Method for identification of endermic tree species Stewartia koreana genotypes using microsatellite markers

Abstract

The present invention relates to a method for identifying individual Styrax japonica trees using a microsatellite marker, comprising a microsatellite marker composition for identifying individual Styrax japonica trees, a kit for identifying individual Styrax japonica trees comprising the microsatellite marker composition, and a method for identifying individual Styrax japonica trees using the microsatellite marker composition or the kit. By using the microsatellite marker composition of Styrax japonica according to the present invention, high affinity can be secured during the binding stage, resulting in very high analytical stability and the ability to search for various alleles of Styrax japonica, thereby achieving an individual identification rate of over 99.99%. Therefore, it will be very useful for establishing individual DNA fingerprint information for the genetic diversity assessment and management of Styrax japonica. Consequently, it can be utilized as a scientific authentication technology to preserve the genetic diversity of Styrax japonica, a native Korean tree species, and to cultivate, distribute, and manage superior individuals for purposes such as medicinal resources.

Description

Technology Field

[0001] The present invention relates to a method for identifying individual specimens of Styrax japonica using a microsatellite marker, and more specifically, to a microsatellite marker composition for identifying individual specimens of Styrax japonica, a kit for identifying individual specimens of Styrax japonica comprising said microsatellite marker composition, and a method for identifying individual specimens of Styrax japonica using said microsatellite marker composition or kit. Background Technology

[0003] As global interest in well-being and eco-friendliness increases, the bio-material industry based on natural resources is also growing rapidly. Since the Nagoya Protocol (Protocol on the Fair and Equitable Sharing of Benefits from Access to and Use of Genetic Resources Attached to the Convention on Biological Diversity) entered into force in 2014, securing sovereignty over genetic resources for each country has become very important.

[0004] Korea's bio-industry relies on imports for more than 67% of natural resource materials. Therefore, securing domestic genetic resources has become important in response to the growth of the biomaterial industry and the entry into force of the Nagoya Protocol. Accordingly, the Korea Forest Service (2023) established the 'Plan to Revitalize the Forest Bio-industry Using Forest Bio-resources (24–28),' which contains four strategies to build a foundation for utilizing forest bio-resources through the discovery and securing of promising forest bio-resource materials and to intensively foster the forest bio-industry.

[0005] The 2022 Convention on Biological Diversity established the Global Biodiversity Framework for conservation and sustainable use in response to the threat of global species decline caused by climate change. This Framework emphasized the maintenance of genetic diversity as a key essential element for enhancing species adaptability to climate change. Accordingly, it recommended that countries assess the genetic diversity of populations of rare, endangered, or endemic species and strive to continuously maintain it.

[0006] Korean dogwood ( Stewartia koreana Stewartia nakai is a deciduous tree species belonging to the genus Stewartia of the family Theaceae. Globally, 30 species of Stewartia are known to exist, distributed in Korea, China, and Japan. Stewartia nakai is an endemic species found only in Korea, primarily distributed in southern regions such as Mt. Jirisan and Mt. Gayasan [Kwon Hye-jin, Song Ho-kyung, Kim Mu-yeol. 2008. Stewartia nakai ( Stewartia koreana Taxonomic re-examination of , Theaceae). Korean Journal of Plant Taxonomy 38(3): 233-250].

[0007] Stewartia koreana is resistant to environmental pollution, has large and beautiful flowers, and has high ornamental value due to the patterns on its bark, so it has been used as street trees, park trees and garden trees. Stewartia koreana is also known as a resource with pharmacological functions. In *Original Color Illustrated Guide to Korean Herbal Medicine* (2000), the bark and root bark of Stewartia koreana are recorded as Moran (帽蘭) with pharmacological effects. Since then, numerous studies have been conducted on substances extracted from the leaves and branches of Stewartia koreana, and it has been found to have anti-inflammatory and antioxidant effects (Bae Jong-Jin, Kwak Jong-Hwan. 2015. Phenolic Components from the Branches of Stewartia koreana. *Korean Journal of Pharmacognosy*. 46(4): 303-308). In recent years, it has been found that the leaf extract of Stewartia koreana also has antibacterial activity, and its potential as a natural-derived antibacterial material has been reported (Lee Sang-Kyun, Kim Hye-Soo, Cho Soo-Jung. 2023. Effect of Stewartia koreana Extract on Biofilm Formation of Pseudomonas aeruginosa. *Korean Journal of Life Science*. 33(11): 936-943). Accordingly, the leaves of Stewartia koreana are registered as edible medicinal resources with the US FDA, and are a forest biological resource with high economic value that can be used in the development of functional foods, cosmetics, and pharmaceuticals (Ju-Yeong Kang, Yu Hwa Kim, Youngdae Yoon, Bong-Gyu Kim. 2023. Quantitative analysis of hyperoside and isoquercitrin in methanolic extract of Stewartia koreana leaves using HPLC-DAD. *Journal of Applied Biological Chemistry*. 66: 436-446).

[0008] Although Stewartia koreana has high utilization value as a useful forest biological resource, it has a low success rate of cuttage propagation, and due to the double dormancy of seeds, germination takes more than 2 years, resulting in low seed propagation efficiency and low dissemination efficiency through proliferation. Therefore, it is necessary to properly preserve the native populations distributed in Korea.

[0009] Genetic diversity is a term referring to the diversity of genes distributed within biological species and is one of the three elements of biodiversity under the Convention on Biological Diversity. Genetic diversity serves as a driving force for biological species to adapt to and evolve in specific environments, and in terms of species utilization, it plays an important role in increasing the potential for future resource utilization. Therefore, there is a high need to develop high-resolution (analytical stability and polymorphic information) DNA markers and individual identification methods using them to maintain the genetic diversity of Styrax japonica and to ensure conservation and sustainable use that takes genetic diversity into account.

[0010] Genetic diversity can be analyzed using DNA markers. DNA markers are molecular biological analysis techniques that indicate genetic differences among biological species, and PCR, which utilizes DNA polymerase, has been the primary method used. Among these, microsatellites are regions in the genome of biological species where units consisting of 1 to 6 nucleotides appear repeatedly (simple sequence repeats); they are widely used as DNA marker techniques for genetic diversity analysis or individual identification because they have a higher mutation rate than other regions. Since microsatellite markers are developed based on the nucleotide sequence information of biological species, they are reported to provide significantly higher analytical stability compared to arbitrary primer techniques (RAPD, AFLP, ISSR) that can be used without relying on nucleotide sequence information (Lee, Je-wan, Baek, Seung-hun, Hong, Kyung-nak, Hong, Yong-pyo, Lee, Seok-woo, Ahn, Ji-young. 2015. Development and Characterization of Simple Sequence Repeat Markers in Korean Pine Chloroplasts. Journal of the Korean Forestry Society. 104(4):549-557).

[0011] However, to date, no microsatellite markers have been developed for the identification of individual Styrax japonica trees that offer high analytical stability and polymorphic information. The problem to be solved

[0013] Accordingly, the inventors have completed the present invention as a result of continuous research aimed at developing a microsatellite marker with high analytical stability and polymorphic information as a genetic diversity assessment technology for the conservation, management, and sustainable use of genetic resources of the Korean native species, Styrax japonica.

[0014] Therefore, the objective of the present invention is to provide a microsatellite marker composition for individual identification of Styrax japonica.

[0015] Another objective of the present invention is to provide a kit for individual identification of Styrax japonica comprising the microsatellite marker composition.

[0016] Another objective of the present invention is to provide a method for identifying individual specimens of Styrax japonica using the microsatellite marker composition or the kit. means of solving the problem

[0018] To achieve the objective of the present invention, the present invention provides a microsatellite marker composition for individual identification of Styrax japonica.

[0019] In the present invention, the microsatellite marker composition comprises a primer pair of SEQ ID NOs 13 and 14 specific to microsatellite marker SK_116, a primer pair of SEQ ID NOs 11 and 12 specific to microsatellite marker SK_092, and a primer pair of SEQ ID NOs 7 and 8 specific to microsatellite marker SK_060.

[0020] The microsatellite marker composition of the present invention may preferably further include a primer pair of SEQ ID NOs. 9 and 10 specific to the microsatellite marker SK_084.

[0021] In addition, the microsatellite marker composition of the present invention comprises a primer pair of SEQ ID NOs. 1 and 2 specific to microsatellite marker SK_006, a primer pair of SEQ ID NOs. 3 and 4 specific to microsatellite marker SK_018, a primer pair of SEQ ID NOs. 27 and 28 specific to microsatellite marker SK_221, a primer pair of SEQ ID NOs. 5 and 6 specific to microsatellite marker SK_046, a primer pair of SEQ ID NOs. 15 and 16 specific to microsatellite marker SK_162, a primer pair of SEQ ID NOs. 17 and 18 specific to microsatellite marker SK_183, a primer pair of SEQ ID NOs. 29 and 30 specific to microsatellite marker SK_230, a primer pair of SEQ ID NOs. 33 and 34 specific to microsatellite marker SK_251, a primer pair of SEQ ID NOs. 21 and 22 specific to microsatellite marker SK_209, and a microsatellite marker It may additionally include one or more primer pairs selected from the group consisting of the primer pair of SEQ ID NOs 31 and 32 specific to SK_250, the primer pair of SEQ ID NOs 19 and 20 specific to microsatellite marker SK_207, the primer pair of SEQ ID NOs 25 and 26 specific to microsatellite marker SK_218, the primer pair of SEQ ID NOs 35 and 36 specific to microsatellite marker SK_291, and the primer pair of SEQ ID NOs 23 and 24 specific to microsatellite marker SK_215.

[0022] Most preferably, the microsatellite marker composition of the present invention may include the primer pair of SEQ ID NOs 1 and 2, the primer pair of SEQ ID NOs 3 and 4, the primer pair of SEQ ID NOs 5 and 6, the primer pair of SEQ ID NOs 7 and 8, the primer pair of SEQ ID NOs 9 and 10, the primer pair of SEQ ID NOs 11 and 12, the primer pair of SEQ ID NOs 13 and 14, the primer pair of SEQ ID NOs 15 and 16, the primer pair of SEQ ID NOs 17 and 18, the primer pair of SEQ ID NOs 19 and 20, the primer pair of SEQ ID NOs 21 and 22, the primer pair of SEQ ID NOs 23 and 24, the primer pair of SEQ ID NOs 25 and 26, the primer pair of SEQ ID NOs 27 and 28, the primer pair of SEQ ID NOs 29 and 30, the primer pair of SEQ ID NOs 31 and 32, the primer pair of SEQ ID NOs 33 and 34, and the primer pair of SEQ ID NOs 35 and 36.

[0023] The inventors obtained genetic information of Styrax japonica, explored microsatellite regions based on this genetic information, and designed primers to develop 18 types of microsatellites (SK_006, SK_018, SK_046, SK_060, SK_084, SK_092, SK_116, SK_162, SK_183, SK_207, SK_209, SK_215, SK_218, SK_221, SK_230, SK_250, SK_251, SK_291) that enable the exploration of polymorphisms in Styrax japonica individuals, and discovered 18 primer pairs (SEQ Nos. 1 to 36) that specifically amplify these microsatellites (Examples 1 and 2, Table 2 and Table 3).

[0024] In the present invention, the term 'microsatellite' refers to a simple sequence repeat (SSR) region having a structure in which 1 to 6 base sequences are repeated.

[0025] Since the number of repeats of microsatellite repeat units can vary depending on the individual or species, the individual or species can be identified by designing a unique sequence on the genome among the base pairs on both sides of the repeating microsatellite region as a primer sequence, performing PCR amplification, and then comparing the size of the obtained product.

[0026] In the present invention, the term 'marker' may refer to a microsatellite that enables individual identification by exhibiting polymorphism resulting from the existence of a variation in the number of repetitions of a microsatellite repeating unit, or a primer pair capable of amplifying it.

[0027] In the present invention, the term 'primer' refers to a short nucleic acid sequence having a short free 3' terminal hydroxyl group, capable of forming base pairs with a complementary template, and functioning as a starting point for template strand replication. 'Primer pair' refers to a combination of a forward primer and a reverse primer.

[0028] In the present invention, the primer can initiate DNA synthesis in the presence of a reagent for a polymerization reaction (i.e., DNA polymerase or reverse transcriptase) and four different deoxyribonucleotides at an appropriate buffer solution and temperature. Additionally, the base sequence of the primer can be modified using a label that can provide a detectable signal directly or indirectly. Examples of labels include radioactive isotopes, fluorescent molecules, and biotin.

[0029] The allele size amplified by the microsatellite marker composition according to the present invention ranges from 148 to 330 bp, and the number of alleles is 3 to 16 (Tables 2 and 3).

[0030] According to an embodiment of the present invention, when analyzed using primer pairs specific to (able to amplify) the three types of microsatellite markers (SK_116, SK_092, SK_060), 91 individuals of Styrax japonica could be identified with a unique genotype with an individual identification rate of 99.99%, and when a primer pair specific to the microsatellite marker SK_084 was additionally used, the individual identification rate was 99.99% and the average individual recognition ability (the probability that each individual happens to have the same genotype) was 0.000000505, showing very high polymorphism (Example 3, Tables 4–7). When analyzed using an additional primer pair specific to any one of the 14 additional microsatellite markers (SK_006, SK_018, SK_221, SK_046, SK_162, SK_183, SK_230, SK_251, SK_209, SK_250, SK_207, SK_218, SK_291 and SK_215), the individual identification rate was 100.00% and the average individual recognition power was up to 0.0000000000000003%, exhibiting very high polymorphism (Example 3, Tables 4–7).

[0031] According to another object of the present invention, the present invention provides a kit for individual identification of a Styrax japonica comprising the microsatellite marker composition.

[0032] The kit of the present invention may be a PCR kit. The kit may additionally include DNA polymerase, deoxynucleotides (dNTPs), PCR buffer solution, test tubes, suitable containers, etc. Additionally, it may include a pair of primers specific to a gene used as a quantitative control.

[0033] The kit of the present invention may additionally include a user guide describing optimal reaction execution conditions. The guide is a printed document explaining the use of the kit, for example, the method of preparing PCR buffer, the presented reaction conditions, etc. The guide includes instructions in the form of a pamphlet or leaflet, a label attached to the kit, and on the surface of a package containing the kit. Additionally, the guide includes information disclosed or provided through electronic media such as the Internet.

[0034] In addition, according to another object of the present invention, the present invention provides a method for identifying individuals of the Japanese dogwood using the microsatellite marker composition or the kit.

[0035] Specifically, the method for identifying individual specimens of the Korean dogwood tree according to the present invention

[0036] i) A step of isolating genomic DNA from a biological sample of a Styrax japonica individual;

[0037] ii) a step of performing a PCR reaction using genomic DNA and the microsatellite marker composition or the kit, and

[0038] iii) includes a step of analyzing the amplified product of the PCR reaction.

[0039] In the present invention, 'biological sample' refers to a sample containing genome DNA of the Japanese dogwood tree. Specifically, the biological sample may be, but is not limited to, the leaves, stems, roots, seeds, and parts thereof of the Japanese dogwood tree.

[0040] Methods for isolating genomic DNA from biological samples may utilize methods known in the art and are not specifically limited to any particular method.

[0041] PCR reactions may utilize methods known in the art, such as Polymerase Chain Reaction, multiplex Polymerase Chain Reaction (multiplex PCR), competitive Polymerase Chain Reaction, real-time Polymerase Chain Reaction, real-time quantitative Polymerase Chain Reaction, DNA chips, or loop-mediated isothermal amplification.

[0042] The analysis of the amplification product of the PCR reaction may utilize methods known in the art, such as gel electrophoresis, capillary electrophoresis, DNA chips, radiometric measurements, fluorescence measurements, or phosphorescence measurements, but is not limited thereto. Depending on the size of the amplification product, agarose gel electrophoresis or acrylamide gel electrophoresis may be used for the gel electrophoresis. In the fluorescence measurement method, when PCR is performed with Cy-5 or Cy-3 labeled at the 5'-terminus of the marker, the target sequence is labeled with a detectable fluorescent label, and this labeled fluorescence can be measured using a fluorescence detector. Additionally, in the radiometric measurement method, when performing PCR 32 P or 35 After labeling the amplification product by adding a radioactive isotope such as S to the PCR reaction solution, radioactivity can be measured using a radioactivity measuring instrument, for example, a Geiger counter or a liquid scintillation counter. Effects of the invention

[0044] By using the microsatellite marker composition of Styrax japonica according to the present invention, high affinity can be secured during the binding stage, resulting in very high analytical stability and the ability to search for various alleles of Styrax japonica, thereby achieving an individual identification rate of over 99.99%. Therefore, it will be very useful for establishing individual DNA fingerprint information for the genetic diversity assessment and management of Styrax japonica. Consequently, it can be utilized as a scientific authentication technology to preserve the genetic diversity of Styrax japonica and to cultivate, distribute, and manage superior individuals for purposes such as garden trees and medicinal resources. Brief explanation of the drawing

[0046] FIG. 1 is a graph showing the results of individual polymorphism analysis (allele comparison) of the microsatellite marker SK_116 according to the present invention (the horizontal axis represents the size of the allele, and the peak represents the amplified DNA product (allele)). Figure 2 is a graph showing the results of individual polymorphism analysis (allele comparison) of microsatellite marker SK_092 according to the present invention. Specific details for implementing the invention

[0047] The present invention is further explained in detail by the following examples. These examples are intended to illustrate the invention and the scope of the invention should not be limited by them.

[0048] Example 1. Development of a microsatellite marker for identifying individual Japanese dogwood trees

[0049] < Construction of a Korean Stellaria DNA Library >

[0050] To analyze the genetic information of Styrax japonica, a genome DNA library was constructed by extracting DNA from leaves collected from a population in Jirisan.

[0051] Specifically, 1 µg / µl of DNA is Ion Shear TMThe DNA was cut into arbitrary sizes using the Plus Reagents Kit (Thermo Fisher Scientific). The ends of the cut products were repaired using the Ion Plus Fragment Library Kit (Thermo Fisher Scientific), and a specific adapter for Ion Proton sequencing was attached. DNA fragments of 230–270 bp were selected using beads, and PCR amplification was performed. The amplified products were sequenced using an Ion Proton (Thermo Fisher Scientific) next-generation sequencing instrument.

[0052] <Hypersatellite Region Exploration and Primer Pair Design>

[0053] The nucleotide sequences obtained above were assembled to select contigs of 500 bp or longer, and microsatellite regions were explored using the MSATCOMMANDER program. Subsequently, sequence similarity analysis was performed using BLAST.

[0054] Primer pairs were designed using the Primer3 program to amplify PCR products containing microsatellite regions for contigs containing microsatellite regions. A total of 300 primer pairs were designed from 503,111 contigs.

[0056] Example 2. Microsatellite-specific primer selection and polymorphism analysis

[0057] <Cornus kousa sample>

[0058] Considering the distribution range of large and well-preserved Styrax japonica populations distributed in Korea, leaf samples were collected from 31, 30, and 30 Styrax japonica individuals (Table 1) from Mt. Jirisan, Mt. Unjangsan, and Mt. Sobaeksan, respectively, and then the genomic DNA of each was extracted and isolated.

[0059] group Namwon City, Gyeongsangnam-do (Jirisan) Yeongju-si, Gyeongsangbuk-do (Songnisan) Jinan-gun, Jeollabuk-do (Unjangsan)

[0060] <PCR 분석>

[0061] PCR analysis was performed on 300 primer pairs designed in Example 1 using each genomic DNA as a template.

[0062] Specifically, 10 ng of DNA (template DNA) from each individual Styrax japonica tree, 1x reaction buffer, 2.5 mM MgCl2, 0.2 mM dNTPs, 0.04 μM FAM fluorescent M13(-19) sequencing primer, a mixture of 0.2 μM forward and reverse primers, and 0.1 U of Taq DNA polymerase (Biofact) were mixed, and distilled water was added to make the final reaction volume 20 μl to proceed with the PCR reaction. The PCR reaction conditions involved initial DNA modification at 94°C for 5 minutes, followed by 35 consecutive cycles of modification, primer binding, and synthesis in the order of 94°C for 30 seconds, 60°C for 30 seconds, and 72°C for 1 minute. Finally, a final synthesis step was performed at 72°C for 10 minutes. The PCR amplification product was ABI 3730 xl Fractionation was performed using equipment. Subsequently, 18 polymorphic microsatellite regions (locuses) and 18 primer pairs specific to them were selected using Gene Mapper version 5.0 and GeneAlEx version 6.41, and the results are shown in Table 2.

[0063] Locus Primer sequence (F: forward primer, R: reverse primer) (5'-3') Sequence number Repeat motif Size range (bp) SK_006 F : GTGCAACCCTCTCAACGTG 1 (TC) 21 148-190 R : ACGCTGTTGGCTTTCAACC 2 SK_018 F : AGCTCCCACAAAGCAATGG 3 (AT) 17 230-252 R : GTGCAAGTGCATGTTCCTTC 4 SK_046 F : TCACGGTCTGCAAGCAAAG 5 (AT) 15 196-214 R : CCGACGAGAAAGTGCAACC 6 SK_060 F : AAATTGGGCACCGGTCAAC 7 (AT) 15 249-273 R : GCTGGGCGGTCTTGAAATC 8 SK_084 F : GCCTTTGGAAGGAAGTGGC 9 (TC) 14 195-223 R : CCCACCCAAGCCTCTAATC 10 SK_092 F : AGGAATGGCCTGACTAGGG 11 (TC) 14 281-305 R : GCCCATAATCCAAACCCGC 12 SK_116 F : AGGGCTTCGACTTTGAGGG 13 (TC) 13 258-304 R : TTCGGACTTGATGGGTCGG 14 SK_162 F : AGTCCAGTGTATTGTTCTATCATCC 15 (See) 12 260-278 R : TGTACTTTCTTCCTAACCAAACAGG 16 SK_183 F : GGGCAATTGGTGATCTAACCG 17 (TC) 12 286-330 R : ACAGGGAGAAATGCCAGCC 18 SK_207 F : TGGTGTTCACCTCAATGAAACG 19 (AAG) 11 220-241 R : CGACATAACCATTATCGCGTGG 20 SK_209 F : GCATGGCAGCACTAGGAAG 21 (TTC) 11 224-236 R : TAAGCCCAGTCATTCCTGC 22 SK_215 F : AGGATTGTACTTATTGGAGCCC 23 (TTA) 10 159-171 R : AGAAGGAAACAGAAATCTTTGCAC 24 SK_218 F : AATAAGCCGGATTGCACGG 25 (TODAY) 10 228-246 R : ACATGGAAACATGAATTGGTGC 26 SK_221 F : ATGGCAGATGGCCAAACAG 27 (ATA)9 265-304 R : GAGATGGTCTGGGACAGAAATG 28 SK_230 F : GGAGGGCCCAAACAAAGTC 29 (TCT)9 172-193 R : TGCACCATCTACGTGGGTC 30 SK_250 F : GGTAGGTGCGAGTGGTTAAG 31 (AAT)8 297-303 R : GAAACCGCAGACAAGGCTC 32 SK_251 F : AGATGACTCGCACATATTACCG 33 (TATC)8 185-205 R : AGCTTTGCTCTCCATGTTAATCC 34 SK_291 F : ATATCAATAGTGTTCTTAGCTGGAG 35 (ATACA)5 161-171 R : ACTAATCCAAATGCAGAATACGTG 36

[0064] As shown in Table 2, all of the primer pairs amplified microsatellite regions (locus) composed of 2 to 5 repeat sequence units, and the size of the microsatellite region (amplification product) varied from 148 to 330 bp depending on each microsatellite and primer pair.

[0065] In addition, the number (types) and size (bp) of alleles amplified by the microsatellite primer pairs (18 types) discovered above were analyzed, and the results are shown in Fig. 1, Fig. 2 and Table 3.

[0066] microsatellite marker Primer pair Number of alleles Allele size (bp) SK_006 Sequence No. 1,2 14 148 158 160 162 164 166 170 172 174 176 178 182 188 190 SK_018 Sequence numbers 3,4 11 230 232 234 238 240 242 244 246 248 250 252 SK_046 Sequence numbers 5,6 8 196 200 202 206 208 210 212 214 SK_060 Sequence number 7,8 11 249 251 257 259 261 263 265 267 269 271 273 SK_084 Sequence numbers 9, 10 9 195 197 203 205 207 209 211 215 223 SK_092 Sequence numbers 11, 12 12 281 283 285 287 289 291 293 295 297 299 301 305 SK_116 Sequence numbers 13, 14 16 258 260 262 264 266 268 270 272 274 276 278 280 282 284 286 304 SK_162 Sequence numbers 15, 16 8 260 266 268 270 272 274 276 278 SK_183 Sequence numbers 17, 18 14 286 292 300 304 306 308 310 312 314 316 324 326 328 330 SK_207 Sequence number 19,20 5 220 229 232 238 241 SK_209 Sequence numbers 21, 22 4 224 227 233 236 SK_215 Sequence numbers 23, 24 4 159 165 168 171 SK_218 Sequence numbers 25, 26 5 228 234 237 240 246 SK_221 Sequence numbers 27, 28 10 265 268 274 277 280 283 286 295 301 304 SK_230 Sequence number 29,30 7 172 178 181 184 187 190 193 SK_250 Sequence numbers 31, 32 3 297 300 303 SK_251 Sequence numbers 33, 34 5 185 193 197 201 205 SK_291 Sequence numbers 35, 36 3 161 166 171

[0067] Figure 1 illustrates the results of a polymorphism analysis of the microsatellite marker SK_116. PCR reactions were performed on four individuals of Styrax japonica from the Jirisan population using primer pairs of SEQ ID NOs. 13 and 14, and the DNA amplification products, the alleles, were compared using the Gene Mapper version 5.0 program. In the first individual, amplified DNA (allele) sizes of 272 bp and 286 bp were observed simultaneously; in the second individual, 272 bp was observed; in the third individual, 260 bp and 274 bp were observed simultaneously; and in the fourth individual, 260 bp and 268 bp were observed simultaneously.

[0068] Figure 2 illustrates the results of a polymorphism analysis of the microsatellite marker SK_092. PCR reactions were performed on four individuals of the Japanese dogwood from the Jirisan population using primer pairs of SEQ ID NOs. 11 and 12, and the DNA amplification products, the alleles, were compared using the Gene Mapper version 5.0 program. The amplified DNA (allele) sizes of 293 bp and 297 bp were observed simultaneously in the first individual, 283 bp in the second individual, 285 bp and 299 bp in the third individual, and 295 bp in the fourth individual.

[0069] As shown in Table 3, it can be confirmed that polymorphism is high, as the allele sizes amplified by 18 types of primer pairs differ from one another, and the number of allele types also varies from 3 to 16. The number of allele types identified by the SK_116 primer pair was the highest at 16, while the SK_250 and SK_291 primer pairs had the fewest at 3.

[0071] Example 3. Identification of Korean dogwood individuals using microsatellite markers

[0072] Individual identification analysis was performed on samples derived from 31, 30, and 30 individuals of Styrax japonica from the Jirisan, Unjangsan, and Sobaeksan populations shown in Table 1, respectively, using 18 primer pairs in which polymorphism was confirmed in Example 2.

[0073] Specifically, genomic DNA was isolated from 91 specimens of Styrax japonica in the same manner as in the PCR analysis of Example 2, amplified using a primer set according to the present invention, and the amplified products, the alleles, are shown in Tables 4 to 6.

[0074] Jirisan individual Genotype (0 indicates amplification below the peak reference value, other numbers indicate the amplified allele size) Geography 1 166 174 232 242 202 212 263 269 195 197 283 295 0 0 270 274 306 306 229 238 233 233 165 165 228 240 280 283 181 181 297 297 185 197 171 171 Geography 2 172 176 230 242 196 202 257 261 195 205 283 293 284 284 272 274 304 308 229 229 233 233 165 165 240 246 277 283 181 181 297 297 197 201 166 171 Geography 3 166 178 242 244 196 210 257 259 195 205 283 297 270 272 274 274 308 312 229 229 233 233 165 165 228 240 277 277 190 190 297 297 197 201 166 171 Geography 4 172 176 238 242 202 202 271 271 195 197 293 295 272 272 274 276 304 308 229 229 233 233 165 165 240 240 283 283 181 190 297 297 197 197 166 166 Geography 5 174 190 242 246 196 202 261 271 195 197 283 305 272 282 274 278 308 308 229 232 233 233 165 168 240 240 274 277 181 181 300 300 197 201 166 171 Geography 6 174 190 242 246 196 202 261 271 195 197 283 305 272 282 274 278 308 308 229 232 233 233 165 168 240 240 274 277 181 181 297 297 197 201 166 171 Geography 7 172 174 242 242 206 212 261 271 205 207 295 301 286 286 272 276 286 304 229 232 233 233 165 165 240 240 277 280 181 184 297 303 197 197 166 171 Geography 8 174 190 242 248 202 202 257 271 195 197 283 283 272 286 260 274 304 308 229 229 233 233 165 165 240 240 283 283 181 190 297 297 185 197 166 171 Geography 9 170 190 242 248 196 202 257 271 195 197 293 297 272 272 274 276 286 308 229 229 233 233 165 171 240 240 277 283 184 190 297 300 197 201 166 171 Geography 10 158 190 246 248 196 214 261 269 205 205 283 283 260 274 276 276 310 316 229 238 233 233 165 165 240 240 277 283 181 184 297 297 201 201 171 171 Geography 11 158 172 246 252 206 210 261 273 195 205 285 299 260 268 272 274 310 324 229 229 233 233 165 165 240 240 277 283 181 190 297 303 201 201 166 171 Geography 12 174 174 242 242 196 196 269 269 195 197 295 295 270 272 272 274 292 308 238 238 233 233 165 165 228 240 277 283 184 190 297 303 197 201 171 171 Geography 13 158 158 240 242 202 206 257 271 195 205 283 295 270 270 274 274 292 310 229 232 233 236 165 165 240 246 277 280 184 190 300 300 201 201 171 171 Geography 14 158 164 246 246 202 214 257 271 195 205 283 293 270 280 268 276 300 308 229 229 233 233 165 165 228 240 274 283 181 181 297 297 185 197 171 171 Geography 15 158 166 244 246 196 210 259 271 195 205 295 297 282 282 268 274 300 316 220 220 233 236 165 171 228 240 280 283 184 184 297 297 201 201 171 171 Geography 16 170 170 250 252 196 210 269 271 203 205 283 295 278 282 268 276 306 310 220 238 236 236 165 171 237 240 277 283 184 184 297 297 201 201 171 171 Geography 17 158 178 246 248 196 196 249 249 195 205 291 299 268 272 274 274 308 308 229 229 233 233 165 165 240 240 283 283 181 184 297 300 201 201 166 166 Geography 18 158 166 242 242 202 212 261 261 195 197 283 289 262 282 268 274 306 312 229 229 233 233 165 165 240 240 277 280 184 190 297 300 201 201 171 171 Geography 19 166 174 232 242 212 212 257 263 195 205 283 283 260 268 266 272 300 310 229 229 233 233 165 165 228 240 274 277 190 190 297 297 201 205 166 171 Geography 20 158 166 248 250 202 210 257 261 195 195 285 293 258 260 260 274 308 326 229 229 233 233 159 165 228 240 283 283 181 190 297 297 201 201 171 171 Geography 21 170 174 232 242 196 202 269 273 195 197 283 285 260 272 274 274 292 308 229 229 233 236 165 171 228 240 277 283 181 184 297 300 201 201 171 171 Geography 22 166 170 240 242 210 212 257 271 195 205 287 297 264 264 260 274 308 308 232 232 233 233 165 165 228 240 280 286 181 190 300 300 201 201 171 171 Geography 23 166 174 242 242 208 212 263 263 205 207 291 299 262 270 260 266 300 308 229 229 233 236 165 165 240 240 277 286 181 181 300 300 197 201 171 171 Geography 24 148 176 242 242 196 212 257 263 205 209 291 299 262 272 272 274 300 300 229 232 233 233 165 165 240 240 280 286 181 184 297 303 193 201 166 171 Geography 25 164 188 242 250 196 206 263 271 197 205 283 299 262 284 268 274 308 310 229 232 233 236 165 165 228 240 277 283 181 184 297 303 201 201 171 171 Geography 26 158 158 242 242 206 210 257 263 197 205 283 299 264 264 260 274 292 310 229 229 233 233 165 165 228 240 274 277 181 184 297 300 197 201 171 171 Geography 27 174 188 242 242 206 206 257 261 195 197 283 283 272 272 272 276 292 314 229 229 233 233 165 165 228 240 277 286 184 187 297 303 197 201 166 166 Geography 28 158 166 242 250 206 210 257 261 195 197 283 283 272 272 272 274 310 314 229 229 233 233 165 165 228 240 277 277 181 184 300 303 197 201 171 171 Geography 29 162 166 248 248 210 212 257 257 195 195 285 287 264 264 270 274 308 308 229 232 233 233 165 165 228 240 268 283 184 187 297 297 201 205 166 171 Geography 30 176 176 232 240 196 202 257 259 195 197 285 295 260 260 274 274 304 310 220 232 233 233 165 165 228 240 274 301 184 184 297 300 197 197 171 171 Geography 31 158 174 242 242 196 202 261 271 195 195 293 297 262 262 272 274 310 314 229 232 233 233 165 165 228 240 274 283 184 184 297 303 197 201 171 171

[0075] Unjangsan individual genotype Unjang 1 164 166 242 246 206 206 263 263 207 209 289 293 282 282 270 274 308 308 229 229 224 224 165 165 240 240 274 277 181 184 297 300 197 201 171 171 Unjang 2 166 166 248 248 206 210 263 269 211 223 293 295 282 282 270 274 308 308 229 229 233 233 165 165 240 240 274 277 181 184 297 300 197 197 171 171 Unjang 3 166 166 242 242 206 210 265 265 195 209 289 293 282 282 274 274 308 310 220 229 233 236 165 165 234 234 265 274 178 181 297 297 193 197 166 171 Unjang 4 164 182 232 242 206 208 265 265 203 215 287 293 274 276 270 274 308 308 220 229 224 233 165 165 240 240 265 274 172 184 297 300 197 201 171 171 Unjang 5 166 166 242 248 206 210 257 263 209 211 289 293 276 282 274 274 328 328 241 241 224 233 165 165 240 240 274 286 181 184 297 303 193 201 166 171 Unjang 6 166 166 242 248 196 210 263 263 207 223 289 293 270 276 274 274 310 328 229 229 224 233 165 165 240 240 274 295 181 184 297 300 197 201 171 171 Unjang 7 158 166 240 244 206 206 269 269 207 207 287 293 0 0 274 274 308 308 229 229 224 224 165 165 240 240 274 286 181 181 297 303 197 197 166 171 Unjang 8 158 166 242 244 206 206 267 269 207 211 289 293 284 284 270 274 308 308 229 229 224 224 165 165 240 240 274 295 181 184 297 300 193 197 171 171 Unjang 9 158 174 242 250 206 208 267 267 207 211 289 293 274 282 268 270 308 308 229 229 224 224 165 165 240 240 295 295 181 184 300 303 193 197 171 171 Unjang 10 162 166 242 250 206 208 263 267 207 211 289 289 274 282 270 274 308 308 229 232 224 224 165 165 240 240 295 295 181 181 297 300 193 201 171 171 Unjang 11 166 166 244 250 206 208 263 263 195 211 289 299 266 282 274 274 308 330 220 229 224 236 165 165 240 246 295 295 181 190 297 300 197 201 171 171 Unjang 12 158 162 234 242 196 206 269 273 195 211 287 293 272 274 268 274 308 308 229 229 224 233 165 165 240 240 274 277 181 181 297 297 193 201 166 171 Unjang 13 172 178 240 242 206 206 257 269 195 207 287 293 274 276 268 268 308 308 229 232 224 233 165 165 240 240 277 286 181 184 297 297 197 197 171 171 Unjang 14 166 178 242 242 206 206 263 265 207 207 287 293 282 282 274 274 308 310 229 229 224 233 165 165 228 228 277 277 181 190 297 303 201 201 171 171 Unjang 15 166 166 242 246 206 206 257 269 207 207 287 293 270 282 268 274 308 308 229 229 224 233 165 165 240 240 274 277 184 190 297 297 197 201 171 171 Unjang 16 164 178 246 248 202 206 263 263 207 211 285 293 266 274 274 274 308 308 229 229 233 233 165 165 228 240 265 277 181 184 297 297 201 205 166 171 Unjang 17 158 166 232 248 202 206 267 267 207 209 299 299 282 282 268 274 308 308 229 229 224 233 165 165 228 228 277 277 181 181 297 297 201 205 166 171 Unjang 18 164 166 244 248 206 206 263 267 207 211 283 289 270 274 268 268 308 308 229 232 224 233 165 165 228 240 295 295 181 181 297 297 201 201 171 171 Unjang 19 166 166 242 246 208 210 249 261 207 207 289 293 266 282 260 268 308 308 229 232 224 233 165 165 228 240 274 277 187 190 297 297 193 197 171 171 Unjang 20 164 166 232 242 206 206 267 269 207 209 283 287 270 270 270 274 308 308 229 232 233 233 165 165 228 240 274 277 190 190 300 300 201 201 171 171 Unjang 21 164 166 232 242 210 210 263 267 207 209 283 289 282 282 270 270 308 310 229 229 224 233 165 165 228 228 274 295 181 190 300 300 193 201 166 171 Unjang 22 166 172 248 252 206 206 257 269 209 223 293 293 274 276 274 274 308 310 229 229 224 233 165 165 240 240 274 277 181 187 297 303 197 201 171 171 Unjang 23 158 166 242 252 206 206 263 263 209 211 289 293 274 276 268 274 308 308 220 229 224 224 165 165 228 228 277 286 181 184 297 297 193 201 166 166 Unjang 24 162 166 250 250 206 206 257 257 195 209 287 293 270 282 268 274 308 308 220 229 224 236 165 165 228 240 277 295 181 184 297 300 193 201 171 171 Unjang 25 158 158 232 252 206 206 263 269 207 223 293 293 0 0 274 274 310 310 229 232 224 233 165 165 240 240 274 277 181 181 297 303 197 197 171 171 Unjang 26 166 178 240 242 206 210 263 267 207 211 289 293 276 276 268 274 306 310 229 229 224 224 165 165 240 240 265 274 181 181 297 300 197 201 171 171 Unjang 27 158 174 242 250 206 206 263 263 207 211 289 293 282 282 268 274 308 308 229 232 224 233 165 165 240 240 277 295 181 181 297 297 197 197 171 171 Unjang 28 158 166 242 244 206 206 263 267 195 211 293 293 262 262 270 274 308 310 229 229 224 233 165 165 240 240 277 295 181 181 297 300 197 197 171 171 Unjang 29 158 166 244 244 206 210 263 263 207 207 289 295 270 282 274 274 308 308 229 229 224 233 165 165 240 240 274 274 181 181 297 297 193 197 166 171 Unjang 30 158 166 232 242 206 206 263 267 207 211 293 293 276 276 270 274 308 310 229 232 224 233 165 165 240 240 274 277 181 190 297 300 197 197 171 171

[0076] Sobaeksan individual genotype Sobaek 1 158 158 238 250 200 214 251 265 195 209 297 299 260 274 270 272 306 308 229 232 227 236 165 171 228 240 304 304 184 184 300 300 201 201 166 171 Sobaek 2 170 188 238 250 196 206 263 265 203 203 293 297 260 260 268 274 308 308 229 229 227 236 165 165 228 228 274 277 184 184 297 300 201 201 166 166 Sobaek 3 158 158 242 250 200 206 257 265 195 207 289 289 304 304 268 270 306 306 229 232 233 233 165 165 228 234 274 304 181 190 297 300 201 201 171 171 Sobaek 4 166 166 240 250 200 206 257 263 195 209 289 297 260 268 270 270 306 308 229 232 233 233 165 165 240 240 304 304 184 190 300 300 193 205 171 171 Sobaek 5 158 188 242 244 206 214 257 265 207 209 283 289 266 266 270 274 306 308 229 232 227 227 165 165 240 240 277 277 184 184 297 300 201 201 171 171 Sobaek 6 170 170 244 250 200 214 251 257 209 209 293 297 266 266 270 272 308 308 232 232 233 236 165 165 228 240 283 304 184 184 300 300 205 205 171 171 Sobaek 7 170 188 242 242 200 200 257 263 211 211 283 289 260 260 270 272 306 306 229 232 233 236 171 171 228 240 274 277 181 184 297 300 201 205 166 171 Sobaek 8 158 170 242 244 200 206 257 265 195 211 283 293 266 266 268 270 306 308 229 232 236 236 165 171 240 240 277 304 181 190 297 300 205 205 166 171 Sobaek 9 158 158 238 250 196 214 257 263 195 203 283 293 266 266 270 270 306 308 229 229 233 236 165 165 228 240 274 283 184 184 300 300 201 205 166 171 Sobaek 10 158 158 244 250 206 214 257 265 195 209 293 297 274 274 270 270 308 308 232 232 233 236 165 165 240 240 274 283 184 184 300 300 201 205 171 171 Sobaek 11 158 188 238 242 202 214 257 257 195 209 289 297 260 266 270 270 308 308 229 232 227 236 165 165 228 228 274 277 184 184 300 300 197 201 171 171 Sobaek 12 158 166 250 250 206 210 265 265 195 211 283 297 260 260 272 274 308 308 229 229 233 233 165 165 228 240 283 283 184 184 297 300 197 201 166 171 Sobaek 13 166 166 242 250 196 206 265 265 195 211 299 299 260 260 270 274 308 308 229 229 227 233 165 165 228 228 274 283 184 184 297 300 197 201 171 171 Sobaek 14 158 158 250 250 210 210 257 257 209 211 283 283 260 260 270 272 306 308 229 232 227 233 165 165 228 240 274 304 184 193 300 300 197 201 161 171 Sobaek 15 158 158 244 244 206 206 251 257 195 209 299 299 266 266 270 272 308 308 229 232 236 236 165 171 240 240 274 277 184 190 300 300 201 201 166 171 Sobaek 16 166 170 244 250 206 206 257 257 195 209 283 289 260 260 274 276 308 308 229 232 233 233 165 165 240 240 274 304 184 190 297 297 201 201 166 166 Sobaek 17 166 170 250 250 206 206 257 271 203 209 287 289 0 0 268 272 306 308 229 232 233 233 165 165 234 240 274 283 184 190 300 303 201 201 171 171 Sobaek 18 158 188 244 250 200 206 257 263 209 209 283 299 304 304 268 270 306 308 229 232 227 233 165 165 240 240 274 277 184 184 297 300 201 201 166 171 Sobaek 19 158 162 240 250 210 214 257 257 195 195 289 299 274 274 270 272 306 306 229 232 233 233 165 171 228 240 274 277 184 184 300 300 201 201 166 171 Sobaek 20 158 162 240 250 202 214 251 257 195 195 289 299 304 304 268 272 306 306 229 232 233 236 165 171 234 240 274 304 184 184 300 303 201 201 166 166 Sobaek 21 158 170 250 250 200 206 251 257 197 211 293 297 272 274 270 272 308 308 229 232 233 236 165 165 228 240 277 304 184 184 300 300 193 201 171 171 Sobaek 22 158 162 242 250 202 202 257 257 209 209 289 293 274 274 272 274 306 308 232 232 233 233 165 165 228 240 277 277 181 184 297 300 201 201 161 166 Sobaek 23 170 170 238 244 200 206 257 265 209 211 283 289 304 304 270 272 308 308 229 232 233 236 165 171 228 240 277 277 184 190 300 300 201 205 171 171 Sobaek 24 158 170 242 250 202 206 265 265 195 211 283 293 274 274 268 274 306 308 229 232 227 236 165 171 240 240 277 283 184 190 297 297 197 201 171 171 Sobaek 25 158 158 242 250 206 214 257 257 195 211 283 289 260 274 270 270 306 308 232 232 227 227 165 165 228 240 283 283 181 184 300 300 201 201 166 171 Sobaek 26 158 166 242 244 214 214 251 265 195 207 293 299 0 0 272 272 306 308 232 232 227 227 165 165 240 240 274 283 184 190 300 300 201 205 166 171 Sobaek 27 160 170 238 242 202 206 265 265 195 209 293 297 274 274 268 272 306 308 232 232 236 236 165 171 228 240 277 277 184 184 297 300 193 193 171 171 Sobaek 28 158 166 250 250 206 214 257 265 195 211 281 283 0 0 270 274 308 308 229 229 227 233 165 165 240 240 274 304 181 181 297 300 201 205 171 171 Sobaek 29 158 166 250 250 196 206 257 257 203 211 281 283 304 304 270 274 308 308 229 229 233 233 165 165 228 240 274 304 181 181 297 300 197 201 166 171 Sobaek 30 166 170 240 244 206 206 257 265 195 195 293 293 274 274 270 274 308 308 229 232 233 236 165 165 228 240 274 277 184 190 297 300 201 201 171 171

[0077] In the tables above, '0' represents a filtered value during data analysis, indicating cases where the peak was amplified below the reference value, while the other numbers represent the size of the amplified alleles in three-digit increments.

[0078] As shown in Tables 4 to 6, when comparing individual genotypes analyzed with the microsatellite marker composition (18 primer pairs) according to the present invention, 91 individuals of Styrax japonica from the Jirisan, Unjangsan, and Sobaeksan populations were identified as having unique genotypes.

[0079] Mean of PI =∑ pi 4 +∑∑(2 pipj ) 2 (PI = object recognition ability of each marker, Pi and Pj are each i The second and j The frequency of the nth allele was calculated and shown in Table 7.

[0080] Marker (number) Object recognition ability Marker combinations Object recognition ability when using combination Individual identification rate SK_116(1) 0.019489 1 　 　 SK_092(2) 0.043729 1+2 0.000852 99.91% SK_060(3) 0.044276 1+2+3 0.000038 99.99% SK_084(4) 0.053564 1+2+3+4 0.000002 99.99% SK_006(5) 0.055123 1+2+3+4+5 0.000000 100.00% SK_018(6) 0.060020 1+2+3+4+5+6 0.000000 100.00% SK_221(7) 0.070031 1+2+3+4+5+6+7 0.000000 100.00% SK_046(8) 0.073781 1+2+3+4+5+6+7+8 0.000000 100.00% SK_162(9) 0.097659 1+2+3+4+5+6+7+8+9 0.000000 100.00% SK_183(10) 0.160852 1+2+3+4+5+6+7+8+9+10 0.000000 100.00% SK_230(11) 0.185014 1+2+3+4+5+6+7+8+9+10+11 0.000000 100.00% SK_251(12) 0.196549 1+2+3+4+5+6+7+8+9+10+11+12 0.000000 100.00% SK_209(13) 0.211952 1+2+3+4+5+6+7+8+9+10+11+12+13 0.000000 100.00% SK_250(14) 0.275788 1+2+3+4+5+6+7+8+9+10+11+12+13+14 0.000000 100.00% SK_207(15) 0.302332 1+2+3+4+5+6+7+8+9+10+11+12+13+14+15 0.000000 100.00% SK_218(16) 0.354445 1+2+3+4+5+6+7+8+9+10+11+12+13+14+15+16 0.000000 100.00% SK_291(17) 0.441303 1+2+3+4+5+6+7+8+9+10+11+12+13+14+15+16+17 0.000000 100.00% SK_215(18) 0.695527 1+2+3+4+5+6+7+8+9+10+11+12+13+14+15+16+17+18 0.000000 100.00%

[0081] As shown in Table 7, when using a combination of three types of microsatellite markers SK_116, SK_092, and SK_060 (1+2+3), the individual identification rate was 99.99%, indicating very high polymorphism. When using a combination of four types of microsatellite markers SK_116, SK_092, SK_060, and SK_084 (1+2+3+4), the individual identification rate was 99.99%, and the average individual recognition power (the probability that each individual happens to have the same genotype; individual recognition power / number of microsatellite markers) was 0.000000505, indicating very high polymorphism.

[0082] In addition, when primer pairs specific to 14 types of microsatellite markers SK_006, SK_018, SK_221, SK_046, SK_162, SK_183, SK_230, SK_251, SK_209, SK_250, SK_207, SK_218, SK_291, and SK_215 were additionally used for analysis, the individual identification rate was 100.00% and the average individual recognition power was a maximum of 0.00000000000000003, showing very high polymorphism. These results indicate that the probability of each individual having the same genotype is only 0.0000000000000003%, meaning that the individual identification power of the microsatellite marker composition according to the present invention is very high. Industrial applicability

[0084] The Japanese pagoda tree is highly useful in the horticultural industry as a high-end garden tree, and its leaves are medicinal resources that can be used in the development of functional foods, cosmetics, and pharmaceuticals, thus having high economic value in the pharmaceutical, cosmetics, and functional food industries. Therefore, the microsatellite marker composition of the present invention can be commercialized in a convenient form such as a kit to perform individual identification of the Japanese pagoda tree with high accuracy and convenience, thereby enabling the maintenance of genetic diversity of the Japanese pagoda tree, which is highly useful in the horticultural, pharmaceutical, cosmetics, and functional food industries, and allowing for conservation and sustainable use that considers genetic diversity.

[0085] No content

Claims

Claim 1 A microsatellite marker composition for individual identification of Styrax japonica, comprising the primer pair of SEQ ID NOs 13 and 14, the primer pair of SEQ ID NOs 11 and 12, and the primer pair of SEQ ID NOs 7 and 8. Claim 2 A microsatellite marker composition for individual identification of Styrax japonica, wherein, in claim 1, the composition further comprises the primer pair of SEQ ID NOs. 9 and 10. Claim 3 A microsatellite marker composition for individual identification of Styrax japonica, wherein the composition further comprises one or more primer pairs selected from the group consisting of the primer pair of SEQ ID NOs. 1 and 2, the primer pair of SEQ ID NOs. 3 and 4, the primer pair of SEQ ID NOs. 27 and 28, the primer pair of SEQ ID NOs. 5 and 6, the primer pair of SEQ ID NOs. 15 and 16, the primer pair of SEQ ID NOs. 17 and 18, the primer pair of SEQ ID NOs. 29 and 30, the primer pair of SEQ ID NOs. 33 and 34, the primer pair of SEQ ID NOs. 21 and 22, the primer pair of SEQ ID NOs. 31 and 32, the primer pair of SEQ ID NOs. 19 and 20, the primer pair of SEQ ID NOs. 25 and 26, the primer pair of SEQ ID NOs. 35 and 36, and the primer pair of SEQ ID NOs. 23 and 24. Claim 4 In claim 2, a microsatellite marker for individual identification of Styrax japonica comprising the primer pairs of SEQ ID NOs. 1 and 2, the primer pairs of SEQ ID NOs. 3 and 4, the primer pairs of SEQ ID NOs. 5 and 6, the primer pairs of SEQ ID NOs. 7 and 8, the primer pairs of SEQ ID NOs. 9 and 10, the primer pairs of SEQ ID NOs. 11 and 12, the primer pairs of SEQ ID NOs. 13 and 14, the primer pairs of SEQ ID NOs. 15 and 16, the primer pairs of SEQ ID NOs. 17 and 18, the primer pairs of SEQ ID NOs. 19 and 20, the primer pairs of SEQ ID NOs. 21 and 22, the primer pairs of SEQ ID NOs. 23 and 24, the primer pairs of SEQ ID NOs. 25 and 26, the primer pairs of SEQ ID NOs. 27 and 28, the primer pairs of SEQ ID NOs. 29 and 30, the primer pairs of SEQ ID NOs. 31 and 32, the primer pairs of SEQ ID NOs. 33 and 34, and the primer pairs of SEQ ID NOs. 35 and 36. Composition. Claim 5 A microsatellite marker composition for individual identification of Styrax japonica, wherein, in claim 2, the allele size amplified by the composition is 148 to 330 bp. Claim 6 A microsatellite marker composition for individual identification of Styrax japonica, wherein, in claim 2, the number of allele types amplified by the composition is 3 to 16. Claim 7 A microsatellite marker composition for individual identification of Styrax japonica, wherein the individual identification rate of the composition is 99.99% or higher in claim 2. Claim 8 A kit for individual identification of Styrax japonica comprising a microsatellite marker composition according to any one of claims 1 to 7. Claim 9 In claim 8, the above kit is a PCR kit for individual identification of Styrax japonica. Claim 10 A method for identifying an individual of a Styrax japonica, comprising: i) a step of isolating genomic DNA from a biological sample of an individual Styrax japonica; ii) a step of performing a PCR reaction using the genomic DNA and a microsatellite marker composition according to any one of claims 1 to 7; and iii) a step of analyzing the amplified product of the PCR reaction. Claim 11 A method for identifying an individual of Styrax japonica, wherein the biological sample is one selected from the group consisting of leaves, stems, roots, seeds, and parts thereof of Styrax japonica. Claim 12 A method for identifying individuals of the Japanese dogwood tree, wherein the individual identification rate is 99.99% or higher, according to Clause 11.

Images