Method for improving transformation efficiency in wheat

Abstract

The present invention relates to a method for increasing the transformation efficiency of wheat varieties, particularly Korean wheat varieties, by incorporating a morphogenetic regulatory gene (GRF4-GIF1 chimera), an extended dormancy period, and engineered Agrobacterium to improve the transformation efficiency of Korean wheat varieties. The protocol according to the present invention can contribute to genetic research and breeding programs for Korean wheat varieties.

Description

Technology Field

[0001] The present invention relates to a method for increasing the transformation efficiency of wheat varieties, particularly Korean wheat varieties, wherein a morphogenetic regulatory gene ( GRF4-GIF1 This invention relates to a method for improving the transformation efficiency of Korean wheat varieties by incorporating a chimera, an extended dormancy period, and engineered Agrobacterium. Background Technology

[0002] Wheat (Triticum aestivum L.) is a major crop essential to humans and is consumed by approximately 40% of the global population (Zhao et al. 2023). Because wheat is a heteroploid and possesses a complex and massive genome structure, it is more difficult to understand its agriculture-related genetic characteristics compared to other major crops such as rice and maize (Borrill et al. 2015, 2019). Therefore, various biotechnological tools, including transformation, have been applied to wheat to overcome several major obstacles in wheat molecular research (Guo et al. 2020; Babu et al. 2020; Kumar et al. 2021; Li et al. 2021).

[0003] Since the first report on Agrobacterium-mediated transformation (AMT), several researchers have established successful transformation of heteroploid wheat under various conditions (Cheng et al. 1997; Zhang et al. 2000; Wu et al. 2003; Ishida et al. 2015; Hayta et al. 2021). A highly efficient, proprietary AMT method called PureWheat, developed by JTC (Japan Tobacco Company), was improved and used in wheat genetic research (Ishida et al. 2015; Wang et al. 2018). The John Innes Center (JIC) in the UK also developed a wheat transformation system to address the reproducibility issues of the PureWheat method (Hayta et al. 2019).

[0004] Nevertheless, successful transformation using AMT has been reported for only a few wheat genotypes (Wang et al. 2020). It has been found that susceptibility to Agrobacterium infection and the ability to induce and regenerate callus vary depending on the wheat genotype (Wang et al. 2018). Accordingly, various studies have sought to overcome this type of genotype dependence by enhancing plant regeneration or improving gene transfer outcomes (Komari et al. 2006; Anand et al. 2018; Gordon-Kamm et al. 2019; Nalapalli et al. 2021; De Saeger et al. 2021; Maren et al. 2022; Kang et al. 2022; Lee and Wang 2023).

[0005] Growth regulator factor 4 (GRF4)-GRF-interacting factor 1 (GIF1) chimera, reported as a morphogenesis regulatory gene, has been reported to significantly improve transformation efficiency and reduce dependence on genotype variation in wheat (Debernardi et al. 2020). GRF4-GIF1 Unlike the previously reported Bbm-Wus2 gene (Lowe et al. 2016), chimeras were found not to exhibit regenerative problems or side effects during the developmental stage (Debernardi et al. 2020). GRF4-GIF1 Chimeras have been applied to overcome genotype-dependent transformation and to develop transgenic plants in varieties other than Fielder (Qiu et al. 2022; Biswal et al. 2023; Draeger et al. 2023). GRF4-GIF1Since reports on the functions of chimeras, new morphogenesis regulatory genes have been continuously identified, two examples being TaWOX5 and TaLAX1 (Wang et al. 2022a; Yu et al. 2024). Additionally, a transcriptional regulatory network (TRN) controlling wheat regeneration was revealed through multi-omics analysis (Liu et al. 2023).

[0006] AMT has a higher probability of single-copy incorporation compared to particle bombardment (Dai et al. 2001; Shou et al. 2004). Since single-copy incorporation by AMT leads to simple separation in pedigrees, there may be advantages in understanding gene function and preventing unintended gene silencing (Rajeev Kumar et al. 2015; Cao et al. 2020). However, particle bombardment enables compatibility with various wheat genotypes compared to AMT (Wang et al. 2022b).

[0007] While some plant species readily integrate with foreign DNA, other plant species, such as strains or varieties resistant to Agrobacterium infection, still struggle to produce transgenic plants. Unlike particle bombardment methods, AMT is influenced by plant defense responses (Pitzschke 2013). Removing myo-inositol from callus induction media and cold treatment during infection affect plant defense responses and enhance transformation (Zhang et al. 2013). The TaVIP2 (VirE2 interacting protein 2) gene is involved in the integration of T-DNA into the plant genome, and overexpression of the TaVIP2 gene in tobacco significantly increases AMT efficiency (Zhao et al. 2016). The TaUGT-B2 gene is known to function in plant defense responses and is upregulated in wheat embryos infected with immature Agrobacterium. Overexpression of the TaUGT-B2 gene in tobacco and Arabidopsis was shown to inhibit AMT (Zhou et al. 2016). This study suggests that plant innate immunity is related to AMT efficiency. Plant pathogenic bacteria inhibit PAMP-induced immunity (PTI) in plants by delivering effector proteins via the Type III secretion system (T3SS) (Chisholm et al. 2006). Pseudomonas syringae ( Pseudomonas syringae The effector protein AvrPto of ) is known to bind to receptor kinases such as Arabidopsis FLS2 and inhibit the PTI signaling pathway, thereby blocking plant immune responses (He et al. 2006; Xiang et al. 2008). Recently, T3SS and AvrPto Using engineered A. tumefaciens expressing effectors, the transformation efficiency in wheat, alfalfa, and switchgrass was enhanced, and plant basal immunity was suppressed (Raman et al. 2022).

[0008] Rate breeding is a flexible growth protocol that utilizes extended photoperiods to accelerate plant development (Ghosh et al. 2018). Rate breeding has been applied to develop genetically stable lines in various wheat (T. aestivum L.) varieties and breeding populations (Watson et al. 2018; Ghosh et al. 2018; Schoen et al. 2023; Cha et al. 2023). In previous studies, rate breeding was utilized to shorten the collection period of immature embryos used in tissue culture of wheat and barley (Hordeum vulgare L.) (Watson et al. 2018; Lee et al. 2020).

[0009] As such, despite the various gene transformation methods established by researchers worldwide, the successful transformation of Korean varieties using AMT remains a challenge for Korean wheat molecular breeders, and there is a need for methods to increase the transformation efficiency of Korean wheat varieties. Prior art literature

[0010] Republic of Korea Published Patent No. 10-2015-0057655 (Published May 28, 2015) Republic of Korea Published Patent No. 10-2012-0128878 (Published November 28, 2012) The problem to be solved

[0011] The objective of the present invention is to provide a method for increasing the transformation efficiency of Korean wheat varieties by integrating a morphogenetic regulatory gene, an extended dormancy period, and an engineered form of Agrobacterium tumefaciens. means of solving the problem

[0012] The present invention GRF4-GIF1 This invention provides a method to improve the transformation efficiency of wheat varieties by inoculating wheat with Agrobacterium bacteria into which a chimera has been introduced, and then culturing the resulting immature embryos for an extended dormancy period.

[0013] In addition, the present invention provides a transformed wheat variety plant and its seeds produced according to the above method. Effects of the invention

[0014] The present invention extends the dormancy period and GRF4-GIF1 The transformation efficiency of Korean wheat varieties can be increased by a combined approach that incorporates a chimera and includes an engineered form of Agrobacterium tumefaciens. In addition, the protocol according to the present invention can contribute to genetic research and breeding programs for Korean wheat varieties. Brief explanation of the drawing

[0015] Figure 1 shows a pipeline overview for the transformation of cv. Keumkang Agrobacterium-mediated wheat using rate breeding growth conditions. a: Growth of donor plants under rate breeding conditions (light / dark, 22 hours / 2 hours), b: Collection of spikes 14 days after flowering. c: Immature embryos in co-culture medium, d: Dormancy in G-418-free wheat callus induction (WCI) medium after co-culture, e: Embryonic callus induced during 4 weeks of dormancy, f: Callus induction in G-418-free WCI medium after dormancy, g: G-418-resistant callus, h: Regenerated shoots in wheat regeneration medium (WRM). Figure 2 shows a schematic diagram of the vector used for transformation. a: Mubi:: GRF4-GIF1 ::nos Intermediate vector constructed to subclone the cassette. b: Mubi:: GRF4-GIF1 Constructed the pGH-012335 vector by subcloning the ::nos cassette into pGH-0135 (backbone vector). c: Mubi:: GRF4-GIF1 ::nos cassette of pGH-012335's 35s:: 3XEGFP Constructed pGH-011435 by using ::nos cassette instead. d: CaMV 35s:: GUSConstructed the pGH-4216 vector by subcloning the ::nos cassette into pB7WG-ASX (backbone vector). e: Mubi:: GRF4-GIF1 Constructed the pGH-421623 vector by subcloning the ::nos cassette into pGH-4216. Figure 3 illustrates the identification process of the generated T3SS AGL-1 strain. a: Verification of the AGL-1 strain using pLN18 introduced in AB medium after three-parent cross. Growth was observed at 28°C but not at 37°C. b: PCR analysis results of the AGL-1 strain and the T3SS AGL-1 strain used in the transformation experiment. The AGL-1 strain genome (C58 GlyA gene) and the Ti plasmid (pTiBo542ΔT) were detected in both strains. T3SS and AvrPto The pLN18 plasmid expressing an effector was detected only in the T3SS AGL-1 strain. Figure 4 shows the results of wheat transfection using the JIC protocol. a to c: Immature embryos that browned and necrotic during callus induction for 6 weeks. a and b: GRF4-GIF1 Wheat transformation of non-chimera cv. Bobwhite. c: GRF4-GIF1 cv. Keumkang with chimeric overexpression. d: NPTII immunostrip results on browning callus of cv. Bobwhite. Positive reactions in 4 out of 88 samples. e to h: GRF4-GIF1 Wheat transformation of cv. Bobwhite using a chimera. e: Induced embryogenic callus. f: Two calluses with regenerated shoots. g and h: Identification of transgenic plants via PCR analysis. Figure 5 shows the transformation process of cv. Bobwhite with an extended dormancy period (JIC method from 5 days to 4 weeks). a to c: Callus formation after 4 weeks of dormancy using each vector. a: Callus induction without Agrobacterium inoculation. b: pGH-011435 vector ( 3XEGFPGene included). c: pGH-012335 vector( GRF4-GIF1 (Including chimera). d and e: Regeneration process. d: pGH-011435 vector. e: pGH-012335 vector. f, g: Sprouting process. f: pGH-011435 vector. g: pGH-012335 vector. h 3XEGFP or GRF4-GIF1 Regeneration rate of each transformation experiment using chimeras. I: 3XEGFP or GRF4-GIF1 Transformation efficiency of transformation experiments using chimeras. The regeneration rates and transformation efficiencies presented here are the average percentages of independent experimental replicates. Figure 6 shows the results of NPTII immunostrip testing on regenerated shoots transformed using the extended dormancy method. Transformers show two lines on the strip test, while untransformed individuals show one line. a and b: cv. Bobwhite. a: Regenerated shoots transformed using the pGH-012335 vector. Grouped strips represent shoots derived from individual calluses. b: pGH-011435 vector. c: cv. Keumkang transformed using the pGH-012335 vector. Figure 7 shows T3SS AGL-1 (type 3 secretion system and AvrPto Shows the results of transformation of cv. Baekkang using the effector expression) and extended dormancy methods. a to c: After a 3-week regeneration period in each experiment. a: The control group was pGH-4216 ( GUS Using the gene-containing) and AGL-1 strains. b: The control was pGH-421623 ( GRF4-GIF1 c: Experimental groups used pGH-421623 and T3SS AGL-1 strains. d: Regeneration rate of each transformation experiment. e: Transformation efficiency. The regeneration rates and transformation efficiencies presented here are the average percentages of independent experimental replicates. Figure 8 shows the PAT immunostrip test results of regenerated shoots transformed using cv. Baekkang and each Agrobacterium strain. Transformers show two lines in the strip test, while untransformed individuals show one line. a: Regenerated shoot transformed using the AGL-1 (pGH-4216 vector) strain. b: Regenerated shoot transformed using the AGL-1 (pGH-421623 vector) strain. c: Regenerated shoot transformed using the T3SS AGL-1 (pGH-421623 vector) strain. Grouped strips represent regenerated shoots within the same replicate experiment. Figure 9 shows a flowchart of a transgenic protocol for Korean wheat varieties using extended dormancy and rate breeding. The duration of each step is in days and is indicated by a number next to the box. Fig. 10 is Mubi:: GRF4A-GIF1B Shows the sequence of chimera::nos (gray: Maize Ubi promoter sequence; yellow: CDS sequence of GRF4-GIF1 chimera gene; blue: nos terminator sequence). Figures 11a and 11b are GRF4-GIF1This shows chimeric alignment. Figure 11a compares the sequences of the GRF4-GIF1 gene presented in the original discovery paper (Debernardi et al. 2020) and the GRF4-GIF1 gene directly cloned by the inventors. In the original discovery paper, the GRF4 and GIF1 genes were cloned using the tetraploid wheat variety Kronos, whereas the inventors cloned the GRF4A gene from the A genome and the GIF1B gene from the B genome using the hexaploid wheat variety Chinese Spring (CS). The gene formed by concatenating the two genes with the 4-alanine sequence (GCGGCCGCTGCC) found in the original paper is the GRF4A-GIF1B chimera. Figure 11b compares the protein sequences of the GRF4-GIF1 gene presented in the Debernardi et al. 2020 paper and the GRF4-GIF1 gene directly cloned by the inventors. Specific details for implementing the invention

[0016] The present invention relates to a method for increasing the transformation efficiency of wheat varieties, particularly Korean wheat varieties, and provides a method for improving the transformation efficiency of Korean wheat varieties by incorporating a morphogenetic regulatory gene, an extended dormancy period, and engineered Agrobacterium.

[0017] wheat( Triticum aestivum L. It is an essential crop with a complex genetic structure, and genetic transformation is difficult, especially in the case of Korean varieties.

[0018] To solve these difficulties, the present invention relates to a morphogenetic regulatory gene ( GRF4-GIF1 It is characterized by incorporating a chimera), an extended dormancy period, and engineered Agrobacterium tumefaciens. The present invention is also characterized by incorporating rate breeding to accelerate donor plant growth, thereby shortening the development period of the transgenic plant.

[0019] As used herein, the term “transformation” means that exogenous DNA is inserted into another cell to form an independent replicant (replicon) or is integrated into the genome of the introduced cell by homologous recombination, thereby enabling continuous replication and resulting in gene expression and the expression of a new trait. Transformation of a plant means any method of transferring DNA into a plant. Such transformation methods do not necessarily require a period of regeneration and / or tissue culture. In principle, any transformation method may be used to introduce the hybrid DNA according to the present invention into a suitable progenitor cell. The method may be suitably selected from the calcium / polyethylene glycol method for protoplasts, electroporation of protoplasts, microinjection into plant elements, impact of (DNA or RNA-coated) particles on various plant elements, and infection by a (non-incomplete) virus in Agrobacterium tumopaciens-mediated gene transfer by infiltration of the plant or transformation of mature pollen or microspores. The method according to the present invention particularly uses an Agrobacterium-mediated transformation method.

[0020] The transformation according to the present invention is Agrobacterium tumefaciens ( Agrobacterium tumefiaciensIt can be mediated by ). Agrobacterium contains a Ti plasmid (tumor inducing plasmid), and once this bacterium comes into contact with a plant cell, a fragment called T-DNA, approximately 23 kb in size, is integrated from the Ti plasmid into a random location on the plant cell's chromosome. Two border regions (left border and right border), approximately 23 bp in size, located at both ends of the T-DNA play an important role in the integration of T-DNA into the plant cell genome. Utilizing this property, a recombinant plasmid for transformation can be constructed by leaving only the left and right border regions essential for T-DNA integration in the Ti plasmid and replacing the remaining T-DNA with an alien gene of interest. This can then be used for plant transformation by introducing the recombinant plasmid into Agrobacterium and co-culturing the host plant with Agrobacterium. Specifically, a binary vector system or cointegration vector can be used, which utilizes a relatively small plasmid containing T-DNA together with a plasmid expressing the gene required for its integration; in this case, Agrobacterium tumefaciens is used as the strain for plant cell transformation ( Agrobacterium tumefaciens Agrobacterium rhizogenes containing a Ri plasmid (root inducing plasmid) similar to ) or Ti plasmid ( Agrobacterium rhyzogenes ...etc. can be used. When using Agrobacterium as described above, the recombinant plasmid is transferred to the plant cell through the wound site by co-culturing the Agrobacterium transformed with the recombinant plasmid with the plant explant.

[0021] As used herein, the term “vector” means a DNA product containing a DNA sequence operably linked to a suitable regulatory sequence capable of carrying out gene expression within a suitable host. Such regulatory sequences include a promoter for carrying out transcription, any operator sequence for regulating such transcription, a sequence coding for a suitable mRNA ribosome binding site, and a sequence regulating the termination of transcription and translation. A vector may be a plasmid, a phage particle, or simply a potential genomic insert. When transformed into a suitable host, the vector may replicate and function independently of the host genome, or in some cases, may be incorporated into the genome itself. Since plasmids are the most commonly used form of vector currently, the terms “plasmid” and “vector” are sometimes used interchangeably in this specification. A regulatory sequence means a DNA sequence essential for the expression of a coding sequence operably linked in a specific host. For example, a regulatory sequence suitable for prokaryotes includes a promoter, optionally an operator sequence, and a ribosome binding site. Eukaryotic cells are known to utilize promoters, polyadenylation signals, and enhancers. Nucleic acids are "operably linked" when positioned in a functional relationship with other nucleic acid sequences. This may be gene and regulatory sequence(s) linked in a manner that enables gene expression when an appropriate molecule (e.g., a transcription-activating protein) binds to the regulatory sequence(s). For example, DNA for a presequence or secretion leader is operably linked to DNA for a polypeptide when expressed as a presequence participating in the secretion of the polypeptide; a promoter or enhancer is operably linked to a coding sequence when it influences the transcription of the sequence; or a ribosome binding site is operably linked to a coding sequence when it influences the transcription of the sequence; or a ribosome binding site is operably linked to a coding sequence when positioned to facilitate translation.Generally, “operably linked” means that the linked DNA sequences are in contact, and in the case of a secretion reader, are in contact and present within the reading phase. However, the enhancer does not need to be in contact. Linkage is performed by ligation at a convenient restriction enzyme site. If such a site is not present, a synthetic oligonucleotide adapter or linker according to conventional methods is used. Vectors suitable for preparing a recombinant expression vector for use in the present invention may be derived, for example, from a phage vector or a plasmid vector.

[0022] In addition, the method of the present invention includes the step of redifferentiating a transgenic plant from the transgenic plant cell. Any method known in the art may be used for the method of redifferentiating a transgenic plant from the transgenic plant cell.

[0023] In the method of the present invention, the cell used for the transformation of wheat may be any cell. In the method according to the present invention, the wheat cell may be a cultured cell, a cultured tissue, a cultured organ, or a whole plant.

[0024] As used herein, the term “wheat tissue” includes, but is not limited to, differentiated or undifferentiated wheat tissues, e.g., roots, stems, leaves, pollen, seeds, and various forms of cells used for culture, namely single cells, protoplasts, sprouts, and callus tissues.

[0025] In the present invention, the transformed wheat may include not only the whole plant body but also tissues, cells, or seeds that can be obtained therefrom.

[0026] The method of the present invention specifically comprises the following steps:

[0027] i) GRF4-GIF1 A step in which a chimera is introduced and Agrobacterium bacteria expressing T3SS are inoculated into wheat;

[0028] ii) a step of obtaining a callus by transferring immature embryos to antibiotic-free wheat callus induction (WCI) medium after axis excision and culturing them in a cow during a dormant period; and

[0029] iii) After the dormancy period, a step of selecting the above callus by culturing it in a cow in WCI medium supplemented with antibiotics.

[0030] In the method of the present invention, to improve the transformation efficiency of wheat, a morphogenesis-regulating gene, a growth regulatory factor 4 (GRF4)-GRF-interaction factor 1 (GIF1) chimera ( GRF4-GIF1 Introduces a chimera.

[0031] To introduce the above gene, a strain of the genus Agrobacterium is used as the transforming strain, specifically Agrobacterium tumefaciens. In addition, in the present invention, T3SS is introduced to further increase the transformation efficiency of wheat. AvrPto A strain of the genus Agrobacterium engineered to express an effector is used.

[0032] In the method of the present invention, the culture of immature embryos is characterized by being carried out during an extended dormancy period compared to the conventional John Innes Center (JIC) method.

[0033] In the conventional JIC method, the dormancy period after co-culturing is 5 days, whereas in the method according to the present invention, the dormancy period after co-culturing reaches 3 to 5 weeks, preferably 4 weeks.

[0034] In the present invention, “dormancy” refers to the culture period between co-culture and selection without selectable antibiotics, followed by the induction of stable callus (Hensel et al. 2009).

[0035] Culture of immature embryos during the dormancy period is carried out in WCI medium free of antibiotics (e.g., G-418) at 23–25°C, preferably 24°C, in the dark.

[0036] After the dormancy period, the callus is cultured for 2 weeks in WCI medium supplemented with antibiotics, specifically 25 mg / L G-418 or 5 mg / L PPT (Piperacillin-tazobactam), in a dark place at 23–25°C, preferably 24°C, then replaced with the same fresh medium and subcultured for an additional 3 weeks.

[0037] In addition, the present invention provides a transformed wheat variety plant and its seeds produced according to the above method.

[0039] The present invention will be explained in detail below through examples. However, the following examples are merely illustrative of the present invention, and the scope of the present invention is not limited to the following examples.

[0041] Examples

[0042] Example 1: Materials and Method

[0043] 1. Plant materials and rapid breeding growth conditions

[0044] Bread wheat varieties "Bobwhite" (USDA, deposit no. SH98-26), "Chinese Spring" (National Institute of Food Science and Technology, deposit no. CITr 14108), "Keumkang" (National Institute of Food Science and Technology, deposit no. IT213100), and "Baekkang" (National Institute of Food Science and Technology, deposit no. IT332201) were obtained from the USDA National Small Grains Collection and the National Institute of Crop Science (RDA, Republic of Korea). Bobwhite, Keumkang, and Baekkang were sown in 20 cm diameter pots after seed sterilization. Keumkang and Baekkang were vernalized at 4°C for 4 weeks after the emergence of the first leaves. Plants were grown until flowering under the rapid breeding conditions described by Lee et al. (2020) (Fig. 1a). Simply put, rate breeding was performed in a growth chamber at 22°C (±1) with light conditions extended to 22 hours and darkness conditions shortened to 2 hours (Watson et al. 2018). Thirteen days after flowering, spikes were collected for tissue culture (Fig. 1b).

[0046] 2. Construction of Binary Vector and Preparation of Agrobacterium Strain - GRF4 and GIF1 Gene Cloning and Vector Construction

[0047] Total RNA was extracted from Chinese Spring wheat leaves at the 3-leaf stage using the Ribospin™ Plant Kit (Geneall, Seoul, Korea) according to the manufacturer's instructions. Then, cDNA was synthesized using the Power cDNA Synthesis Kit (iNtRON Biotechnology, Seoul, Korea) as described by Kim et al. (2020). PCR was performed using the synthesized cDNA with each primer set (TaGRF4_F1 / TaGRF4_R1 and TaGIF1_F4 / TaGIF1_R5) to GRF4 (TraesCS6A02G269600) and GIF1 The coding region of the (TraesCS4B02G064000) gene was cloned (Table 1). GRF4-GIF1 To create a chimera GRF4 and GIF1 The full length of the gene was amplified by overlapping PCR using bridge primers (TaGRF4_over_R1 / TaGIF1_over_F1) according to the process described by Debernardi et al. (2020). The sequences of the specific primers are shown in Table 1.

[0048] designation Sequence (5'→3') Size (bp) Gene (Deposit Number) reference TaGRF4_F1 ATGGCGATGCCGTATGCCTCT (Sequence No. 1) 1224 growth-regulating factor 4-like (LOC123128103) Debernardi et al. 2020 TaGRF4_R1 GTACATCTCGCCGGCGAACAG (Sequence No. 2) TaGIF1_F4 GGAGGGGCGTAAGCTTTTTGCAGTTG (Sequence No. 3) 678 GRF-interacting factor 1-like (LOC123091007) This study TaGIF1_R5 GTGCTAGCGACGATGCCGCTGG (Sequence No. 4) TaGRF4_over_R1 GGCAGCGGCCGCGTACATCTCGCCGGCGAACAG (Sequence No. 5) 1935 TaGRF4-GIF1 chimera Debernardi et al. 2020 TaGIF1_over_F1 GCGGCCGCTGCCATGCAGCAGCAACACCTGATG (Sequence No. 6) Cas9_F GCTTCGAAGGAGATAGAACC (Sequence No. 7) 747 hCas9 (QFX65988.1) This study Cas9_R ACCAGCACAGAATAGGCCAC (Sequence No. 8) C58 GlyA_F CCACCACCACGACGCACAAGTCT (Sequence No. 9) 422 GlyA gene (EU334236.1) Deeba et al. 2014 C58 GlyA_R TGCCGAGACGGACACCCGAC (Sequence No. 10) pTiBo542ΔT_F CCCGCTGAGAATGACGCCAA (Sequence No. 11) 766 accF gene (NC_010929) Deeba et al. 2014 pTiBo542ΔT_R CCTGCGACACATCGTTGCTGA (Sequence No. 12) tetR_F GGTAGCCGGCGCTTATATTG (Sequence No. 13) 341 tetA gene (AY532632.1) This study tetR_R CCTGTCCGACAAGTTGCATG (Sequence No. 14) AvrPto_F GGAAATATATGTGTCGGCGG (Sequence No. 15) 326 AvrPto1 (AAO57459.1) This study AvrPto_R CGCATATCGTCCACATTCTC (Sequence No. 16) SpecR_F ACTATCAGAGGTAGTTGGCG (Sequence No. 17) 639 SpecR (AUO29336.1) This study SpecR_R AGTATGACGGGCTGATACTG (Sequence No. 18)

[0049] GRF4-GIF1 Chimera Pac I and Bst After digestion with BI, it was subcloned into the pJK308NPTII vector (Kim et al. 2017). GRF4-GIF1 The chimera was controlled by the corn ubiquitin promoter (Mubi) and the nophalin synthase terminator (nos) (Fig. 2a). After HindIII digestion, the Mubi::GRF4-GIF1::nos expression cassette (Fig. 10; SEQ ID NO. 19) was subcloned into the pGH-0135 vector, and then the pGH-012335 vector was generated (Fig. 2b). The pGH-011435 vector, used as the transformation control vector, was the pGH-0135 vector's GRF4-GIF1 expression cassette 3XEGFP It was constructed by replacing it with the expression cassette (Addgene plasmid # 61628) (Fig. 2c).

[0050] To construct the pGH-4216 vector, the CaMV35S::GUS::nos expression cassette of the pCAMBIA1301 vector was subcloned into the pB7WG-ASX vector (Addgene plasmid # 98891) (Lukan et al. 2018) after KpnI and BamHI digestion (Fig. 2d). The pGH-421623 vector was constructed by subcloning the Mubi::GRF4-GIF1::nos expression cassette into the pGH-4216 vector (Fig. 2e).

[0052] 3. Modification of Agrobacterium tumefaciens and preparation of inoculum

[0053] To construct an AGL-1 strain expressing T3SS with introduced pLN18, a slightly modified three-parent cross method as described by Wise et al. (2006) was used. Specifically, a cross mixture was prepared by mixing suspensions of the AGL-1 (receptor) strain, the HB101 (helper) strain containing pRK2013 (ATCC, Manassas, Virginia, USA), and the KE157 (donor) strain containing pLN18 (Raman et al. 2022). This mixture was then cultured in LB medium. After culturing for 2 days, a portion of the grown bacteria was subcultured for 3 days at 28°C in AB medium supplemented with 10 mg / L rifampicin and 5 mg / L tetracycline. Then, single colonies were seeded onto two separate AB media and incubated at 28°C and 37°C, respectively, to check for contamination of the helper and donor strains (Fig. 3). After three-parent cross, the pBBR1MCS5-AvrPto vector (effector expression cassette in AvrPto T3SS AGL-1 strains were constructed by transforming the pLN18-containing strain (Raman et al. 2022) into an AGL-1 strain (containing pLN18).

[0054] Each constructed vector is As described in et al. (2018), A. tumefaciens strains AGL-1 and T3SS AGL-1 were transformed by electroporation using a Gene Pulser Xcell electroporation system (Bio-Rad, Hercules, California, USA). A standard inoculum of A. tumefaciens was prepared according to Tingay et al. (1997) and used in each experiment.

[0056] Example 2. Agrobacterium-mediated transformation using the JIC method

[0057] 1. Agrobacterium-mediated transformation

[0058] Immature embryo isolation and co-culture were performed according to the method of Hayta et al. (2021).

[0059] Specifically, immature caryopsis were separated from the ear harvested 13 days after flowering, placed in a container, washed in 70% EtOH for 1 minute and in 1% sodium hypochlorite solution for 5 minutes, and then washed 4 times with triple distilled water. Then, immature embryos were separated from the immature caryopsis using sterilized forceps and a scalpel in a clean bench, collected in 0.1x MS liquid medium, and centrifuged at 18,000 xg for 5 minutes at 4℃.

[0060] The Agrobacterium inoculum used for co-culture was prepared by culturing the “standard inoculum” prepared as described in the “Modification of Agrobacterium tumefaciens and Preparation of Inoculum” section of Example 1 above in an MG / L medium for 16 hours, and then adjusting the bacterial density of the suspension to an absorbance value of OD600=0.5 for use in co-culture.

[0061] 1 ml of inoculum was dispensed into a tube containing centrifuged immature embryos and cultured for 15 minutes, and 50 immature embryos were placed on the inoculum medium with the blastodisc facing upward and cultured for 3 days.

[0062] After 3 days of co-culture, the dormancy and selection periods were performed in two different ways depending on the method used (Table 2). "Dormant" refers to the culture period between co-culture and selection without selectable antibiotics, leading to stable callus induction (Hensel et al. 2009). In all cases, wheat callus induction (WCI) medium and wheat regeneration medium (WRM) were prepared as described by Hayta et al. (2021). Specifically, the components of the medium are as follows:

[0063] - 100X Vitamin Stock

[0064] 100 mg / L Thiamine HCl

[0065] 35 g / L myo-inositol

[0066] 69 g / L Proline

[0067] After completely dissolving the three reagents in 1 liter of triple-distilled water, sterilize them using a 0.22 μm membrane filter and store at 4°C.

[0069] - Wheat Callus Induction Medium (WCI)

[0070] 4.3 g / L MS medium

[0071] 30 g / L maltose

[0072] 1.0 g / L casein hydrolysate

[0073] 10 ml 100x Vitamin Stock

[0074] After dissolving the above reagent in 1 liter of triple-distilled water, the pH was adjusted to 5.8 using KOH, 5 g of agarose was added, and the mixture was autoclaved at 121℃ / 20 min / 1.5 atm.

[0075] 2 mg / L picloram

[0076] 0.5 mg / L 2,4-D

[0077] 1.25 mg / L CuSO4·5H2O

[0078] 160 mg / L Timentin

[0079] After autoclaving, when the medium temperature dropped to 60℃, add the four reagents above, dispense 25 ml into each 90 cm diameter petri dish, and let it solidify at room temperature for 2 days.

[0080] - Wheat Regeneration Medium (WRM)

[0081] 4.3 g / L MS medium

[0082] 30 g / L maltose

[0083] 1.0 g / L casein hydrolysate

[0084] 10 ml Vitamin Stock

[0085] After dissolving the above reagent in 1 liter of triple-distilled water, the pH was adjusted to 5.8 using KOH, 3.5 g of Gelzan™ was added, and autoclaved at 121°C / 20 minutes / 1.5 atm.

[0086] 1.0 mg / L Zeatin

[0087] 1.25 mg / L CuSO4·5H2O

[0088] 160 mg / L Timentin

[0089] When the medium temperature dropped to 60℃ after autoclaving, add the three reagents above, dispense 25 ml into each 90 cm diameter Petri dish, and let it solidify at room temperature for 2 days.

[0090] Table 2 below shows the transformation period for each stage between the John Innes Center (JIC) method and the extended dormancy period method.

[0091] method Co-culture dormancy Selection reproduction Rooting John Innes Center (JIC) 3 days 5 days 5 weeks 3 weeks 7 to 10 days Extended dormancy period 4 weeks 3 weeks

[0093] 2. JIC Method and Extended Dormant Period Method

[0094] The JIC method was established based on Hayta et al. (2021) with minor modifications.

[0095] The procedure was performed as follows according to the JIC method. Immature embryos were excised and transferred to WCI medium free of the antibiotic G-418, and cultured at 24°C in a cow during the dormancy period. After 5 days of dormancy, the calluses were cultured at 24°C in a cow for 2 weeks in WCI medium supplemented with 25 mg / L G-418 (selection period; a period between dormancy and regeneration, designed to induce the growth of only transformed cells resistant to antibiotics or herbicides), and then subcultured for an additional 3 weeks in the same fresh medium.

[0096] The method of the extended dormancy period according to the present invention was performed as follows. After axis excision, immature embryos were transferred to WCI medium without the antibiotic G-418 and cultured during the dormancy period in a dark cow at 24°C. After 4 weeks of dormancy, the calluses were cultured for 3 weeks (selection period) in WCI medium supplemented with 25 mg / L G-418 or 5 mg / L PPT in a dark cow at 24°C.

[0098] 3. Regeneration and Adaptation

[0099] After selection, the regeneration process was performed using the same procedure for both the JIC and extended dormancy methods. After the selection period, shoots were induced for 3 weeks in WRM medium supplemented with 25 mg / L G-418 or 5 mg / L PPT under approximately 100 μmol m-2s-1 illumination at 24°C. The regeneration rate was measured as the ratio of the number of individual regenerated calluses to the number of immature embryos used in each transformation event. The regenerated shoots were transferred to culture tubes containing 8 mL of hormone-free WCI medium.

[0100] After a regeneration period of one week, the presumed transgenic plants were transplanted into the soil and acclimatized for one week in the transplanted plastic bags to prevent the soil from drying out. Leaves were collected during acclimatization for analysis of NPTII or PAT expression.

[0102] 4. Immunostrip analysis of presumed transgenic plants

[0103] NPTII (Neomycin Phosphortransferase II) or PAT (phosphinothricin acetyltransferase) protein expression was evaluated in all putative transgenic shoots. Additionally, non-regenerated calluses from the JIC method were subjected to NPTII immunostrip analysis. Immunostrip analysis was performed using ImmunoStrip® for the Neomycin Phosphortransferase II kit (Agdia, Elkhart, Indiana, USA) or QuickStix for the PAT / bar kit (Envirologix, St. Charles, Missouri, USA) according to the manufacturer's instructions. Soluble proteins were extracted from shoots and calluses using extraction buffer. After centrifugation for 10 minutes, the supernatant was incubated with ImmunoStrip for 30 minutes. NPTII or PAT proteins were determined by the visual observation of the appearance of two purple lines on the ImmunoStrip.

[0105] 5. PCR analysis of presumed transgenic plants

[0106] To identify transgenic plants, PCR screening was performed using genomic DNA from the leaves of regenerated plants. Genomic DNA was extracted using the HiGene™ Genomic DNA Prep Kit (BIOFACT, Seoul, South Korea) according to the manufacturer's instructions. The concentration of gDNA was determined using BioDrop Duo+ (Biochrom, Cambridge, UK), and then the gDNA was diluted to a concentration of 50 ng / μl. PCR screening was performed using Taq 5x Master Mix (NEB, Ipswich, MA, USA) containing Cas9 primers (Table S1) according to the manufacturer's instructions, and the results were visualized by electrophoresis on a 2% agarose gel after EtBr staining.

[0108] 6. Statistical Analysis

[0109] Regeneration rate and transformation efficiency were analyzed using the Student t-test with IBM SPSS 27.0 (IBM, Armonk, NY, USA). A p-value <0.05 was considered statistically significant. Transformation efficiency is expressed as mean ± sd.

[0111] 7. Results

[0112] Immature embryos of cv. Bobwhite collected under rapid breeding growth conditions according to Example 1 above were treated with pGH-0135 or pGH-012335 using the JIC method (replacing hygromycin B with G-418) GRF4-GIF1Transformed with a vector (including a chimeric cassette). In a transformation experiment using the pGH-0135 vector, which underwent 5 days of dormancy and 5 weeks of selection, all immature embryos failed to induce callus formation and subsequently showed browning (Figs. 4a to 4c). Interestingly, among the browned calluses, 4 were identified as transformed calluses by NPTII immunostrip testing (Fig. 4d). When using the pGH-012335 vector, immature embryos showed callus morphology after 5 days of dormancy and 5 weeks of selection (Fig. 4e). However, out of a total of 688 immature embryos (4 replicates), 2 calluses showed regenerated shoots, which originated from 2 individual embryos (Fig. 4f). Transformed plants were confirmed by PCR screening using Cas9-specific primers. Two of the six regenerated shoots were observed via 747 bp PCR amplification. However, slight PCR amplification bands were also observed at similar locations in #1 and WT (Fig. 4g). In this case, the four negatively detected shoots (#1, #2, #4, and #6) were removed from the transgenic shoots. Finally, two individual transgenic shoots were transplanted into the soil. To verify the identification of the transgenic plants, PCR analysis was performed on the flag leaves of each individual plant for double verification. Lastly, the two regenerated plants were identified as two separate transgenic plants (Fig. 4h). The results of the transgenic results using the JIC method GRF4-GIF1 In experiments incorporating chimeras, the regeneration rate and transformation efficiency were determined to be 0.76±0.44%, respectively. GRF4-GIF1 In experiments performed without chimeras, no transformed calluses were produced despite the use of a total of 4,141 immature embryos over three replicates. Table 3 below shows the transformation efficiency of Bobwhite and Keumgang varieties using the JIC method.

[0113] varieties vector Inoculated embryo Number of sprouted calluses playback rate (%) NPTII-positive plants Transformation efficiency (%) Bobwhite pGH-012335 152 2 1.31 2 1.31 97 0 0.00 0 0.00 156 0 0.00 0 0.00 283 0 0.00 0 0.00 Mean ± sd 0.76 ± 0.44 0.76 ± 0.44 pGH-0135 3303 0 0.00 0 0.00 390 0 0.00 0 448 0 0.00 0 Mean ± sd 0.00 0.00 Keumgang pGH-012335 113 0 0.00 0 0.00

[0115] Example 3 - Extended dormancy period and GRF4-GIF1 Transformation of Korean wheat using chimeras

[0116] 1. Extended method

[0117] To change the dormancy period of the JIC method used in Example 2 above from 5 days to 4 weeks, the pGH-012335 vector or pGH-011435 vector ( GRF4-GIF1 Chimera 3XEGFP Transformation experiments were performed using (replacement with genes).

[0118] Immature embryos were transferred to WCI medium without axis resection and cultured in a dark environment at 24°C for a 4-week dormancy period, followed by subculture in fresh medium every 2 weeks (Fig. 1, c and d). After the dormancy period, nodular embryogenic calluses were observed (Fig. 1, e). After the 4-week dormancy period, the calluses were cultured in WCI medium supplemented with 25 mg / L G-418 or 5 mg / L PPT under dark conditions at 24°C for 3 weeks (Fig. 1, f and g).

[0120] 2. Results

[0121] After a 4-week dormancy period in WCI medium (G-418 antibiotic-free), immature embryos transformed with the pGH-011435 vector showed calluses with a smaller or amorphous phenotype compared to untransformed immature embryos (Fig. 5a and b). Most transformation events using the pGH-012335 vector showed much larger somatic embryoid calluses compared to transformation events using the pGH-011435 vector (Fig. 5c).

[0122] After combining the selection period of 3 weeks and the regeneration period of 3 weeks (Fig. 5d and e), the average regeneration rate was found to be 5.84±0.96% in transformation using the pGH-012335 vector, whereas the regeneration rate was 0.63±0.36% in transformation using the pGH-011435 vector (Fig. 5h, Table 4). Table 4 below shows the transformation efficiency of Bobwhite and Keumgang varieties using the extended dormancy period method.

[0123] varieties vector Inoculated embryo Number of sprouted calluses playback rate (%) NPTII-positive plants Transformation efficiency (%) Bobwhite pGH-012335 53 1 1.89 0 0.00 60 6 10.00 5 8.33 131 12 9.16 10 7.63 72 5 6.94 5 6.94 73 4 5.48 4 5.48 229 6 2.62 6 2.62 280 12 4.29 10 3.57 247 10 4.05 5 2.02 233 9 3.86 3 1.29 298 30 10.07 20 6.71 Mean ± sd 5.84 ± 0.96 a 4.46 ± 0.93 b pGH-011435 274 3 1.09 0 0.00 49 0 0.00 0 0.00 84 0 0.00 0 0.00 Mean ± sd 0.63 ± 0.36 a 0 b Keumgang pGH-012335 100 5 5.00 3 3.00

[0124] a, b: Identical characters indicate a significant difference (p < 0.05).

[0126] Transformed plants containing the pGH-012335 vector were identified by NPTII immunostrip testing (Fig. 6). The average transformation event rate was determined to be 4.46 ± 0.93%, and transformed shoots were successfully produced in 9 out of 10 replicate experiments (Fig. 5i, Table 4). However, in the transformation event using the pGH-011435 vector, the regenerated shoots were identified as escaped shoots (Fig. 6b). In three replicate experiments using the pGH-011435 vector involving a total of 407 transformed immature embryos, the transformation efficiency was determined to be 0%.

[0127] Based on the results mentioned earlier GRF4-GIF1A successful wheat transformation method combining chimera and extended dormancy was applied to the Korean elite variety (Fig. 1). Under rate breeding conditions, immature embryos of cv. Keumkang were transformed using the pGH-012335 vector and the extended dormancy method. Embryonic calluses were induced in the immature embryos of cv. Keumkang after a 4-week dormancy period in WCI medium without the antibiotic G-418, followed by a 3-week selection process using the antibiotic G-418 (Figs. 1 e and g). After the regeneration process, shoots were induced in 5 out of a total of 88 individual calluses (Fig. 1 h). Confirmation via NPTII immunostrip revealed that 3 of the 5 regenerated shoots were transgenic shoots (Fig. 6 c).

[0129] Example 4 - Improvement of Transformation Efficiency of Korean Wheat Varieties through Inhibition of Plant Defense

[0130] 1. Transformation experiment using extended dormancy period and engineered Agrobacterium

[0131] The method described in Examples 2 and 3 and pGH-4216 ( GUS gene) or pGH-421623( GRF4-GIF1Transformation experiments were performed on cv. Baekkang using the AGL-1 strain containing the chimeric vector, but the expression level of PAT (phosphinothricin acetyltransferase) protein was evaluated for the transformed specimens. Most transformation events using the pGH-421623 vector produced larger somatic embryoid calluses compared to the pGH-4216 vector (Fig. 7a and b). However, there was no statistically significant difference in regeneration rates between transformation events using the two vectors, with an average of 9.70 ± 2.80% for pGH-4216 and 12.75 ± 2.79% for pGH-421623 (Fig. 7d, Table 5). Through PAT immunostrip testing in AMT using the AGL-1 strain and two vectors (Fig. 8), the transformation efficiency of pGH-4216 was found to be 2.65 ± 0.92%, and the transformation efficiency of pGH-421623 was found to be 9.70 ± 1.94% (Fig. 7e, Table 5). Table 5 below shows the transformation efficiency of the Baekkang variety using T3SS Agrobacterium and the extended dormancy period method.

[0132] varieties strain vector Inoculated embryo Number of sprouted calluses playback rate (%) PAT-positive plants Transformation efficiency (%) Baekkang AGL-1 pGH-4216 58 4 6.90 1 1.72 56 7 12.50 2 3.57 Mean ± sd 9.70 ± 2.80 2.65 ± 0.92 pGH-421623 48 8 16.67 6 12.50 49 5 10.20 5 10.20 50 9 18.00 6 12.00 53 1 1.89 0 0.00 49 3 6.12 2 4.08 Mean ± sd 10.58 ± 3.06 a 7.76 ± 2.45 b T3SSAGL-1 pGH-421623 42 9 21.43 6 14.29 53 16 30.19 13 24.53 53 14 26.42 12 22.64 48 12 25.00 9 18.75 52 13 25.00 11 21.15 55 10 18.18 5 9.09 60 11 18.33 8 13.33 Mean ± sd 23.51 ± 1.67 a 17.68 ± 2.12 b

[0134] 2. GRF4-GIF1 Transformation experiments using chimeras and engineered Agrobacterium

[0135] To suppress the innate immunity of plants and increase the efficiency of Agrobacterium infection and transformation, the T3SS AGL-1 strain (Type III effector) AvrPto expression) and pGH-421623( GRF4-GIF1 AMT was performed on the cv. Baekkang variety using a chimera vector. After the regeneration process, more shoots were observed in the experiment using the T3SS AGL-1 strain compared to the transformation event using the AGL-1 strain (containing the pGH-421623 vector) (Fig. 7b and c).

[0136] The regeneration rate was measured to be an average of 23.51 ± 1.67% in the transformation event using the T3SS AGL-1 strain, which was approximately 2.22 times higher than that of the AGL-1 strain (Fig. 7d, Table 5). When the transformation efficiency using the T3SS AGL-1 strain was measured, the result was an average of 17.68 ± 2.12%, which was statistically significantly different from the transformation event using the AGL-1 strain (Fig. 7e). In addition, the transformation efficiency was approximately 2.27 times higher than that of the AGL-1 strain, and transformants were produced in all 7 experimental replicates using the T3SS AGL-1 strain (Table 5).

[0138] 3. Discussion

[0139] Current approaches to plant genetic transformation require continuous research to address critical challenges across various crops. These challenges include reducing tissue culture duration, increasing the frequency of stable transformation events, and optimizing the efficiency of Agrobacterium-mediated transgenic gene delivery (Altpeter et al. 2016). To enhance transformation efficiency, several studies have been conducted to optimize somatic embryogenesis and regeneration during wheat transformation by evaluating various factors such as variety, medium composition, and selection pressure (Przetakiewicz et al. 2003; Ding et al. 2009; Hensel et al. 2017). Recently, JIC developed an optimized protocol achieving up to 25% transformation efficiency in the Fielder variety (Hayta et al. 2019). To apply AMT to Korean wheat varieties, extending the dormancy period and GRF4-GIF1 The JIC protocol was modified using an AGL-1 strain that incorporates a chimera and expresses T3SS.

[0140] The quality of immature embryos and the sustained growth of wheat plants are considered important factors in the production of transgenic plants (Abe et al. 2020). In previous studies, immature embryos collected under rate breeding conditions did not show a statistically significant difference in regeneration efficiency compared to those under normal growth conditions (12 hours / 12 hours, light / dark) (Lee et al. 2020). Since stable and healthy immature embryos were obtained 7 to 8 weeks after sowing under rate breeding conditions, we applied these conditions to ensure a continuous supply of immature embryos for wheat transgenics (Fig. 9). In the JIC protocol, donor plants were grown to the early milking stage (GS73) in a controlled environment chamber for 12 to 14 weeks (Zadoks et al. 1974). Applying rate breeding allows for a stable supply of immature embryos, and regularly attempting wheat transgenics is crucial for the success of wheat transgenics.

[0141] Transformation of the Bobwhite and Keumkang varieties was performed using immature embryos collected after rate breeding growth conditions according to the JIC protocol (Fig. 4). The type of selector was also changed from Hygromycin B in the pGH-0135 vector to G-418 or PPT in the GH-421623 vector. However, the initial transformation experiment using the JIC protocol failed as none of the calluses regenerated (Figs. 4a to c). Interestingly, 4 of the 84 non-regenerating calluses were identified as transformed calluses by NPTII immunostrip testing (Fig. 4d). According to the NPTII immunostrip results, T-DNA was stably incorporated into the non-regenerating calluses during the transformation stage using the JIC protocol, but there may be issues with the regeneration stage. Therefore, the results of the initial experiment indicated that somatic embryo formation and regeneration did not occur in the transformed calluses.

[0142] To solve these problems GRF4-GIF1Somatic cell embryogenesis and regenerative capacity during AMT were enhanced by applying chimera and extended dormancy strategies. The JIC protocol GRF4-GIF1 It has been reported that using chimeras can significantly improve the transformation efficiency of cv. Fielder by 77.5% (Hayta et al. 2021). Furthermore, GRF4-GIF1 Chimeras have been reported to improve low transformation efficiency caused by genotypic variation in specific varieties (Debernardi et al. 2020). Therefore GRF4-GIF1 Chimera was applied to Bobwhite and Keumkang varieties along with the JIC protocol. GRF4-GIF1 Despite the use of chimeras, transforming cv. Bobwhite using the JIC protocol resulted in very low efficiency (0.76 ± 0.44%) and unstable transgenic plants (Fig. 4). Additionally, cv. Keumkang did not form embryogenic callus. These results suggest that to increase transformation efficiency GRF4-GIF1 It suggests that additional improvements are needed beyond the use of chimeras.

[0143] In the JIC protocol, callus formation begins during the dormancy phase following co-culture. The dormancy period in the JIC protocol was 5 days after co-culture. During the dormancy period, immature embryos recovered from stress caused by infection and initiated callus induction (Hayta et al. 2021). In the QuickWheat transformation method, embryos were able to grow four times their original size during a dormancy period of 7 to 10 days (Johnson et al. 2023). In a study on wheat transformation using particle bombardment, improved somatic embryogenesis and shoot regeneration were observed by inducing callus for 4 weeks without selective pressure after particle bombardment (Biswal et al. 2023). Following a similar approach, the method according to the present invention extended the dormancy period required for embryogenic callus induction to 4 weeks (Table 2); however, immature Bobwhite embryos exhibited necrosis during the 5-day dormancy period suggested by the JIC protocol (Fig. 4b). The 4-week dormancy period is as shown in Figures 5b and 5c. GRF4-GIF1 It was possible to facilitate stable callus induction regardless of the presence of chimeras. Ultimately, compared to using the 5-day dormancy period of the JIC protocol, the extended 4-week dormancy period improved the transformation efficiency of cv. Bobwhite (improved from 0.76 ± 0.44 to 4.46 ± 0.93%) and successfully generated cv. Keumkang transformants (Fig. 1, Table 4). GRF4-GIF1 Regarding the chimera-free extended dormancy method, no transgenic plants were identified in the transfection experiment using the pGH-011435 (3XEGFP gene) vector for the Bobwhite variety. Interestingly, pGH-4216 (for the Korean wheat variety Baekkang) GUSTransgenic plants were successfully developed using a gene vector. The Korean variety Baekkang may be more sensitive to an extended dormancy period for stable callus induction than cv. Bobwhite and cv. Keumkang. These results indicate that the inventors' modified method still requires improvement through slight adjustments based on genotype variation. Nevertheless, the extended dormancy period method can mitigate obstacles observed in JIC protocol experiments, such as poor somatic embryogenesis and low regeneration rates.

[0144] In previous experiments, cv. Baekkang was reported to be susceptible to transient Agrobacterium infection via GUS staining with very low infection efficiency (Lee et al. 2022). To increase the transformation efficiency of Baekkang, an improved infection efficiency strategy was utilized by using the AGL-1 strain expressing T3SS (Fig. 7). As a control experiment for the T3SS AGL-1 strain, the extended dormancy period method and in Baekkang GRF4-GIF1 Chimera or GUS AMT was performed using the AGL-1 strain containing the gene vector. As mentioned above, GUS Several transgenic plants were produced by incorporating the gene (Table 5). In addition to the effect of the extended dormancy period on Baekgang, other factors such as T-DNA length (12,951 bp or 4,235 bp) and the selection of the selector (G-418 or PPT) can influence the production of transgenic plants.

[0145] Engineered Agrobacterium expressing T3SS increased both transient and stable transformation efficiencies of cv. Fielder (Raman et al. 2022). In the inventors' experiments, transformation efficiency was found to be approximately 2.27 times higher in the T3SS AGL-1 strain compared to the standard AGL-1 strain (Fig. 7e, Table 5). Furthermore, this approach GRF4-GIF1Transformation efficiency of up to 30% was achieved in combination with a chimera. Transformed plants were successfully generated in all transformation events performed in the T3SS system. This indicates that T3SS AGL-1 leads to more stable transformation events compared to the AGL-1 strain. A strategy to increase infection efficiency by weakening the plant's innate immunity may be advantageous when applying AMT to other Korean varieties. Furthermore, T3SS operates independently of the Type IV Secretion System (T4SS) that delivers the transformation gene to plants (Raman et al. 2022). The T3SS AGL-1 strain has the potential to further improve the transformation efficiency of difficult genetic variations, including Korean wheat varieties.

[0146] In conclusion, by combining all the strategies mentioned above, the present invention provides a robust framework for improving the transformation efficiency of Korean wheat varieties in particular. Morphological regulatory genes ( GRF4-GIF1 Chimeras), extended dormancy periods and engineered Agrobacterium strains (T3SS and AvrPto The integration of expression presents a comprehensive approach to overcome existing barriers to wheat genetic transformation. To the best of the inventors' knowledge, stable transgenic wheat varieties such as Keumkang and Baekkang have never been developed in Korea using AMT, and it is expected that the method according to the present invention will contribute to the advancement of the Korean wheat molecular breeding program.

Claims

Claim 1 A method for increasing the transformation efficiency of the Baekkang wheat variety, comprising the following steps: i) inoculating immature embryos of the Baekkang wheat variety with AGL-1 Agrobacterium tumefaciens, engineered to express T3SS and AvrPto effectors and into which a pGH-421623 vector containing the GRF4-GIF1 chimeric gene has been introduced; ii) co-culturing the inoculated immature embryos, then transferring them to an antibiotic-free wheat callus induction medium and inducing a callus by dormant culture for 4 weeks at 23 to 25°C under dark conditions; iii) selecting the callus by culturing it for 3 weeks at 23 to 25°C under dark conditions in a wheat callus induction medium supplemented with 5 mg / L phosphinothricin (PPT); and iv) a step of regenerating transformed White Gang wheat plants by culturing the selected callus in a wheat regeneration medium supplemented with 5 mg / L phosphinothricin. Claim 2 The method of claim 1, wherein the pGH-421623 vector comprises an expression cassette comprising a corn ubiquitin promoter, a GRF4-GIF1 chimeric gene, and a nophalin synthase terminator. Claim 3 In claim 1, the method wherein the GRF4-GIF1 chimeric gene is the GRF4A-GIF1B chimeric gene. Claim 4 The method of claim 1, wherein the AGL-1 Agrobacterium tumefaciens engineered to express the T3SS and AvrPto effectors comprises a pLN18 plasmid and an AvrPto expression plasmid. Claim 5 In claim 1, the method is a method that increases the transformation efficiency of the Baekgang wheat variety compared to a method using AGL-1 Agrobacterium tumefaciens into which a pGH-421623 vector containing the GRF4-GIF1 chimeric gene has been introduced. Claim 6 A transformed Baekkang wheat variety produced according to the method of any one of paragraphs 1 to 5.

Images