was transformed into Corynebacterium glutamicum KCCM12120P (Korean Registered Patent No. 10-1947959) to produce a strain expressing pntAB(S289A), and the strain was cultured in the following manner.

[0266] Specifically, each strain was inoculated into a 250 ml corner-baffle flask containing 25 ml of production medium and cultured at 30°C for 24 hours with shaking at 200 rpm.

[0268] Production Medium (pH 7.0)

[0269] Glucose 45g, (NH4)2SO4 20g, MgSO4·7H2O 1.2g, KH2PO4 1.1g, Biotin 900µg, Thiamine Hydrochloride 4500µg, Calcium Pantothenic Acid 4500µg, CaCO3 30g (based on 1 liter of distilled water)

[0270] After the culture was finished, the production of L-homoserin was measured using high-performance liquid chromatography (HPLC), and the concentrations are shown in Table 6 below.

[0272] Homoserin production capacity of microorganisms expressing the PntAB(S289A) variant strain name L-homoserine concentration (g / L) Percentage of concentration relative to parent strain (%) KCCM12120P △N1287(13032)::PgapA_pntAB 0.56 100 KCCM12120P △N1287(13032)::PgapA_pntAB(S289A) 0.62 110

[0273] As a result, as shown in Table 6 above, it was confirmed that the KCCM12120P △N1287(13032)::PgapA_pntAB(S289A) strain with the introduced mutation showed a 10% increase in homoserine production capacity compared to the KCCM12120P △N1287(13032)::PgapA_pntAB strain.

[0275] Example 4: Introduction of a saturated mutagenesis at amino acid position 289 of PntB and comparison of threonine production ability of strains expressing it

[0277] Example 4-1: Preparation of Vector and Strain for Mutant Amino Acid Substitution Insertion

[0279] Since the expression of the pntAB(S289A) variant showed a high increase in amino acid yield compared to the wild type, we intended to verify the efficacy of improving L-threonine production at the 289 position by mutating serine, the 289th amino acid of pntB, to another amino acid.

[0280] Accordingly, in order to construct a vector expressing a variant in which serine at position 289 of PntB is substituted with 19 other amino acids besides serine, site-directed mutagenesis was performed using pDC24△N1287(13032)::PgapA_pntAB constructed in Example 1 as a template in the following manner.

[0281] Composition of a PCR reaction composition for generating site-specific mutations furtherance Content (μl) 10X pfu-X Buffer 5 10mM dNTP Mix 1 pfu-X Polymerase 1 Mutagenic forward primer (5pmol) 2 Mutagenic reverse primer (5pmol) 2 template DNA, 200 ng / μl 1 dH2O 38 Total 50

[0282] PCR conditions for generating site-specific mutations Number of cycles temperature hour 1 time 95℃ 5 min Episode 18 95℃ 30 sec 60℃ 1 min 68℃ 10 min

[0283] Specifically, using pDC24△N1287(13032)::PgapA_pntAB as a template, each primer pair in Table 9 was added to prepare a PCR composition as shown in Table 7, and PCR was performed under the conditions in Table 8. After the PCR was completed, 1 µl of DpnI restriction enzyme was added and treated at 37°C for 1 hour. 3 µl of DpnI-treated DNA was transformed into DH5a competent cells to obtain the variant plasmid of pDC24△N1287(13032)::PgapA_pntAB listed in Table 9.

[0285] Mutagenic primer set for the production of variant pntAB plasmids variant pntAB plasmid Sequence number nucleotide sequence pDC24△N1287(13032)-PgapA_pntAB S289A Sequence number 36 CCTCGTCGGTGCATCTGGTGCTTACT Sequence number 37 ACAAGTAAGCACCAGATGCACCGACGA pDC24△N1287(13032)-PgapA_pntAB S289C Sequence number 38 CCTCGTCGGTTGCTCTGGTGCTTACT Sequence number 39 ACAAGTAAGCACCAGAGCAACCGACGA pDC24△N1287(13032)-PgapA_pntAB S289D Sequence number 40 CCTCGTCGGTGATTCTGGTGCTTACT Sequence number 41 ACAAGTAAGCACCAGAATCACCGACGA pDC24△N1287(13032)-PgapA_pntAB S289E Sequence No. 42 CCTCGTCGGTGAATCTGGTGCTTACT Sequence No. 43 ACAAGTAAGCACCAGATTCACCGACGA pDC24△N1287(13032)-PgapA_pntAB S289F Sequence No. 44 CCTCGTCGGTTTCTCTGGTGCTTACT Sequence number 45 ACAAGTAAGCACCAGAGAAACCGACGA pDC24△N1287(13032)-PgapA_pntAB S289G Sequence number 46 CCTCGTCGGTGGCTCTGGTGCTTACT Sequence number 47 ACAAGTAAGCACCAGAGCCACCGACGA pDC24△N1287(13032)-PgapA_pntAB S289H Sequence number 48 CCTCGTCGGTCACTCTGGTGCTTACT Sequence number 49 ACAAGTAAGCACCAGAGTGACCGACGA pDC24△N1287(13032)PgapA_pntAB S289I Sequence number 50 CCTCGTCGGTATCTCTGGTGCTTACT Sequence number 51 ACAAGTAAGCACCAGAGATACCGACGA pDC24△N1287(13032)-PgapA_pntAB S289K Sequence No. 52 CCTCGTCGGTAAGTCTGGTGCTTACT Sequence number 53 ACAAGTAAGCACCAGACTTACCGACGA pDC24△N1287(13032)-PgapA_pntAB S289L Sequence number 54 CCTCGTCGGTCTTTCTGGTGCTTACT Sequence number 55 ACAAGTAAGCACCAGAAAGACCGACGA pDC24△N1287(13032)-PgapA_pntAB S289M Sequence number 56 CCTCGTCGGTATGTCTGGTGCTTACT Sequence number 57 ACAAGTAAGCACCAGACATACCGACGA pDC24△N1287(13032)-PgapA_pntAB S289N Sequence number 58 CCTCGTCGGTAATTCTGGTGCTTACT Sequence number 59 ACAAGTAAGCACCAGAATTACCGACGA pDC24β-PgapA_pntAB S289P Sequence number 60 CCTCGTCGGTCCCTCTGGTGCTTACT Sequence number 61 ACAAGTAAGCACCAGAGGGACCGACGA pDC24△N1287(13032)-PgapA_pntAB S289Q Sequence number 62 CCTCGTCGGTCAATCTGGTGCTTACT Sequence number 63 ACAAGTAAGCACCAGATTGACCGACGA pDC24△N1287(13032)-PgapA_pntAB S289R Sequence number 64 CCTCGTCGGTCGTTCTGGTGCTTACT Sequence number 65 ACAAGTAAGCACCAGAACGACCGACGA pDC24△N1287(13032)-PgapA_pntAB S289T Sequence number 66 CCTCGTCGGTACCTCTGGTGCTTACT Sequence number 67 ACAAGTAAGCACCAGAGGTACCGACGA pDC24△N1287(13032)-PgapA_pntAB S289V Sequence number 68 CCTCGTCGGTGTGTCTGGTGCTTACT Sequence number 69 ACAAGTAAGCACCAGACACACCGACGA pDC24△N1287(13032)-PgapA_pntAB S289W Sequence number 70 CCTCGTCGGTTGGTCTGGTGCTTACT Sequence number 71 ACAAGTAAGCACCAGACCAACCGACGA pDC24△N1287(13032)-PgapA_pntAB S289Y Sequence number 72 CCTCGTCGGTTACTCTGGTGCTTACT Sequence number 73 ACAAGTAAGCACCAGAGTAACCGACGA

[0286] After transforming the constructed vectors into a threonine-producing strain (CA09-0903) by electroporation using the method of Example 3, 19 strains with the variant pntAB gene inserted on the chromosome were obtained through a secondary crossover process.

[0288] Example 4-2: Evaluation of Threonine Production Capacity of pntAB Mutant

[0290] The 19 strains produced in Example 4-1 and the previously produced CA09-0903 △N1287(13032)::PgapA_pntAB strain were cultured using the L-threonine production flask medium and culture method of Example 3-1, and after the end of culture, the production amount of L-threonine was measured by HPLC and is shown in Table 10.

[0292] L-threonine production of strains introducing the 289 amino acid variant pntAB strain Threonine production (g / L) Percentage of concentration relative to parent strain (%) CA09-0903△N1287(13032)::PgapA_pntAB 5.6 100 CA09-0903△N1287(13032)::PgapA_pntAB(S289A) 5.9 105 CA09-0903△N1287(13032)::PgapA_pntAB(S289C) 5.7 102 CA09-0903△N1287(13032)::PgapA_pntAB(S289D) 5.5 98 CA09-0903△N1287(13032)::PgapA_pntAB(S289E) 5.4 96 CA09-0903△N1287(13032)::PgapA_pntAB(S289F) 1.6 29 CA09-0903△N1287(13032)::PgapA_pntAB(S289G) 5.3 95 CA09-0903△N1287(13032)::PgapA_pntAB(S289H) 2.8 50 CA09-0903△N1287(13032)::PgapA_pntAB(S289I) 5.7 102 CA09-0903△N1287(13032)::PgapA_pntAB(S289K) 5.3 95 CA09-0903△N1287(13032)::PgapA_pntAB(S289L) 1.4 25 CA09-0903△N1287(13032)::PgapA_pntAB(S289M) 5.8 104 CA09-0903△N1287(13032)::PgapA_pntAB(S289N) 5.4 96 CA09-0903△N1287(13032)::PgapA_pntAB(S289P) 1.3 23 CA09-0903△N1287(13032)::PgapA_pntAB(S289Q) 1.2 21 CA09-0903△N1287(13032)::PgapA_pntAB(S289R) 1.4 25 CA09-0903△N1287(13032)::PgapA_pntAB(S289T) 5.8 104 CA09-0903△N1287(13032)::PgapA_pntAB(S289V) 1.1 20 CA09-0903△N1287(13032)::PgapA_pntAB(S289W) 1.2 21 CA09-0903△N1287(13032)::PgapA_pntAB(S289Y) 5.6 100

[0293] As shown in Table 10, strains inserted with 5 of the 19 variants of amino acid 289 of the pntB protein (S289A, S289C, S289I, S289M, S289T) showed improved fermentation yield compared to strains inserted with wild-type pntAB. Among them, the threonine production capacity of CA09-0903 △N1287(13032)::PgapA_pntAB(S289A), a strain expressing the pntAB (S289A) variant, was found to be the most effective, increasing by 5% compared to the wild-type pntAB strain.

[0295] From the foregoing description, those skilled in the art to which this application pertains will understand that this application may be implemented in other specific forms without altering its technical concept or essential features. In this regard, the embodiments described above should be understood as illustrative in all respects and not restrictive. The scope of this application should be interpreted as including all modifications or variations derived from the meaning and scope of the claims set forth below and their equivalents, rather than from the detailed description above.

Claims

Claim 1 A nicotinamide nucleotide transhydrogenase beta-subunit variant polypeptide in which the amino acid corresponding to the 289th position of SEQ ID NO. 11 is substituted with alanine; cysteine; isoleucine; methionine; or threonine. Claim 2 In claim 1, the variant polypeptide is a variant polypeptide composed of the amino acid sequence of SEQ ID NO. 74, SEQ ID NO. 76, SEQ ID NO. 78, SEQ ID NO. 80, or SEQ ID NO.

82. Claim 3 Nicotinamide nucleotide transhydrogenase comprising a variant polypeptide of any one of claims 1 to 2. Claim 4 A polynucleotide encoding a variant polypeptide of any one of claims 1 to 2. Claim 5 A microorganism comprising a variant polypeptide of any one of claims 1 to 2; and one or more selected from a polynucleotide encoding said variant polypeptide. Claim 6 In paragraph 5, the microorganism is a microorganism of the genus Corynebacterium. Claim 7 In paragraph 6, the microorganism of the genus Corynebacterium is Corynebacterium glutamicum. Claim 8 In claim 6, the microorganism is a microorganism having an increased ability to produce L-amino acids or derivatives compared to a microorganism comprising the polypeptide of SEQ ID NO. 11 or a polynucleotide encoding the same. Claim 9 A microorganism according to claim 8, wherein the L-amino acid or its derivative is L-threonine, L-arginine, or L-homoserine. Claim 10 A method for producing L-amino acid, comprising the step of culturing the microorganism of claim 5 in a culture medium. Claim 11 A method according to claim 10, further comprising the step of recovering L-amino acids from the cultured microorganism; the culture of the microorganism; the fermented product of the microorganism; or the medium. Claim 12 In claim 11, the method wherein the L-amino acid is L-threonine or L-arginine. Claim 13 A method for producing an L-amino acid derivative, comprising the step of culturing the microorganism of claim 5 in a culture medium. Claim 14 A method according to claim 13, further comprising the step of recovering an L-amino acid derivative from the cultured microorganism; the culture of the microorganism; the fermented product of the microorganism; or the medium. Claim 15 In paragraph 14, the method wherein the L-amino acid derivative is L-homoserine.