Recombinant strain for producing L-glutamic acid by modifying gene BBD29_11265, method of composition thereof, and application

Abstract

The present invention discloses a recombinant strain for producing L-glutamic acid by modifying the gene BBD29_11265, a method for configuring the same, and an application thereof. The recombinant strain is a bacterium that produces L-glutamic acid with improved expression of a polynucleotide encoding the amino acid sequence indicated in SEQ ID NO:3 or a sequence homologous thereto. The improved expression may be due to the presence of a point mutation in the polynucleotide encoding the amino acid sequence indicated in SEQ ID NO:3 or a sequence homologous thereto. The present invention comprises a genetically engineered bacterium in which the base at the 70th site of the BBD29_11265 gene sequence is mutated from guanine to adenine, and the alanine at the 24th site of the corresponding amino acid sequence is substituted with threonine, and an engineered bacterium advantageous for improving the production and conversion rate of L-glutamic acid by overexpressing the BBD29_11265 gene or the BBD29_11265G70A gene.

Description

Technology Field

[0001] The present invention belongs to the field of genetic engineering and microbial technology, and in particular relates to a recombinant strain that produces L-glutamic acid, a method of configuring the same, and its application. Background Technology

[0002] L-glutamic acid is an important amino acid applied in food, clinical medicine, and other fields. Traditionally, L-glutamic acid is produced by fermenting L-glutamic acid-producing bacteria or their mutants, mainly belonging to genera such as Curtobacterium, Corynebacterium, or Microbacterium.

[0003] L-glutamic acid is biosynthesized in microbial cells from α-ketoglutarate, an intermediate of the citric acid cycle. There are two biosynthetic pathways for forming L-glutamic acid from α-ketoglutarate through the anabolic action of ammonium ions. One pathway involves the synthesis of L-glutamic acid via the catalysis of glutamate dehydrogenase (GDH) in the presence of high concentrations of ammonium ions. The other pathway (the GS / GOGAT pathway) involves the synthesis of L-glutamic acid by glutamine synthetase and glutamine-oxoglutarate aminotransferase. Glutamine synthetase (GS) catalyzes the conversion of L-glutamic acid and ammonium ions into glutamine. Glutamine-oxoglutaric acid amino transferase, also known as glutamine synthase (GOGAT), catalyzes the synthesis of L-glutamic acid. In this reaction, there are two molecules of L-glutamic acid synthesized from one molecule of glutamine already synthesized by GS and one molecule of α-ketoglutaric acid.

[0004] Improvements to fermentation methods for L-amino acid production may be related to fermentation techniques such as stirring and oxygen supply, the composition of the nutrient medium such as sugar concentration during the fermentation process, processing the fermentation liquid into a suitable product form such as drying and pelletizing the liquid or ion exchange chromatography, or the inherent performance characteristics of the microorganisms themselves.

[0005] Methods to improve the performance characteristics of these microorganisms include mutagenesis, mutant selection, and screening. Strains obtained through these methods are resistant to metabolites, nutrient-deficient in metabolites of regulatory importance, and produce L-amino acids. Although there are many methods to increase the production capacity of L-glutamic acid, it is still necessary to advance methods for producing L-glutamic acid to meet the ever-increasing demand.

[0006] The present invention aims to provide a method for efficiently producing L-glutamic acid by developing a new technology to improve the L-glutamic acid production ability of bacteria.

[0007] To achieve the aforementioned objective, the inventors of the present invention discovered through research that the bacterial BBD29_11265 gene or its homologous gene can improve the ability of bacteria to produce L-glutamic acid by modifying said gene or improving its expression. Based on this discovery, the present invention was completed.

[0008] The present invention provides a bacterium that produces L-glutamic acid with improved expression of a polynucleotide encoding the amino acid sequence of SEQ ID NO: 3 (sequence 3 of the sequence list) or a homologous sequence thereof. The present invention also provides a method for producing L-glutamic acid using said microorganism.

[0009] One aspect of the present invention provides a bacterium that produces L-glutamic acid with improved expression of a polynucleotide comprising an amino acid sequence of SEQ ID NO: 3 or a homologous sequence thereof. According to the present invention, the improved expression is characterized by the expression of the polynucleotide being enhanced, or having a point mutation in the polynucleotide encoding the amino acid sequence of SEQ ID NO: 3 or a homologous sequence thereof, or having a point mutation in the polynucleotide encoding the amino acid sequence of SEQ ID NO: 3 or a homologous sequence thereof, thereby enhancing the expression.

[0010] The amino acid sequence of SEQ ID NO: 3 above or its homologous sequence is a protein encoded by the BBD29_11265 gene or its homologous gene.

[0011] The above bacteria have a strong ability to produce L-glutamic acid compared to the unmodified strain.

[0012] In the present invention, the term "bacteria having the ability to produce L-glutamic acid" refers to bacteria having the ability to produce and accumulate the target L-glutamic acid in the medium and / or within the bacterial cells to the extent that L-glutamic acid can be collected when the bacteria are cultured in the medium. Bacteria having the ability to produce L-glutamic acid may be bacteria capable of accumulating the target L-glutamic acid in the medium and / or within the bacterial cells in an amount greater than that obtainable from an unmodified strain.

[0013] The term "unmodified strain" refers to a control strain that has not yet been modified to possess specific characteristics. In other words, examples of unmodified strains include wild-type strains and maternal strains.

[0014] Bacteria capable of producing L-glutamic acid may preferably be bacteria capable of accumulating the target L-glutamic acid in an amount of 0.5 g / L or more, more preferably 1.0 g / L or more in the medium.

[0015] In the present invention, unless otherwise specified, the term "L-glutamic acid" refers to L-glutamic acid in free form, a salt thereof, or a mixture thereof.

[0016] The above polynucleotide may encode an amino acid sequence having at least about 90%, at least about 92%, at least about 95%, at least about 97%, at least about 98%, or at least about 99% sequence homology with the amino acid sequence of SEQ ID NO: 3. As used herein, the term “homology” means percentage identity between two polynucleotides or two polypeptide modules. Sequence homology between one module and another module can be measured using methods known in the art. For example, such sequence homology can be measured by the BLAST algorithm.

[0017] The expression of polynucleotides can be enhanced by substitution or mutation of the expression regulatory sequence, introduction of mutations into the polynucleotide sequence, increasing the number of copies of the polynucleotide through chromosomal insertion or vector introduction, or a combination thereof.

[0018] The expression regulatory sequence of the polynucleotide may be modified. The expression regulatory sequence controls the expression of the polynucleotide operably linked thereto and may include, for example, a promoter, terminator, enhancer, and silencer. The polynucleotide may have a modified start codon. The polynucleotide may be incorporated into a specific region of a chromosome to increase the copy number. In this specification, the specific region may include a transposon region or an intergene region. Additionally, the polynucleotide may be incorporated into an expression vector and said expression vector introduced into a host cell to increase the copy number.

[0019] In one embodiment of the present invention, the number of copies is increased by incorporating a polynucleotide or a polynucleotide having a point mutation in a specific region of a microbial chromosome.

[0020] In one embodiment of the present invention, the nucleic acid sequence is overexpressed by incorporating a polynucleotide having a promoter sequence or a polynucleotide having a point mutation having a promoter sequence into a specific region of a microbial chromosome.

[0021] In one embodiment of the present invention, a polynucleotide or a polynucleotide having a point mutation is incorporated into an expression vector, and said expression vector is introduced into a host cell to increase the copy number.

[0022] In one embodiment of the present invention, a polynucleotide having a promoter sequence or a polynucleotide having a point mutation having a promoter sequence is incorporated into an expression vector, and said expression vector is introduced into a host cell to overexpress said amino acid sequence.

[0023] In a specific embodiment of the present invention, the polynucleotide may include the nucleotide sequence of SEQ ID NO: 1.

[0024] In one embodiment of the present invention, the polynucleotide encoding the amino acid sequence of SEQ ID NO: 3 is the 24th region of the amino acid sequence of SEQ ID NO: 3.

[0025] There is a point mutation in which alanine is replaced by another amino acid.

[0026] According to the present invention, it is preferable that the alanine at the 24th site be replaced with threonine.

[0027] The amino acid sequence after substituting alanine at the 24th site with threonine in the amino acid sequence shown in SEQ ID NO: 3 according to the present invention is as shown in SEQ ID NO: 4.

[0028] In one embodiment of the present invention, the polynucleotide sequence having the point mutation is formed by a mutation occurring in the base of the 70th site of the polynucleotide sequence indicated in SEQ ID NO: 1.

[0029] According to the present invention, the mutation comprises a mutation in which the base at the 70th site of the polynucleotide sequence indicated in SEQ ID NO: 1 is changed from guanine (G) to adenine (A).

[0030] In one embodiment of the present invention, the polynucleotide sequence having the point mutation comprises the polynucleotide sequence indicated in SEQ ID NO: 2.

[0031] As used herein, the term “operable link” refers to a functional link between a regulatory sequence and a polynucleotide sequence, whereby the regulatory sequence controls the transcription and / or translation of the polynucleotide sequence. The regulatory sequence may be a strong promoter capable of increasing the expression level of the polynucleotide. The regulatory sequence may be a promoter derived from a microorganism belonging to the genus Corynebacterium or a promoter derived from another microorganism. For example, the promoter may be a trc promoter, a gap promoter, a tac promoter, a T7 promoter, a lac promoter, a trp promoter, an araBAD promoter, or a cj7 promoter.

[0032] In a specific embodiment of the present invention, the promoter is a polynucleotide (BBD29_11265 gene) promoter encoding the amino acid sequence of SEQ ID NO: 3.

[0033] As used herein, the term “vector” refers to a polynucleotide structure comprising a gene regulation and gene sequence configured to express a target gene in a suitable host cell. Alternatively, a vector may refer to a polynucleotide structure comprising a sequence that can be used for homologous recombination to allow the insertion of a target gene into a specific region of the host genome, such that the regulatory sequence of an endogenous gene within the host cell genome may be altered or expressed as a result of introducing the vector into the host cell. In this regard, the vector used in the present invention may further include a selection marker for determining whether to introduce the vector into a host cell or to insert the vector into the chromosome of the host cell. The selection marker may include a marker that confers selectable phenotypes, such as drug resistance, nutrient deficiency type, resistance to cytotoxic substances, or expression of surface proteins. Transformed cells may be selected because, in an environment treated with such selective agents, cells expressing only the selection marker may survive or exhibit other phenotypic characteristics. The vectors described herein are known to those skilled in the art and include, but are not limited to, plasmids, phages (e.g., gamma phages or M13 filament phages, etc.), mucosal vectors (i.e., cos plasmids), or viral vectors.

[0034] The vectors used in some specific embodiments of the present invention are pK18mobsacB plasmid and pXMJ19 plasmid.

[0035] As used herein, the term “transformation” refers to introducing a polynucleotide into a host cell so that the polynucleotide can be replicated as an extragenomic component or inserted into the host cell’s genome. Methods for transforming the vector used in the present invention may include methods for introducing nucleic acids into cells. Alternatively, as disclosed in the related art, an electrical pulse method may be performed depending on the host cell.

[0036] In this specification, the microorganism may be yeast, bacteria, algae, or fungi.

[0037] According to the present invention, the bacteria are Corynebacterium acetoacidophilum ( Corynebacterium acetoacidophilum ), Corynebacterium acetoglutamicum ( Corynebacterium acetoglutamicum ), Corynebacterium calunae( Corynebacterium callunae ), Corynebacterium glutamicum ( Corynebacterium glutamicum ), Brevibacterium flavum ( Brevibacterium flavum ), Brevibacterium lactofermentum( Brevibacterium lactofermentum ), Corynebacterium ammoniagenes( Corynebacterium ammoniagenes ), Corynebacterium pekinens ( Corynebacterium pekinense ), Brevibacterium saccharolyticum ( Brevibacterium saccharolyticum ), Brevibacterium roseum( Brevibacterium roseum ) Brevibacterium thiogenitalis( Brevibacterium thiogenitalis It may be a microorganism belonging to the genus Corynebacterium, such as ).

[0038] In one embodiment of the present invention, the microorganism belonging to the genus Corynebacterium is Corynebacterium glutamicum ATCC 13869.

[0039] In one embodiment of the present invention, the microorganism belonging to the genus Glutamicum is Corynebacterium glutamicum YPGLU001, and this bacterium has a high glutamic acid production amount, and the preservation information is as follows. The strain name is Corynebacterium glutamicum, the Latin name is Corynebacterium glutamicum, the strain number is YPGLU001, the storage institution is the General Microbiology Center of the Chinese Microbial Strain Storage and Management Committee, the abbreviation of the storage institution is CGMCC, the address is No. 3, No. 1, Beichen West Road, Chaoyang District, Beijing, the storage date is November 23, 2020, and the registration number of the storage center is CGMCC No. 21220.

[0040] According to the present invention, the bacteria may have other improvements related to an increase in L-glutamate production that can enhance or reduce the activity of enzymes such as glutamate dehydrogenase, glutamine synthase, and glutamine ketoglutaamine aminotransferase, or the expression of genes, or allow genes to be replaced with foreign genes.

[0041] A second aspect of the present invention provides a polynucleotide sequence, an amino acid sequence encoded by the polynucleotide sequence, a recombinant vector comprising the polynucleotide sequence, and a recombinant strain comprising the polynucleotide sequence.

[0042] According to the present invention, the polynucleotide sequence comprises a polynucleotide encoding a polypeptide comprising an amino acid sequence indicated in SEQ ID NO: 3, wherein the alanine at the 24th site in the sequence is substituted with another amino acid.

[0043] According to the present invention, it is preferable that the alanine at the 24th site be replaced with threonine.

[0044] According to the present invention, the amino acid sequence shown in SEQ ID NO: 3 is substituted with alanine at the 24th site as shown in SEQ ID NO: 4.

[0045] According to the present invention, a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence indicated in SEQ ID NO: 3 preferably comprises a polynucleotide sequence as indicated in SEQ ID NO: 1.

[0046] In one embodiment of the present invention, the polynucleotide sequence is formed by a mutation occurring at the base of the 70th site in the polynucleotide sequence indicated in SEQ ID NO: 1.

[0047] According to the present invention, the mutation refers to a change in a base / nucleotide of the site, and the mutation method may be selected from at least one of the following methods: mutagenic, PCR apex mutation method, and / or homologous recombination. In the present invention, it is preferable to use the PCR apex mutation method and / or homologous recombination.

[0048] According to the present invention, the mutation comprises a guanine (G) at the 70th site in the polynucleotide sequence indicated in SEQ ID NO: 1 being mutated to adenine (A).

[0049] In one embodiment of the present invention, the polynucleotide sequence comprises a polynucleotide sequence as shown in SEQ ID NO: 2.

[0050] According to the present invention, the amino acid sequence comprises the amino acid sequence as shown in SEQ ID NO: 4.

[0051] According to the present invention, the recombinant vector is constructed by introducing the polynucleotide sequence into a plasmid.

[0052] In one embodiment of the present invention, the plasmid is the pK18mobsacB plasmid.

[0053] In another embodiment of the present invention, the plasmid is the PXMJ19 plasmid.

[0054] Specifically, the polynucleotide sequence and the plasmid can be formed into a recombinant vector by a NEBuider recombination system.

[0055] According to the present invention, the recombinant strain comprises the polynucleotide sequence.

[0056] As one embodiment of the present invention, the starting bacteria of the recombinant strain is Corynebacterium glutamicum CGMCC No. 21220.

[0057] As one embodiment of the present invention, the starting bacteria of the recombinant strain is ATCC 13869.

[0058] In a third aspect of the present invention, a method for constructing a recombinant strain that produces L-glutamic acid is further provided.

[0059] According to the present invention, the method of configuration comprises the step of modifying the polynucleotide sequence of the wild-type BBD29_11265 gene as shown in SEQ ID NO: 1 in a host strain, thereby causing a mutation at the 70th base of the same to obtain a recombinant strain containing the mutated BBD29_11265 code gene.

[0060] The method of configuration according to the present invention comprises at least one of the following methods: the modification includes mutation induction, PCR apex mutation method, and / or homologous recombination.

[0061] In the method of construction according to the present invention, the mutation means that the base at the 70th site in SEQ ID NO: 1 is mutated from guanine (G) to adenine (A). Specifically, the polynucleotide sequence containing the coding gene for the mutation BBD29_11265 is as shown in SEQ ID NO: 2.

[0062] In addition, the above configuration method is,

[0063] (1) A step of modifying the nucleotide sequence to obtain a mutated BBD29_11265 gene polynucleotide sequence by causing a mutation in the base at site 70 of the wild-type BBD29_11265 gene as indicated in SEQ ID NO: 1,

[0064] (2) a step of combining the mutated polynucleotide sequence into a plasmid to form a recombinant vector, and

[0065] (3) The step of introducing the recombinant vector into a host strain to obtain a recombinant strain containing the mutated BBD29_11265 coding gene.

[0066] In the method of construction according to the present invention, step (1) is a process of constructing a point-mutated BBD29_11265 gene: according to the genome sequence of an unmodified strain, two pairs of primers P1 and P2 and P3 and P4 are synthesized to amplify the BBD29_11265 gene fragment, and a point mutation is introduced into the wild-type BBD29_11265 gene SEQ ID NO: 1 by PCR point mutation to BBD29_11265 G70A Includes the step of obtaining the point-mutated BBD29_11265 gene nucleotide sequence SEQ ID NO: 2.

[0067] In one embodiment of the present invention, the unmodified strain genome may be derived from strain ATCC13869, and its genome sequence can be obtained from the NCBI website.

[0068] In one embodiment of the present invention, the primer of step (1) is as follows:

[0069] P1: 5'CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAGCGGTGCCAGACACTGTCAAG 3' (SEQ ID NO: 5)

[0070] P2: 5' ACGATGACAA TCGTTGCGAT CCCGCCCATG 3' (SEQ ID NO: 6)

[0071] P3: 5' CATGGGCGGG ATCGCAACGA TTGTCATCGT 3' (SEQ ID NO: 7)

[0072] P4: 5' CAGCTATGACCATGATTACGAATTCGAGCTCGGTACCC CGTCAGCCCC TGACCGTTCT 3' (SEQ ID NO: 8)

[0073] In one embodiment of the present invention, the PCR amplification is performed in the following manner: pre-denaturation at 94°C for 5 minutes, denaturation at 94°C for 30 seconds, annealing at 52°C for 30 seconds, extension at 72°C for 45 seconds (30 cycles), and then over-extension at 72°C for 10 minutes.

[0074] In one embodiment of the present invention, the nested PCR amplification is performed in the following manner: pre-denaturation at 94°C for 5 minutes, denaturation at 94°C for 30 seconds, annealing at 52°C for 30 seconds, extension at 72°C for 90 seconds (30 cycles), and then over-extension at 72°C for 10 minutes.

[0075] In the method of configuration according to the present invention, step (2) is a separated and purified BBD29_11265 to obtain a recombinant plasmid. G70A It includes the step of constructing a recombinant plasmid, which includes the process of assembling the pK18mobsacB plasmid by the NEBuider recombinant system.

[0076] In the method of construction according to the present invention, step (3) includes the step of transforming a recombinant plasmid into a host strain to obtain a recombinant strain and constructing a recombinant strain.

[0077] In one embodiment of the present invention, the transformation in step (3) is by an electric transformation method.

[0078] In one embodiment of the present invention, the host strain is ATCC 13869.

[0079] In one embodiment of the present invention, the host strain is Corynebacterium glutamicum CGMCC No. 21220.

[0080] In one embodiment of the present invention, the recombination is implemented by homologous recombination.

[0081] In a fourth aspect of the present invention, a method for configuring a recombinant strain that produces L-glutamic acid is further provided.

[0082] According to the present invention, the above-described method amplifies the sequences of upstream and downstream homologous cancer fragments of BBD29_11265, the coding region of the BBD29_11265 gene, and the promoter region thereof, so that the strain is BBD29_11265 or BBD29_11265 G70A BBD29_11265 or BBD29_11265 in the host strain genome via homologous recombination to implement gene overexpression G70A It includes the step of introducing a gene.

[0083] In one embodiment of the present invention, the primer for amplifying the upstream homologous arm fragment is as follows:

[0084] P7: 5' CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAG GACCCGCTTG CCATACGAAG 3' (SEQ ID NO: 11)

[0085] P8: 5' CCCAGAACAC GACAAAAGGT ATCTACTCAT CTGAAGAATC 3' (SEQ ID NO: 12)

[0086] In one embodiment of the present invention, the primer for amplifying the downstream homologous arm fragment is as follows:

[0087] P11: 5' ACTGGCCTCC TACGCAATAA TTCGTGGGCA CTCTGGTTTG 3' (SEQ ID NO: 15)

[0088] P12: 5' CAGCTATGACCATGATTACGAATTCGAGCTCGGTACCCCATAAGAAAC AACCACTTCC 3' (SEQ ID NO: 16)

[0089] In one embodiment of the present invention, the primers for amplifying the sequences of the gene coding region and the promoter region are as follows:

[0090] P9: 5' GATTCTTCAG ATGAGTAGAT ACCTTTTGTC GTGTTCTGGG 3' (SEQ ID NO: 13)

[0091] P10: 5' CAAACCAGAG TGCCCACGAA TTATTGCGTA GGAGGCCAGT 3' (SEQ ID NO: 14)

[0092] In one embodiment of the present invention, the integrated homologous arm fragment is obtained by amplifying using a template that mixes three fragments: an upstream homologous arm fragment, a downstream homologous arm fragment, and a sequence fragment of a gene's coding region and its promoter region, which are amplified using the P7 / P12 as primers.

[0093] In one embodiment of the present invention, the PCR system used comprises 5 μL of l0 ХEx Taq buffer, 4 μL of dNTP mixture (2.5 mM each), and Mg 2+ 4 μL of (25 mM), 2 μL of primers (10 pM), 0.25 μL of Ex Taq (5 U / μL), and a total volume of 50 μL. PCR amplification is performed by pre-denaturation at 94°C for 5 minutes, denaturation at 94°C for 30 seconds, annealing at 52°C for 30 seconds, extension at 72°C for 120 seconds (30 cycles), followed by over-extension at 72°C for 10 minutes.

[0094] In one embodiment of the present invention, an integrated plasmid is obtained by assembling the shuttle plasmid PK18mobsacB and the integrated homologous arm fragment using the NEBuider recombination system.

[0095] In one embodiment of the present invention, an integrated plasmid is infected into a host strain to infect BBD29_11265 or BBD29_11265 into the genome of the host strain in a homologous recombination manner. G70A Introduce genes.

[0096] In one embodiment of the present invention, the host strain is Corynebacterium glutamicum CGMCC No. 21220.

[0097] In one embodiment of the present invention, the host strain is ATCC 13869.

[0098] In one embodiment of the present invention, the host strain is a strain having the polynucleotide sequence indicated in SEQ ID NO: 2.

[0099] In a fifth aspect of the present invention, a method for configuring a recombinant strain that produces L-glutamic acid is further provided.

[0100] According to the present invention, the above-described method comprises the sequences of the coding region and promoter region of the BBD29_11265 gene or BBD29_11265 G70A Construct an overexpression plasmid vector by amplifying the sequences of the coding region and promoter region of a gene, transfer the vector to a host strain, and in the strain, BBD29_11265 or BBD29_11265 G70A It includes a step of implementing gene overexpression.

[0101] In one embodiment of the present invention, the primers for amplifying the sequence of the coding region of the gene and the sequence of the promoter region are as follows:

[0102] P17: 5' GCTTGCATGCCTGCAGGTCGACTCTAGAGGATCCCCACCTTTTGTC GTGTTCTGGG 3' (SEQ ID NO: 21)

[0103] P18: 5' ATCAGGCTGAAAATCTTCTCTCATCCGCCAAAAC TTATTGCGTA GGAGGCCAGT 3' (SEQ ID NO: 22)

[0104] In one embodiment of the present invention, the PCR system comprises 5 μL of l0 ХEx Taq buffer, 4 μL of dNTP mixture (2.5 mM each), and Mg 2+4 μL of (25 mM), 2 μL of primer (10 pM) each, 0.25 μL of Ex Taq (5 U / μL), and a total volume of 50 μL. The PCR amplification is performed by pre-denaturation at 94°C for 5 minutes, denaturation at 94°C for 30 seconds, annealing at 52°C for 30 seconds, extension at 72°C for 45 seconds (30 cycles), followed by over-extension at 72°C for 10 minutes.

[0105] In one embodiment of the present invention, the overexpression plasmid is BBD29_11265 or BBD29_11265 having a self-promoter and the shuttle plasmid pXMJ19 using the NEBuider recombination system. G70A Obtained by assembling fragments.

[0106] In one embodiment of the present invention, the host strain is Corynebacterium glutamicum CGMCC No. 21220.

[0107] In one embodiment of the present invention, the host strain is ATCC 13869.

[0108] In one embodiment of the present invention, the host strain is a strain having the polynucleotide sequence indicated in SEQ ID NO: 2.

[0109] The present invention obtains a recombinant strain that can be applied alone to the fermentation production of L-glutamic acid or mixed with other L-glutamic acid-producing bacteria to the fermentation production of L-glutamic acid.

[0110] In another aspect of the present invention, a method for producing L-glutamic acid is provided, comprising a method of obtaining L-glutamic acid from a culture medium by culturing the bacteria.

[0111] Bacterial culture may be performed in a suitable medium under culture conditions known in the art. The medium may contain carbon sources, nitrogen sources, trace elements, and combinations thereof. The pH of the culture medium may be adjusted during culture. Additionally, a step of using an antifoaming agent during culture to prevent the generation of gas bubbles may be included. Additionally, a step of injecting gas into the culture medium during culture may be included. The gas may include any gas capable of maintaining aerobic conditions of the culture medium. During culture, the temperature of the culture medium may be 20 to 45°C. The generated L-glutamic acid may be recovered from the culture medium by a combination of methods such as anion exchange chromatography, concentration, crystallization, and isoelectric point precipitation after treating the culture medium with sulfuric acid or hydrochloric acid.

[0112] In the present invention:

[0113] SEQ ID NO: 1: BBD29_11265 The wild-type ORF sequence is

[0114]

[0115] am.

[0116] SEQ ID NO: 2: BBD29_11265 G70A The ORF sequence is

[0117]

[0118] am.

[0119] SEQ ID NO: 3: BBD29_11265 The wild-type coding protein amino acid sequence is

[0120]

[0121] am.

[0122] SEQ ID NO: 4: BBD29_11265 A24T The amino acid sequence of a coding protein is

[0123]

[0124] am.

[0125] BBD29_11265 A24T It is BBD29_11265A24T.

[0126] The present invention also BBD29_11265 A24T Provides a protein referred to as protein, and said protein is:

[0127] A1) Protein with amino acid sequence SEQ ID NO: 4,

[0128] A2) A protein having 80% or more identity with the protein indicated in A1) and having the same function, obtained by substituting and / or deleting and / or adding amino acid residues to the amino acid sequence indicated in SEQ ID NO: 4,

[0129] A3) It may be any one of the fusion proteins with the same function obtained by attaching a label to the N-terminus and / or C-terminus of A1) or A2).

[0130] The present invention also BBD29_11265 G70A It provides a nucleic acid molecule called, and said nucleic acid molecule BBD29_11265 G70A Is:

[0131] B1) The above protein BBD29_11265 A24T nucleic acid molecules encoding,

[0132] B2) DNA molecule with the coding sequence indicated by SEQ ID NO: 2,

[0133] B3) The nucleotide sequence may be any one of the DNA molecules indicated in SEQ ID NO: 2.

[0134] The DNA molecule indicated by SEQ ID NO: 2 is the BBD29_11265 of the present invention. G70A It is a gene.

[0135] DNA molecule (BBD29_11265) indicated in SEQ ID NO: 2 G70A The gene) is the protein BBD29_11265 indicated by SEQ ID NO: 4 A24T Codes.

[0136] The above protein BBD29_11265 A24T is a protein in which the threonine (T) at the 24th site of the amino acid sequence (SEQ ID NO: 4) is mutated from alanine (A).

[0137] The present invention also provides a biological material, said biological material is:

[0138] C1) The above nucleic acid molecule BBD29_11265 G70A Expression cassette including,

[0139] C2) The above nucleic acid molecule BBD29_11265 G70A A recombinant vector comprising, or a recombinant vector comprising the above-mentioned expression cassette of C1,

[0140] C3) The above nucleic acid molecule BBD29_11265 G70A It may be any one of the following: a recombinant microorganism containing the expression cassette of C1), or a recombinant microorganism containing the recombinant vector of C2.

[0141] The present invention also provides that any one of D1)-D8) is applied to any one of the following:

[0142] F1) Any one of D1)-D8) is applied to the regulation of L-glutamic acid production by microorganisms,

[0143] F2) Any one of D1)-D8) is applied to the bacterial composition of the gene process that produces L-glutamic acid,

[0144] F3) Any one of D1)-D8) is applied to the preparation of L-glutamic acid.

[0145] Here, the above D1)-D8) is:

[0146] D1) is the above protein BBD29_11265 A24T And,

[0147] D2) is the above nucleic acid molecule BBD29_11265 G70A is,

[0148] D3) is the above biological material, and

[0149] D4) is a DNA molecule with nucleotide sequence SEQ ID NO: 1, and

[0150] D5) is a DNA molecule having more than 90% identity with and the same function as the DNA molecule indicated in SEQ ID NO: 1, obtained by modifying the nucleotide sequence indicated in SEQ ID NO: 1 and / or undergoing one or more nucleotide substitutions and / or deletions and / or additions, and

[0151] D6) is an expression cassette containing the DNA molecule of D4) or D5), and

[0152] D7) is a recombinant vector comprising the DNA molecule of D4) or D5), or a recombinant vector comprising the expression cassette of D6), and

[0153] D8) is a recombinant microorganism comprising the DNA molecule of D4) or D5), a recombinant microorganism comprising the expression cassette of D6), or a recombinant microorganism comprising the recombinant vector of D7).

[0154] The DNA molecule indicated in SEQ ID NO: 1 is the BBD29_11265 gene according to the present invention.

[0155] The DNA molecule (gene BBD29_11265) indicated in SEQ ID NO: 1 codes for the protein indicated in SEQ ID NO: 3.

[0156] In this specification, homology refers to the identity of an amino acid sequence or a nucleotide sequence. The identity of an amino acid sequence can be verified using a homology search site on the international internet, such as the BLAST page on the NCBI homepage. For example, in Advanced BLAST 2.1, blastp is used as the program, the expected value is set to 10, all filters are set to OFF, BLOSUM62 is used as the matrix, and the gap presence cost, gap cost per residue, and lambda ratio are set to 11, 1, and 0.85 (default values), respectively, to search for and calculate the identity of a pair of amino acid sequences and obtain an identity value (%).

[0157] In this specification, the identity of 80% or more may be at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%.

[0158] In this specification, 90% or more identity may be at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity.

[0159] In this specification, the control of the amount of L-glutamic acid produced by the microorganism may be to increase or decrease the amount of accumulated L-glutamic acid in the microorganism (i.e., to promote or inhibit the biosynthesis of L-glutamic acid).

[0160] The present invention also provides a method for increasing the production of L-glutamic acid in microorganisms, said method:

[0161] E1) The above nucleic acid molecule BBD29_11265 in the target microorganism G70A A step of obtaining a microorganism with a higher L-glutamic acid production amount than the target microorganism by increasing the expression amount or content of,

[0162] E2) a step of increasing the expression amount or content of the DNA molecule of D4) or D5) in the target microorganism to obtain a microorganism with a higher L-glutamic acid production amount than the target microorganism,

[0163] E3) Includes any one of the steps of obtaining a microorganism with a higher L-glutamic acid production amount than the target microorganism by mutating a DNA molecule with nucleotide sequence SEQ ID NO: 1 in the target microorganism.

[0164] In the above method, the mutation may be a point mutation, that is, a mutation of a single nucleotide.

[0165] In the method described above, the point mutation may be a mutation in which an alanine residue at the 24th site in the amino acid sequence encoded by the DNA molecule indicated in SEQ ID NO: 1 is mutated into another amino acid residue.

[0166] In the method described above, the point mutation mutates alanine to threonine at the 24th site of the amino acid sequence encoded by the DNA molecule indicated by SEQ ID NO: 1, thereby producing a mutant protein BBD29_11265 with an amino acid sequence of SEQ ID NO: 4. A24T It may be possible to acquire.

[0167] The aforementioned mutation refers to a gene apex mutation in which one or more bases of a gene are altered through an apex mutation, thereby changing the amino acid composition of the corresponding protein, resulting in the generation of a new protein or the creation of a new function in the original protein. Techniques for gene apex mutations, such as oligonucleotide primer-mediated apex mutations, PCR-mediated apex mutations, or cassette mutations, are well known to those skilled in the art.

[0168] The point mutation described in this specification may be a single base substitution, a single base insertion, or a single base deletion, and specifically, may be a single base substitution. The single base substitution may be an allelic substitution.

[0169] The above point mutation may be a nucleic acid modification of guanine (G) at site 70 of the BBD29_11265 gene (SEQ ID NO: 1).

[0170] Specifically, the above point mutation may be a mutation in which guanine (G) is mutated to adenine (A) at site 70 of the BBD29_11265 gene (SEQ ID NO: 1) to obtain the DNA molecule shown in SEQ ID NO: 2.

[0171] In this specification, the recombination vector is specifically the recombination vector pK18-BBD29_11265 G70A , PK18mobsacB-BBD29_11265, PK18mobsacB-BBD29_11265 G70A , pXMJ19-BBD29_11265 or pXMJ19-BBD29_11265 G70A am.

[0172] The above recombination vector pK18-BBD29_11265 G70A is, the DNA fragment indicated at site 37-1495 of SEQ ID NO: 29 in the sequence list, without altering the rest of the base sequence of the pK18mobsacB vector of the pK18mobsacB vector Xba I and / BamH I is a recombination vector obtained by replacing fragments (small fragments) between recognition regions. The above recombination vector pK18-BBD29_11265 G70A is the mutant gene BBD29_11265 indicated at SEQ ID NO: 2 G70A It contains the DNA molecule indicated at site 1-173 of.

[0173] The above-mentioned recombinant vector PK18mobsacB-BBD29_11265 is used to incorporate the exogenous gene BBD29_11265 into the host chromosome and to overexpress the wild-type BBD29_11265 gene in the resulting bacteria. The above-mentioned recombinant vector PK18mobsacB-BBD29_11265 is the DNA fragment of the pK18mobsacB vector indicated at site 37-1966 of SEQ ID NO: 30 in the nucleotide sequence list, without altering other sequences of the pK18mobsacB vector. Xba I and / BamH I is a recombination vector obtained by replacing fragments (small fragments) between recognition regions.

[0174] The above recombination vector PK18mobsacB-BBD29_11265 G70A is the exogenous gene BBD29_11265 G70A Integrating into the host chromosome and the mutant gene BBD29_11265 in the resulting bacteria G70A It is used to overexpress. The recombinant vector PK18mobsacB-BBD29_11265 G70A without altering other parts of the pK18mobsacB vector, the DNA fragment indicated at site 37-1966 of SEQ ID NO: 31 in the sequence list of the pK18mobsacB vector Xba I and / BamH I is a recombination vector obtained by replacing fragments (small fragments) between recognition regions.

[0175] The above-mentioned recombinant vector pXMJ19-BBD29_11265 is used to express the exogenous gene BBD29_11265 extrachromosomally via a plasmid and to overexpress the wild-type BBD29_11265 gene in the resulting bacteria. The above-mentioned recombinant vector pXMJ19-BBD29_11265 is the DNA fragment of the pXMJ19 vector indicated at sites 37-486 of SEQ ID NO: 32 in the sequence list above, without altering other sequences of the pXMJ19 vector. EcoR I andKpn I is a recombination vector obtained by replacing fragments (small fragments) between recognition regions.

[0176] The above recombination vector pXMJ19-BBD29_11265 G70A is exogenous gene BBD29_11265 through plasmid G70A Expressed extrachromosomally, and the mutant gene BBD29_11265 in the resulting bacteria G70A It is used to overexpress. The recombinant vector pXMJ19-BBD29_11265 G70A is the DNA fragment indicated at sites 37-486 of SEQ ID NO: 33 in the sequence list, without altering other sequences of the pXMJ19 vector of the pXMJ19 vector EcoR I and Kpn I is a recombination vector obtained by replacing fragments (small fragments) between recognition regions.

[0177] The above recombination vector pK18-BBD29_11265 G70A , PK18mobsacB-BBD29_11265, PK18mobsacB-BBD29_11265 G70A , pXMJ19-BBD29_11265 and pXMJ19-BBD29_11265 G70A All of these are within the scope of protection of the present invention.

[0178] In this specification, the recombinant microorganism may specifically be the recombinant bacteria YPG-013, YPG-014, YPG-015, YPG-016, or YPG-017.

[0179] The above recombinant bacteria YPG-013 is the above recombinant vector pK18-BBD29_11265 G70A A recombinant bacterium obtained by transforming into Corynebacterium glutanicum CGMCC No. 21220, wherein the recombinant bacterium YPG-013 has the mutated gene BBD29_11265 indicated in SEQ ID NO: 2 G70A Includes

[0180] The above-mentioned recombinant bacterium YPG-014 contains a double copy of the BBD29_11265 gene indicated in SEQ ID NO: 1. Recombinant bacteria containing a double copy of the BBD29_11265 gene significantly and stably increase the expression level of the BBD29_11265 gene. Recombinant bacterium YPG-014 is an engineered bacterium in which the wild-type BBD29_11265 gene is overexpressed in the genome.

[0181] The above-mentioned recombinant bacterium YPG-015 is the mutated BBD29_11265 indicated in SEQ ID NO: 2 G70A It contains the gene. Recombinant bacterium YPG-015 contains the mutant BBD29_11265 in its genome. G70A It is an engineered bacterium that overexpresses genes.

[0182] The above recombinant bacterium YPG-016 contains a double copy of the BBD29_11265 gene indicated by SEQ ID NO: 1. The recombinant bacterium YPG-016 is an engineered bacterium that overexpresses the wild-type BBD29_11265 gene by the plasmid pXMJ19-BBD29_11265 in a plasmid, that is, extrachromosomally.

[0183] The above-mentioned recombinant bacterium YPG-017 is the mutated BBD29_11265 indicated in SEQ ID NO: 2 G70A It contains the gene. Recombinant bacteria YPG-017 is in a plasmid, that is, outside the chromosome, plasmid pXMJ19-BBD29_11265 G70A Mutation BBD29_11265 by G70A It is an engineered bacterium that overexpresses genes.

[0184] The above recombinant bacteria YPG-013, YPG-014, YPG-015, YPG-016, and YPG-017 are all within the scope of protection of the present invention.

[0185] The present invention also provides a method for producing the recombinant microorganism, wherein the method is:

[0186] F1) To obtain the above recombinant microorganism, the nucleic acid molecule BBD29_11265 G70A The step of introducing into the target microorganism,

[0187] F2) A step of introducing a DNA molecule indicated in SEQ ID NO: 1 into a target microorganism to obtain the above recombinant microorganism,

[0188] F3) Any one of the steps of editing the DNA molecule indicated in SEQ ID NO: 1 using a gene editing means (e.g., single nucleotide gene editing) so that the target microorganism contains the DNA molecule indicated in SEQ ID NO: 2.

[0189] The above introduction may involve transforming a vector carrying the DNA molecule of the present invention into a host bacterium by any known transformation method, such as chemical transformation or electroshock transformation. The introduced DNA molecule may be a single copy or multiple copies. The above introduction may incorporate the exogenous gene into the host chromosome or express it outside the chromosome via a plasmid.

[0190] The present invention also provides a method for producing L-glutamic acid, the method comprising the step of producing L-glutamic acid using any of the recombinant microorganisms described herein.

[0191] In the above method, the method may be a fermentation method for the production of L-glutamic acid, and the recombinant microorganism is Corynebacterium ( Corynebacteriuin ) genus, especially Corynebacterium glutamicum ( Corynebacterium glutamicum It may be ) and variants thereof.

[0192] The storage information is as follows. The strain name is Corynebacterium glutamicum, the Latin name is Corynebacterium glutamicum, the strain number is YPGLU001, the storage institution is the General Microbiology Center of the Chinese Committee for the Storage and Administration of Microbial Strains, the abbreviation of the storage institution is CGMCC, the address is No. 3, No. 1, Beichen West Road, Chaoyang District, Beijing, the storage date is November 23, 2020, and the storage center registration number is CGMCC No. 21220. Specific details for implementing the invention

[0193] The present invention is described in more detail in combination with the specific embodiments below. The presented embodiments are not intended to limit the scope of the invention but merely to illustrate it. The embodiments provided below may be used as a guideline for further improvement by those skilled in the art and do not limit the invention in any way.

[0194] Unless otherwise specified, the experimental methods of the following examples are conventional methods and are performed according to the techniques or conditions described in the literature within the art or according to product specifications. Unless otherwise specified, the materials, reagents, etc. used in the following examples are commercially available.

[0195] In the following examples, the composition of the basic medium used for culturing the strain is the same, and the corresponding sucrose, kanamycin, or chloramphenicol required for the composition of this basic medium is added, and the composition of the basic medium is shown in Table 1:

[0196]

[0197] In the following examples, Corynebacterium glutamicum ( Corynebacterium glutamicumYPGLU001 CGMCC No. 21220 was stored on November 23, 2020, with storage registration number CGMCC No. 21220 at the General Microbiology Center of the Chinese Commission on the Storage and Administration of Microbial Strains (abbreviated as CGMCC; address: No. 3, Block 1, Beichen West Road, Chaoyang District, Beijing; Institute of Microbiology, Chinese Academy of Sciences). Corynebacterium glutamicum ( Corynebacterium glutamicum YPGLU001 is also called Corynebacterium glutamicum CGMCC No. 21220.

[0198] Example 1 Transformation vector pK18-BBD29_11265 containing the coding region of the point-mutated BBD29_11265 gene G70A composition

[0199] To amplify the coding region sequence of the BBD29_11265 gene based on the genome sequence of Corynebacterium glutamicum ATCC13869 disclosed in NCBI, two pairs of primers were designed and synthesized, and a point mutation was introduced into strain Corynebacterium glutamicum CGMCC No. 21220 (the coding region of the BBD29_11265 gene on the chromosome of this strain was confirmed to be identical to that of ATCC13869 via sequencing) through allelic substitution. The amino acid sequence corresponding to the coding protein is SEQ ID NO: 3, and the nucleotide sequence of the BBD29_11265 gene shows that guanine (G) at site 70 is adenine (A) (SEQ ID NO: 2: BBD29_11265 G70A It is changed to ), and in the amino acid sequence corresponding to the coding protein, the alanine (A) at site 24 is changed to threonine (T) (SEQ ID NO: 4: BBD29_11265 A24T It changes to ).

[0200] The above point mutation is a mutation in which guanine (G) at site 70 of the nucleotide sequence (SEQ ID NO: 1) of the BBD29_11265 gene is mutated to adenine (A), resulting in the DNA molecule indicated by SEQ ID NO: 2 (the name of the mutated BBD29_11265 gene is BBD29_11265 G70A ).

[0201] Here, the DNA molecule indicated by SEQ ID NO: 1 codes for a protein with an amino acid sequence of SEQ ID NO: 3 (the protein is referred to as protein BBD29_11265).

[0202] The DNA molecule indicated by SEQ ID NO: 2 is a mutant protein with an amino acid sequence of SEQ ID NO: 4 (the above mutant protein is BBD29_11265 A24T로 지칭됨 Codes for ). The above mutant protein BBD29_11265 A24T Threonine (T) at the 24th position in the amino acid sequence (SEQ ID NO: 4) is a mutated alanine (A).

[0203] Gene apex mutations were performed using Overlap PCR technology, and the primers were designed with the bases in bold font as the mutation sites as shown below (synthesized by Invitrogen, Shanghai).

[0204] P1: 5'CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAGCGGTGCCAGACACTGTCAAG 3' (SEQ ID NO: 5)

[0205] P2: 5' ACGATGACAA TCG T TGCGAT CCCGCCCATG 3' (SEQ ID NO: 6)

[0206] P3: 5' CATGGGCGGG ATCGCA A CGA TTGTCATCGT 3' (SEQ ID NO: 7)

[0207] P4: 5' CAGCTATGACCATGATTACGAATTCGAGCTCGGTACCC CGTCAGCCCC TGACCGTTCT 3' (SEQ ID NO: 8)

[0208] Construction method: PCR amplification was performed using Corynebacterium glutamicum ATCC13869 as a template with primers P1 and P2 and P3 and P4, respectively, to obtain two DNA fragments (above BBD29_11265 and below BBD29_11265) with mutant base sizes of 775 bp and 788 bp, respectively, in the BBD29_11265 gene coding region.

[0209] System: 5 μL l0 ХEx Taq buffer, 4 μL dNTP mixture (2.5 mM each), Mg 2+ 4 μL of (25 mM) primer (10 pM), 2 μL of Ex Taq (5 U / μL), and 0.25 μL of Ex Taq, with a total volume of 50 μL.

[0210] The above PCR amplification was performed as follows: 30 cycles of pre-denaturation at 94°C for 5 minutes, denaturation at 94°C for 30 seconds, annealing at 52°C for 30 seconds, and extension at 72°C for 45 seconds were performed, followed by over-extension at 72°C for 10 minutes to obtain two DNA fragments (BBD29_11265 top and BBD29_11265 bottom) with sizes of 775 bp and 788 bp, respectively, containing the coding region of the BBD29_11265 gene.

[0211] The two DNA fragments mentioned above (BBD29_11265 top and BBD29_11265 bottom) were purified by agarose gel electrophoresis and the target bands were recovered. Then, the two DNA fragments above were used as templates and P1 and P4 were used as primers to amplify the fragments via nested PCR, yielding a fragment named BBD29_11265 top-bottom (sequence indicated in SEQ ID NO: 29) with a length of 1533 bp. In the DNA fragment indicated in SEQ ID NO: 29, region 693-965 contains the mutant site of BBD29_11265. G70A It is a gene fragment (i.e., region 1-273 of SEQ ID NO: 2).

[0212] Nested PCR System: 5 μL x 0 XEx Taq buffer, 4 μL dNTP mixture (2.5 mM each), Mg 2+ 4 μL of (25 mM) primer (10 pM), 2 μL of Ex Taq (5 U / μL), and 0.25 μL of Ex Taq, with a total volume of 50 μL.

[0213] The above nested PCR amplification was performed as follows: 30 cycles of pre-denaturation at 94°C for 5 minutes, denaturation at 94°C for 30 seconds, annealing at 52°C for 30 seconds, and extension at 72°C for 90 seconds, followed by over-extension at 72°C for 10 minutes.

[0214] This DNA fragment BBD29_11265 up-down (SEQ ID NO: 29) contains a mutation site for introducing a nucleic acid modification to site 70 of the BBD29_11265 gene-coding region of Corynebacterium glutamicum CGMCC No. 21220. Specifically, it changes guanine (G) to adenine (A) at site 70 of the BBD29_11265 gene-coding region of Corynebacterium glutamicum CGMCC No. 21220, thereby changing the amino acid at site 24, which codes for a protein, from alanine (A) to threonine (T). The pK18mobsacB plasmid (purchased from Addgene) Xba I / BamH After decomposing into I, BBD29_11265 G70A and linearized pK18mobsacB plasmids were separated and purified by agarose gel electrophoresis, and then assembled into a NEBuider recombinant system to obtain vector pK18-BBD29_11265 containing a kanamycin resistance marker in the plasmid G70A Obtained. Vector pK18-BBD29_11265 G70A It was sent to a sequencing company for DNA sequencing and identification, and the vector pK18-BBD29_11265 containing the exact point mutation (GA) G70A It was kept for backup purposes.

[0215] Specifically, the above DNA fragment (BBD29_11265 top-bottom) was separated and purified by agarose gel electrophoresis, and the enzyme (purchased from NEB) was used at 50°C for 30 minutes ( Xba I / BamH I) purified pK18mobsacB plasmid (purchased from Addgene and Xba I / BamH It was conjugated to (degraded by I). The conjugated product was transformed into DH5a (purchased from TAKARA), and the grown monoclones were confirmed via PCR to conjugate kanamycin resistance (Kan rPositive recombinant vector pK18-BBD29_11265 containing a ) marker G70A Obtained the accurately decomposed recombination vector pK18-BBD29_11265 G70A Send to a sequencing company for sequencing and identification, and the recombinant vector pK18-BBD29_11265 containing the accurate point mutation (GA) G70A It was kept as a backup.

[0216] The above recombination vector pK18-BBD29_11265 G70A is the DNA fragment indicated at site 37-1495 of SEQ ID NO: 29 in the sequence list of the pK18mobsacB vector without altering other nucleotide sequences of the pK18mobsacB vector Xba I and / BamH I is a recombination vector obtained by replacing fragments (small fragments) between recognition regions.

[0217] The above recombination vector pK18-BBD29_11265 G70A is the mutated gene BBD29_11265 indicated by SEQ ID NO: 2 G70A It contains the DNA molecule indicated at site 1-273 of.

[0218] Example 2 point-mutated BBD29_11265 G70A Engineering strain composition including

[0219] Method of construction: Allelic substitution plasmid pK18-BBD29_11265 of Example 1 G70A[The sample] was transformed into Corynebacterium glutamicum CGMCC No. 21220 by electric shock and cultured in media under the medium composition and culture conditions described in Table 1. The resulting single colonies were identified using primer P1 and universal primer M13R, respectively, and strains amplified to a band of approximately 1560 bp were identified as positive. Positive strains were cultured in media containing 15% sucrose, and the resulting single colonies were cultured in media containing kanamycin and media without kanamycin, respectively. Strains that grew in media without kanamycin but not in media containing kanamycin were further confirmed by PCR using the primers below (synthesized by Invitrogen, Shanghai):

[0220] P5: 5' TTTTCTGACT GCTCTGAACC 3' (SEQ ID NO: 9)

[0221] P6: 5' GACCGTTAAC CACGCTAGAC 3' (SEQ ID NO: 10)

[0222] The above-mentioned PCR amplification product was denatured at high temperature and subjected to SSCP electrophoresis in an ice bath (plasmid pK18-BBD29_11265 G70AThe fragment amplified by [method] was used as a positive control, the fragment amplified by ATCC13869 was used as a negative control, and water was used as a blank control. The PAGE preparation and electrophoresis conditions for SSCP electrophoresis are shown in Table 2. Since the fragment structure and electrophoretic region differ for each strain, strains in which the electrophoretic region of the fragment does not match the region of the negative control but matches the positive control fragment are strains that have successfully undergone allelic substitution. The target fragment of the strain that successfully underwent allelic substitution was amplified again by PCR using primers P5 and P6, and bound to the PMD19-T vector for sequencing. Through sequence comparison, sequences in which mutations occurred were confirmed to have successfully undergone allelic substitution in the strain and were named YPG-013.

[0223] Recombinant bacteria YPG-013 contains the mutated gene BBD29_11265 indicated in SEQ ID NO: 2 G70A Includes

[0224]

[0225] Example 3 BBD29_11265 or BBD29_11265 in the genome G70A Composition of engineered strains that overexpress genes

[0226] In the process of generating bacteria, the wild-type BBD29_11265 gene or its mutant gene BBD29_11265 G70A To further demonstrate that the overexpression of can increase the production of L-glutamate, an exogenous gene was incorporated into the host chromosome to examine the BBD29_11265 gene or BBD29_11265 in the genome G70A An engineered strain that overexpresses a gene was constructed.

[0227] Based on the genome sequence of Corynebacterium glutamicum ATCC13869 disclosed in NCBI, the sequences of upstream and downstream homologous cancer fragments and the coding and promoter regions of the BBD29_11265 gene were amplified, and BBD29_11265 or BBD29_11265 in strain Corynebacterium glutamicum CGMCC No. 21220 through homologous recombination G70A Three pairs of primers were designed and synthesized to introduce the gene.

[0228] The primers were designed as follows (synthesized by Shanghai Invitrogen):

[0229] P7: 5' CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAG GACCCGCTTG CCATACGAAG 3' (SEQ ID NO: 11)

[0230] P8: 5' CCCAGAACAC GACAAAAGGT ATCTACTCAT CTGAAGAATC 3' (SEQ ID NO: 12)

[0231] P9: 5' GATTCTTCAG ATGAGTAGAT ACCTTTTGTC GTGTTCTGGG 3' (SEQ ID NO: 13)

[0232] P10: 5' CAAACCAGAG TGCCCACGAA TTATTGCGTA GGAGGCCAGT 3' (SEQ ID NO: 14)

[0233] P11: 5' ACTGGCCTCC TACGCAATAA TTCGTGGGCA CTCTGGTTTG 3' (SEQ ID NO: 15)

[0234] P12: 5' CAGCTATGACCATGATTACGAATTCGAGCTCGGTACCCCATAAGAAACAACCACTTCC 3' (SEQ ID NO: 16)

[0235] Construction Method: Using Corynebacterium glutamicum ATCC13869 or YPG-013 as templates, respectively, PCR amplification was performed with primers P7 / P8, P9 / P10, and P11 / P12 to obtain an approximately 806 bp upstream homologous cancer fragment, a 490 bp BBD29_11265 gene-coding region and promoter region fragment, or a 490 bp BBD29_11265 G70A Fragments of the gene-coding region and promoter region, along with a downstream homologous arm fragment of approximately 788 bp, were obtained. The three amplified fragments above were mixed and used as a template, and amplified using P7 / P12 primers to obtain integrated homologous arm fragments 1 and 2 (integrated homologous arm fragment 1 is 2004 bp in size, and its sequence is indicated in SEQ ID NO: 30; integrated homologous arm fragment 2 is 2004 bp in size, and its sequence is indicated in SEQ ID NO: 31). After the PCR reaction, the amplified products were recovered by electrophoresis, and the desired DNA fragment of approximately 2004 bp was recovered using a column DNA gel recovery kit (TIANGEN), and then using a NEBuider recombination system Xba I- Combine with the recovered shuttle plasmid PK18mobsacB to form the integrated plasmid (i.e., recombinant vector) PK18mobsacB-BBD29_11265 or PK18mobsacB-BBD29_11265 G70A The plasmid contains a kanamycin resistance marker, so a recombinant in which the plasmid is integrated into the genome can be obtained through kanamycin screening.

[0236] The above-mentioned recombinant vector PK18mobsacB-BBD29_11265 is the DNA fragment of the pK18mobsacB vector indicated at site 37-1966 of SEQ ID NO: 30 in the sequence list, without altering other sequences of the pK18mobsacB vector. Xba I and / BamH I is a recombination vector obtained by replacing fragments (small fragments) between recognition regions.

[0237] The above recombination vector PK18mobsacB-BBD29_11265 G70A is, the DNA fragment indicated at site 37-1966 of SEQ ID NO: 31 in the sequence list of the pK18mobsacB vector without altering other sequences of the pK18mobsacB vector Xba I and / BamH I is a recombination vector obtained by replacing fragments (small fragments) between recognition regions.

[0238] PCR System: 5 μL x0 XEx Taq buffer, 4 μL dNTP mixture (2.5 mM each), Mg 2+ 4 μL of (25 mM) primer (10 pM), 2 μL of Ex Taq (5 U / μL), and 0.25 μL of Ex Taq, with a total volume of 50 μL.

[0239] The above PCR amplification was performed in the following manner: pre-denaturation at 94°C for 5 minutes, denaturation at 94°C for 30 seconds, annealing at 52°C for 30 seconds, extension at 72°C for 120 seconds (30 cycles), followed by over-extension at 72°C for 10 minutes.

[0240] Two integrated plasmids (PK18mobsacB-BBD29_11265 and PK18mobsacB-BBD29_11265 G70AEach strain was electro-transformed with Corynebacterium glutamicum CGMCC No. 21220, and the resulting single colonies were cultured. PCR was performed using P13 / P14 primers, and single colonies containing a fragment amplified by approximately 1190 bp were identified as positive strains, while single colonies that were not amplified into a fragment were identified as the primordial strain. Positive strains were screened with 15% sucrose and cultured in media containing kanamycin and media not containing kanamycin, respectively. Strains that grew in media not containing kanamycin but not in media containing kanamycin were further confirmed by PCR using P15 / P16 primers, and strains amplified to approximately 1200 bp were identified as BBD29_11265 or BBD29_11265 G70A The strains in which the gene was integrated into the genome of Corynebacterium glutamicum CGMCC No. 21220 were named YPG-014 (no mutant site) and YPG-015 (with mutant site).

[0241] The recombinant bacterium YPG-014 contains a double copy of the BBD29_11265 gene indicated by SEQ ID NO: 1. The recombinant bacterium containing the double copy of the BBD29_11265 gene significantly and stably increased the expression level of the BBD29_11265 gene. The recombinant bacterium YPG-014 is an engineered bacterium that overexpresses the wild-type BBD29_11265 gene in its genome.

[0242] Recombinant bacteria YPG-015 is the mutated BBD29_11265 indicated by SEQ ID NO: 2 G70A It contains the gene. Recombinant bacteria YPG-015 has the mutant BBD29_11265 in its genome. G70A It is an engineered bacterium with overexpressed genes.

[0243] The PCR identification primers are as follows:

[0244] P13: 5' GTCCAAGGTG ACGGCCGCAC 3' (SEQ ID NO: 17)

[0245] P14: 5' TGCGATCTCT GTCAATGCAG 3' (SEQ ID NO: 18)

[0246] P15: 5' CTGGGATAGT TTCAAGCCTT 3' (SEQ ID NO: 19)

[0247] P16: 5' ATATTCGGCC CAGCAGCAGC 3' (SEQ ID NO: 20)

[0248] Example 4 BBD29_11265 or BBD29_11265 in the plasmid G70A Composition of engineered strains that overexpress genes

[0249] Based on the genome sequence of Corynebacterium glutamicum ATCC13869 disclosed in NCBI, a pair of primers to amplify the coding and promoter regions of the BBD29_11265 gene were designed and synthesized as follows (synthesized by Invitrogen, Shanghai):

[0250] P17: 5' GCTTGCATGCCTGCAGGTCGACTCTAGAGGATCCCCACCTTTTGTC GTGTTCTGGG 3' (SEQ ID NO: 21)

[0251] P18: 5' ATCAGGCTGAAAATCTTCTCTCATCCGCCAAAAC TTATTGCGTA GGAGGCCAGT 3' (SEQ ID NO: 22)

[0252] Construction Method: PCR amplification was performed using YPG-0014 or YPG-0013 as templates, respectively, with primers P17 / P18 to obtain the BBD29_11265 gene and its 520 bp promoter fragment (SEQ ID NO: 32) or BBD29_11265 G70AThe gene and its 520 bp promoter fragment (SEQ ID NO: 33) were obtained. The amplified product was recovered by electrophoresis, the desired 520 bp DNA fragment was recovered using a column DNA gel recovery kit, and the NEBuider recombination system was used. EcoR I binds to the shuttle plasmid pXMJ19 recovered by digestion to form the overexpression plasmid (i.e., recombinant vector) pXMJ19-BBD29_11265 or pXMJ19℃11265 G70A ...was obtained. The plasmid contains a chloramphenicol resistance marker and can be transformed into a strain through chloramphenicol screening.

[0253] The above-mentioned recombinant vector pXMJ19-BBD29_11265 is a DNA fragment of the pXMJ19 vector indicated at sites 37-486 of sequence SEQ ID NO: 32 in the sequence list, without altering other sequences of the pXMJ19 vector. EcoR I and Kpn I is a recombination vector obtained by replacing fragments (small fragments) between recognition regions.

[0254] The above recombination vector pXMJ19-BBD29_11265 G70A is the DNA fragment indicated at sites 37-486 of SEQ ID NO: 33 in the sequence list of the pXMJ19 vector without altering other sequences of the pXMJ19 vector of the pXMJ19 vector EcoR I and K pn I is a recombination vector obtained by replacing fragments (small fragments) between recognition regions.

[0255] PCR System: 5 μL x0 XEx Taq buffer, 4 μL dNTP mixture (2.5 mM each), Mg 2+ 4 μL of (25 mM), 2 μL of primer (10 pM), 0.25 μL of Ex Taq (5 U / μL), and a total volume of 50 μL.

[0256] The above PCR amplification was performed in the following manner: pre-denaturation at 94°C for 5 minutes, denaturation at 94°C for 30 seconds, annealing at 52°C for 30 seconds, extension at 72°C for 45 seconds (30 cycles), followed by over-extension at 72°C for 10 minutes.

[0257] Two plasmids (pXMJ19-BBD29_11265 and pXMJ19-BBD29_11265 G70A Each of the strains was transformed into the CGMCC No. 21220 strain of Corynebacterium glutamicum, and the resulting single colony was cultured and confirmed by PCR using M13R (-48) and P18 primers. The strain containing the PCR fragment amplified to a size of approximately 569 bp was identified as the transgenic strain and named YPG-016 (without point mutation) and YPG-017 (with point mutation).

[0258] Recombinant bacterium YPG-016 contains a double copy of the BBD29_11265 gene indicated by SEQ ID NO: 1. Recombinant bacterium YPG-016 is an engineered bacterium that overexpresses the wild-type BBD29_11265 gene by the plasmid pXMJ19-BBD29_11265 outside the chromosome.

[0259] Recombinant bacteria YPG-017 is the mutated BBD29_11265 indicated by SEQ ID NO: 2 G70A It contains the gene. Recombinant bacteria YPG-017 is a plasmid, that is, the plasmid pXMJ19-BBD29_11265 outside the chromosome. G70A mutant BBD29_11265 by G70A It is an engineered bacterium that overexpresses genes.

[0260] Example 5: Composition of an engineered strain in which the BBD29_11265 gene is missing from the genome

[0261] Based on the genome sequence of Corynebacterium glutamicum ATCC13869 disclosed by NCBI, primers were synthesized to amplify fragments located at both ends of the coding region of two pairs of BBD29_11265 genes, and amplified into upstream and downstream homologous cancer fragments. The primers were designed as follows (synthesized at Yingjun Pharmaceuticals, Shanghai):

[0262] P19: 5' CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAG GATTTCGCCA CGCCATCTAC 3' (SEQ ID NO: 23)

[0263] P20: 5' AGCCCCTTTAGATGGGGTGGTTTTCTCCTTAAATAACGG 3' (SEQ ID NO: 24)

[0264] P21: 5' CCGTTATTTAAGGAGAAAACCACCCCATCTAAAAGGGGCT 3' (SEQ ID NO: 25)

[0265] P22: 5' CAGCTATGACCATGATTACGAATTCGAGCTCGGTACCCCGAGGGTGAG CCGGGTGCAT 3' (SEQ ID NO: 26)

[0266] Methods: PCR amplification was performed using Corynebacterium glutamicum ATCC13869 as a template with primers P19 / P20 and P21 / P22, respectively, to obtain a 773 bp upstream homologous arm fragment and a 778 bp downstream homologous arm fragment. Nested PCR was performed using primers P19 / P22 to obtain a 1511 bp total homologous arm fragment. After the PCR reaction, the amplified products were recovered by electrophoresis, and the desired 1511 bp DNA fragment was recovered using a column DNA gel recovery kit and passed through the NEBuider recombination system. Xba I / BamHA knockout plasmid was obtained by combining the shuttle plasmid recovered by dissolving in I with the pkl8mobsacB plasmid. This plasmid contains a kanamycin resistance marker.

[0267] The knockout plasmid was electro-transformed into the Corynebacterium glutamicum CGMCC No. 21220 strain, and the resulting single colonies were cultured and then confirmed by PCR using the primers below (synthesized by Shanghai Yingjun Pharmaceuticals):

[0268] P23: 5' GATTTCGCCA CGCCATCTAC 3' (SEQ ID NO: 27)

[0269] P24: 5' CGAGGTGAG CCGGGTGCAT 3' (SEQ ID NO: 28)

[0270] The strain in which bands of 1437 bp and 1710 bp were amplified by the above PCR is a positive strain, and the strain in which only the 1710 bp band was amplified is a primordial strain. After screening the positive strains in 15% sucrose medium, they were cultured in media containing kanamycin and media not containing kanamycin. Strains that grew in media not containing kanamycin but not in media containing kanamycin were selected and further confirmed by PCR using P23 / P24 primers. The strain in which the 1437 bp band was amplified is a genetically engineered strain in which the coding region of the BBD29_11265 gene is knocked out, and this was named YPG-018 (a strain in which the BBD29_11265 gene is knocked out in the genome of Corynebacterium glutamicum CGMCC No. 21220).

[0271] Example 6 L-glutamic acid fermentation experiment

[0272] Fermentation experiments were performed on the strains (YPG-013, YPG-014, YPG-015, YPG-016, YPG-017, YPG-018) configured in Examples 2 to 5 described above and the original strain of Corynebacterium glutamicum CGMCC No. 21220 in a BLBIO-5GC-4-H model fermenter (purchased from Shanghai Bailun Biotechnology Co., Ltd.) using the media shown in Table 3 and the control process shown in Table 4. Each strain was repeated three times, and the results are shown in Table 5.

[0273]

[0274]

[0275]

[0276] As shown in Table 5, the results indicate overexpression of the BBD29_11265 gene in Corynebacterium glutamicum, or overexpression of the coding region of the BBD29_11265 gene. G70A Causing point mutations and / or the BBD29_11265 gene or its mutant gene BBD29_11265 G70A Overexpression of [the gene] was helpful in increasing L-glutamate production, but weakening or knockout of the BBD29_11265 gene was adverse to L-glutamate accumulation.

[0277] The present invention has been described in detail above. Those skilled in the art can practice the present invention over a relatively wide range of parameters, concentrations, and conditions without departing from the spirit and scope of the invention and without the need for unnecessary experiments. While specific embodiments of the present invention have been presented, it should be understood that the invention can be further improved. In conclusion, in accordance with the principles of the present invention, this application is intended to include all modifications, uses, or improvements to the present invention made by prior art known in the art, beyond the scope already disclosed in this application. Some basic features may be applied according to the claims appended below.

[0278] Industrial application

[0279] The present invention revealed that by weakening or knocking out the BBD29_11265 gene, the product coated by this gene affects the ability to produce L-glutamic acid. Recombinant strains were obtained by introducing point mutations into the coding sequence, increasing the copy number of this gene, or overexpressing it, and the obtained strains were advantageous for producing high concentrations of glutamic acid compared to unmodified strains.

[0280] Specifically, the present invention first introduced a point mutation by allelic substitution into the coding region (SEQ ID NO: 1) of the BBD29_11265 gene of Corynebacterium glutamicum CGMCC No. 21220 to construct the genetically modified bacterium YPG-013 containing the point mutation (GA). In the generated bacteria, the wild-type BBD29_11265 gene or its mutant gene BBD29_11265 G70A To further investigate and verify whether the overexpression of can increase the production of L-glutamate, the exogenous gene was either integrated into the host chromosome or expressed extrachromosomally via a plasmid, respectively, and the BBD29_11265 gene or BBD29_11265 in the genome and plasmidG70A Engineered bacteria YPG-014, YPG-015, YPG-016, and YPG-017 were constructed to overexpress the gene. Experimental results showed that the BBD29_11265 gene and its variants are involved in the biosynthesis of L-glutamic acid, and the accumulation of L-glutamic acid in microorganisms can be regulated by the overexpression, knockout, or point mutation (e.g., point mutation) of the BBD29_11265 gene. In bacteria produced by inducing point mutations in the coding region of the BBD29_11265 gene or the BBD29_11265 gene or its mutant gene BBD29_11265 G70A Overexpression of may help increase L-glutamate production and conversion rates, but knockout or attenuation of the BBD29_11265 gene was adverse to L-glutamate accumulation. The BBD29_11265 gene and its variants (e.g., BBD29_11265 G70A The gene can be used to construct genetically engineered strains for L-glutamic acid production, promote the improvement of L-glutamic acid yield, and cultivate high-yield, high-quality strains suitable for industrial production, which has extensive application value and significant economic importance for the industrial production of L-glutamic acid.

[0281]

Claims

Claim 1 As a bacterium that produces L-glutamic acid, the bacterium possesses enhanced production of L-glutamic acid compared to unmodified bacteria, the bacterium contains a polynucleotide encoding the amino acid sequence of SEQ ID NO: 3 and having a point mutation, the enhanced production of L-glutamic acid is caused by the overexpression of the polynucleotide encoding the amino acid sequence of SEQ ID NO: 3 and having a point mutation in the bacterium, the point mutation of the polynucleotide encoding the amino acid sequence of SEQ ID NO: 3 causes alanine at site 24 of the amino acid sequence of SEQ ID NO: 3 to be substituted with threonine, and the bacterium is Corynebacterium glutamicum ( Corynebacterium glutamicum Bacteria characterized by being ). Claim 2 A bacterium according to claim 1, characterized in that the polynucleotide encoding the amino acid sequence of SEQ ID NO: 3 comprises the polynucleotide sequence of SEQ ID NO:

1. Claim 3 A bacterium according to paragraph 2, characterized in that the point mutation comprises a base point mutation from guanine (G) to adenine (A) at the 70th site of the polynucleotide sequence of SEQ ID NO:

1. Claim 4 In paragraph 3, the bacterium is characterized in that the polynucleotide having a point mutation comprises the polynucleotide sequence of SEQ ID NO:

2. Claim 5 The bacteria according to claim 1, characterized in that the bacteria is Corynebacterium glutamicum CGMCC No. 21220 or ATCC 13869. Claim 6 As a polynucleotide, the polynucleotide is characterized by encoding the amino acid sequence of SEQ ID NO:

4. Claim 7 In claim 6, the polynucleotide is formed from a point mutation of a base at the 70th site of the polynucleotide sequence of SEQ ID NO: 1; and the point mutation is a point mutation of a base from guanine (G) to adenine (A) at the 70th site of the polynucleotide sequence of SEQ ID NO: 1, characterized in that the polynucleotide is formed from a point mutation of a base. Claim 8 In claim 7, the polynucleotide is characterized as being the polynucleotide sequence of SEQ ID NO:

2. Claim 9 A protein characterized by having an amino acid sequence of SEQ ID NO:

4. Claim 10 A recombinant vector characterized by comprising a polynucleotide of any one of claims 6 to 8 as a recombinant vector. Claim 11 A recombinant microorganism characterized by comprising a polynucleotide of any one of claims 6 to 8. Claim 12 A method for producing L-glutamic acid, wherein the method comprises the step of culturing bacteria according to any one of claims 1 to 5, and the step of recovering L-glutamic acid from the culture. Claim 13 delete Claim 14 delete Claim 15 delete Claim 16 delete Claim 17 delete Claim 18 delete Claim 19 delete Claim 20 delete

Images