Method for gene editing of tomato using novel recombinant vector

Abstract

The present invention relates to a gene editing method for tomatoes, and more specifically, to a gene editing method for tomatoes that has high gene editing efficiency and can simultaneously and rapidly produce individuals with multiple target genes edited, by comprising the steps of: preparing a first recombinant vector comprising a promoter that specifically induces expression in stem apical meristematic tissue and germ cells, and a gene encoding a Cas9 protein operably linked to said promoter; preparing a second recombinant vector comprising the nucleotide sequence of SEQ ID NO. 3; preparing a tomato transformant using said first recombinant vector; and injecting the second recombinant vector into said tomato transformant.

Description

Technology Field

[0001] The present invention relates to a method for gene editing of tomatoes using a novel recombinant vector. Background Technology

[0003] As a high-value global vegetable crop, the importance of tomatoes is gradually increasing domestically; however, due to the lack of development of superior varieties, there is a high dependence on imported varieties.

[0004] There is a need to develop superior new tomato varieties that can reduce the economic burden on domestic farmers caused by royalty payments for imported seeds and promote exports.

[0005] Tomatoes are a crop for which new varieties can be developed using the CRISPR / Cas9 system, as their genome sequences have been elucidated and, although there are variations depending on the lineage, technology for producing transgenic plants has been developed to some extent.

[0006] However, conventional tomato gene editing methods have the problem of being time-consuming and inefficient, resulting in a low proportion of individuals with the target gene actually edited.

[0007] Meanwhile, Professor Dinesh-Kumar of UC Davis published a gene editing method in 2015 that applies the existing virus-induced gene silencing (VIGS) system. This method first requires the production of tobacco transformants expressing the Cas9 enzyme, and is designed so that the pea early browning virus (PEBV) promoter in the TRV RNA2 construct induces the expression of sgRNA of the target gene. The approach involves simultaneously agroinfiltrating the cotyledons of Cas9-expressing tobacco with TRV RNA1 and RNA2 containing PEBV::sgRNA to select seeds in which the gene targeted by the sgRNA has been edited. However, attempts to edit the genome of tomatoes by applying this system as is failed to yield successful results for various reasons.

[0008] Accordingly, the inventors of the present invention completed the present invention as a result of diligent research to develop a tomato gene editing vector utilizing the VIGS system and a method for gene editing tomatoes using the same. Prior art literature

[0010] Efficient virus-mediated genome editing in plants using the CRISPR / Cas9 system (2015) Molecular Plants 8: pages 1288-1291 The problem to be solved

[0011] The present invention aims to provide a gene editing vector having a promoter capable of promoting Cas9 gene expression in the stem apical meristematic tissue and germ cells of a tomato, and a selection marker capable of increasing the efficiency of producing tomato transformants.

[0012] The present invention aims to provide a vector capable of efficiently delivering the sgRNA base sequence of a target gene to a Cas9 expression site (stem apical meristematic tissue).

[0013] The present invention aims to provide an efficient method for gene editing of tomatoes. means of solving the problem

[0015] 1. A method for gene editing of a tomato, comprising: a step of preparing a first recombinant vector comprising a promoter that induces expression in stem apical meristem and germ cells and a gene encoding a Cas9 protein operably linked to the promoter; a step of preparing a second recombinant vector comprising the nucleotide sequence of SEQ ID NO. 3; a step of preparing a tomato transformant using the first recombinant vector; and a step of injecting the second recombinant vector into the tomato transformant.

[0016] 2. The gene editing method according to 1 above, wherein the promoter has the nucleotide sequence of SEQ ID NO. 1.

[0017] 3. In the above 1, the first recombinant vector is a gene editing method further comprising a kanamycin resistance gene.

[0018] 4. A gene editing method in which the kanamycin resistance gene in 3 above is the NPT II gene.

[0019] 5. A gene editing method according to 1 above, wherein the first recombinant vector is pKNTU10 / Kn consisting of the full-length nucleotide sequence of SEQ ID NO. 2.

[0020] 6. In the above 1, the second recombinant vector is a gene editing method having the nucleotide sequence of SEQ ID NO. 4.

[0021] 7. A gene editing method according to 1 above, wherein the step of injecting a second recombinant vector into a tomato transformant is performed by agroinfiltration.

[0022] 8. A gene editing composition comprising a vector comprising a promoter having the nucleotide sequence of SEQ ID NO. 1, a gene encoding a Cas9 protein operably linked to said promoter, and an NPT II gene as a selection marker.

[0023] 9. In the above 8, the vector is a gene editing composition pKNTU10 / Kn consisting of the full-length nucleotide sequence of SEQ ID NO. 2. Effects of the invention

[0025] The gene editing method for tomatoes according to the present invention has high gene editing efficiency.

[0026] The gene editing method for tomatoes according to the present invention enables the simultaneous and rapid production of individuals in which multiple target genes have been edited.

[0027] By using the gene editing method for tomatoes of the present invention, gene-edited seeds can be obtained, thereby enabling the edited nucleotide sequence to be inherited by the next generation.

[0028] The tomato gene editing method of the present invention can be very usefully utilized to rapidly and economically breed useful new varieties from various tomato lines. Brief explanation of the drawing

[0030] Figure 1 shows an agarose gel photograph showing a primer set used to isolate a promoter (SlUbi10) that induces expression in stem apical meristem and germ cells from tomato genome DNA according to one embodiment of the present invention, and an amplified PCR product. Figure 2 shows a map of the recombination vector pBI101.3-TU10 according to one embodiment of the present invention. Figure 3 shows the results of a histochemical GUS assay performed to confirm whether SlUbi10 has promoter activity in plants according to one embodiment of the present invention. Figure 4 shows the process of manufacturing a recombinant vector pKNTU10 / Kn according to one embodiment of the present invention. Figure 5 shows the process of transforming a tomato with a recombinant vector pKNTU10 / Kn according to one embodiment of the present invention. Figure 6 shows the results of extracting genomic DNA from a tomato transformant prepared according to one embodiment of the present invention and investigating whether the NPTII gene was inserted by PCR. Figure 7 shows the results of confirming Cas9 mRNA expression in a tomato transformant prepared according to one embodiment of the present invention. FIG. 8 shows a map of the recombinant vector pUC-gRNA:SlmFT and its nucleotide sequence according to one embodiment of the present invention. FIG. 9 shows a map of the recombinant vector pUC-gRNA:mFT and its nucleotide sequence according to one embodiment of the present invention. FIG. 10 shows a map of the recombination vector pTRV2.PEBV:SlPDS-t2-SlmFT according to one embodiment of the present invention. FIG. 11 shows a map of the recombination vector pTRV2.PEBV:SlPDS-t2-mFT according to one embodiment of the present invention. Figure 12 shows the results of observing tomato seedlings injected with SlPDS-t2-SlmFT sgRNA. Figure 13 shows the results of observing tomato seedlings injected with SlPDS-t2-mFT sgRNA. Figure 14 shows the primer sequences used for PCR amplification for deep sequencing analysis of the target site. Figure 15 shows the PCR amplification results for deep sequencing analysis of the target site. Figure 16 shows a table summarizing the frequency of indel occurrence in tomato individuals according to the targeted gene editing experiment. Figure 17 shows the results of the indel pattern analysis of the tomato individuals with the highest frequency of indel occurrence according to the targeted gene editing experiment. Figure 18 shows the yellowing phenomenon observed in tomato individuals 2 and 3 injected with SlPDS-t2-SlmFT sgRNA. Figure 19 shows the results of confirming the phenotype of seeds obtained from tomato individual 2 injected with SlPDS-t2-SlmFT sgRNA and SIPDS base deletion. Figure 20 shows the results of confirming the phenotype of seeds obtained from tomato individual 3 injected with SlPDS-t2-SlmFT sgRNA and SIPDS base deletion. Specific details for implementing the invention

[0031] The present invention provides a method for gene editing of tomatoes.

[0032] In this specification, the term "gene editing" refers to a technology capable of introducing targeted mutations into the genomic base sequences of animal and plant cells, and means a technology capable of knocking out or knocking in specific genes by deletion, insertion, substitution, etc., of one or more nucleic acid molecules through DNA cutting, or introducing mutations into non-coding DNA sequences that do not produce proteins. The gene editing of the present invention may, in particular, introduce mutations into a plant body using an endonuclease, such as the Cas9 (CRISPR associated protein 9) protein and gRNA. In the present invention, "gene editing" may be used interchangeably with "transformation."

[0033] In the present invention, "target gene" refers to a portion of DNA within the genome of a plant to be edited through the present invention, and is not limited to the type of gene and may include both coding and non-coding regions. A person skilled in the art may select a target gene according to a desired variation for a genome-edited plant to be manufactured, depending on the purpose.

[0034] The present invention provides a method for gene editing of a tomato, comprising the steps of: preparing a first recombinant vector comprising a promoter that specifically induces expression in stem apical meristems and germ cells and a gene encoding a Cas9 protein operably linked to the promoter; preparing a second recombinant vector comprising the nucleotide sequence of SEQ ID NO. 3; preparing a tomato transformant using the first recombinant vector; and injecting the second recombinant vector into the tomato transformant.

[0035] In the present invention, the first recombinant vector refers to a vector for plant transformation capable of promoting Cas9 gene expression in the shoot apical meristem and germ cells (sperm and egg) of a tomato.

[0036] In the present invention, the first recombinant vector comprises a promoter that induces expression in stem apical meristems and germ cells, and a gene encoding a Cas9 protein operably linked to said promoter.

[0037] Promoters that induce expression in stem apical meristems and germ cells may include, but are not limited to, the 5' upstream region of the tomato ubiquitin 10 (SlUbi10; Gene ID: LOC101248251) gene, the 5' upstream region of the tomato ribosomal protein S5 A2 (SlRPS5A2: Gene ID: Solyc11g042610) gene and the 5' upstream region of the tomato ribosomal protein L8 (SlRPL8: Gene ID: Solyc10g006580.3) gene.

[0038] In one embodiment, the promoter that induces expression in stem apical meristem and germ cells may be the SlUbi10 gene.

[0039] In one embodiment, the promoter that induces expression in stem apical meristem and germ cells may be composed of the nucleotide sequence of SEQ ID NO. 1.

[0040] The Cas9 protein of the present invention may be a Cas9 protein derived from Streptococcus pyogenes, a Cas9 protein derived from Campylobacter jejuni, a Cas9 protein derived from Streptococcus thermophilus or Streptococcus aureus, a Cas9 protein derived from Neisseria meningitidis, a Cas9 protein derived from Pasteurella multocida, a Cas9 protein derived from Francisella novicida, etc., but is not limited thereto. Cas9 proteins or genetic information thereof can be obtained from known databases such as GenBank of the NCBI (National Center for Biotechnology Information). The above Cas9 gene information may use the known sequence as is, or may use a sequence optimized for the codon of the target (organism) to be transfected.

[0041] Cas9 protein is an RNA-guided DNA endonuclease enzyme that induces double-stranded DNA breaks. For Cas9 protein to accurately bind to a target sequence and cut a DNA strand, a short sequence of three bases known as a Protospacer Adjacent Motif (PAM) must be present next to the target sequence, and Cas9 protein cuts by estimating the interval between the 3rd and 4th base pairs from the PAM sequence (NGG).

[0042] In the present invention, the first recombinant vector can increase the efficiency of producing tomato transformants by further including an antibiotic resistance gene as a selection marker in addition to a gene encoding a Cas9 protein operably linked to a promoter that induces expression in stem apical meristematic tissue and germ cells.

[0043] In one embodiment, the first recombinant vector may include a kanamycin resistance gene as a selection marker.

[0044] In one embodiment, the first recombinant vector may include the NPT II gene as a selection marker.

[0045] In one embodiment, the first recombinant vector may be pKNTU10 / Kn consisting of the full-length nucleotide sequence of SEQ ID NO. 2.

[0046] In the present invention, the second recombinant vector is a means to efficiently deliver the gRNA base sequence of a target gene to stem apical meristematic tissue or germ cells where the Cas9 enzyme is expressed.

[0047] In the present invention, "gRNA (guide RNA)" refers to a short single-stranded RNA that is specific to the target DNA among the base sequences encoding a target gene, and refers to a ribonucleic acid that binds wholly or partially to the target DNA base sequence to guide an endonuclease protein to the corresponding target DNA base sequence.

[0048] In the present invention, the gRNA may be in the form of a single guide RNA (sgRNA) comprising a first region containing a sequence that is wholly or partially complementary to a base sequence within a target gene and a second region containing a sequence that interacts with an endonuclease (particularly, an RNA-guide nuclease). However, any form capable of having activity at the target base sequence may be included within the scope of the present invention without limitation, and may be prepared and used according to known techniques in the art, taking into account the type of endonuclease used together or the microorganism from which the endonuclease originates. The endonuclease protein may be Cas9 (CRISPR-associated protein 9).

[0049] In the present invention, the second recombinant vector comprises the nucleotide sequence of SEQ ID NO. 3.

[0050] In the present invention, the second recombinant vector may include the nucleotide sequence of SEQ ID NO. 4.

[0051] The gene editing method for tomatoes according to the present invention produces a Cas9-expressing transformant through the step of producing a tomato transformant using a first recombinant vector.

[0052] The gene editing method for tomatoes according to the present invention includes the step of injecting a second recombinant vector into a Cas9-expressing transformant.

[0053] In the gene editing method for tomatoes according to the present invention, the steps of preparing a tomato transgenic organism using a first recombinant vector and injecting a second recombinant vector into the tomato transgenic organism are the calcium / polyethylene glycol method for protoplasts (Krens et al., 1982, Nature 296: 72-74; Negrutiu et al., 1987, Plant Mol. Biol. 8: 363-373), electroporation of protoplasts (Shillito et al., 1985, Bio / Technol. 3: 1099-1102), microinjection into plant elements (Crossway et al., 1986, Mol. Gen. Genet. 202: 179-185), particle impaction of various plant elements (DNA or RNA-coated) (Klein et al., 1987, Nature 327: 70), and by plant infiltration or transformation of mature pollen or microspores. It can be suitably selected from Agrobacterium tumefaciens-mediated gene transfer (incomplete) and viral infection (EP 0 301 316).

[0055] The present invention will be explained in detail below through examples. However, the following examples are merely illustrative of the present invention, and the scope of the present invention is not limited to the following examples.

[0057] Examples

[0058] 1. Preparation of the recombinant vector pKNTU10 / Kn for Cas9 expression in meristematic tissues and germ cells of tomato plants

[0059] To induce Cas9 expression in the stem apical meristem and germ cells of tomatoes, the 5' upstream region (2,148 bp, SEQ ID NO. 1) of the tomato ubiquitin 10 (SlUbi10; Gene ID: LOC101248251) gene was isolated from the genomic DNA of the tomato Moneymaker line by PCR using the primer set of SEQ ID NOs. 5 and 6. The nucleotide sequence of the obtained PCR product was determined, and the amplification of the expected DNA region was confirmed via an agarose gel (Fig. 1). To investigate whether the isolated DNA fragment actually possesses promoter activity in plants, it was treated with SalI / XmaI restriction enzymes and cloned into the plant transformation vector pBI101.3 to construct the pBI101.3-TU10 recombinant vector as shown in Fig. 2. In Fig. 2, RB and LB represent the nucleotide sequences of the right and left boundary of the T-DNA. Arabidopsis thaliana transformants in which the T-DNA region of the pBI101.3-TU10 vector was inserted into the chromosome were obtained using the floral dipping method with the Agrobacterium GV3101 strain, and a histochemical GUS assay was performed to confirm that the cloned DNA region (SlUBI10) has promoter activity in plants (Fig. 3). In particular, high levels of GUS expression were observed in the stem apex, pistil, and stamen regions.

[0060] To construct Cas9-expressing tomato transformants using the obtained SlUBI10 promoter region, the pKNTU10 / Kn vector was constructed based on Professor Dinesh-Kumar's pSPDK3257 vector (Fig. 4). Briefly, the pKNTU10 vector was first constructed by replacing the Arabidopsis promoter region of the pSPDK3257 vector with a PCR product (2,148 bp) amplified by the primer set of SlUBI10-pro2-XmaI-F (Sequence No. 7) and SlUBI10-pro-Avr2-R (Sequence No. 8). Then, the 35S::BAR region was cleaved with the EcoRI / KpnI restriction enzyme and replaced with the NOS::NPTII DNA fragment to complete the pKNTU10 / Kn vector, which is capable of selecting kanamycin (Kn)-resistant transformants. The NOS::NPTII chimeric gene was PCR amplified using the pBI121 vector as a template and the Nos-pro-EcoR1-F (Sequence No. 9) and NPT2-Kpn1-R (Sequence No. 10) primer set.

[0062] 2. Preparation of Cas9-expressing tomato transformants using the pKNTU10 / Kn vector

[0063] The pKNTU10 / Kn vector prepared in Example 1 was introduced into the Agrobacterium strain LBA4404, and transformation was performed on commercially viable tomato lines (Saladette paternal line) using a previously known method (Shah et al. 2015. The Journal of Animal & Plant Sciences 25: 528-538). Figure 5 illustrates the process of preparing transformants. Genomic DNA was extracted from the obtained tomato transformants, and the presence of NPTII gene insertion was investigated by PCR using the NPTII-F (SEQ No. 11) and NPTII-R (SEQ No. 12) primer sets; as shown in Figure 6, four lines of transformants were obtained. In Figure 6, WT represents the genomic DNA of the Saladette paternal line, and C indicates that the pKNTU10 / Kn vector was used as the template. Total RNA was isolated from these plants, and quantitative real-time RT-PCR analysis was performed to confirm Cas9 mRNA expression and determine the differences in relative expression levels among individuals (Fig. 7). The mRNA expression level of the tomato TIP41 gene was used as an internal control. Transformer No. 3 showed the highest level of Cas9 expression. The primer sequences used are as follows: SlTIP41-RT-F (Sequence No. 13), SlTIP41-RT-R (Sequence No. 14), Cas9-RT-F2 (Sequence No. 15), and Cas9-RT-R2 (Sequence No. 16).

[0065] 3. Construction of a pUC-gRNA:SlmFT vector possessing a mobile gRNA scaffold

[0066] Arabidopsis thaliana Flowering Locus T(FT) Gene mRNA is expressed in the leaf veins, moves to the shoot apical meristem at the stem apex, and promotes flower formation. According to a recently published paper (Nature Plants, 2020), Arabidopsis thaliana FTAttaching a portion of a gene to the 3' end of sgRNA has the effect of increasing the efficiency of the TRV-mediated gene editing system in tobacco. Through comparative genomic analysis, the inventors found that Arabidopsis thaliana also affects tomatoes. FT A gene similar to (Solyc03g063100.2.1; SlFT It was discovered that (named as) exists, and intended to utilize this discovery in the tomato VIGE system SlFT A pUC-gRNA:SlmFT vector (Sequence No. 4) containing a gRNA:SlmFT sequence (Sequence No. 3) was developed using a portion of the gene (Fig. 8). A pUC-gRNA:mFT vector (Fig. 9) was also constructed using the nucleotide sequence of the Arabidopsis FT gene, which has been reported to be effective in tobacco, and was used to compare and analyze the tomato genome editing efficiency between the two vectors.

[0068] 4. Targeted Gene Editing

[0069] To examine the efficiency of the VIGE system established by the inventors in Saladette paternal plants, tomato phytoene desaturase was used as a target gene ( SlPDS ) A gene was selected and an experiment was performed. SlPDS When an indel mutation occurs in a gene, photobleaching appears in the resulting leaves, which has the advantage of allowing the results of gene editing to be easily identified with the naked eye. SlPDS First, an sgRNA sequence targeting the gene (t2: GATGGAGATTGGTACGAGAC, sequence number 9) was selected, and using this sequence, the pTRV2.PEBV:SlPDS-t2-SlmFT construct (Fig. 10) and the pTRV2.PEBV:SlPDS-t2-mFT construct (Fig. 11) were constructed. These constructs were each injected into the cotyledons of 14 Cas9-expressing tomato plants using the agroinfiltration method.

[0071] 5. Results

[0072] Interestingly, chlorosis was not observed in tomato seedlings injected with SlPDS-t2-mFT sgRNA; however, in the case of SlPDS-t2-SlmFT sgRNA, tomato leaves exhibiting chlorosis were produced in eight individuals, varying in degree (Figs. 12 and 13). To confirm the presence of targeted gene editing via targeted deep sequencing analysis, genomic DNA was extracted from these leaves using the CTAB method, and PCR was performed in three stages using the primers (sequence numbers 17 to 30) shown in Fig. 14. The results are presented in Fig. 15. The final PCR products were purified and sent to the KAIST Biocore Center at a concentration of 10 ng / μL per sample for Illumina sequencing. NGS analysis revealed that in individuals without the chlorosis phenotype, the results were not different from WT; however, in individuals exhibiting the phenotype, the results occurred with a frequency of approximately 20–71% SlPDS It was confirmed that indel mutations occurred in the genes (Figs. 16 and 17). In the case of Tomato individuals SlPDS-t2-SlmFT No. 2 (70.9%) and No. 3 (52.3%), which had a high frequency of indels, leaves, flowers, and fruits of different colors from the WT were observed (Fig. 18). In particular, seeds obtained from individual No. 2 showed a 100% chlorosis phenotype, and sequencing analysis of the genomic DNA extracted from these plants confirmed that a 'GA' base deletion occurred in the SlPDS target site (Fig. 19). Additionally, seeds from individual No. 3 showed a chlorosis phenotype in about 50% of cases, and an 'ACGAG' base deletion was confirmed (Fig. 20). These experimental results indicate that the VIGE system established by the inventors efficiently performs gene editing in tomatoes. Therefore, the present invention will be very useful for the future development of new tomato varieties.

Claims

Claim 1 A method for gene editing of a tomato, comprising: a step of preparing a first recombinant vector comprising a promoter having a nucleotide sequence of SEQ ID NO. 1 that induces expression in stem apical meristem and germ cells, and a gene encoding a Cas9 protein operably linked to said promoter; a step of preparing a second recombinant vector comprising a nucleotide sequence of SEQ ID NO. 3; a step of preparing a tomato transformant using said first recombinant vector; and a step of injecting said second recombinant vector into said tomato transformant. Claim 2 delete Claim 3 A gene editing method according to claim 1, wherein the first recombinant vector further comprises a kanamycin resistance gene. Claim 4 A gene editing method according to claim 3, wherein the kanamycin resistance gene is the NPT II gene. Claim 5 A gene editing method according to claim 1, wherein the first recombinant vector is pKNTU10 / Kn consisting of the full-length nucleotide sequence of SEQ ID NO.

2. Claim 6 The gene editing method according to claim 1, wherein the second recombinant vector has the nucleotide sequence of SEQ ID NO.

4. Claim 7 A gene editing method according to claim 1, wherein the step of injecting a second recombinant vector into the tomato transformant is performed by agroinfiltration. Claim 8 delete Claim 9 delete

Images