HLA-J and its medical / diagnostic uses

Abstract

The present invention comprises: (a) encoding a polypeptide consisting of or containing the amino acid sequence of SEQ ID NO: 1; (b) consisting of the nucleotide sequence of SEQ ID NO: 2; (c) encoding a polypeptide having at least 70%, preferably at least 80%, homology more preferably at least 90%, and most preferably at least 95% homology with respect to the amino acid sequence of SEQ ID NO: 1; (d) consisting of a nucleotide sequence having at least 70%, preferably at least 80%, homology more preferably at least 90%, and most preferably at least 95% homology with respect to the nucleotide sequence of SEQ ID NO: 2; and (e) consisting of a nucleotide sequence that is degenerate with respect to the nucleic acid molecule of (d); (f) a fragment of any one of (a) to (e), wherein the fragment comprises at least 150 nucleotides, preferably at least 300 nucleotides, more preferably at least 450 nucleotides, and most preferably at least 600 nucleotides; or (g) corresponding to any one of (a) to (f), wherein T relates to a nucleic acid molecule substituted with U.

Description

Technology Field

[0001] The present invention comprises: (a) encoding a polypeptide consisting of or containing the amino acid sequence of SEQ ID NO: 1; (b) consisting of the nucleotide sequence of SEQ ID NO: 2; (c) encoding a polypeptide having at least 70%, preferably at least 80%, homology more preferably at least 90%, and most preferably at least 95% homology with respect to the amino acid sequence of SEQ ID NO: 1; (d) consisting of a nucleotide sequence having at least 70%, preferably at least 80%, homology more preferably at least 90%, and most preferably at least 95% homology with respect to the nucleotide sequence of SEQ ID NO: 2; and (e) consisting of a nucleotide sequence that is degenerate with respect to the nucleic acid molecule of (d); (f) a fragment of any one of (a) to (e), wherein the fragment comprises at least 150 nucleotides, preferably at least 300 nucleotides, more preferably at least 450 nucleotides, and most preferably at least 600 nucleotides; or (g) corresponding to any one of (a) to (f), wherein T relates to a nucleic acid molecule substituted with U. Background Technology

[0002] This specification incorporates many documents, including patent applications and manufacturer's product descriptions. While the disclosure of these documents is not related to the patentability of the invention, the entirety thereof is incorporated herein by reference. More specifically, all referenced documents are incorporated by reference to the same extent as each individual document is indicated as being specifically and individually incorporated by reference.

[0003] The Human Leukocyte Antigen (HLA) system or complex is a gene complex that encodes human Major Histocompatibility Complex (MHC) proteins. These cell surface proteins are responsible for regulating the human immune system. The HLA gene complex is located on the 3 Mbp stretch within chromosome 6p21. The genes in this complex are classified into three basic groups: Class I, Class II, and Class III.

[0004] Humans possess three major MHC class I genes known as HLA-A, HLA-B, and HLA-C. Proteins produced by these genes are present on the surface of almost all cells. On the cell surface, these proteins bind to protein fragments (peptides) released from within the cell. MHC class I proteins present these peptides to the immune system. If the immune system recognizes these peptides as foreign substances (e.g., viral or bacterial peptides), it triggers a response that causes the infected cells to self-destruct.

[0005] Humans have six major MHC class II genes: HLA-DPA1, HLA-DPB1, HLA-DQA1, HLA-DQB1, HLA-DRA, and HLA-DRB1. MHC class II genes provide instructions for making proteins that are present almost exclusively on the surface of specific immune system cells. Like MHC class I proteins, these proteins present peptides to the immune system.

[0006] Proteins produced by MHC class III genes have somewhat different functions; they are involved in inflammation and other immune system activities. The functions of some MHC genes are unknown.

[0007] HLA genes have as many variations as possible, enabling each person's immune system to respond to various external invaders. Some HLA genes have hundreds of identified versions (alleles), and each version is assigned a specific number (e.g., HLA-B27). Closely related alleles are classified together; for example, at least 40 very similar alleles are subtypes of HLA-B27. These subtypes are designated as HLA-B*2701 through HLA-B*2743.

[0008] More than 100 diseases are associated with different alleles of the HLA gene. For example, the HLA-B27 allele increases the risk of developing an inflammatory joint disease called ankylosing spondylitis. Many other disorders associated with abnormal immune function and some forms of cancer are also linked to specific HLA alleles. However, it is often unclear what role HLA genes play in the risk of developing these diseases.

[0009] The non-classical MHC class I molecules HLA-E, HLA-F, and HLA-G are encoded by the HLA class I region alongside the three major MHC class I genes. Overexpression of HLA-G, -E, and -F is commonly found in various malignancies (Kochan et al., Oncoimmunology. 2013 Nov 1; 2 (11): e26491.). HLA-G and HLA-E have been reported as cancer biomarkers and have been reported to be positively correlated with poor clinical outcomes of cancer.

[0010] HLA class I regions have also been reported to contain class I pseudogenes (Hughes, Mol Biol Evol. 1995 Mar; 12 (2): 247-58) and gene fragments. For example, HLA-H, J, K, and L are classified as class I pseudogenes, while HLA-N, S, and X are classified as gene fragments. In particular, Messer et al., J Immunol, reported that HLA-J is a pseudogene caused by harmful mutations that produce translation termination in exon 2 or exon 4. 1992 Jun 15; 148 (12): 4043-53.

[0011] US 9,353,416 B2 discusses that HLA-J can be used as a marker for the postoperative prognosis of patients with breast cancer. More specifically, HLA-J provides a good prognosis when overexpressed along with various other markers. Regarding the characteristics of HLA-J sequences, US 9,353,416 B2 assumes that the HLA-J sequences reported by Messer et al., J Immunol. 1992 Jun 15; 148(12):4043-53 are accurate. Furthermore, based on the assumption that HLA-J is an indicator of a good prognosis, US 9,353,416 B2 remains silent on the potential use of HLA-J as a cancer vaccine.

[0012] Therefore, human leukocyte antigen (HLA) genes have a long history of research as important targets in biomedicine and therapy. However, considering the clinical importance of the HLA system, there is still a need to focus research on HLA genes, particularly to find additional targets for biomedicine and therapy based on the HLA system. This need is addressed by the present invention. Surprisingly, in relation to the present invention, it was discovered that HLA-J is not a pseudogene but contains a functional open reading frame encoding the HLA-J protein, and that HLA-J is a target for the treatment and detection of diseases, particularly tumors. means of solving the problem

[0013] Accordingly, in the first aspect, (a) encoding a polypeptide consisting of or containing the amino acid sequence of SEQ ID NO: 1; (b) consisting of the nucleotide sequence of SEQ ID NO: 2; (c) encoding a polypeptide having at least 70%, preferably at least 80%, homology more preferably at least 90%, and most preferably at least 95% homology with respect to the amino acid sequence of SEQ ID NO: 1; (d) consisting of a nucleotide sequence having at least 70%, preferably at least 80%, homology more preferably at least 90%, and most preferably at least 95% homology with respect to the nucleotide sequence of SEQ ID NO: 2; and (e) consisting of a nucleotide sequence that is degenerate with respect to the nucleic acid molecule of (d); (f) a fragment of any one of (a) to (e), wherein the fragment comprises at least 150 nucleotides, preferably at least 300 nucleotides, more preferably at least 450 nucleotides, and most preferably at least 600 nucleotides; or (g) corresponding to any one of (a) to (f), wherein T relates to a nucleic acid molecule substituted with U.

[0014] The term “nucleic acid molecule” according to the present invention includes DNA such as cDNA or double or single-stranded genomic DNA and RNA. In this regard, “DNA (deoxyribonucleic acid)” means any chain or sequence of adenine (A), guanine (G), cytosine (C), and thymine (T), which are chemical building blocks called nucleotide bases linked together on a deoxyribose sugar backbone. DNA may have a single strand of nucleotide bases or two complementary strands that can form a double helix structure. “RNA (ribonucleic acid)” means any chain or sequence of adenine (A), guanine (G), cytosine (C), and uracil (U), which are chemical building blocks called nucleotide bases linked together on a ribose sugar backbone. RNA generally has a single strand of nucleotide bases, such as mRNA. Single-stranded and double-stranded hybrid molecules, namely DNA-DNA, DNA-RNA, and RNA-RNA, are also included. Nucleic acid molecules may also be modified by many means known in the art. Non-limiting examples of such modifications include methylation, "cap," substitution with one or more analogs of natural nucleotides, and internucleotide modifications, e.g., modifications with non-charged bonds (e.g., methylphosphonate, phosphotriester, phosphoromidate, carbamate, etc.) and modifications with charged bonds (e.g., phosphorothioate, phosphorodithioate, etc.). Nucleic acid molecules, also referred to as polynucleotides below, may include one or more additional covalently bonded moieties, e.g., proteins (e.g., nucleases, toxins, antibodies, signal peptides, poly-L-lysine, etc.), intercalators (e.g., acridine, psoralen, etc.), chelators (e.g., metals, radioactive metals, iron, oxidizing metals, etc.), and alkylators.Polynucleotides may be derivatized by the formation of methyl or ethyl phosphotriester or alkyl phosphoamidate bonds. Nucleic acid mimicking molecules known in the art, such as synthetic or semi-synthetic derivatives of DNA or RNA and mixed polymers, are further included. Such nucleic acid mimicking molecules or nucleic acid derivatives according to the present invention include phosphorothioate nucleic acid, phosphoramidate nucleic acid, 2'-O-methoxyethyl ribonucleic acid, morpholino nucleic acid, hexitol nucleic acid (HNA), peptide nucleic acid (PNA), and locked nucleic acid (LNA) (see Braasch and Corey, Chem Biol 2001, 8: 1). LNA is an RNA derivative in which a ribose ring is bound by a methylene bond between the 2'-oxygen and the 4'-carbon. Nucleic acids containing modified bases, e.g., thio-uracil, thio-guanine, and fluorouracil, are also included. Nucleic acid molecules generally carry genetic information, including information used by cellular machinery to make proteins and / or polypeptides. The nucleic acid molecules of the present invention may additionally include promoters, enhancers, reaction elements, signal sequences, polyadenylation sequences, introns, 5'- and 3'- non-coding regions, etc.

[0015] The nucleic acid molecule according to the present invention encodes a polypeptide or a fragment thereof derived from the HLA-J protein of SEQ ID NO: 1. Accordingly, the nucleic acid molecule of the present invention is preferably genomic DNA or mRNA. In the case of mRNA, the nucleic acid molecule may additionally include a poly-A tail.

[0016] In the present invention, the term “protein” is used interchangeably with the term “polypeptide” and refers to a linear molecular chain of amino acids comprising a single-chain protein or fragments thereof comprising at least 50 amino acids. As used herein, the term “peptide” refers to a molecular group composed of up to 49 amino acids, whereas as used herein, the term “polypeptide” (also referred to as “protein”) refers to a molecular group composed of at least 50 amino acids. As used herein, the term “peptide” refers to a group of molecules composed of at least 15 amino acids, at least 20 amino acids, at least 25 amino acids, and at least 40 amino acids with increased preference for amino acids. Peptides and polypeptide groups are referred to together using the term “(poly)peptide.” (Poly)peptides may further form oligomers composed of at least two identical or different molecules. Higher-order structures corresponding to such multimers are correspondingly referred to as homodimers or heterodimers, homodimers or heterotrimers, etc. The HLA-J protein of SEQ ID NO: 1 contains cysteine ​​at positions 139, 175, and 189 and is therefore a potential dimerization site. Furthermore, peptidomimetic versions of these proteins / (poly)peptides in which amino acid(s) and / or peptide bond(s) are replaced by functional analogues are also included in the invention. These functional analogues include all known amino acids in addition to the 20 gene-coding amino acids, such as selenocysteine. The terms “(poly)peptide” and “protein” also refer to naturally modified (poly)peptides and proteins, said modifications being, for example, glycosylation, acetylation, phosphorylation, and similar modifications well known in the art.

[0017] According to the present invention, the term “percentage of sequence homology (%)” indicates the number of matches (“hits”) of the same nucleotide / amino acid in two or more aligned nucleic acid or amino acid sequences relative to the number of nucleotide or amino acid residues constituting the total length of the template nucleic acid or amino acid sequence. That is, when (partial) sequences are compared and aligned to the greatest degree of correspondence across a comparison window or across a designated region measured using a sequence comparison algorithm known in the art, or when aligned manually and visually inspected, alignment can be used to determine the percentage of the same amino acid residue or nucleotide (e.g., 70%, 75%, 80%, 85%, 90%, or 95% identity) for two or more sequences or subsequences. This definition also applies to the complements of all sequences being aligned.

[0018] Nucleotide and amino acid sequence analysis and alignment related to the present invention are preferably performed using the NCBI BLAST algorithm (Stephen F. Altschul, Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), Nucleic Acids Res. 25:3389-3402). BLAST can be used for nucleotide sequences (nucleotide BLAST) and amino acid sequences (protein BLAST). A person skilled in the art is aware of additional programs suitable for aligning nucleic acid sequences.

[0019] As defined herein, sequence homology of at least 70% identical, preferably at least 80% identical, more preferably at least 90% identical, and most preferably at least 95% identical is conceived by the present invention. However, additionally, sequence homology of at least 97.5%, at least 98.5%, at least 99%, at least 99.5%, at least 99.8%, and 100% is conceived by the present invention with increasing preference.

[0020] Furthermore, the 16 nucleotide sequences "TCACACATTTCTGGAA" (SEQ ID NO: 3) of SEQ ID NO: 2 are present within a nucleotide sequence having at least 70% homology or, preferably, higher homology with the nucleotide sequence of SEQ ID NO: 2, and it is preferable that they remain unchanged. As is evident from FIG. 2, SEQ ID NO: 3 corresponds to a 16-nucleotide insertion mutation that can be found only in the HLA-J nucleic acid molecule of SEQ ID NO: 2 but not in nucleic acid molecules of other HLAs. Therefore, the 16-nucleotide insertion is unique to the HLA-J nucleic acid molecule. Furthermore, the nucleotide insertion causes a frame shift, so that the entire nucleic acid sequence from the insertion to the 3'-terminus of SEQ ID NO: 2 (excluding the stop codon "TAG") encodes a unique peptide. Accordingly, it is more preferable that "TCACACATTTCTGGAAACTTCTCAAGG TTCCAAGACTAGGAGGTTCCTC" (SEQ ID NO: 4) of SEQ ID NO: 2 exists within a nucleotide sequence having at least 70% homology or preferably higher homology with the nucleotide sequence of SEQ ID NO: 2 and remains unchanged. The amino acid encoded by SEQ ID NO: 4 is "HTFLETSQGSKTRRFL" (SEQ ID NO: 5). Therefore, it is more preferable that a nucleotide sequence having at least 70% homology or preferably higher homology with the nucleotide sequence of SEQ ID NO: 2 encodes an amino acid sequence containing SEQ ID NO: 5, preferably at the C-terminus.

[0021] MHC class I molecules generally contain two chains: the MHC alpha chain (heavy chain) and the beta 2-microglobulin chain (light chain). Only the alpha chain spans the membrane. The alpha chain has three extracellular domains (referred to as alpha 1, 2, and 3, with alpha 1 located at the N-terminus). The alpha chain domains alpha 1 and alpha 3 of HLA-J primarily determine the immunosuppressive capacity of HLA-J, where domain alpha 3 is known to be the most important. The nucleotides at SEQ ID NO 6 and 7 encode domains alpha 1 and alpha 3 of HLA-J, respectively. The amino acid sequences at SEQ ID NO 8 and 9 are the amino acid sequences of domains alpha 1 and alpha 3 of HLA-J, respectively. Accordingly, a nucleotide sequence having at least 70% homology or preferably higher homology with the nucleotide sequence of SEQ ID NO: 2 preferably comprises a nucleotide sequence that is at least 97.5%, at least 98.5%, at least 99%, at least 99.5%, at least 99.8%, and 100% identical to SEQ ID NO: 7 in increasing order of preference. Additionally, a nucleotide sequence having at least 70% homology or preferably higher homology with the nucleotide sequence of SEQ ID NO: 2 preferably encodes an amino acid sequence that is at least 97.5%, at least 98.5%, at least 99%, at least 99.5%, at least 99.8%, and 100% identical to SEQ ID NO: 9 in increasing order of preference. A nucleotide sequence having at least 70% homology or preferably higher homology with the nucleotide sequence of SEQ ID NO: 2 is, with increasing preference, at least 97.5%, at least 98.5%, at least 99%, at least 99.5%, and at least 99% with SEQ ID NO: 7.It comprises nucleotide sequences that are 8% and 100% identical; and / or, with increasing preference, more preferably comprises nucleotide sequences that are at least 97.5%, at least 98.5%, at least 99%, at least 99.5%, at least 99.8%, and 100% identical to SEQ ID NO: 6. Additionally, a nucleotide sequence having at least 70% homology or preferably higher homology with the nucleotide sequence of SEQ ID NO: 2 encodes an amino acid sequence that is at least 97.5%, at least 98.5%, at least 99%, at least 99.5%, at least 99.8%, and 100% identical to SEQ ID NO: 9; and / or with increasing preference, it is more desirable to encode an amino acid sequence that is at least 97.5%, at least 98.5%, at least 99%, at least 99.5%, at least 99.8%, and 100% identical to SEQ ID NO: 8.

[0022] A nucleotide sequence having at least 70% homology or preferably higher homology with the nucleotide sequence of SEQ ID NO: 2 is most preferably composed of two or three of the following: (i) the nucleotide sequence of SEQ ID NO: 3, preferably SEQ ID NO: 4, wherein SEQ ID NO: 4 is preferably at the 3'-terminus; (ii) a nucleotide sequence identical to SEQ ID NO: 7 by at least 97.5%, at least 98.5%, at least 99%, at least 99.5%, at least 99.8%, and 100% with increasing preference; and (iii) a nucleotide sequence identical to SEQ ID NO: 6 by at least 97.5%, at least 98.5%, at least 99%, at least 99.5%, at least 99.8%, and 100% with increasing preference. If two of (i) to (iii) are present, the two are preferably (i) and (ii).

[0023] The term "degenerate" according to the present invention refers to the degeneracy of a genetic code. Since a triplet code specifies 20 amino acids and one stop codon and there are four bases used to encode genetic information, triplet codons are required to generate at least 21 different codes. The 4³ possible possibilities for three bases provide 64 possible codons, which implies that some degeneracy must exist. Consequently, some amino acids are encoded by one or more triplets, namely up to six triplets. Degeneracy mostly arises from changes in the third position of the triplet. This implies that nucleic acid molecules having a nucleotide sequence different from that specified above but still encoding the same polypeptide are within the scope of the present invention. In relation to the first aspect of the present invention, therefore, a person skilled in the art understands that the phrase "composed of a degenerate nucleotide sequence for the nucleic acid molecule of (e) (d)" mentioned in (e) refers to a nucleomorphic molecule encoding the same amino acid sequence as the nucleic acid molecule according to this entry (d). Such amino acid sequence is the amino acid sequence of SEQ ID NO: 1 or is derived therefrom, and said latter amino acid sequence is identical to SEQ ID NO: 1 to at least the extent required and implied by the sequence homology value mentioned in the main embodiment of entry (d).

[0024] A fragment of any one of (a) to (f) according to the present invention comprises at least 150 nucleotides. In this regard, with increasing preference, the fragment according to the present invention is preferably a polynucleotide of at least 200, at least 250, at least 300, at least 350, at least 400, at least 450, at least 500, at least 550, at least 600, or at least 650 nucleotides, and most preferably, said fragment is a fragment lacking only a 5'-ATP start codon and / or a 3'-TAG stop codon. Furthermore, said fragment comprises a nucleotide sequence encoding SEQ ID NO: 3, preferably SEQ ID NO: 4, and most preferably SEQ ID NO: 5. The nucleotide sequence encoding SEQ ID NO:5 is preferably found at the 3'-end of the fragment, which is followed by no additional nucleotide(s) or a stop codon. Likewise, the fragment preferably contains a nucleotide sequence that is at least 97.5%, at least 98.5%, at least 99%, at least 99.5%, at least 99.8%, and 100% identical to SEQ ID NO:7 with increasing preference; or preferably encodes an amino acid sequence that is at least 97.5%, at least 98.5%, at least 99%, at least 99.5%, at least 99.8%, and 100% identical to SEQ ID NO:9 with increasing preference. It is more preferable that the above fragment comprises, with increasing preference, at least 97.5%, at least 98.5%, at least 99%, at least 99.5%, at least 99.8%, and 100% identical nucleotide sequences with increasing preference, SEQ ID NO: 7; and / or at least 97.5%, at least 98.5%, at least 99%, at least 99.5%, at least 99.8%, and 100% identical nucleotide sequences with increasing preference, SEQ ID NO: 6.Similarly, the fragment encodes an amino acid sequence that is at least 97.5%, at least 98.5%, at least 99%, at least 99.5%, at least 99.8%, and 100% identical to SEQ ID NO: 9 with increasing preference; and / or more preferably encodes an amino acid sequence that is at least 97.5%, at least 98.5%, at least 99%, at least 99.5%, at least 99.8%, and 100% identical to SEQ ID NO: 8 with increasing preference. The fragment preferably comprises two or all three of the following: (i) a nucleotide sequence of SEQ ID NO: 3, preferably SEQ ID NO: 4, wherein SEQ ID NO: 4 is preferably at the 3'-terminus; (ii) nucleotide sequences that are at least 97.5%, at least 98.5%, at least 99%, at least 99.5%, at least 99.8%, and 100% identical to SEQ ID NO: 7 with increasing preference; and (iii) nucleotide sequences that are at least 97.5%, at least 98.5%, at least 99%, at least 99.5%, at least 99.8%, and 100% identical to SEQ ID NO: 6 with increasing preference. If two of (i) to (iii) are present, the two are preferably (i) and (ii).

[0025] In 1992, Messer et al. reported that HLA-J is a pseudogene caused by harmful mutations producing translation termination in exon 2 or exon 4 (J Immunol. 1992 Jun 15; 148 (12): 4043-53). Since then, the firm belief that HLA-J is a pseudogene has persisted in the art. As is evident in the examples below, it has been surprisingly discovered only now that the HLA-J nucleotide sequence contains a functional open reading frame (referred herein to be "open reading frame 3" or "ORF3") which can be safely assumed to encode the HLA-J protein. The sequence of said functional open reading frame is shown in SEQ ID NO: 2, and the HLA-J protein encoded by it is presented in SEQ ID NO: 1. Thus, after more than 25 years, it has been unexpectedly revealed that HLA-J is not a pseudogene but a functional gene; Refer to Example 1.

[0026] It is further noted that ORF3 contains a 16-nucleotide insertion unique to HLA-J. No other HLA contains a similar sequence. Due to this insertion, HLA-J lacks a homolog of exon 4 of HLA-G, which codes for alpha domain structure 2. The alpha 2-like domain is important for peptide presentation. More importantly, the insertion results in a unique 3-terminus of ORF3 encoding the peptide "HTFLETSQGSKTRRFL(-terminus)" (SEQ ID NO: 5). Due to the multiple charged amino acids and aromatic amino acids within this peptide, the fact that the HLA-J protein contains a transmembrane spanning region or anchor can be safely ruled out. Therefore, the newly identified HLA-J protein is a secretory protein with characteristics similar to HLA-G, but lacks peptide presentation ability due to the deficiency of an alpha 2-like domain; see Example 1.

[0027] According to a preferred embodiment of the first aspect of the present invention, a nucleic acid molecule is fused to a heterogeneous nucleotide sequence and, preferably, operably linked to a heterogeneous promoter.

[0028] The above heterogeneous nucleotide sequence may be fused directly or indirectly to the nucleic acid molecule of the present invention. In the case of indirect fusion, preferably, a nucleotide sequence encoding a peptide linker, e.g., a GS-linker (e.g., (Gly-Gly-Gly-Gly-Ser)n, (SEQ ID NO: 54), where n is 1 to 3) is used for fusion.

[0029] As used herein, a heterogeneous nucleotide sequence is a sequence not found in nature that is fused to the nucleotide sequence of SEQ ID NO: 2. Note that SEQ ID NO: 2 is of human origin, and it is also preferable that the heterogeneous nucleotide sequence be of human origin.

[0030] Therefore, the heterologous promoter is a sequence not found in nature that is operably linked to the nucleotide sequence of SEQ ID NO: 2. The heterologous promoter is preferably of human origin.

[0031] A promoter is a nucleic acid sequence that initiates the transcription of a specific gene, said gene being the one according to the present invention derived from the HLA-J gene of SEQ ID NO: 2 or SEQ ID NO: 2. In this regard, "operably linked" means that a heterologous promoter is fused to the nucleic acid molecule of the present invention so that transcription of the nucleic acid molecule of the present invention can be initiated, for example, in prokaryotes or eukaryotic cells, through the promoter. The heterologous promoter may be a constitutively active promoter, a tissue-specific or development-stage-specific promoter, an inducible promoter, or a synthetic promoter. Constitutive promoters direct expression in virtually all tissues and are largely, though not entirely, independent of environmental and developmental factors. Because their expression is generally not regulated by endogenous factors, constitutive promoters are generally active across species and across kingdoms. Tissue-specific or developmental-stage-specific promoters direct gene expression at specific tissue(s) or specific developmental stages. The activity of inducible promoters is induced by the presence or absence of biotic or abiotic factors. Inducible promoters are very powerful tools in genetic engineering because they can turn the expression of operably linked genes on or off as needed. Synthetic promoters are constructed by combining key elements of promoter regions from various origins.

[0032] Non-limiting examples of heterogeneous promoters used in the art to heterogeneously express genes are SV40, CMV, HSV, UBC, EF1A, PGK, Vlambda1, RSV, and CAGG (for mammalian systems); COPIA and ACT5C (for Drosophila systems) and GAL1, GAL10, GAL7, and GAL2 (for yeast systems) and may also be used in connection with the present invention.

[0033] Alternatively or additionally, the heterogeneous nucleic acid sequence may be a sequence encoding the nucleic acid sequence of the present invention to produce a fusion protein. Such fusion proteins are discussed in more detail below.

[0034] If the nucleic acid molecule is not fused to a heterologous promoter, it is fused to its own promoter for the purpose of expression.

[0035] In a second aspect, the present invention relates to a vector comprising a nucleic acid molecule of the first aspect.

[0036] The term "vector" according to the present invention preferably means a plasmid, cosmid, virus, bacteriophage, or other vector (e.g., commonly used in genetic engineering to carry the nucleic acid molecule of the present invention). The nucleic acid molecule of the present invention may be inserted into, for example, various commercially available vectors. Non-limiting examples include prokaryotic plasmid vectors such as the pUC-series, pBluescript (Stratagene), the pET series of expression vectors (Novagen), or pCRTOPO (Invitrogen); It also includes vectors compatible with expression in mammalian cells, such as pREP (Invitrogen), pcDNA3 (Invitrogen), pCEP4 (Invitrogen), pMC1neo (Stratagene), pXT1 (Stratagene), pSG5 (Stratagene), EBO-pSV2neo, pBPV-1, pdBPVMMTneo, pRSVgpt, pRSVneo, pSV2-dhfr, pIZD35, pLXIN, pSIR (Clontech), pIRES-EGFP (Clontech), pEAK-10 (Edge Biosystems), pTriEx-Hygro (Novagen), and pCINeo (Promega). Examples of plasmid vectors suitable for Pichia pastoris include, for instance, plasmids pAO815, pPIC9K, and pPIC3.5K (all from Invitrogen).

[0037] The nuclear molecule inserted into the vector may be synthesized by standard methods, for example, or isolated from nature. Ligation of the coding sequence to transcription regulatory elements and / or other amino acid coding sequences may also be performed using established methods. Transcription regulatory elements (part of an expression cassette) that ensure expression in prokaryotic or eukaryotic cells are well known to those skilled in the art. These elements include regulatory sequences that ensure the initiation of transcription (e.g., translation initiation codons, naturally related or heterologous promoters, and / or insulators; see above), internal ribosomal entry sites (IRES) (Owens, Proc. Natl. Acad. Sci. USA 98 (2001), 1471-1476), and poly-A signals that optionally ensure the termination of transcription and stabilization of the transcript. Additional regulatory elements may include transcription and translation enhancers. Preferably, the polynucleotide encoding the polypeptide / protein or fusion protein of the present invention is operably linked to such expression regulatory sequences that allow expression in prokaryotic or eukaryotic cells. The vector may further include a nucleic acid sequence encoding a secretory signal as an additional regulatory element. Such sequences are well known to those skilled in the art. Additionally, depending on the expression system used, a leader sequence capable of directing the expressed polypeptide into a cellular compartment may be added to the encoding sequence of the polynucleotide of the present invention. Such leader sequences are well known in the art.

[0038] Additionally, it is preferable that the vector includes selectable markers. Examples of selectable markers include genes encoding resistance to neomycin, ampicillin, hygromycin, and kanamycin. Specially designed vectors allow DNA transfer between different hosts, such as bacterial-fungal cells or bacterial-animal cells (e.g., the Gateway system available from Invitrogen). Expression vectors according to the present invention may direct the replication and expression of the polynucleotides and coded peptides or fusion proteins of the present invention. Apart from introduction via vectors such as phage vectors or viral vectors (e.g., adenoviruses, retroviruses), the nucleic acid molecules described herein may be designed for direct introduction or introduction into cells via liposomes. Additionally, systems based on baculovirus systems or vaccinia viruses or Semlicky forest viruses may be used as eukaryotic expression systems for the nucleic acid molecules of the present invention.

[0039] A third aspect of the present invention relates to a host cell that is transformed, transduced, or transfected with the vector of the second aspect.

[0040] The term "host cell" means any cell of any organism that is selected, modified, transformed, grown, or used or manipulated in any way for the production of the protein or peptide or fusion protein of the present invention by the cell.

[0041] The host cell of the present invention is typically produced by introducing the nucleic acid molecule or vector(s) of the present invention into the host cell, which mediates the expression of the nucleic acid molecule of the present invention encoding the protein or peptide or fusion protein of the present invention in its / the presence thereof. The host from which the host cell is derived or isolated may be a prokaryotic or eukaryotic cell or organism, and preferably may exclude human embryonic stem cells derived directly by the destruction of a human embryo.

[0042] Suitable prokaryotes (bacteria) useful as hosts for the present invention are, for example, Escherichia coli (e.g., E coli Strains BL21, HB101, DH5a, XL1 Blue, Y1090, and JM101), Salmonella typhimurium, Serratia marcescens, Burkholderia glumae, Pseudomonas putida, Pseudomonas fluorescens, Pseudomonas stutzeri, Streptomyces lividans, Lactococcus lactis, Mycobacterium smegmatis, Streptomyces coelicolor or Bacillus subtilis These are commonly used for cloning and / or expression. Appropriate culture media and conditions for the aforementioned host cells are well known in the art.

[0043] Suitable eukaryotic host cells can be vertebrate cells, insect cells, fungal / yeast cells, nematode cells, or plant cells. Fungal / yeast cells are Saccharomyces cerevisiae cell, Pichia pastoris cell or Aspergillus It may be a cell. Preferred examples of host cells genetically engineered with the nucleic acid molecule or vector(s) of the present invention are yeast, Escherichia coli, and / or species of the genus Bacillus (e.g., B. subtilis It is a cell of ). In one preferred embodiment, the host cell is a yeast cell (e.g., S. cerevisiae )am.

[0044] In other preferred embodiments, the host cells are mammalian host cells, such as CHO (Chinese Hamster Ovary) cells, mouse myeloma lymphoblastoid, human embryonic kidney cells (HEK-293), human embryonic retinal cells (Crucell's Per.C6), or human amniotic fluid cells (Glycotope and CEVEC). These cells are frequently used in the industry for the production of recombinant proteins. CHO cells are the most commonly used mammalian host cells for the industrial production of recombinant protein therapeutics for humans.

[0045] A fourth aspect of the present invention relates to a protein or peptide encoded by a nucleic acid molecule of the first aspect.

[0046] The terms "protein" and "peptide" and preferred embodiments thereof are defined above in relation to the first aspect of the present invention. These definitions and preferred embodiments are modified only where necessary ( mutatis mutandis ), and the fourth aspect of the present invention applies. The peptide according to the fourth aspect is preferably at least 80%, preferably at least 90%, and most preferably at least 95% identical to a subsequence of SEQ ID NO: 1. Most preferably, the peptide comprises or is composed of SEQ ID NO: 5.

[0047] The protein or peptide of the present invention can be produced by molecular cloning techniques well known in the art. Recombinant expression can be achieved, for example, using the vector and host cell described above in this invention.

[0048] The detection of the protein or peptide of the present invention in blood and tissue samples of cancer patients is disclosed in Example 4.

[0049] According to a preferred embodiment, the protein or peptide of the present invention is a fusion protein.

[0050] The “fusion protein” according to the present invention comprises at least one additional heterogeneous amino acid sequence. Often, but not necessarily, such additional sequence will be located at the N- or C-terminus of the (poly)peptide. For example, it may be convenient to initially express the polypeptide as a fusion protein in which the additional amino acid residue can be removed, for example, by a proteinase capable of specifically trimming the fusion protein of the present invention and releasing the (poly)peptide. The amino acid sequence compound may be fused directly or indirectly to the nucleic acid molecule of the present invention. In the case of indirect fusion, a peptide linker, for example, a GS-linker (e.g., Gly-Gly-Gly-Gly-Ser)n (SEQ ID NO: 54), where n is 1 to 3), may generally be used for fusion.

[0051] At least one additional heterogeneous amino acid sequence of the fusion protein comprises an amino acid sequence that confers desired properties, such as modified / enhanced stability, modified / enhanced solubility, and / or the ability to target one or more specific cell types. For example, a fusion protein having an antibody. The term antibody is further defined below and includes, in particular, antibody fragments and derivatives. The antibody may be, for example, specific to a cell surface marker or may be an antigen-recognition fragment of the antibody. The protein or peptide of the present invention may be fused to the N-terminus or C-terminus of the light chain and / or heavy chain(s) of the antibody. The protein or peptide of the present invention is preferably fused to the N-terminus of the light chain and / or heavy chain(s) of the antibody so that the Fc portion of the antibody can freely bind to the Fc receptor.

[0052] Fusion proteins may also contain protein domains known to function in signal transduction and / or be involved in protein-protein interactions. Examples of such domains are Ankyrin repeats; arm, Bcl-homology, Bromo, CARD, CH, Chr, C1, C2, DD, DED, DH, EFh, ENTH, F-box, FHA, FYVE, GEL, GYF, hect, LIM, MH2, PDZ, PB1, PH, PTB, PX, RGS, RING, SAM, SC, SH2, SH3, SOCS, START, TIR, TPR, TRAF, tsnare, Tubby, UBA, VHS, W, WW, and 14-3-3 domains. Further information on these and other protein domains can be obtained from the databases InterPro (http: / / www.ebi.ac.uk / interpro / , Mulder et al., 2003, Nucl. Acids. Res. 31: 315-318), Pfam (http: / / www.sanger.ac.uk / Software / Pfam / , Bateman et al., 2002, Nucleic Acids Research 30(1): 276-280) and SMART (http: / / smart.embl-heidelberg.de / , Letunic et al., 2002, Nucleic Acids Res. 30(1), 242-244).

[0053] The at least one additional heterogeneous amino acid sequence of the fusion protein according to the present invention may comprise or be composed of (a) a cytokine, (b) a chemokine, (c) a pro-coagulant, (d) a proteotoxic compound and / or (e) an enzyme for pro-drug activation.

[0054] The above cytokines are preferably selected from the group consisting of IL-2, IL-12, TNF-alpha, IFN-alpha, IFN-beta, IFN-gamma, IL-10, IL-15, IL-24, GM-CSF, IL-3, IL-4, IL-5, IL-6, IL-7, IL-9, IL-11, IL-13, LIF, CD80, B70, TNF-beta, LT-beta, CD-40 ligand, Fas-ligand, TGF-beta, IL-1-alpha, and IL-1-beta. As is well known in the art, cytokines can favor pro-inflammatory or anti-inflammatory responses of the immune system. Therefore, depending on the disease to be treated, a fusion protein having pro-inflammatory or anti-inflammatory cytokines may be preferred. For example, for the treatment of inflammatory diseases, a general fusion structure containing anti-inflammatory cytokines is desirable, whereas for the treatment of cancer, a general fusion structure containing pro-inflammatory cytokines is preferred.

[0055] The above chemokine is preferably selected from the group consisting of IL-8, GRO alpha, GRO beta, GRO gamma, ENA-78, LDGF-PBP, GCP-2, PF4, Mig, IP-10, SDF-1 alpha / beta, BUNZO / STRC33, I-TAC, BLC / BCA-1, MIP-1 alpha, MIP-1 beta, MDC, TECK, TARC, RANTES, HCC-1, HCC-4, DC-CK1, MIP-3 alpha, MIP-3 beta, MCP-1-5, eotaxin, eotaxin-2, I-309, MPIF-1, 6Ckine, CTACK, MEC, lymphotactin, and fractalkine. The primary role of chemokines is to act as chemoattractants that guide cell migration. Cells attracted to chemokines follow signals of increasing chemokine concentration toward the source of the chemokines. This implies that chemokines within fusion proteins can be used to guide the migration of the proteins or peptides of the present invention, for example, to specific cell types or body parts.

[0056] The above coagulation-promoting factor is preferably a tissue factor. The coagulation-promoting factor promotes the process of blood changing from liquid to gel and forms blood clots. For example, the coagulation-promoting factor can aid in wound healing.

[0057] The proteinaceous toxic compounds mentioned above are preferably lysine-A chains, modeccin, truncated Pseudomonas exotoxin A, diphtheria toxin, and recombinant gelonin. Toxic compounds can exert toxic effects on the organism as a whole, as well as on substructures of the organism such as specific cell types. Toxic compounds are frequently used in the treatment of tumors. Since tumor cells generally grow faster than normal somatic cells, they preferentially accumulate more toxic compounds.

[0058] The enzyme for the above-mentioned prodrug activation is preferably an enzyme selected from the group consisting of carboxy-peptidase, glucuronidase, and glucosidase. Among the various genes evaluated for tumor treatment, genes encoding prodrug-activating enzymes are particularly attractive because they directly complement ongoing clinical chemotherapy regimens. These enzymes can activate prodrugs with low endogenous toxicity using both bacterial and yeast enzymes, or enhance prodrug activation using mammalian enzymes.

[0059] According to a preferred embodiment, a protein or peptide is fused to a heterogeneous non-protein compound.

[0060] The heterogeneous compound used in this invention is a compound not found in nature that is fused to the amino acid sequence of SEQ ID NO: 1.

[0061] The above heterogeneous non-protein compounds may be fused directly or indirectly to the nucleic acid molecules of the present invention. For example, chemical linkers may be used. Chemical linkers may include various functional groups such as primary amines, sulfhydryls, acids, alcohols, and bromides. Many crosslinkers are functionalized with maleimide (sulfhydral reactive) and succinimidyl ester (NHS) or isothiocyanate (ITC) groups that react with amines.

[0062] The above heterogeneous non-protein compound is preferably a pharmaceutically active compound or a diagnostically active compound. The pharmaceutically active compound or the diagnostically active compound is preferably selected from the group consisting of (a) fluorescent dyes, (b) photosensitizers, (c) radionuclides, (d) medical imaging contrast agents, (e) toxic compounds, or (f) ACE inhibitors, renin inhibitors, ADH inhibitors, aldosterone inhibitors, angiotensin receptor blockers, TSH receptors, LH- / HCG receptors, estrogen receptors, progesterone receptors, androgen receptors, GnRH receptors, GH (growth hormone) receptors, or receptors for IGF-I or IGF-II.

[0063] The above fluorescent dye is preferably a component selected from Alexa Fluor or Cy dyes.

[0064] The above photosensitizer is preferably a phototoxic red fluorescent protein KillerRed or hematoporphyrin.

[0065] The above radionuclides are preferably gamma-emitting isotopes, more preferably 99m Tc, 123 I, 111 From, and / or the group of positron emitters, more preferably 18 F, 64 Cu,68 Ga, 86 Y, 124 From I, and / or the beta-emitter group, more preferably 131 I, 90 Y, 177 Lu, 67 Cu, 90 Selected from Sr or the alpha-emitter group, preferably 213 Bi, 211 Selected from At.

[0066] Contrast agents as used herein are substances used to enhance the contrast of internal structures or body fluids in medical imaging. Common contrast agents operate based on X-ray attenuation and magnetic resonance signal enhancement.

[0067] The above toxic compound is preferably a small organic compound, more preferably a toxic compound selected from the group consisting of calicheamicin, maytansinoid, neocarzinostatin, esperamicin, dynemicin, kedarcidin, maduropeptin, doxorubicin, daunorubicin, and auristatin. In contrast to the proteinaceous toxic compounds described herein, these toxic compounds are non-proteinaceous.

[0068] In a fifth aspect, the present invention relates to an inhibitor of a nucleic acid molecule and / or a binding molecule of the first aspect, preferably to an inhibitor of a protein of the fourth aspect, wherein (i) the inhibitor of the nucleic acid molecule of the first aspect of the present invention is preferably selected from small molecules, aptamers, siRNA, shRNA, miRNA, ribozymes, antisense nucleic acid molecules, CRISPR-Cas9-based constructs, CRISPR-Cpf1-based constructs, meganucleases, zinc finger nucleases, and transcription activator-like (TALE) effector nucleases, and / or (ii) the inhibitor of a binding molecule, preferably the inhibitor of a protein of the fourth aspect of the present invention, is preferably selected from small molecules, antibodies or antibody mimetics, and aptamers, wherein the antibody mimetic is preferably an affibody, It is selected from adnectin, anticalin, DARPin, avimer, nanofitin, affilin, Kunitz domain peptides, Fynomers®, trispecific binding molecule, and probody.

[0069] The binding molecule of the protein of the fourth aspect is a compound capable of binding to the protein of the fourth aspect. The binding molecule preferably binds specifically to the protein of the fourth aspect. Specific binding indicates that the binding molecule essentially does not bind to or essentially does not bind to proteins or peptides other than the protein of the fourth aspect. In particular, it is preferable that the binding molecule cannot bind to HLA proteins other than HLA-J. The binding molecule preferably binds to the C-terminal portion of HLA-J, i.e., the C-terminally of the incorrectly estimated termination, as reported in Messer et al., J Immunol. 1992 Jun 15; 148 (12): 4043-53. The exact location of the incorrectly estimated termination is shown in FIG. 1 and is further discussed in Example 1. The binding molecule of the protein of the fourth aspect is suitable, for example, for research purposes. For example, antibodies that bind to the protein of the fourth aspect can be used in immunoassays such as ELISA or Western Blot. This is exemplified in Example 4. Immunoassay is a biochemical test capable of measuring the presence or concentration of the protein of the fourth aspect in a sample (e.g., a solution). The binding molecule of the protein of the fourth aspect can preferably inhibit the protein of the fourth aspect. In this case, the binding molecule refers to an inhibitor.

[0070] A compound that inhibits the expression of a nucleic acid molecule and / or protein according to the present invention is, according to the present invention, (i) a compound that reduces or blocks the transcription of a gene encoding the nucleic acid molecule and / or protein of the present invention, or (ii) a compound that reduces or blocks the transcription of an mRNA encoding the protein of the present invention. The compound of (i) includes a compound that interferes with the transcriptional machinery and / or the interaction with the promoter of said gene and / or the interaction with expression regulatory elements located far from the promoter, such as enhancers. The compound of (ii) includes a compound that interferes with the translational machinery. The compound that inhibits the expression of a nucleic acid molecule and / or protein according to the present invention specifically inhibits the expression of the nucleic acid molecule and / or protein of the present invention by specifically interfering, for example, with a promoter region that controls expression. Preferably, transcription of the nucleic acid molecule and / or protein of the present invention or translation of the protein of the present invention is reduced by at least 50%, more preferably by at least 75%, e.g., at least 90% or at least 95%, more preferably by at least 98%, and most preferably by about 100% (e.g., compared to the same experimental setup in the absence of the compound).

[0071] The compound of the present invention that inhibits the activity of nucleic acid molecules and / or proteins according to the present invention causes said nucleic acid molecules and / or proteins to perform their functions with reduced efficiency. The compound of the present invention that inhibits the activity of nucleic acid molecules and / or proteins specifically inhibits the activity of said nucleic acid molecules and / or proteins. As described in more detail below, the compound of the present invention that inhibits the activity of nucleic acid molecules and / or proteins may specifically inhibit (preferably cause apoptosis) cells that interact with said nucleic acid molecules and / or proteins themselves or produce said nucleic acid molecules and / or proteins and / or bind to said proteins. Preferably, the activity of said nucleic acid molecules and / or proteins is reduced by at least 50%, more preferably by at least 75%, e.g., at least 90% or at least 95%, more preferably by at least 98%, and most preferably by about 100% (e.g., compared to the same experimental setup in the absence of said compound).

[0072] According to the present invention, the activity of the nucleic acid molecules and / or proteins is, preferably, its / their ability to induce resistance to chemotherapy in cancer patients and / or reduce the progression-free survival and overall survival of cancer patients (see attached examples). The chemotherapy referred to herein may be adjuvant chemotherapy or neoadjuvant chemotherapy, preferably adjuvant chemotherapy. Chemotherapy uses drugs to destroy cancer cells, stop their growth, or alleviate symptoms. In neoadjuvant chemotherapy (also referred to as pre-operative or primary), drug treatment is administered before the surgical removal of the tumor. This is in contrast to adjuvant chemotherapy, which administers drugs after surgery. Means and methods for determining such activity are established in the art and are described in the examples below. Accordingly, according to the medical aspect of the present invention, such activity of the nucleic acid molecules and / or proteins of the present invention is inhibited.

[0073] The inhibitory efficiency of an inhibitor can be quantified by comparing the level of activity in the presence of the inhibitor with the level of activity in the absence of the inhibitor. For example, changes in the amount of nucleic acid molecules and / or proteins of the present invention formed can be used for measurement. The efficiencies of multiple inhibitors can be determined simultaneously in a high-throughput format. High-throughput analysis can be performed, typically in the wells of a microtiter plate, separately from biochemical, cellular, or other analyses, wherein each plate may contain 96, 384, or 1536 wells. Handling the plate, incubation at a temperature other than ambient temperature, and contacting the test compound with the analysis mixture are preferably influenced by one or more computer-controlled robotic systems including pipetting devices. If a large library of test compounds is to be screened or screening must be performed within a short time, a mixture of test compounds, e.g., 10, 20, 30, 40, 50, or 100 test compounds, may be added to each well. For wells exhibiting expected activity, the mixture of test compounds may be de-convoluted to identify one or more test compounds in the mixture that cause said activity.

[0074] The compounds of the present invention that inhibit the fermentation and / or activity of nucleic acid molecules and / or proteins can be formulated into vesicles such as liposomes or exosomes. Liposomes have attracted significant interest in terms of drug delivery due to the specificity and duration of action they provide. Liposomal cell-type delivery systems have been used to effectively deliver nucleic acids, such as siRNA, into cells in vivo (Zimmermann et al. (2006) Nature, 441:111-114). Liposomes are monolayer or multilayer vesicles having a membrane formed of a lipophilic substance and an aqueous interior. The aqueous portion contains the composition to be delivered. Cationic liposomes have the advantage of being able to fuse with the cell wall. Non-cationic liposomes, although unable to efficiently fuse with the cell wall, are phagocytosed by macrophages and other cells in vivo. Exosomes are lipid packages capable of carrying various molecules, including RNA (Alexander et al. (2015), Nat Commun; 6:7321). Exosomes containing the molecules within them can be absorbed by recipient cells. Therefore, exosomes are important mediators for intercellular communication and regulators of the cellular niche. Exosomes are useful for diagnostic and therapeutic purposes because they can be used, for example, as a delivery vehicle for contrast agents or drugs.

[0075] The compound of the present invention that inhibits the expression and / or activity of nucleic acid molecules and / or proteins may be administered to a subject at an appropriate dose and / or a therapeutically effective amount. This will be further discussed below in relation to the pharmaceutical composition of the present invention.

[0076] The treatment period required to observe changes and the interval at which a response occurs after treatment vary depending on the desired effect. Specific amounts can be determined by conventional tests well known to those skilled in the art. Appropriate tests are described, for example, in Tamhane and Logan (2002), “Multiple test procedure to determine the minimum effective and maximum safe dose of a drug”, Journal of the American Statistics Association, 97 (457):1-9.

[0077] The compound of the present invention that inhibits the expression and / or activity of nucleic acid molecules and / or proteins is preferably mixed with a pharmaceutically acceptable carrier or excipient to form a pharmaceutical composition. Suitable pharmaceutically acceptable carriers or excipients, as well as formulations of the pharmaceutical composition, will be discussed below in relation to the pharmaceutical composition of the present invention.

[0078] As used herein, "small molecules" are preferably organic molecules. Organic molecules belong to or relate to a class of chemical compounds having carbon atoms connected to each other by carbon-carbon bonds. The original definition of the term organic relates to the source of the chemical compound; while inorganic compounds are obtained from mineral sources, organic compounds are carbon-containing compounds obtained from plant, animal, or microbial sources. Organic compounds can be natural or synthetic. Organic molecules are preferably aromatic molecules and more preferably heteroaromatic molecules. In organic chemistry, the term aromatic is used to describe cyclic (ring-shaped), planar (flat) molecules having resonance bond rings that exhibit higher stability than other geometric or bonding arrangements with the same set of atoms. Aromatic molecules are very stable and do not easily decompose or react with other substances. In heteroaromatic molecules, at least one of the atoms in the aromatic ring is an atom other than carbon, e.g., N, S, or O. For all the aforementioned organic molecules, the molecular weight is preferably in the range of 200 Da to 1500 Da, and more preferably in the range of 300 Da to 1000 Da.

[0079] Additionally, the “small molecule” according to the present invention may be an inorganic compound. Inorganic compounds include all compounds derived from mineral sources that lack carbon atoms (excluding carbon dioxide, carbon monoxide, and carbonates). Preferably, the small molecule has a molecular weight of less than about 2000 Da, or less than about 1000 Da, e.g., less than about 500 Da, and more preferably less than about Da atomic mass units (Da amu). The size of the small molecule may be determined by methods well known in the art, e.g., mass spectrometry. The small molecule may be designed, for example, based on the crystal structure of a target molecule, wherein the site presumed to be responsible for biological activity may be identified and verified through in vivo analysis, such as high-throughput screening (HTS) analysis.

[0080] The term "antibody" as used according to the present invention includes, for example, polyclonal or monoclonal antibodies. Additionally, derivatives or fragments thereof that still retain binding specificity to a target, for example, the HLA-J protein of SEQ ID NO: 1, are included in the term "antibody." Antibody fragments or derivatives include, in particular, Fab or Fab' fragments, Fd, F(ab')2, Fv or scFv fragments, single-domain VH or V-like domains, such as VhH or V-NAR- domains, as well as minibodies, diabodies, tribodies or triplebodies, tetrabodies or chemically conjugated Fab'-multimers (see, e.g., Harlow and Lane "Antibodies, A Laboratory Manual", Cold Spring Harbor Laboratory Press, 198; Harlow and Lane "Using Antibodies: A Laboratory Manual", Cold Spring Harbor Laboratory Press, 1999; Altshuler EP, Serebryanaya DV, Katrukha AG. 2010, Biochemistry (Mosc)., vol. 75(13), 1584; Holliger P, Hudson PJ. 2005, Nat Biotechnol., vol.23(9), 1126). In particular, the multimeric form includes a bispecific antibody capable of simultaneously binding to two different types of antigens. The first antigen can be found in the protein of the present invention. The second antigen may be, for example, a tumor marker specifically expressed in cancer cells or a specific type of cancer cell.Non-limiting examples of bispecific antibody forms are biclonic (bispecific, full-length human IgG antibody), DART (Dual-affinity Re-targeting antibody), and BiTE (composed of two single-chain variable fragments (scFv) of different antibodies) molecules (Kontermann and Brinkmann (2015), Drug Discovery Today, 20(7): 838-847).

[0081] The above term "antibody" also includes specific examples such as chimeras (human constant domain, non-human variable domain), single-chain antibodies, and humanizing antibodies (human antibodies excluding non-human CDRs).

[0082] Various techniques for antibody production are well known in the art, e.g., Harlow and Lane (1988) and (1999) and Altshuler et al., 2010, loc. cit. Thus, polyclonal antibodies can be obtained from animal blood after immunization with antigens mixed with additives and adjuvants, while monoclonal antibodies can be produced by any technique that provides antibodies produced by continuous cell line culture. Examples of such techniques are described in Harlow E and Lane D, Cold Spring Harbor Laboratory Press, 1988; Harlow E and Lane D, Using Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, 1999; and K This includes hybridoma technology first described by hler and Milstein (1975), trioma technology, human B-cell hybridoma technology (e.g., see Kozbor D, 1983, Immunology Today, vol.4, 7; Li J, et al. 2006, PNAS, vol. 103(10), 3557), and human monoclonal antibody EBV-hybridomoma technology (Cole et al., 1985, Alan R. Liss, Inc, 77-96). Additionally, recombinant antibodies can be obtained from monoclonal antibodies or produced de novo using various presentation methods such as phage, ribosomal, mRNA, or cell display. A system suitable for the expression of recombinant (humanized) antibodies may be selected from, for example, bacteria, yeast, insect, mammalian cell lines, or genetically modified animals or plants (see, e.g., U.S. Patent 6,080,560; Holliger P, Hudson PJ. 2005, Nat Biotechnol., 23(9), 11265). Additionally, the techniques described for the production of single-strand antibodies (in particular, see U.S. Patent 4,946,778) may be modified to produce single-strand antibodies specific to the epitope of HLA-J. Surface plasmon resonance used in the BIAcore system may be used to increase the efficiency of the phage antibody.

[0083] As used herein, the term "antibody mimetic" refers to a compound capable of specifically binding to an antigen, such as the HLA-J protein of SEQ ID NO: 1 in this application, like an antibody, but without structural relation to an antibody. Antibody mimetics are generally artificial peptides or proteins with a molar mass of about 3 to 20 kDa. For example, antibody mimetics may be selected from affibodies, adnectin, anticalin, DARPin, avimer, nanofitin, affilin, Kunitz domain peptides, Fynomers®, trispecific binding molecules, and probodies. These polypeptides are well known in the art and are described in more detail below.

[0084] As used herein, the term "affibody" refers to a family of antibody analogs derived from the Z-domain of staphylococcal protein A. Structurally, affibody molecules are based on a three-helix bundled domain, which can also be incorporated into fusion proteins. Affibodies themselves have a molecular weight of approximately 6 kDa and are stable under high temperatures and acidic or alkaline conditions. Target specificity is acquired by the randomization of 13 amino acids located on two alpha helices involved in the binding activity of the parent protein domain (Feldwisch J, Tolmachev V.; (2012) Methods Mol Biol. 899: 103-26).

[0085] The term “adnectin” (also called “monobody”) as used herein refers to a molecule based on the 10th extracellular domain of human fibronectin III (10Fn3), which adopts a 94-residue Ig-like β-sandwich fold with 2 to 3 exposed loops but lacks a central disulfide bridge (Gebauer and Skerra (2009) Curr Opinion in Chemical Biology 13: 245-255). Adnectin with specificity for a desired target, namely HLA-J, can be genetically engineered by introducing modifications to specific loops of the protein.

[0086] The term “anticalin” as used herein refers to an engineered protein derived from lipocalin (Beste G, Schmidt FS, Stibora T, Skerra A. (1999) Proc Natl Acad Sci US A. 96 (5): 1898-903; Gebauer and Skerra (2009) Curr Opinion in Chemical Biology 13: 245-255). Anticalin has an 8-stranded β-barrel that forms a highly conserved core unit among lipocalins and naturally forms binding sites for ligands through four structurally variable loops at the open ends. Anticalin, although not homologous to the IgG superfamily, exhibits features previously considered typical for antibody binding sites: (i) high structural flexibility resulting from sequence variations and (ii) enhanced conformational flexibility allowing for induced fitting to targets of different shapes.

[0087] As used herein, the term "DARPin" refers to an engineered ankyrin repeat domain (166 residues) that provides a rigid interface occurring at three repeated β-turns. DARPin typically has three repeats corresponding to an artificial consensus sequence, where six positions per repeat are randomly assigned. Consequently, DARPin lacks structural flexibility (Gebauer and Skerra, 2009).

[0088] As used herein, the term "avimer" refers to a class of antibody analogs consisting of two or more peptide sequences of 30 to 35 amino acids each, which are derived from the A-domains of various membrane receptors and linked by linker peptides. Binding to the target molecule occurs through the A-domain, and the domain with the desired binding specificity (i.e., HLA-J) can be selected, for example, by phage display technology. The binding specificity of different A-domains included in the avimer may be the same, but is not necessarily the same (Weidle UH, et al., (2013), Cancer Genomics Proteomics; 10(4):155-68).

[0089] "Nanofitin (also known as apitin)" is Sulphorobus Ashidocaldarius ( Sulfolobus acidocaldarius It is an antibody-mimicking protein derived from the DNA-binding protein Sac7d. Nanophytin generally has a molecular weight of about 7 kDa and is designed to specifically bind to target molecules, e.g., HLA-J, through the randomization of amino acids on its binding surface (Mouratou B, Behar G, Paillard-Laurance L, Colinet S, Pecorari F., (2012) Methods Mol Biol.; 805:315-31).

[0090] As used herein, the term "affilin" refers to an antibody analog developed by using gamma-B crystalline form or ubiquitin as a scaffold and modifying amino acids on the surface of these proteins through random mutagenesis. The selection of affilins with desired target specificity (i.e., for HLA-J) is performed, for example, by phage display or ribosome display techniques. Depending on the scaffold, the molecular weight of affilin is approximately 10 or 20 kDa. As used herein, the term affilin also refers to affilins in dimeric or polymeric forms (Weidle UH, et al., (2013), Cancer Genomics Proteomics; 10(4):155-68).

[0091] "Kunitz domain peptides" are derived from the Kunitz domains of Kunitz-type protease inhibitors, such as bovine pancreatic trypsin inhibitor (BPTI), amyloid precursor protein (APP), or tissue factor pathway inhibitor (TFPI). Kunitz domains have a molecular weight of approximately 6 kDA, and domains specific to a desired target, namely HLA-J, can be selected by display technologies such as phage display (Weidle et al., (2013), Cancer Genomics Proteomics; 10 (4): 155-68).

[0092] As used herein, the term "Fynomer®" refers to a non-immunoglobulin-derived conjugated polypeptide derived from the human Fyn SH3 domain. Fyn SH3-derived polypeptides are well known in the art and are described, for example, in Grabulovski et al. (2007) JBC, 282, p. 3196-3204, WO 2008 / 022759, Bertschinger et al. (2007) Protein Eng Des Sel 20(2):57-68, Gebauer and Skerra (2009) Curr Opinion in Chemical Biology 13:245-255, or Schlatter et al. (2012), MAbs 4:4, 1-12).

[0093] As used herein, the term “trispecific binding molecule” refers to a polypeptide molecule having three binding domains and thus capable of binding to three different epitopes, preferably specifically binding to them. At least one of these three epitopes is an epitope of the protein of the fourth aspect of the present invention. Two other epitopes may also be epitopes of the protein of the fourth aspect of the present invention or epitopes of one or two different antigens. The trispecific binding molecule is preferably TriTac. TriTac is a T-cell engager for solid tumors composed of three binding domains designed to have an extended serum half-life and be about one-third the size of a monoclonal antibody.

[0094] As used herein, the term "probody" refers to a protease-activating antibody prodrug. The probody consists of an authentic IgG heavy chain and a modified light chain. A masking peptide is fused to the light chain via a peptide linker that can be cleaved by tumor-specific proteases. The masking peptide prevents the probody from binding to healthy tissue, thereby minimizing toxic side effects.

[0095] Aptamers are nucleic acid or peptide molecules that bind to specific target molecules. Aptamers are generally created by selecting from a large pool of random sequences, but natural aptamers also exist in riboswitches. Aptamers can be used as macromolecular drugs for both basic research and clinical purposes. Aptamers can bind to ribozymes and self-cleave in the presence of the target molecule. These compound molecules have further research, industrial, and clinical applications (Osborne et al. (1997), Current Opinion in Chemical Biology, 1:5-9; Stull & Szoka (1995), Pharmaceutical Research, 12, 4:465-483).

[0096] Nucleic acid aptamers are generally nucleic acid species composed of strands of (usually short) oligonucleotides. Typically, they are designed through repeated rounds of in vitro selection or, equivalently, SELEX (systematic evolution of ligands by exponential enrichment) to bind to various molecular targets such as small molecules, proteins, nucleic acids, and even cells, tissues, and organisms.

[0097] Peptide aptamers are peptides or proteins designed to interfere with other protein interactions within a cell. They consist of variable peptide loops attached to both ends of a protein scaffold. This dual structural constraint significantly increases the binding affinity of peptide aptamers to levels comparable to antibodies (in the nanomolar range). Variable peptide loops typically contain 10 to 20 amino acids, and scaffolds can be any protein with excellent solubility characteristics. Currently, the bacterial protein Thioredoxin-A is the most commonly used scaffold protein, and the variable peptide loop is inserted into a redox-activated site, which is the -Cys-Gly-Pro-Cys-loop (SEQ ID NO: 55) in the wild-type protein, where two cysteine ​​side chains can form a disulfide bridge. Peptide aptamers can be selected using different systems, but the most widely used currently is the yeast two-hybrid system.

[0098] Aptamers offer utility for biotechnological and therapeutic applications because they provide molecular recognition properties comparable to commonly used biomolecules, particularly antibodies. In addition to differential recognition capabilities, aptamers offer advantages over antibodies because they can be fully manipulated in vitro, are easily produced by chemical synthesis, possess desirable storage characteristics, and induce little to no immunogenicity in therapeutic use. Unmodified aptamers are rapidly eliminated from the bloodstream, with half-lives ranging from minutes to hours, as they are nuclease-degraded and removed from the body primarily by the kidneys, mainly as a result of their inherently low molecular weight. Applications of unmodified aptamers currently focus on treating transient conditions such as blood clots or treating organs like the eyes where local delivery is possible. This rapid elimination can be advantageous in applications such as in vivo diagnostic imaging. Various modifications are possible for scientists, such as 2'-fluorine-substituted pyrimidines, polyethylene glycol (PEG) bonds, albumin, or fusion with other half-life-extending proteins, and by doing so, the half-life of the aptamer can be increased by a few days or weeks.

[0099] As discussed, the aforementioned small molecules, antibodies or antibody analogs, and aptamers may specifically bind to the protein of the fourth aspect of the present invention. Such binding will block the immunosuppressive properties of the protein of the fourth aspect of the present invention, preferably the ability to induce resistance to chemotherapy in cancer patients and / or reduce progression-free survival and overall survival. In this case, the small molecules, antibodies or antibody analogs, and aptamers are also referred to as blocking small molecules, blocking antibodies or antibody analogs, and blocking aptamers. The blocking small molecules, blocking antibodies or antibody analogs, and blocking aptamers block the interaction of the protein of the fourth aspect of the present invention with other cellular components, such as ligands and receptors, that generally interact with the protein of the fourth aspect of the present invention.

[0100] The small molecules, antibodies or antibody analogs, and aptamers mentioned above may also be produced in the form of drug-conjugates. In this case, the small molecules, antibodies or antibody analogs, and aptamers themselves may not have an inhibitory effect, and the inhibitory effect is imparted solely by the drug. The small molecules, antibodies or antibody analogs, and aptamers impart site-specific binding ability of the drug to cells that produce and / or bind to the protein of the present invention. The drug is preferably capable of killing cells that produce and / or bind to the protein of the present invention. Thus, by combining the targeting ability of the molecule binding to the protein of the present invention with the cell-killing ability of the drug, the drug-conjugate becomes an inhibitor capable of distinguishing between healthy tissue and diseased tissue. Cleavable and non-cleavable linkers for designing drug-conjugates are known in the art. Non-limiting examples of drugs capable of killing cells are cell proliferation inhibitors and radioisotopes that deliver radiation directly to cancer cells.

[0101] Additionally, it is possible to limit the binding and / or inhibitory activity of small molecules, antibodies or antibody analogs, and aptamers to specific tissue or cell types, particularly diseased tissues or cell types. For example, a probody may be designed. In the probody, said small molecule, antibody or antibody analog, or aptamer may be bound to a masking peptide that restricts or prevents binding to the protein of the present invention, and the masking peptide may be cleaved by a protease. A protease is an enzyme that breaks down proteins into small pieces by cleaving a specific amino acid sequence known as a substrate. In normal healthy tissues, protease activity is strictly controlled. In cancer cells, protease activity is upregulated. In healthy tissues or cells where protease activity is controlled and minimal, the target-binding region of the probody is masked and cannot be bound. On the other hand, in diseased tissues or cells where protease activity is upregulated, the target-binding region of the probody is not masked and can be bound and / or inhibited.

[0102] According to the present invention, the term “small interfering RNA (siRNA),” also known as short interfering RNA or silencing RNA, refers to a class of double-stranded RNA molecules of 18 to 30, preferably 19 to 25, most preferably 21 to 23, or much more preferably 21 nucleotides in length, which play various roles in biology. In particular, siRNA is involved in RNA interference (RNAi) pathways that interfere with the expression of specific genes. In addition to its role in RNAi pathways, siRNA also plays a role in RNAi-related pathways, for example, as an antiviral mechanism or as a component of the chromatin structure of the genome.

[0103] Naturally occurring siRNA possesses a well-defined structure: short double-stranded RNA (dsRNA) with 2-nt 3' overhangs at both ends. Each strand has a 5' phosphate group and a 3' hydroxyl (-OH) group. This structure is the result of processing by Dicer, an enzyme that converts long dsRNA or small hairpin RNA into siRNA. siRNA can also be introduced exogenously (artificially) into cells to induce specific knockdown of genes of interest. Thus, any gene with a known sequence can be targeted with appropriately customized siRNA based on sequence complementarity. Double-stranded RNA molecules or their metabolic processing products can mediate target-specific nucleic acid modifications, particularly RNA interference and / or DNA methylation. Exogenously introduced siRNA may not have overhangs at the 3' and 5' ends, but it is preferable that at least one RNA strand has a 5'- and / or 3'- overhang. Preferably, one end of the double-strand has a 3'-overhang of 1 to 5 nucleotides, more preferably 1 to 3 nucleotides, and most preferably 2 nucleotides. The other end will be a blunt-end or have a 3'-overhang of up to 6 nucleotides. In general, any RNA molecule suitable for acting as siRNA is envisioned in the present invention. To date, the most efficient silencing has been achieved with siRNA duplexes consisting of 21-nt sense and 21-nt antisense strands paired in such a manner that they have a 2nt 3'-overhang. The sequence of the above 2-nt 3' protrusion contributes slightly to the specificity of target recognition, which is restricted to unpaired nucleotides adjacent to the first base pair (Elbashir et al. 2001).The 2'-deoxynucleotide of the 3' overhang is as efficient as ribonucleotide but is cheaper to synthesize and likely has greater nuclease resistance. Delivery of siRNA can be achieved using any method known in the art, for example, by combining siRNA with saline and administering said combination intravenously or intranasally, or by formulating siRNA in glucose (e.g., 5% glucose) or cationic lipids; polymers can be used for in vivo siRNA delivery via systemic routes intravenously (IV) or intraperitoneally (IP) (Fougerolles et al. (2008), Current Opinion in Pharmacology, 8: 280-285; Lu et al. (2008), Methods in Molecular Biology, vol. 437: Drug Delivery Systems - Chapter 3: Delivering Small Interfering RNA for Novel Therapeutics).

[0104] Short hairpin RNA (shRNA) is a sequence of RNA that forms a taut hairpin curve that can be used to silence gene expression through RNA interference. shRNA uses a vector introduced into the cell and utilizes a U6 promoter to ensure that the shRNA is always expressed. This vector is typically passed to daughter cells to ensure that gene silencing is inherited. The shRNA hairpin structure is cleaved into siRNA by the cellular machinery and then bound to an RNA-induced silencing complex (RISC). This complex binds to and cleaves mRNA that matches the bound siRNA. The si / shRNA used in the present invention is preferably chemically synthesized using appropriately protected ribonucleoside phosphoramidite and a conventional DNA / RNA synthesizer. RNA synthesis reagent suppliers include Proligo (Hamburg, Germany), Dharmacon Research (Lafayette, CO, USA), Pierce Chemical (Perbio Science, Rockford, IL, USA), Glen Research (Sterling, VA, USA), ChemGenes (Ashland, MA, USA), and Cruachem (Glasgow, UK). Most conveniently, siRNA or shRNA is obtained from commercial RNA oligo synthesis suppliers that sell RNA-synthesizing products of various qualities and costs. Generally, the RNA applicable in this invention is typically synthesized and readily available in a quality suitable for RNAi.

[0105] Additional molecules affecting RNAi include, for example, microRNAs (miRNAs). These RNA species are single-stranded RNA molecules. Endogenous miRNA molecules regulate gene expression by binding to complementary mRNA transcripts and triggering the degradation of said mRNA transcripts through a process similar to RNA interference. Therefore, exogenous miRNAs can be used as inhibitors of HLA-J after being introduced into individual cells.

[0106] Ribozymes (also known as ribonucleases, RNA enzymes, or catalytic RNA) are RNA molecules that catalyze chemical reactions. Many natural ribozymes catalyze their own cleavage or the cleavage of other RNAs, but they have also been found to catalyze the aminotransferase activity of ribosomes. Non-limiting examples of well-characterized small self-cleaving RNAs include hammerhead, hairpin, hepatitis delta virus, and in vitro-selected lead-dependent ribozymes, whereas Group I introns are examples of larger ribozymes. The principles of catalytic self-cleavage have been well established in recent years. Hammerhead ribozymes are the most well-characterized among RNA molecules possessing ribozyme activity. Since it has been demonstrated that hammerhead structures can be incorporated into heterologous RNA sequences and thereby transfer ribozyme activity to these molecules, it appears that catalytic antisense sequences can be generated for almost any target sequence provided that the target sequence contains a potentially matching cleavage site. The basic principle of constructing a hammerhead ribozyme is as follows: a region of interest of RNA containing a GUC (or CUC) triplet is selected. Generally, two oligonucleotide strands, each containing 6 to 8 nucleotides, are taken, and a catalytic hammerhead sequence is inserted between them. The best results are generally obtained with a short ribozyme and a target sequence.

[0107] A useful recent development according to the present invention is a combination of an aptamer that recognizes small compounds and a hammerhead ribozyme. When binding to a target molecule, conformational changes induced in the aptamer can modulate the catalytic function of the ribozyme.

[0108] As used herein, the term "antisense nucleic acid molecule" refers to a nucleic acid that is complementary to a target nucleic acid. The antisense molecule according to the present invention can interact with a target nucleic acid, and more specifically, can hybridize with the target nucleic acid. Due to the formation of the hybrid, the transcription of target genes and / or the translation of target mRNA is reduced or blocked. Standard methods related to antisense technology are described (see, e.g., Melani et al., Cancer Res. (1991) 51: 2897-2901).

[0109] CRISPR / Cas9 and CRISPR-Cpf1 technologies are applicable to almost any cell or model organism and can be used for mutations, chromosomal deletions, DNA sequence editing, and gene expression regulation. The regulation of gene expression can be achieved using a catalytically inactive Cas9 enzyme (dCas9) conjugated with a transcription repressor to inhibit the transcription of a specific gene, such as the HLA-J gene. Similarly, a catalytically inactive, "dead" Cpf1 nuclease (CRISPR from Prevotella and Francisella-1) is fused with a synthetic transcription repressor or activator to downregulate an endogenous promoter, for example, the promoter that regulates HLA-J expression. Alternatively, the DNA binding domain of a zinc finger nuclease (ZFN) or TALEN (transcription activator-like effector nuclease) can be designed to specifically recognize the HLA-J gene or its promoter region or 5'-UTR to inhibit the expression of the HLA-J gene.

[0110] Inhibitors provided as repressive nucleoside molecules targeting the HLA-J gene or regulatory molecules involved in HLA-J expression are also considered herein. These molecules that reduce or eliminate the expression of HLA-J or regulatory molecules include, but are not limited to, meganucleases, zinc finger nucleases (ZFNs), and TALENs (transcription activator-like effector nucleases). Such methods are described in Silva et al., Curr Gene Ther. 2011; 11(1):11-27; Miller et al., Nature biotechnology. 2011;29(2):143-148 and Klug, Annual review of biochemistry. 2010; 79:213-231.

[0111] In a sixth aspect, the present invention relates to a method for producing a protein or peptide of a fourth aspect, comprising (a) culturing a host cell of a third aspect and (b) isolating the produced protein or peptide of a fourth aspect.

[0112] The term "culture" above refers to the process of host cells growing under controlled conditions. These conditions may vary depending on the host cells used. Those skilled in the art are well aware of how to establish optimized culture conditions. Furthermore, methods for establishing, maintaining, and manipulating cell cultures have been extensively described at the latest level of technology.

[0113] Methods for isolating the generated (poly)peptide are well known in the art and include, but are not limited to, method steps such as ion exchange chromatography, gel filtration chromatography (size exclusion chromatography), affinity chromatography, high-pressure liquid chromatography (HPLC), reverse-phase HPLC, disk gel electrophoresis, or immunoprecipitation, see, for example, Sambrook, 2001, Molecular Cloning: A Laboratory manual, 3rd ed, Cold Spring Harbor Laboratory Press, New York.

[0114] The term “produced protein or peptide” according to the present invention refers to the product of a process, implying that the process can be induced in a host cell, thereby using information from a nucleic acid molecule encoding a (poly)peptide in the synthesis of the (poly)peptide of the present invention. Several steps in this process, including transcription, RNA splicing, translation, and post-translational modification of the peptide of the present invention by methods known in the art, may be controlled. Thus, such control enables control of the timing, location, and amount of the produced (poly)peptide.

[0115] In a seventh aspect, the present invention relates to a composition comprising a nucleic acid molecule, a vector, a host cell, a protein or peptide, a binding molecule, preferably an inhibitor of the present invention, or a combination thereof, preferably a pharmaceutical or diagnostic composition.

[0116] The term “composition” as used herein refers to a composition comprising at least one of a nucleic acid molecule, a vector, a host cell, a protein or peptide, a binding molecule, preferably an inhibitor of the fifth aspect, or a combination thereof collectively referred to as a compound below.

[0117] The term "pharmaceutical composition" according to the invention relates to a composition intended for administration to a patient, preferably a human patient. The pharmaceutical composition of the present invention comprises the compound mentioned above. Optionally, it may comprise additional molecules capable of modifying the properties of the compound of the present invention, thereby stabilizing, regulating, and / or activating the function of said compound, for example. The composition may be in solid, liquid, or gaseous form, and in particular, may be in the form of powder(s), tablet(s), solution(s), or aerosol(s). The pharmaceutical composition of the present invention may optionally and additionally comprise a pharmaceutically acceptable carrier. Examples of suitable pharmaceutical carriers are well known in the art and include phosphate-buffered saline solutions, water, emulsions, e.g., oil / water emulsions, various types of wetting agents, sterile solutions, organic solvents including DMSO, etc. Compositions comprising such carriers may be formulated by well-known conventional methods. The pharmaceutical composition may be administered to a subject in an appropriate dose. The dosing regimen will be determined by the attending physician and clinical factors. As is well known in the medical field, the dosage for a single patient depends on several factors, including the patient's size, body surface area, age, the specific compound administered, gender, time and route of administration, general health, and concurrently administered drugs. The therapeutically effective dose for a given situation will be easily determined by routine experimentation and is within the skill and judgment of a general clinician or physician. Generally, a regimen of regular administration of a pharmaceutical composition should be in the range of 1 µg to 5 g per day. However, a more preferred dosage may be in the range of 0.01 mg to 100 mg per day, even more preferably 0.01 mg to 50 mg, and most preferably 0.01 mg to 10 mg.Furthermore, for example, if the compound is an iRNA agonist such as siRNA, the total pharmaceutically effective amount of the administered pharmaceutical composition will generally be less than about 75 mg per kg of body weight, e.g., less than about 70, 60, 50, 40, 30, 20, 10, 5, 2, 1, 0.5, 0.1, 0.05, 0.01, 0.005, 0.001, or 0.0005 mg / kg of body weight. More preferably, the amount will be less than 2000 nmol of iRNA agonist per kg of body weight (e.g., about 4.4 x 10⁻⁶). 16 (Copies), for example, will be iRNA preparations of less than 1500, 750, 300, 150, 75, 15, 7.5, 1.5, 0.75, 0.15, 0.075, 0.015, 0.0075, 0.0015, 0.00075, or 0.00015 nmol per kg body weight. The treatment period required to observe changes and the interval for response to occur after treatment depend on the desired effect. Specific amounts may be determined by conventional tests well known to those skilled in the art.

[0118] As further explained below, the pharmaceutical composition of the present invention can be used, for example, as a vaccine or immunosuppressant, as well as for treating tumors (particularly cancer). However, the pharmaceutical composition can also be used for the treatment or prevention of additional diseases. For example, if the protein or peptide of the present invention is a fusion protein, the fusion partner can confer therapeutic specificity for inflammatory diseases. As discussed above, the use of cytokines as fusion partners results in fusion proteins suitable for the treatment of inflammatory diseases. Specific cytokines have been introduced into clinical trials for the treatment of stroke, Alzheimer's disease, autoimmune diseases, wound healing, and amyotrophic lateral sclerosis, and local or systemic delivery of anti-inflammatory cytokines or inflammatory cytokine antagonists can be utilized for the treatment of chronic pain. Furthermore, as discussed above, the use of coagulation-promoting factors as fusion partners results in fusion proteins suitable for wound healing. Therefore, the therapeutic use of the protein or peptide of the present invention by the fusion protein can be supplemented by additional therapeutic use provided by the fusion partner, potentially leading to a synergistic therapeutic effect.

[0119] In addition to the above, radionuclides are discussed as fusion partners for the proteins or peptides of the present invention. Fusion proteins containing radionuclides can be used in radioligand therapy. In radioligand therapy, radiopharmaceuticals (typically labeled with beta-emitting substances such as lutetium-177) specifically bind to tumor target structures (typically surface molecules). For example, radiopharmaceuticals may additionally include antibodies that target the radionuclides against the tumor by conferring specific binding to the tumor target. Radioligand therapy is an effective systemic treatment regimen generally used for metastatic diseases. Radiopharmaceuticals are typically administered into or infused into the peripheral veins of the patient to be treated.

[0120] In addition, HLA-J nucleotide molecules, vectors, host cells, proteins or peptides, binding molecules, preferably inhibitors of the fifth aspect of the present invention, or combinations thereof themselves may provide additional therapeutic options. For example, HLA regions encode several molecules that play important roles in the immune system. A strong association between HLA regions and autoimmune diseases (AIDs) has been established for over 50 years (Gough and Simmons, Curr Genomics. 2007 Nov; 8(7):453-465). Non-limiting examples of AIDs include type 1 diabetes (T1D), multiple sclerosis (MS), rheumatoid arthritis (RA), Graves' disease (GD), ankylosing spondylitis (AS), and systemic lupus erythematosus (SLE).

[0121] The success of bone marrow or organ transplantation depends on matching the recipient's HLA phenotype with the donor's HLA phenotype to prevent graft-versus-host disease (GVHD). There has been a long-standing debate regarding which HLA loci are clinically relevant. As clinical outcome data have accumulated, it has become clear that all HLA loci are relevant. Therefore, it can be safely assumed that HLA-J also plays a role. In cases where the recipient's HLA-J phenotype cannot be matched to the donor's HLA-J phenotype, inhibition by the pharmaceutical composition of the present invention can serve as a means to prevent GVHD.

[0122] The cosmetic composition according to the present invention is intended for use in non-therapeutic applications. The cosmetic composition may also be defined by its intended use as a composition to be rubbed, poured, sprayed, or otherwise applied to the human body for cleansing, beauty, enhancement of attractiveness, or alteration of appearance. The specific formulations of the cosmetic composition according to the present invention are not limited. Expected formulations include rinse solutions, emulsions, creams, milks, gels such as hydrogels, ointments, suspensions, dispersions, powders, solid sticks, foams, sprays, and shampoos. To this end, the cosmetic composition according to the present invention may further include diluents and / or carriers acceptable for cosmetic use. Selecting appropriate carriers and diluents according to the desired formulation is within the skill of those skilled in the art. Suitable diluents and carriers acceptable for cosmetic use are well known in the art and include formulations mentioned in Bushell et al. (WO 2006 / 053613). Preferred formulations of the cosmetic composition are rinse solutions and creams. The preferred amount of the cosmetic composition according to the present invention applied for single use is 0.1 to 10 g, more preferably 0.1 to 1 g, and most preferably 0.5 g. In addition, the amount applied depends on the size of the area to be treated and should be adjusted accordingly.

[0123] In the eighth aspect, the present invention relates to a nucleic acid molecule, vector, host cell, protein or peptide, binding molecule, preferably an inhibitor of the present invention, or a combination thereof, for use as a medicine, preferably an immunosuppressant, vaccine, or pregnancy promoter.

[0124] As already mentioned above, immunosuppressants are drugs that can suppress immune responses. They can be used in immunosuppressive therapy, for example, to (i) prevent rejection of transplanted organs and tissues (e.g., bone marrow, heart, kidney, liver), (ii) treat autoimmune diseases or diseases most likely of autoimmune origin (e.g., rheumatoid arthritis, multiple sclerosis, myasthenia gravis, psoriasis, vitiligo, systemic lupus erythematosus, sarcoidosis, focal segmental glomerulosclerosis, Crohn's disease, Behcet's disease, pemphigus, sclerodermia, and ulcerative colitis), and / or (iii) treat non-autoimmune inflammatory diseases (e.g., control of chronic allergic asthma and ankylosing spondylitis).

[0125] The above vaccine is preferably a tumor vaccine that can be used to treat an existing tumor or prevent the development of a tumor. A vaccine that treats existing cancer is also referred to as a therapeutic cancer vaccine. The above vaccine may be "autologous," that is, manufactured from a sample taken from a patient, and is specific to that patient. The method of the cancer vaccine generally aims to kill said cancer cells by isolating a protein from said protein and stimulating the immune system using said protein as an antigen. According to the present invention, said antigen is derived from an HLA-J protein / peptide.

[0126] Accordingly, the present invention also relates to a method for preparing a tumor vaccine comprising mixing a nucleic acid molecule, a vector, a host cell, a protein or peptide, a binding molecule, preferably an inhibitor of the present invention or a combination thereof, with at least one pharmaceutically acceptable excipient, a carrier, and / or a diluent.

[0127] Example 2 and Figures 4 / 5 show that high levels of HLA-J expression are associated with a significant reduction in progression-free survival and overall survival in ovarian cancer patients. Therefore, it can be safely assumed that HLA-J expression helps tumors evade the immune system. This, in turn, demonstrates that HLA-J acts as an immunosuppressant. While the action of HLA-J as an immunosuppressant is harmful from the perspective of the tumor, it may be beneficial from the perspective of the aforementioned diseases treated in the art by immunosuppressants. This also makes it at least plausible that vaccination of tumor patients with HLA-J may help suppress or eliminate the tumor's evasion of the immune system through HLA-J expression. Accordingly, the nucleic acid molecule, vector, host cell, protein or peptide, or combination of the present invention may be used as a drug, preferably as an immunosuppressant or vaccine. The nucleic acid molecule is preferably the nucleic acid molecule of item (g) of the first aspect. Meanwhile, as described in more detail below, the binding molecule, preferably the inhibitor of the fifth aspect of the present invention, can be used, for example, to treat tumors.

[0128] Pregnancy promoters are compounds that increase the likelihood of pregnancy, particularly the possibility of embryo implantation. Implantation is the stage of pregnancy where an already fertilized egg attaches to the uterine wall. This adhesion allows the embryo to receive oxygen and nutrients from the mother and grow. In humans, the attachment and implantation of the fertilized egg are most likely to occur around 5 to 6 days after ovulation. It is estimated that two-thirds of implantation failures are due to inadequate uterine receptivity, while one-third are caused by problems with the embryo itself. This also depends on the mother's age. Inadequate uterine receptivity occurs more frequently in younger mothers, whereas problems with the embryo itself (e.g., chromosomal abnormalities) occur more often in older mothers (especially those over 35). Inadequate uterine receptivity can be caused by abnormal cytokines, hormonal signaling, and epigenetic alterations. Recurrent implantation failure is a cause of female infertility. Therefore, pregnancy rates can be improved by optimizing endometrial receptivity for implantation. Nucleic acid molecules, vectors, host cells, proteins or peptides, or combinations thereof may be used to promote pregnancy by optimizing endometrial receptivity for implantation. The nucleic acid molecule is preferably the nucleic acid molecule of item (g) of the first aspect. This is because HLA-G is thought to play an important role in implantation by regulating cytokine secretion to control trophopblastic cell invasion and maintain local immune tolerance (see Roussev and Coulam, J Assist Reprod Genet. 2007 Jul; 24(7): 288-295). Furthermore, preimplantation embryos are known to express soluble HLA-G and soluble HLA-F.The higher the expression levels of soluble HLA-G and soluble HLA-F, the higher the implantation rate of the embryo. Therefore, high levels of HLA-J expression are expected to be associated with successful implantation, while low levels of HLA-J expression are expected to be associated with implantation failure. Accordingly, nucleic acid molecules, vectors, host cells, proteins or peptides, binding molecules, preferably the inhibitor of the fifth aspect of the present invention, or combinations thereof may be used, for example, in in vitro fertilization, wherein oocytes are cultured in the presence of said nucleic acid molecules, vectors, host cells, proteins or peptides, or combinations thereof, before being fertilized and implanted into the mother.

[0129] In the ninth aspect, the present invention relates to a binding molecule for use as a pharmaceutical agent, preferably for use in tumor treatment, preferably an inhibitor of the present invention.

[0130] The ninth aspect above also relates to an immune activator, preferably a binding molecule for use in tumor treatment, preferably an inhibitor of the present invention.

[0131] Immunostimulators are drugs capable of promoting an immune response. Immunostimulators can be used, for example, in an immune-activating therapy to promote and / or initiate an immune response against diseased cells. The immune response is preferably a cytotoxic immune response and / or a T-cell response against diseased cells.

[0132] As mentioned, immune activators are preferably used in the context of tumor treatment. As is evident from the attached examples, HLA-J is expressed in tumors. HLA-J is a secreted protein, and the data in the following examples show that HLA-J is secreted by tumor cells; therefore, a "cloud" of HLA-J protein is most likely to form around the tumor cells, and this cloud prevents the tumor cells from being recognized and eliminated by the immune system. The binding molecule, preferably the inhibitor of the present invention, removes this protective cloud from the tumor cells, thereby promoting and / or initiating an immune response against the tumor cells. This immune activation mechanism is modified only where necessary ( mutatis mutandis It applies to disease cells other than tumor cells.

[0133] A tumor is a new growth of abnormal benign or malignant tissue that does not have a physiological function and generally arises from uncontrolled rapid cell proliferation. A tumor is preferably cancer. Cancer is a new growth of abnormal malignant tissue that does not have a physiological function and generally arises from uncontrolled rapid cell proliferation. The cancer is preferably selected from the group consisting of breast cancer, ovarian cancer, endometrial cancer, vaginal cancer, vulvar cancer, bladder cancer, salivary gland cancer, pancreatic cancer, thyroid cancer, kidney cancer, lung cancer, upper gastrointestinal cancer, colorectal cancer, colon cancer, prostate cancer, head and neck squamous cell carcinoma, cervical cancer, glioblastoma, malignant ascites, lymphoma, and leukemia. Among the list of cancers, gynecological cancers (e.g., cervical cancer, ovarian cancer, uterine cancer, vaginal cancer, and vulvar cancer) are preferred, and breast cancer and ovarian cancer are most preferred. Additionally, among the list of cancers, bladder cancer is preferred.

[0134] A tumor or cancer is preferably a solid tumor or cancer. A solid tumor or cancer is generally an abnormal mass of tissue that does not contain cysts or fluid areas, unlike a liquid tumor.

[0135] As demonstrated in Example 2 of the present invention and illustrated in Figures 4 and 5, high levels of HLA-J mRNA expression are associated with a significant reduction in asymptomatic survival and overall survival in ovarian cancer patients. Similarly, Example 3 and Figure 10 indicate that breast cancer patients with detected high levels of HLA-J prior to chemotherapy are less sensitive to chemotherapy. Finally, Example 5 and Figure 18 show high levels of HLA-J mRNA expression in bladder cancer patients. Surprisingly, in relation to the present invention, it has been found that inhibition of HLA-J, for example, inhibition of HLA-J expression and / or translation, is suitable for tumor treatment.

[0136] In the 10th aspect, the present invention relates to the use of a nucleic acid molecule of item (g) of the 1st aspect or a protein or peptide of the 4th aspect for the diagnosis of a tumor and / or grading of the prognosis of the tumor and / or classifying the tumor as an HLA-J low-expression tumor or an HKA-J high-expression tumor and / or diagnosis of implantation failure and / or diagnosis of a tumor obtained from a sample obtained from a subject.

[0137] As mentioned, the tumor is preferably cancer. Also mentioned, in relation to this aspect of the present invention, the tumor or cancer is preferably a solid tumor or cancer.

[0138] The sample may be a body fluid of the subject or a tissue sample extracted from the subject's organ. Non-limiting examples of body fluids include whole blood, plasma, serum, urine, peritoneal fluid, and cells from pleural fluid, cerebrospinal fluid, tear fluid, or solutions thereof. Non-limiting examples of tissues include the colon, liver, breast, ovary, and testis. The tissue sample may be obtained by aspiration or puncture, excision or biopsy, or other surgical methods capable of obtaining cellular material. The sample may be a processed sample, e.g., frozen, fixed, or embedded sample. A preferred type of sample is a formalin-fixed, paraffin-embedded (FFPE) sample. The preparation of FFPE samples is standard medical practice, and such samples can be preserved for a long period.

[0139] As used herein, the term "diagnosis" refers to the identification of a disease in a subject suffering from symptoms of the disease. According to the present invention, the disease is a tumor or implantation failure. As used herein, the term "grading" refers to the identification of the degree of cell anaplasia of tumor cells in a subject diagnosed with a tumor. The most commonly used system for grading tumors is the system based on the guidelines of the American Joint Commission on Cancer. According to these guidelines, the following grading categories are distinguished: GX (unable to grade), G1 (highly differentiated; low grade), G2 (moderately differentiated; medium grade), G3 (poorly differentiated; high grade), and G4 (undifferentiated, high grade). As used herein, the term "prognosis" refers to the prediction or possibility of recovery from a disease such as a tumor and / or the prediction or possibility of survival from a disease such as a tumor. In the case of tumors, the above prognosis includes one or more of changes in tumor size of the target lesion, disease-specific survival (DSS), recurrence-free survival (RFS), progression-free survival (PFS), and distant recurrence-free survival, wherein disease-specific survival (DDS) is preferred.

[0140] The term "subject" according to the present invention means a mammal, preferably a livestock or a pet such as a horse, cow, pig, sheep, goat, dog, or cat, most preferably a human.

[0141] As discussed above, increased HLA-J expression levels in tumor patients are associated with a significant decrease in progression-free survival and overall survival. Therefore, higher levels of HLA-J expression also correspond to higher tumor grades. Furthermore, since HLA-J expression was detected in all tumor samples, it was demonstrated in the examples that HLA-J expression can serve not only as a prognostic marker but also as a tumor diagnostic marker.

[0142] In the above use, positive and / or negative samples as well as predetermined standards may be included. The control group may be obtained from samples of one or more subjects, for example, at least 5, at least 10, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 200, at least 300, at least 400, at least 500, at least 600, at least 700, at least 800, at least 900, at least 1000, at least 1500, or at least 2000 subjects. The predetermined standards specify values ​​previously obtained from positive and / or negative samples.

[0143] Since healthy subjects are not expected to express HLA-J, it is considered that no criteria are necessary at all for the diagnosis of tumors. Furthermore, it is shown in the examples that HLA-J expression was detected in all tumor patients investigated. Nevertheless, positive and / or negative samples, as well as predetermined criteria, may be included in the application of the tumor diagnosis of the present invention. For diagnosis, a positive sample is obtained from one or more subjects known to have a tumor, preferably subjects known to have a tumor in the same body part as the subject to be diagnosed. Similarly, a negative sample is obtained from one or more subjects known not to have a tumor. A subject is diagnosed as having a tumor if the expression level of a nucleic acid molecule of the first aspect or a protein or peptide of the fourth aspect in the sample is increased by at least 1.5-fold, 2-fold, 3-fold, or 4-fold with increased preference compared to a negative control or a predetermined criterion derived therefrom. If the expression level of nucleic acid molecules of the first aspect or proteins or peptides of the fourth aspect in the sample differs from a positive control or a preset standard derived therefrom by less than 50%, less than 25%, and less than 10% with increased preference, the subject is diagnosed as having a tumor. For example, if the positive control is set to 100%, a patient exhibiting a value of 150% to 50%, preferably 125% or 75%, is diagnosed as having a tumor.

[0144] Additionally, for the diagnosis of implantation failure, positive and / or negative samples as well as predetermined standards may be used. For diagnosis, the positive sample is obtained from one or more female subjects who have had at least one implantation failure, preferably at least two implantation failures, and most preferably at least three implantation failures. Two or more implantation failures are also referred to as recurrent or habitual implantation failures. Similarly, the negative sample is obtained from one or more female subjects who have had at least one successful pregnancy, preferably at least two successful pregnancies, and most preferably at least three successful pregnancies. A female subject is diagnosed with implantation failure if the expression level of a nucleic acid molecule of the first aspect or a protein or peptide of the fourth aspect in the sample is reduced by at least 1.5-fold, 2-fold, 3-fold, or 4-fold with increased preference compared to a negative control or a predetermined standard derived from these. If the expression level of nucleic acid molecules of the first aspect or proteins or peptides of the fourth aspect in the sample differs (i.e., higher or lower) by less than 50%, less than 25%, and less than 10% with increased preference from a positive control or a preset standard derived therefrom, the subject is diagnosed as implantation failure. For example, if the positive control is set to 100%, a patient exhibiting a value of 125% or 75% is diagnosed as implantation failure.

[0145] Regarding the classification of tumors as HLA-J low-expression tumors or HLA-J high-expression tumors, it should be noted that neither the respective nor all tumors are expected to express or express a significant amount of HLA-J. Therefore, to determine whether a binding molecule, preferably an inhibitor of the fifth aspect of the present invention, can be a therapeutic option in subjects having tumors, the tumors may be classified as HLA-J low-expression tumors or HLA-J high-expression tumors, and only in the latter case are said binding molecule or inhibitors a choice. For classification, the control group may be derived from one or more subjects known to have tumors expressing HLA-J, preferably tumors known to be treatable by a binding molecule, preferably an inhibitor of the fifth aspect of the present invention. If the HLA-J expression of the tumor to be classified is reduced by at least 2-fold, at least 3-fold, at least 4-fold, and at least 5-fold with increasing preference compared to the control tumor, said tumor is an HLA-J low-expression tumor. Meanwhile, if the HLA-J expression of the tumor to be classified is increased by at least 2 times, at least 3 times, at least 4 times, and at least 5 times with increasing preference compared to the control tumor, the tumor is an HLA-J high-expression tumor.

[0146] For prognosis, a positive control may be obtained from one or more subjects who have died from a tumor (preferably a tumor in the same body part as the subject being prognosed), and a negative sample may be obtained from one or more subjects who have survived from a tumor for a substantial period of time without progression (preferably a tumor in the same body part as the subject being prognosed). A substantial period refers, with increased preference, to at least 1 year, at least 2 years, at least 3 years, at least 4 years, and at least 5 years. If the expression of nucleic acid molecules of the first aspect or proteins or peptides of the fourth aspect in the sample is reduced by at least 1.5, 2, 3, or 4 times with increased preference compared to the positive control or a preset reference derived from them, the subject has a favorable prognosis. In addition, if the expression level of nucleic acid molecules of the first aspect or proteins or peptides of the fourth aspect in the sample differs by less than 50%, less than 25%, and less than 10% with increased preference compared to the negative control or the preset reference derived therefrom, the subject has a favorable prognosis. If the expression of nucleic acid molecules of the first aspect or proteins or peptides of the fourth aspect in the sample increases by at least 1.5-fold, 2-fold, 3-fold, or 4-fold with increased preference compared to the negative control or the preset reference derived therefrom, the subject has a poor prognosis. In addition, if the expression level of nucleic acid molecules of the first aspect or proteins or peptides of the fourth aspect in the sample differs by less than 50%, less than 25%, and less than 10% with increased preference compared to the positive control or the preset reference derived therefrom, the subject has a poor prognosis. Regarding the aspect of prognosis, it is noted that Example 3 and Figures 9 and 10 show that HLA-J expression levels in breast cancer patients indicate a prognosis of responsiveness during chemotherapy. Luminal breast cancer patients had the highest HLAJ expression levels, and these patients showed little response to chemotherapy.Accordingly, preferably, the above prognosis is the prognosis of expected therapeutic success of tumor treatment, wherein the anti-tumor treatment is preferably chemotherapy and / or the patient to be diagnosed preferably has breast cancer.

[0147] For grading, positive samples may be obtained from one or more subjects graded to one of categories G1 to G4. For grading, one or more positive samples may be used, said positive samples being two, preferably three, most preferably all four of categories G1 to G4. If the expression level of nucleic acid molecules of the first aspect or proteins or peptides of the fourth aspect in the sample differs by less than 50%, less than 25%, and less than 10% with increased preference compared to a positive G1 control or a preset standard derived from them, the subject is graded as having a G1 tumor. This is applied to the G2 to G4 stages with only necessary modifications.

[0148] Methods for obtaining levels of nucleic acid molecules of the first aspect or proteins or peptides of the fourth aspect are established in the art.

[0149] For example, the level of nucleic acid molecules of the first aspect can be obtained by real-time quantitative PCR (RT-qPCR), electrophoresis techniques, or DNA microarrays (Roth (2002), Curr. Issues Mol. Biol., 4: 93-100), wherein RT-qPCR is preferred. In these methods, the expression level will be normalized to the (average) expression level of one or more reference genes in the sample. As used herein, the term "reference gene" refers to a gene having a relatively unchanging level of expression at the RNA transcript / mRNA level in the system being tested, i.e., in cancer. Such genes may be referred to as housekeeping genes. Non-limiting examples of reference genes are CALM2, B2M, RPL37A, GUSB, HPRT1, and GAPDH, preferably CALM2 and / or B2M. Other suitable reference genes are known to those skilled in the art.

[0150] RT-qPCR is exemplified by the examples. RT-qPCR is performed in a thermal cycler capable of illuminating each sample with light of at least one specified wavelength and detecting the fluorescence emitted from the excited fluorophore. The thermal cycler can also rapidly heat and cool the sample, thereby utilizing the physicochemical properties of nucleic acids and DNA polymerases. Two common methods for detecting PCR products in real-time qPCR are as follows: (1) a non-specific fluorescent dye that intercalates with any double-stranded DNA, and (2) a sequence-specific DNA probe (e.g., TaqMan probe) consisting of an oligonucleotide labeled with a fluorescent reporter that can be detected only after the probe hybridizes with a sequence complementary to the probe. The latter detection method is used in the following examples. The probe is generally a fluorescently labeled probe. Preferably, the fluorescently labeled probe consists of an oligonucleotide labeled with both a fluorescent reporter dye and a quenching dye (= double-labeled probe). Suitable fluorescent reporters and quenching dyes / moties are known to those skilled in the art, said reporter dyes / moties include 6-FAMTM, JOETM, Cy5®, Cy3®, and said quenching dyes / moties include, but are not limited to, dabcyl, TAMRATM, BHQTM-1, -2, or -3. Preferably, the primer for use according to the present invention has a length of 15 to 30 nucleotides and is, in particular, a deoxyribonucleotide.In one embodiment, the primer is designed to (1) be specific to or derived from the target mRNA sequence of HLA-J, (2) provide an amplicon size of less than 120 bp (preferably less than 100 bp), (3) be mRNA-specific (considering exon / intron; preferably no amplification of genomic DNA), (4) have no tendency to dimerize, and / or (5) have a melting temperature (Tm) in the range of 58 °C to 62 °C (preferably Tm is about 60 °C). More preferably, one or more primers and probes specifically bind to the HLA-J-specific exon 4 / exon 5 junction of HLA-J (Fig. 3). Much more preferably, one or more primers and probes shown in Table 1 of the examples are used for RT-qPCR, and more preferably, one of specific primer pairs that can be selectively used in relation to each probe is used. As mentioned, the probe is required for RT-qPCR according to (2), but for RT-qPCR according to (1), the probe can be replaced with an intercalating dye such as SYBR green. The forward primers in Table 1 correspond to SEQ ID NO: 12 to 25, the probes to SEQ ID NO: 26 to 39, and the reverse primers to SEQ ID NO: 40 to 53. The forward primer of SEQ ID NO: 12 and the reverse primer of SEQ ID NO: 40 are a primer pair, SEQ ID NO: 26 corresponds to the probe, the forward primer of SEQ ID NO: 13 and the reverse primer of SEQ ID NO: 41 are a primer pair, and SEQ ID NO: 27 corresponds to the probe. Most preferably, the primer pair of SEQ ID NO: 18 and 46, optionally the probe of SEQ ID NO: 32 are used together.These primer pairs and probes are specific to the HLA-J-specific exon 4 / exon 5 junction of HLA-J.

[0151] As an alternative to qPCR, levels of nucleic acid molecules of the first aspect of the present invention can also be obtained using electrophoresis techniques or DNA microarrays. Conventional approaches to mRNA identification and quantification are achieved through a combination of gel electrophoresis, which provides information on size, and sequence-specific probing. Northern blot is the most commonly applied technique in this class. Ribonuclease protection assays (RPA) have been developed as a more sensitive and less labor-intensive alternative to Northern blot. After hybridization is performed using labeled ribonucleotide probes in solution, the unhybridized samples and probes are digested with a ribonuclease mixture (e.g., RNase A and RNase T1) that selectively degrades single-stranded RNA. Subsequent denaturation of polyacrylamide gel electrophoresis provides a means of quantification and also provides the size of the region hybridized by the probes. In both Northern blot and RPA, the accuracy and precision of the quantification are functions of the detection method and the reference or standard used. Most commonly, probes are radiolabeled with 32P or 33P, in which case the final gel is exposed to an X-ray film or phosphor screen, and the intensity of each band is quantified by a densitometer or phosphor imager, respectively. In both cases, exposure times can be adjusted to the required sensitivity, but phosphor-based technologies generally have greater sensitivity and a larger dynamic range. As an alternative to the use of radioactivity, probes can be labeled with antigens or haptens, which are then bound to a horseradish peroxidase- or alkaline phosphatase- conjugated antibody, and quantified by chemiluminescence on a film or fluorescence imager after the addition of a substrate.In all of their imaging applications, background values ​​in adjacent regions of the gel must be subtracted without probes. The greatest advantage of the gel format is that all reference standards can be imaged simultaneously with the sample. Likewise, the detection of housekeeping genes is performed under the same conditions for all samples.

[0152] Two techniques have emerged for the construction of DNA microarrays. Generally, the starting point for array design in each case is a series of sequences corresponding to the gene to be investigated or the putative gene. In the first approach, oligonucleotide probes are chemically synthesized, starting on a glass substrate. Due to the variable efficiency of oligonucleotide hybridization to cDNA probes, multiple oligonucleotide probes are synthesized complementarily to each gene of interest. Furthermore, for each fully complementary oligonucleotide on the array, an oligonucleotide with a single nucleotide position mismatch is constructed and used for normalization. Oligonucleotide arrays are typically about 10 4 -10 6 Probe / cm 2 It is generated at a density of. The second major technique for constructing DNA microarrays is robotically printing cDNA probes directly onto glass slides or other suitable substrates. DNA clones for each gene of interest are obtained, purified, and amplified from a common vector via PCR using universal primers. The probes are robotically deposited into spots approximately 50–200 μm in size. In this space, for example, about 10 3 Probe / cm 2 You can obtain the density of.

[0153] The level of the protein or peptide of the fourth aspect may be determined, for example, using a "binding molecule for the protein or peptide" and preferably a "specific binding molecule for the protein or peptide." A binding molecule for the protein or peptide refers to a molecule that is primarily bound to the protein or peptide under known conditions. The "molecule binding to the protein or peptide," which is one of the binding molecules described herein, may preferably be an inhibitor of the protein or peptide of the fourth aspect, for example, an antibody, an aptamer, etc. The level of the protein or peptide of the fourth aspect may also be obtained using Western blot analysis, mass spectrometry, FACS analysis, and ELISA. These techniques are non-limiting examples of methods that can be used to qualitatively, semi-quantitatively, and / or quantitatively detect the protein or peptide.

[0154] Western blot analysis is a widely used and well-known analytical technique used to detect specific proteins or peptides in a given sample (e.g., tissue homogenates or body extracts). It uses gel electrophoresis to separate natural or denatured proteins or peptides based on the length of the (poly)peptide (denatured conditions) or the 3D structure of the protein (natural / non-denatured conditions). The proteins or peptides are then transferred to a membrane (typically nitrocellulose or PVDF), where they are probed (detected) using antibodies specific to the target protein.

[0155] In addition, mass spectrometry (MS) is a widely used and well-known analytical technique that measures the mass-to-charge ratio of charged particles. Mass spectrometry is used to determine the mass of particles, determine the elemental composition of samples or molecules, and elucidate the chemical structure of molecules such as proteins, peptides, and other compounds. The principle of MS consists of ionizing chemical compounds to produce charged molecules or molecular fragments and measuring their mass-to-charge ratio.

[0156] Fluorescence-activated cell sorting (FACS) is a widely used and well-known analytical technique in which biological cells are sorted according to specific light scattering of the fluorescent properties of each cell. Cells can be fixed in 4% formaldehyde, permeated with 0.2% Triton-X-100, and incubated with fluorescently labeled antibodies (e.g., mono- or poly-clonal anti-HLA-J antibodies).

[0157] Enzyme-linked immunosorbent assay (ELISA) is a widely used and well-known sensitive analytical technique in which enzymes are linked to antibodies or antigens as markers for the detection of specific proteins or peptides.

[0158] Following the nucleic acid molecule of the first aspect or the protein or peptide of the fourth aspect, one or more additional compounds from the sample obtained from the subject may be used to diagnose a tumor and / or determine the grade of the tumor and / or tumor prognosis. Numerous markers for diagnosing a tumor and / or determining the grade of the tumor and / or tumor prognosis are known in the art and may be used in conjunction with the nucleic acid molecule of the first aspect or the protein or peptide of the fourth aspect. Several tumor markers indicate specific tumors, for example, breast cancer or colon cancer. Tumor markers are listed, for example, at the National Cancer Institute (https: / / www.cancer.gov / about-cancer / diagnosis-staging / diagnosis / tumor-markers-fact-sheet) or the Cancer Gene and Marker Integration Database CGMD (http: / / cgmd.in / ). The use of one or more additional markers generally increases the reliability of diagnosis, grading, or prognosis.

[0160] In the eleventh aspect, the present invention relates to a tumor diagnostic method comprising the step of detecting the presence of a nucleic acid molecule of the first aspect, item (g) and / or a protein or peptide of the fourth aspect in a sample obtained from a subject, wherein the presence of the nucleic acid molecule of the first aspect, item (g) and / or a protein or peptide of the fourth aspect indicates a tumor of the subject.

[0161] In the 12th aspect, the present invention relates to a method for grading a tumor and / or a tumor prognosis, comprising the step of determining the level of a nucleic acid molecule of the 1st aspect, item (g) and / or a protein or peptide of the 4th aspect in a sample obtained from a subject, wherein the increased level of the nucleic acid molecule of the 1st aspect, item (g) and / or the protein or peptide of the 4th aspect is positively correlated with a higher grade of the tumor and / or a poor tumor prognosis compared to a control group.

[0162] The methods of the eleventh and twelfth aspects of the present invention implement the use of the tenth aspect of the present invention in the form of a method. The definitions and preferred embodiments provided above in relation to the tenth aspect of the present invention may be equally applied to the eleventh and twelfth aspects of the present invention.

[0163] In the 13th aspect, the present invention relates to a kit for diagnosing a tumor and / or grading a tumor and / or tumor prognosis, comprising (a) means for detecting and / or quantifying a nucleic acid molecule of item (g) of the 1st aspect and / or a protein or peptide of the 4th aspect in a sample obtained from a subject, and (b) instructions for use of said kit.

[0164] The kit of the 13th aspect of the present invention embodies the means necessary to perform the use of the 10th aspect of the present invention in the form of a kit. For this reason, the definitions and preferred embodiments provided above in relation to the 10th aspect of the present invention may be equally applied to the kit of the 13th aspect of the present invention.

[0165] The means for detection and / or quantification of nucleic acid molecules of the first aspect is preferably one or more of the primers and probes shown in Table 1 of the Examples used in RT-qPCR, and more preferably one of a specific primer pair that can be selectively used in relation to each probe. The means for detection of proteins or peptides of the fourth aspect is preferably an antibody and / or antibody analog as described herein. For detection and / or quantification, said antibody and / or antibody analog may be labeled, for example, with a fluorescent dye or a radiolabel. Examples of fluorescent dyes and radiolabels are also described above in this specification.

[0166] Various components of the kit may be packaged in one or more containers, such as one or more vials. In addition to the addition of the components, the vials may contain a preservative or a buffer for storage. The kit may include instructions for use, which preferably provide information on how to use the components of the kit for tumor diagnosis and / or grading of tumors and / or tumor prognosis.

[0167] In a 14th aspect, the present invention relates to a method for monitoring the non-efficacy of tumor treatment in a subject having a tumor, comprising: (a) determining the amount of nucleic acid molecules of the first aspect and / or proteins or peptides of the fourth aspect in a sample obtained from the subject before starting treatment; and (b) determining the amount of nucleic acid molecules of the first aspect and / or proteins or peptides of the fourth aspect in a sample obtained from the subject one or more times after starting treatment, wherein an increased amount in b) compared to a) indicates non-efficacy of tumor treatment and / or a decreased amount in b) compared to a) indicates efficacy of tumor treatment.

[0168] Similarly, in the 15th aspect, the present invention relates to a method for monitoring the non-efficacy of an immunosuppressive therapy in a subject requiring treatment, comprising: (a) determining the amount of nucleic acid molecules of the first aspect and / or proteins or peptides of the fourth aspect in a sample obtained from the subject before initiation of treatment; and (b) determining the amount of nucleic acid molecules of the first aspect and / or proteins or peptides of the fourth aspect in a sample obtained from the subject one or more times after initiation of treatment, wherein a reduced amount in b) compared to a) indicates non-efficacy of the immunosuppressive therapy and / or an increased amount in b) compared to a) indicates efficacy of the immunosuppressive therapy.

[0169] With respect to other aspects of the present invention, the definitions and preferred embodiments provided above may be equally applied to the 14th and 15th aspects of the present invention. For example, means and methods for determining the amount of nucleic acid molecules of the 1st aspect and / or proteins or peptides of the 4th aspect are described above with respect to the 10th aspect of the present invention. Such means and methods may be equally used with respect to the 14th and 15th aspects of the present invention.

[0170] The tumor treatment may be any tumor treatment, e.g., surgery, radiation therapy, or chemotherapy. The tumor treatment is preferably chemotherapy. Chemotherapy involves the administration of a chemotherapeutic agent. Chemotherapeutic agents that may be used according to the present invention include cytostatic compounds and cytotoxic compounds. Traditional chemotherapeutic agents act by killing rapidly dividing cells, which is one of the major characteristics of most cancer cells. Chemotherapeutic agents include, but are not limited to, taxanes, nucleoside analogs, camptothecin analogs, anthracycline and anthracycline analogs, etoposide, bleomycin, vinorelbine, cyclophosphamide, antimetabolites, anti-mitotics, and alkylating agents. The aforementioned chemotherapy may also be platinum-based, meaning it involves the administration of platinum-based compounds, such as cisplatin. Chemotherapy agents are usually administered in combination for 3 to 6 months. One of the most common treatments is the co-administration of cyclophosphamide and doxorubicin (adriamycin; belonging to the group of anthracyclines and anthracycline analogs), known as AC. Sometimes, a taxane drug such as docetaxel is added, and the subsequent treatment regimen (regime) is known as CAT; the taxane attacks the microtubules of cancer cells. Another common treatment that produces equivalent results involves the administration of cyclophosphamide, the metabolic antagonist methotrexate, and the nucleoside analog fluorouracil (CMF).Another standard chemotherapy treatment involves the administration of fluorouracil, epirubicin, and cyclophosphamide (FEC), which may be supplemented with taxanes such as docetaxel or vinorelbine.

[0171] The tumor according to aspect 14 is preferably a non-luminal tumor. A non-luminal tumor is a hormone receptor (estrogen-receptor and / or progesterone-receptor) negative tumor or a tumor expressing low levels of hormone receptors (estrogen-receptor and / or progesterone-receptor). In the case of a breast tumor, a luminal A tumor is hormone-receptor positive, Her2 negative, and has low levels of Ki-67 expression, and a luminal B tumor is (i) hormone-receptor positive, Her2 negative, and has high levels of Ki-67 expression, or (ii) estrogen-receptor positive, progesterone-receptor negative, Her2 negative, and has low levels of Ki-67 expression. Non-luminal tumors can be divided into HER2-positive tumors and TNBC (triple-negative breast cancer) which is HER2-negative and hormone receptor (estrogen receptor and / or progesterone receptor) negative.

[0172] Likewise, immunosuppressive therapy may be any immunosuppressive therapy. For example, immunosuppressive therapy is selected from one or more immunosuppressive drugs, e.g., glucocorticoids, cytostatics, and antibodies. According to aspect 15, the subject may be used to treat an autoimmune disease or a disease most likely of autoimmune origin (e.g., rheumatoid arthritis, multiple sclerosis, myasthenia gravis, psoriasis, vitiligo, systemic lupus erythematosus, sarcoidosis, focal segmental glomerulosclerosis, Crohn's disease, Behcet's disease, pemphigus, ankylosing spondylitis, and ulcerative colitis), or a non-autoimmune inflammatory disease (e.g., control of chronic allergic asthma and ankylosing spondylitis).

[0173] In Example 2 and Figures 4 and 5, an eightfold increase in HLA-J expression was demonstrated upon exposure of ovarian cancer tissue to chemotherapy. Similarly, in breast cancer patients, significant upregulation of HLA-J expression during chemotherapy was found to be positively correlated with the subtotal response to chemotherapy; see Example 3 and Figure 12. The higher the increase in HLA-J expression, the worse the progression-free survival and overall survival of each tumor patient. In particular, an increase of at least twofold, preferably at least threefold, more preferably at least fourfold, much more preferably at least sixfold, and most preferably at least eightfold indicates a worse prognosis.

[0174] In the 16th aspect, the present invention relates to a method for predicting the efficiency of tumor treatment in a subject having a tumor, comprising determining the levels of nucleic acid molecules of the first aspect, item (g) and / or proteins or peptides of the fourth aspect in a sample obtained from the subject before starting treatment, wherein a reduced level of nucleic acid molecules of the first aspect, item (g) and / or proteins or peptides of the fourth aspect compared to a negative control is positively correlated with the effect of tumor treatment; and / or if there is no substantial difference in the levels of nucleic acid molecules of the first aspect, item (g) and / or proteins or peptides of the fourth aspect compared to a positive control, there is a positive correlation with the effect of tumor treatment.

[0175] With respect to other aspects of the present invention, the definitions and preferred embodiments provided above may be applied in the same way to the 16th aspect of the present invention. For example, means and methods for determining the amount of nucleic acid molecules of the first aspect and / or proteins or peptides of the fourth aspect are described above with respect to the 10th aspect of the present invention. These means and methods may be used in the same way with respect to the 16th aspect of the present invention.

[0176] In the 16th aspect, a negative control group may be obtained from one or more subjects who have not responded to tumor treatment. A positive control group may be obtained from one or more subjects who have responded to tumor treatment. Additionally, for the control group, samples from one or more subjects must be obtained before starting tumor treatment. Preferably, one or more subjects of the negative and / or positive control groups have received the same tumor treatment as that used on the subject under investigation, and / or these one or more subjects have tumors in the same body parts as the subject under investigation.

[0177] If the expression level of nucleic acid molecules of the first aspect or proteins or peptides of the fourth aspect in the sample is reduced by at least 1.5-fold, 2-fold, 3-fold, or 4-fold with increased preference compared to a negative control or a preset reference derived therefrom, the subject is expected to be responsive to tumor treatment. Additionally, if the expression level of nucleic acid molecules of the first aspect or proteins or peptides of the fourth aspect in the sample differs from a positive control or a preset reference derived therefrom by less than 50%, less than 25%, and less than 10% with increased preference, the subject is expected to be responsive to tumor treatment.

[0178] The tumor treatment is preferably chemotherapy. The tumor is preferably as defined above, and most preferably breast cancer with respect to the 16th aspect. Example 3 and Figures 9 and 10 show that HLA-J expression levels in breast cancer patients are an indicator that predicts the response during chemotherapy.

[0179] In the 17th aspect, the present invention relates to a method for predicting whether a tumor of an individual is a luminal tumor, comprising determining the levels of nucleic acid molecules of the first aspect, item (g) and / or proteins or peptides of the fourth aspect in a sample obtained from an individual; and indicating that the tumor is a luminal tumor if, compared to a negative control, the levels of nucleic acid molecules of the first aspect, item (g) and / or proteins or peptides of the fourth aspect are increased and / or the levels of nucleic acid molecules of the first aspect, item (g) and / or proteins or peptides of the fourth aspect are not substantially different compared to a positive control.

[0180] With respect to other aspects of the present invention, the definitions and preferred embodiments provided above may be applied in the same way to the 17th aspect of the present invention. For example, means and methods for determining the amount of nucleic acid molecules of the first aspect and / or proteins or peptides of the fourth aspect are described above with respect to the 10th aspect of the present invention. Such means and methods may be used in the same way with respect to the 17th aspect of the present invention.

[0181] Luminal tumors are estrogen receptor (ER)-positive, whereas non-luminal tumors are ER-negative. The luminal tumor is preferably luminal breast cancer. Luminal breast cancer is ER-positive and Her2-negative. Despite adjuvant endocrine therapy and chemotherapy, patients with ER-positive tumors have a high risk of recurrence; early and late recurrences may occur. Therefore, it is important to identify patients with ER-positive tumors, as they may not need to undergo adjuvant chemotherapy. This is because these patients will respond better to extended adjuvant hormone therapy.

[0182] In the 17th aspect, the negative control may be derived from one or more subjects having a non-luminous tumor. The positive control may be derived from one or more subjects having a luminous tumor. One or more subjects of the negative and / or positive control preferably have a tumor in the same body part as the subject under investigation.

[0183] If the expression level of nucleic acid molecules of the first aspect or proteins or peptides of the fourth aspect in the sample is increased by at least 1.5-fold, 2-fold, 3-fold, or 4-fold with increased preference compared to a negative control or a preset reference derived therefrom, the subject is expected to be responsive to tumor treatment. Additionally, if the expression level of nucleic acid molecules of the first aspect or proteins or peptides of the fourth aspect in the sample differs from a positive control or a preset reference derived therefrom by less than 50%, less than 25%, and less than 10% with increased preference, the subject is expected to be responsive to tumor treatment.

[0184] In a method for predicting whether a subject's tumor is a luminal tumor, additional markers of luminal tumors expected to increase the sensitivity and specificity of the method may be investigated. Non-limiting examples of additional markers are ESR1, PGR, and ERBB2. Since estrogen receptor alpha (ERα) is encoded by the ESR1 gene, expression of ESR1 indicates a luminal tumor. The PgR gene encodes the progesterone receptor, which is typically expressed in luminal tumors. Finally, the ERBB2 gene encodes HER2. The absence of ERBB2 expression indicates a luminal tumor.

[0185] As shown in Example 3, since luminal breast cancer patients exhibited the highest levels of HLA-J expression, high HLA-J expression in breast cancer patient samples indicates that the breast cancer is luminal breast cancer. It has been revealed that HLA-J is an excellent marker for luminal tumors.

[0186] In the 18th aspect, the present invention relates to a method for predicting whether a tumor of a subject is a non-luminal tumor or a luminal tumor, comprising: (a) determining the levels of nucleic acid molecules of the first aspect, item (g) and / or proteins or peptides of the fourth aspect in a sample obtained from the subject before initiating chemotherapy; and (b) determining the levels of nucleic acid molecules of the first aspect, item (g) and / or proteins or peptides of the fourth aspect in a sample obtained from the subject after initiating chemotherapy, preferably after completion of chemotherapy, wherein, compared to (a), an increased level of nucleic acid molecules of the first aspect, item (g) and / or proteins or peptides of the fourth aspect in (b) indicates a non-luminal tumor, whereas compared to (a), if the levels of nucleic acid molecules of the first aspect, item (g) and / or proteins or peptides of the fourth aspect in (b) are not substantially different, it indicates a luminal tumor.

[0187] With respect to other aspects of the present invention, the definitions and preferred embodiments provided above may be applied in the same way to the 18th aspect of the present invention. For example, means and methods for determining the amount of nucleic acid molecules of the first aspect and / or proteins or peptides of the fourth aspect are described above with respect to the tenth aspect of the present invention. Such means and methods may be used in the same way with respect to the 18th aspect of the present invention.

[0188] When comparing the level of (b) above with the level of (a) above, if the expression level of the nucleic acid molecule of the first aspect or the protein or peptide of the fourth aspect in the sample is increased by at least 1.5-fold, 2-fold, 3-fold, or 4-fold with increased preference, the subject is expected to have a non-luminous tumor. When comparing the level of (b) above with the level of (a) above, if the expression level of the nucleic acid molecule of the first aspect or the protein or peptide of the fourth aspect in the sample differs by less than 50%, less than 25%, and less than 10% with increased preference (i.e., higher or lower), the subject is expected to have a luminous tumor.

[0189] The above non-luminous and luminous tumors are preferably non-luminous and luminous breast cancers.

[0190] In Example 3, it is shown that during chemotherapy, HLA-J expression levels increase in non-luminous breast cancer patients, whereas in luminous breast cancer patients, HLA-J expression is essentially unaffected by chemotherapy.

[0191] In a final aspect, the present invention relates to a method for identifying an inhibitor of a nucleic acid molecule of the first aspect and / or a protein or peptide of the second aspect, comprising: (a) culturing tumor cells that express a nucleic acid molecule of the first aspect and / or produce a protein or peptide of the second aspect with immunocompetent cells under growth conditions; (i) in the presence of a test agent and (ii) in the absence of said test agent; (b) determining the growth of the tumor cells for a)i) and a)ii); (c) comparing the growth determined in step b) for a)i) with the growth determined in step b) for a)ii), wherein, compared with the growth of a)ii), the reduced growth for a)i) indicates that said test agent is an inhibitor of a nucleic acid molecule of the first aspect and / or a protein or peptide of the second aspect.

[0192] While growth conditions vary significantly by cell type, the artificial environment in which cells are cultured invariably consists of a suitable vessel containing the following: (i) a substrate or medium supplying essential nutrients (amino acids, carbohydrates, vitamins, minerals), (ii) growth factors, (iii) hormones, (iv) gases (O2, CO2), and (v) a controlled physicochemical environment (pH, osmotic pressure, temperature). Therefore, even if the aforementioned growth conditions for any specific tumor cell have not yet been established, identifying the appropriate conditions for tumor cell growth is a common task.

[0193] Techniques for determining determined cell growth are established in the industry. Cell growth can be detected by various methods. An increase in cell number can be measured, for example, by manually counting cells under microscopic observation using a dye exclusion method (i.e., trypan blue) to count only viable cells. Less demanding and scalable methods involve the use of cytometers, and flow cytometry allows cell counts ('events') to be combined with other specific parameters: using fluorescent probes for membrane, cytoplasm, or nucleus allows for the distinction between dead and viable cells, cell types, cell differentiation, and the expression of biomarkers such as Ki-67.

[0194] As the above test formulation, small molecules, antibodies or antibody analogs, aptamers, siRNA, shRNA, miRNA, ribozymes, or antisense nucleic acid molecules may be used. The characteristics of these compounds are described above in relation to the fifth aspect of the present invention. Although the inhibitor used according to the fifth aspect of the present invention is already known to be an inhibitor of the nucleic acid molecule of the first aspect and / or the protein or peptide of the fourth aspect, the test formulation is tested for its ability to be such an inhibitor in the manner of the last aspect of the present invention. For example, according to the fifth aspect of the present invention, a small molecule known to inhibit the nucleic acid molecule of the first aspect and / or the protein or peptide of the fourth aspect is used, but according to the last aspect of the present invention, a small molecule not yet known to be capable of inhibiting the nucleic acid molecule of the first aspect and / or the protein or peptide of the fourth aspect is embodied in the above manner. The small molecule is tested for its ability to be such an inhibitor in the manner of the last aspect of the present invention.

[0195] Immunocompetent cells are cells capable of generating an immune response in vivo after exposure to antigens in the body. The immunocompetent cells are preferably macrophages or lymphocytes, more preferably lymphocytes, and most preferably natural killer (NK) cells. Lymphocytes and especially NK cells can specifically recognize and kill tumor cells.

[0196] The efficiency of several test formulations can be determined simultaneously in a high-throughput system, which is described in more detail above in relation to the 5th aspect of the present invention.

[0197] As can be seen from the examples discussed above and below, since the nucleic acid molecule of the first aspect and / or the protein or peptide of the fourth aspect promote tumor cell growth by shielding tumor cells from recognition by immunocompetent cells, inhibiting the nucleic acid molecule of the first aspect and / or the protein or peptide of the fourth aspect can be expected to result in a reduction in tumor cell growth, as immunocompetent cells can better recognize and inhibit or kill the tumor cells. The test agent is qualified as an inhibitor if the growth of a)i) is reduced by at least 10%, at least 20%, at least 50%, at least 75%, at least 90%, and at least 95% compared to the growth of a)ii), depending on the increasing preference. Most preferably, the test agent completely or essentially eliminates the growth of tumor cells.

[0198] To ensure the specificity of the test agent for the nucleic acid molecule of the first aspect and / or the protein or peptide of the fourth aspect, the method of the last aspect preferably includes an additional step of determining the amount of the nucleic acid molecule of the first aspect and / or the protein or peptide of the fourth aspect in a)i) compared to a)ii). In the presence of the test agent compared to the absence of the test agent, a reduced amount or activity indicates the specificity of the test agent for the nucleic acid molecule of the first aspect and / or the protein or peptide of the fourth aspect.

[0199] With respect to this detailed description, particularly with respect to the embodiments characterized in the claims, each embodiment mentioned in a dependent claim is intended to be combined with each embodiment of each claim (independent or dependent claim) cited by said dependent claim. For example, in the case of independent claim 1 listing three alternatives A, B, and C; dependent claim 2 listing three alternatives D, E, and F; and claim 3 citing claims 1 and 2 and listing three alternatives G, H, and I, unless specifically stated otherwise, the specification [does not include] A, D, G; A, D, H; A, D, I; A, E, G; A, E, H; A, E, I; A, F, G; A, F, H; A, F, I; B, D, G; B, D, H; B, D, I; B, E, G; B, E, H; B, E, I; B, F, G; B, F, H; B, F, I; C, D, G; It should be understood that specific examples corresponding to combinations of C, D, H; C, D, I; C, E, G; C, E, H; C, E, I; C, F, G; C, F, H; and C, F, I are disclosed unambiguously.

[0200] Similarly, and also where independent and / or dependent claims do not refer to alternatives, or where a dependent claim refers to multiple prior claims, it is understood that any combination of the subject matter of the invention included herein is deemed to be explicitly disclosed. For example, in the case of independent claim 1, dependent claim 2 citing claim 1, and dependent claim 3 citing both claims 2 and 1, the combination of the subject matter of claims 3 and 1 is clearly and unambiguously disclosed, as is the combination of the subject matter of claims 3, 2 and 1. In the case of an additional dependent claim 4 citing any one of claims 1 through 3, the combination of claims 4 and 1, claims 4, 2 and 1, and claims 4, 3 and 1, as well as the combination of claims 4, 3, 2 and 1, are clearly and unambiguously disclosed. Brief explanation of the drawing

[0201] Fig. 1. Sequence alignment of HLA-A1, HLA-A2, HLA-G, HLA-F1, HLA-F2, and HLA-F3 at potential translation initiation sites. Potential start codons are indicated on a light gray background. Differences between the disclosed common nucleotide sequences and start codons are indicated on a yellow background. Splice locations are indicated on a gray background. The described early stop codon of HLA-J is indicated on a gray background with gray text. Fig. 2. Sequence alignment of HLA-A1, HLA-A2, HLA-G, HLA-F1, HLA-F2, and HLA-F3 at the transition to the transmembrane domain. Splice locations are indicated by a gray background. Extended spanning between the exon 5-exon 6 donor and acceptor regions results from the insertion of the HLA-J intrinsic sequence. The new stop codon of HLA-J initiated by this is indicated by a gray background and gray text. Fig. 3. HLA-J mRNA expression quantified by RT-qPCR analysis at the HLA-J specific exon 4 / exon 5 junction. Relative mRNA expression is determined by the 40-DCT method using CALM2 as the reference gene. Higher 40-DCT values ​​indicate higher gene expression. Due to the exponential nature of the PCR method, each increase of 1 signifies a doubling of gene expression. An increase of 3 DCT values ​​signifies an eightfold increase in HLA-J mRNA expression. Fig. 4. Kaplan-Meier plot showing progression-free survival probability in neoadjuvantly treated ovarian cancer patients based on stratification by HLA-J mRNA expression quantified by RT-qPCR analysis at the HLA-J specific exon 4 / exon 5 junction. Relative mRNA expression is determined by the 40-DCT method using CALM2 as the reference gene. The difference in expression levels before and after treatment was determined based on 40-DCT calculations (see above). A change of 2 DCT or more (i.e., ≥ 2.1) reflects an increase in HLA-J of more than 8-fold (a > 8 fold) when ovarian cancer tissue is exposed to chemotherapy. Fig. 5. Kaplan-Meier plot showing the overall survival probability of ovarian cancer patients receiving neoadjuvant therapy based on stratification by HLA-J mRNA expression quantified by RT-qPCR analysis at the HLA-J specific exon 4 / exon 5 junction. Relative mRNA expression is determined by the 40-DCT method using CALM2 as the reference gene. The difference in expression levels before and after treatment was determined based on 40-DCT calculations (see above). 2.1 Changes of DCT or greater reflect an increase in HLA-J of more than 8-fold (a > 8 fold) when ovarian cancer tissue is exposed to chemotherapy. Fig. 6. HLA-J mRNA expression quantified by RT-qPCR analysis at the HLA-J specific exon 4 / exon 5 junction. Relative mRNA expression is determined by the 40-DCT method using CALM2 as the reference gene. Higher 40-DCT values ​​indicate higher gene expression. Fig. 7. Correlation between HLA-J mRNA expression and key markers of breast cancer subtypes in pre-treatment core needle biopsies of chemotherapy-naive breast cancer tissue. Fig. 8. Correlation between HLA-J mRNA expression and key markers of breast cancer subtypes in surgical specimens of residual breast cancer tissue after chemotherapy. Fig. 9. Data distribution of Tumor Regression Grade (TRG) status and mRNA expression levels of HLA-J, ESR1, ERBB2, and KRT5 mRNA in pre-treatment core needle biopsy samples from breast cancer patients. Fig. 10. Spearman correlation between TRG status and mRNA expression levels of HLA-J, ESR1, ERBB2, and KRT5 mRNA in pre-treatment core needle biopsy samples from breast cancer patients. Fig. 11. Data distribution of mRNA expression levels and TRG status of HLA-J, ESR1, ERBB2, and KRT5 mRNA in breast tumors after neoadjuvant chemotherapy. Tumor tissues with limited responsiveness to neoadjuvant chemotherapy are highlighted in dark gray. Fig. 12. Spearman correlation between TRG status and mRNA expression levels of HLA-J, ESR1, ERBB2, and KRT5 mRNA in tumor tissue of breast cancer patients after neoadjuvant chemotherapy. Fig. 13. Scatter plot of HLA-J mRNA expression (y-axis) according to TRG status (x-axis) in tumor tissue of breast cancer patients before (left panel) and after (right panel) neoadjuvant chemotherapy. Fig. 14. Scatter plot of differences in HLA-J mRNA expression before and after chemotherapy (y-axis) according to TRG status (x-axis) in tumor tissue of breast cancer patients. Fig. 15. Kaplan-Meier plot showing progression-free survival probability in breast cancer patients receiving neoadjuvant therapy based on stratification by HLA-J mRNA expression quantified by RT-qPCR analysis at the HLA-J specific exon 4 / exon 5 junction. Relative mRNA expression is determined by the 40-DCT method using CALM2 as the reference gene. The difference in expression levels before and after treatment was determined based on 40-DCT calculations (see above). A change of more than 3,5 DCTs reflects a more than 16-fold (a > 16 fold) increase in HLA-J when breast cancer tissue is exposed to chemotherapy. Fig. 16. Regions of the linking peptide corresponding to the alpha 2 and 3 domain regions, the transmembrane domain, and the cytoplasmic region. Protein sequence summary of HLA-A, HLA-B, HLA-C, HLA-E, HLA-F isoforms, and HLA-G, HLA-H, and HLA-J proteins; common base sequences are highlighted in gray above the aligned sequences. Differences in HLA peptide sequences are also highlighted in gray. The expected alpha 3 domain of HLA-J differs from this domain (doaim) of other HLA genes and is highlighted in gray. The peptide sequence for the generation of HLA-J specific antibodies is indicated by an arrow labeled "JULY antibody". Fig. 17. (A) Evidence of HLA-J protein expression by Western blot analysis in ovarian cancer tissue of patients with chemotherapy-resistant tumors (n = 4; patient IDs: 107, 114, 116, and 128). For each patient, HLA-J protein expression was evaluated before (pre) and after (post) neoadjuvant chemotherapy. (B) Evidence of HLA-J protein expression by Western blot analysis in ovarian cancer ("OC"), breast cancer ("BC"), urinary tract / blacker's carcinoma ("UC"), and placental tissue ("P1"). Fig. 18. Tumor-specific expression of HLA-J in cystectomy (CYS) biopsy specimens obtained from 3 cancer patients after neoadjuvant chemotherapy, and no expression was detected in the "mapping" of matched transurethral resection (TUR) biopsy specimens and negative control specimens derived from normal tissue before chemotherapy treatment. Specific details for implementing the invention

[0202] Examples illustrate the present invention.

[0203] Example 1: Identification of HLA-J as a non-gene and determination of HLA-J specific regions at respective exon / exon boundaries.

[0204] We accessed the UCSC Genome Browser (https: / / genome.ucsc.edu / cgi-bin / hgGateway) and downloaded the genome sequences of HLA-A1 (NM_002116.7), HLA-A2 (NM_001242758.1), HLA-G (NM_002127.5), HLA-F1 (NM_001098479.1), HLA-F2 (NM_018950.2), and HLA-F3 (NM_001098478.1), and performed sequence alignment with the putative sequence of HLA-J (NR_024240.1). The initial alignment analysis focused on potential translation initiation regions and potential transitions from the extracellular alpha domain to the transmembrane region. According to a previous publication by Messer et al. (Messer G, Zemmour J, Orr HT, Parham P, Weiss EH, Girdlestone J. HLA-J, a second inactivated class I HLA gene related to HLA-G and HLA-A. Implications for the evolution of the HLA-A-related genes. J Immunol. 1992 Jun 15; 148(12):4043-53.), HLA-J is considered a pseudogene due to harmful mutations that produce translation termination in exon 2 or exon 4. To analyze potential reading frames, the start codon, the first codon of the messenger RNA (mRNA) transcript translated by the ribosome, was analyzed. Messer et al. based their sequence analysis of the common sequence start site according to the following: ATG-GGG-GTC-ATG-GCG-CCC-CGA-ACC-C (SEQ ID NO: 10) (Fig. 1, ATG is on a light gray background in the HLA-G sequence).According to sequence analysis of the HLA-J cloned by their group, a detrimental point mutation at nucleotide position 4, lacking G (gray "-" in Fig. 1, HLA-J sequence), can be observed, which actually causes a frame shift: ATG-GGG-TCA-TGG-CGC-CCC-GAA-CCC (SEQ ID NO: 11). As described by Messer et al., this results in the premature termination of the protein sequence in exon 2. However, further studies described herein have revealed, surprisingly, the existence of a second potential initiation site at position 10. Sequence analysis shows that the nucleotides surrounding the second ATG at the 5' and 3' ends match the requirements of the Kozak sequence. Furthermore, compared to the disclosed common initiation codon sequence, HLA-F does not possess a common initiation codon as disclosed by Messer et al., but possesses a second initiation site, which is the true translation initiation site for the HLA-J according to the present invention. Analysis of the sequence alignment revealed that when starting at position 10 and having a translation start codon at the second ATG site, HLA-J is a protein substantially similar to HLA-G, although it does not have frameshift deletions that lead to premature termination. The "open reading frame 3 (ORF3)" of the common alignment was identified as the relevant reading frame, which changed the pseudogene into the true gene sequence.

[0205] The sequence alignment of HLA-A1, HLA-A2, HLA-G, HLA-F1, HLA-F2, HLA-F3, and HLA-J at the transition from the alpha domain to the transmembrane domain is depicted in Fig. 2. Based on NCBI nomenclature, exon 5 encodes the alpha 23 domain of HLA-S, and exon 6 encodes the transmembrane domain. When observing the splice site at the junction between exon 5 and exon 6 (indicated by the gray background color in Fig. 2 according to the HLA-G sequence in gray text), it becomes evident that the insertion of 16 nucleotides within HLA-J disrupts these splicing donor and acceptor sites, while generating the unique sequence of HLA-J. There are no other HLAs with similar sequences at the same location or any other arbitrary location within the entire sequence. Importantly, this region originates from a true exonic region with an intron length of approximately 570 bp between the HLA-J specific donor and adductor for splicing. Therefore, this region was selected as a site of particular interest to demonstrate the presence of HLA-J mRNA secreted from tumor and normal tissue samples (see Example 2).

[0206] When comparing the exon structure of the non-like gene HLA-J with that of HLA-G, it becomes clear that HLA-J lacks the exon 4 homolog encoding the alpha domain structure 2, in particular, and functions as a genomically determined splice variant homolog of HLA-G. More importantly, the amino acid sequence inferred from ORF3, namely “HTFLETSQGSKTRRFL(-terminal)” (SEQ ID NO: 5), contains various charged amino acids (e.g., E, K, R) and an aromatic amino acid (F), which excludes the possibility that this sequence serves as a transmembrane transversal region or anchor. Thus, the newly identified HLA-J is clearly a secreted protein with features similar to HLA-G, but lacks the alpha 2-like domain important for peptide presentation.

[0207] Example 2: Determination of HLA-J mRNA expression levels by reverse transcription (RT) quantitative PCR (RT-qPCR) in a cohort of ovarian cancer patients treated with neoadjuvant therapy

[0208] Forty-five newly diagnosed patients with histologically confirmed FIGO III to IV epithelial ovarian cancer or peritoneal carcinoma for whom optimal neoadjuvant surgery was not suitable, and candidates for neoadjuvant chemotherapy (the aforementioned carcinomas are also referred to as ovarian cancer hereinafter), were enrolled in the study between September 2004 and December 2007. Other inclusion criteria included age of 18 years or older and hematological, renal, hepatic, and cardiac function suitable for platinum-based chemotherapy. Exclusion criteria included a Karnofsky performance status (KPS) of less than 70%, a history of other malignancies, and reasons for contraindication to surgery. The possibility of optimal volume reduction surgery was excluded from the criteria based on open laparoscopy. The initial study population of 45 patients was reduced to 35, excluding 9 patients whose biopsy samples were unsuitable for microarray analysis and 1 patient who was deemed unsuitable due to a diagnosis of peritoneal mesothelioma following histological review. Standard therapy of carboplatin AUC 5 and paclitaxel 175 mg / m2 Q3 was administered as nephroadjuvant therapy for 6 cycles over 3 hours every 3 weeks. In 3 patients aged 75 years or older and 1 patient with poor scores (KPS 70%), monotherapy with carboplatin was preferred over combination chemotherapy.

[0209] Histopathological response was evaluated postoperatively using surgical specimen analysis. To date, histopathological criteria for describing the therapeutic response following neoadjuvant chemotherapy in ovarian cancer have not been firmly established. According to the literature on responses to first-line chemotherapy in ovarian cancer (Le et al. 2007, Sassen et al. 2007) and breast cancer (Ogston et al. 2003), a complete pathological response was considered to be the absence of cancer cells in the surgical specimen, while a very good partial remission was considered to be the persistence of only small clusters (<1 cm) or individual cancer cells and the absence of macroscopic residues after surgery. Partial pathological remission was defined as a reduction in tumor burden between 30% and 90% at the time of surgery, whereas stable disease was defined as no reduction in tumor burden or a reduction of less than 30% at the time of surgery compared to the initial diagnostic laparoscopy. Only patients with complete and very good partial remission were considered pathological responders, and all other cases were considered pathological non-responders. For survival analysis, Kaplan-Meier survival estimation and Cox regression analysis were used for the time from initial diagnosis to progression-free survival (PFS) or overall survival (OS), or the time between progression and death (PDT). Complete survival data were available from 40 patients. At the time of data termination, the median PFS was 14.7 months and the median OS was 33.5 months, which are high figures considering the very advanced stage of disease at the start of the study (unresectable FIGO III–IV).

[0210] For mRNA detection, collected tissues were immediately frozen and stored in liquid nitrogen until analysis. Approximately 20–100 mg of frozen ovarian tumor tissue was pulverized in liquid nitrogen. RNA was extracted using a commercial kit (Qiagen), RNA integrity was evaluated on an Agilent 2100 Bioanalyzer (Agilent Technologies, Palo Alto, CA, USA), cDNA was synthesized from 1 mg of total RNA using an Invitrogen kit (Invitrogen Corp.) and analyzed on an Affymetrix HG-U133A microarray (Affymetrix Inc., Santa Clara, CA, USA) as described elsewhere (Ihnen et al. 2008).

[0211] For validation purposes, total RNA isolated from the same fresh tissue biopsy was subjected to RT-qPCR as described above to validate array data via an independent technical approach. A gene-specific TaqMan-based primer / probe set was used to evaluate HLA-J expression. For detailed analysis of gene expression by the RT-qPCR method, primers adjacent to the region of interest and fluorescently labeled probes that hybridize between them were used. Target-specific primers and probes were selected using the NCBI Primer Design Tool (www.ncbi.nlm.nih.go). RNA-specific primer / probe sequences were used to enable RNA-specific measurements by positioning the primer / probe sequences across exon-exon boundaries. Additionally, primers / probes were selected so as not to bind to sequence regions containing known polymorphisms (SNPs). In cases where multiple isomorphisms of the same gene exist, primers were selected to amplify all appropriate related or selected splice variants. The specificity of all primer pairs was verified by a conventional PCR reaction. After further optimization of the primers / probes, the primers and probes providing optimal results are listed in Table 1. These primers / probes are superior to primers / probes known from prior art, for example, in terms of specificity and amplification efficiency. To standardize the amount of sample RNA, CALM2 was selected as the reference gene because it was not differentially regulated in the analyzed samples. Sample pairs with low RNA content (i.e., raw CT values ​​for CALM2 less than 22) for pre-treatment biopsies or post-treatment resectates were excluded.

[0212] Primers and probes used for HLA-J mRNA quantification gene Forward-Primer probe Reverse Primer HLA-J CCTCTGTCTCTACACCTCCATTCC AGCTCCCTCTCTGGCACCAAGCTCC TTCCCCTGGACTCTTCAAAAAG HLA-J CCCTCTCTGGCACCAAGCT AGCCTGCGACGGGTCCTTCTTCCT GGTCCGCGTCGTGAGTGT HLA-J GACCCT GCTCCGCTACTACAA CAGAGCGAGGCGGACCCCCC AGAACCCAGGACCTCGTTATGC HLA-J ACCCCCCCCAAGACACA TGACCCACCCCCCTCTCTGAACATG GAACCCAGGACCTCGTTATGC HLA-J GACCAGACCCAGGACATGGA CTCGTGGAGACCAGGCCCACAGG TACCACAACCGCCCACTTCT HLA-J TGCC CAAGCCCCTC ATC TGAGATGGTCACACATTTCTGGAAACTTCTC CAGGGCCATGAGGTCCTAGA HLA-J TGCC CAAGCCCCTC ATC TGAGATGGTCACACATTTCTGGAAACTTCTC CTAGAGGAACCTCCTAGTCTTGGAAC HLA-J GGAAACTTCTCAAGGTTCCAAGAC AGGTTCCTCTAGGACCTCATGGCCCTGC CTGTGAGAGGCCAGGAAGGTA HLA-J GGAGCTACTCTCAGGCTGCAA CAGCCAAAGTGCCCAGGGCTC CTTTACAAGCCGTGAGAGACACAT HLA-J TGCCTTGTGTGGGACTGAGA CAAGATTTGTTCATGCCTTCCCTTTGTGAC CAGAAAGAGAAGTCAGGGTTCTTGA HLA-J CTTCCCCGATCACCTTTCCT CAGAGAAGTGGTGCTGGGATGTCTCCAT TACAGCTCAGTGCACCATGAAGT HLA-J GCTCTCGGGGACCCTGG ATGAGGTATTTCAGCACCGCCGTTCC CCCACGGCAATGAAGCTG HLA-J CCAATCAGCGTCGCGCG ACGCACCCACCGGGACTCGGAGT ACCCCATCGTCGGCGTC CALM2 GAGCGAGCTGAGTGGTTGTG TCGCGTCTCGGAAACCGGTAGC AGTCAGTTGGTCAGCCATGCT

[0213] Comparison △ A TaqMan® validation experiment was performed to demonstrate that the efficiency of target and control amplification is nearly identical, which is a prerequisite for the relative quantification of gene expression by the CT method. To perform expression analysis of genes of interest within biological samples, a 4x double assay mixture was prepared by mixing each primer / probe of two specific assays. For the individual detection of CT values, the assay probes were modified with different fluorescent probes. Each 4x assay mixture contained 2 μM of unmodified forward and reverse primers and 1.2 μM of probes. For each reaction, 2.5 μL of total RNA extracted from FFPE sections (see above) was mixed with 2.5 μL of assay mixture, 2.5 μL of enzyme mixture, and 2.5 μL of water in one well of a 96-well optical reaction plate. PCR reaction measurements were performed using a Versant qPCR Cycler (Siemens) or Light Cycler 480 (Roche) under appropriate conditions (5 min 50 ℃, 1 cycle; 20 sec 95 ℃, 1 cycle; 15 sec 95 ℃; 1 min 60 ℃, 40 cycles) according to the manufacturer's instructions.

[0214] As shown in Fig. 3, all ovarian cancer samples expressed HLA-J. The dynamic range of HLA-J mRNA expression included a DCT value of 5, which corresponds to a maximum of 2 for ovarian cancer-specific HLA-J expression. 5This implies upregulation of up to (i.e., 30-fold). Importantly, such upregulation occurred frequently after neoadjuvant chemotherapy in advanced ovarian cancer (comparison of HLA-J mRNA levels before neoadjuvant chemotherapy—light bar—and HLA-J mRNA levels after chemotherapy—dark bar). In 14 out of 26 matched sample pairs (~50%), substantial HLA-J upregulation was observed after chemotherapy, whereas downregulation was observed only in patient #107. Furthermore, a significant increase in HLA-J expression was associated with worse outcomes. For example, the three patients with the greatest increase in HLA-J mRNA expression (i.e., more than 8-fold)—patient #106, patient #108, and patient #112—had progression-free survival intervals of 8.7 months, 9.2 months, and 7.9 months, respectively. Similarly, the overall survival periods between initial diagnosis and death were 10.6 months, 12.5 months, and 10.3 months, respectively. In contrast, patient #107, who showed a significant decrease in HLA-J mRNA expression, had a progression-free survival interval of 15.1 months and an overall survival of 43.0 months. The median PFS for comparison was 14.7 months, and the median OS was 33.5 months.

[0215] Next, we analyzed whether changes in HLA-J mRNA expression had a prognostic value in ovarian cancer patients treated with neoadjuvant therapy, observing a greater than fourfold increase in HLA-J mRNA expression in the resectate after chemotherapy. Within this predefined setting, 16% of tumors showed a significant increase in HLA-J expression. Indeed, the progression-free survival and overall survival of such patients were significantly poor, as shown in Figures 4 and 5.

[0216] These data demonstrate that the secreted form of HLA-J is overexpressed in ovarian cancer. Furthermore, they show that its expression frequently increases when ovarian cancer is exposed to chemotherapy drugs (at least 50% of patients). Moreover, these data show that extreme upregulation (more than 8-fold) is consistently associated not only with resistance to chemotherapy but also with reduced progression-free survival and overall survival.

[0217] According to the previously defined hypothesis, researchers can demonstrate that the expression of previously misclassified "pseudogenes" holds functional and prognostic value in cancer, as has been proven for ovarian cancer. The efficacy of neoadjuvant therapy for cancer regression has long been a subject of discussion. It is presumed that the destruction of neoplastic cells exposes antigens and neoantigens to the immune system, triggering a systemic, mid-to-long-term anti-tumor response that ultimately leads to long-term survival. However, the mechanism by which tumors evade these anti-tumor effects and escape removal by immune cells remains unknown.

[0218] Here, a mechanism was shown to upregulate secreted HLA-J isoforms. It is evident that these small HLA-G-like proteins cannot bind to peptides for the presentation and activation of cytotoxic and anti-tumor immune cells (e.g., T cells) because they lack an alpha 2 domain. However, the secretion of proteins that can bind to immune cells, even without antigen presentation capabilities, can interfere with the activation process of immune cells, thereby inducing immune tolerance and enabling tumor cells to evade them.

[0219] Because the secreted isoforms are not membrane-bound, they alter effector activity by establishing a gradient of immune-activating ligands binding to infiltrating immune cells. In extreme cases, immune cells may switch from anti-tumor to tumor-promoting activity. Due to their small size, secreted HLA isoforms are active not only in the paracrine but also in the distant. Detecting these fragments in the blood allows for monitoring anti-tumor activity and changes in treatment, respectively, upon the development of resistance. Furthermore, blocking these immune-activating ligands can enhance the efficacy of conventional and / or other anti-neoplastic therapies, including, for example, immunotherapies (e.g., immune checkpoint inhibitors).

[0220] Example 3: Determination of HLA-J mRNA expression levels by reverse transcription (RT) quantitative PCR (RT-qPCR) in a cohort of breast cancer (BC) patients treated with neoadjuvant therapy

[0221] Newly diagnosed early / locally advanced BC patients with a medical status appropriate for chemotherapy and breast surgery were eligible for the study. Patients with oligometastatic breast cancer (oligometastatic BC) were also eligible if breast surgery following chemotherapy was included in the treatment program. Histological diagnosis of BC was confirmed by core needle biopsy. By all patients, a physical examination, mammography, breast ultrasound, breast MRI, thoracic-abdominal CT scan, bone scan, and 18F-FDG-PET / CT study were obtained. The physical examination, mammography, breast ultrasound, and 18F-FDG-PET / CT study were repeated after two cycles of PCT (preoperative chemotherapy) and before surgery.

[0222] Anthracycline-based and taxane-based PCT were administered to patients for 6 to 8 cycles. Surgery (including axillary lymph node dissection) was performed after the completion of PCT. Patients who underwent breast-conserving surgery were subsequently treated with radiation therapy.

[0223] Fresh surgical specimens (breast and axillary lymph nodes) obtained after chemotherapy were evaluated by experienced breast pathologists. Miller-Payne classification was a grading system used to evaluate the histological response to PCT. Estrogen receptor (ER), progesterone receptor (PR), and human epidermal growth factor receptor 2 (HER2) were the molecular markers investigated. Immunohistochemistry (IHC) was used to evaluate ER and PR; to be positive, at least 10% of tumor nucleus cells had to be stained. HER2 status was evaluated by IHC; HER2 positivity (HER2+ive) was defined as 3+ by IHC or 2+ by gene amplification via FISH (fluorescent in situ hybridization). Additionally, RT-qPCR-based evaluations of ESR1 and ERBB2 status were performed to quantitatively assess key parameters of breast cancer biology to determine the association between HLA gene expression and distinct breast cancer subtypes.

[0224] Sixty newly diagnosed BC patients with the major characteristics listed in Table 2 were enrolled from July 2004 to March 2011. PCT consisted of anthracycline and taxane therapy for 6 cycles in 9 patients (15%) and sequential anthracycline and taxane therapy for 4 cycles over a total of 8 cycles in 45 patients. At the median interval of 31 days (d) (ranging from 11 to 52d) from the last chemotherapy cycle, all patients except two underwent surgery. After the end of chemotherapy, an overall optimal pathological response (pR) was observed in 13 patients (22%), and a pathological non-response (pNR) occurred in 47 patients (78%).

[0225] Patient characteristics of the breast cancer cohort Patient characteristics (n=60) n (%) Age (median range) 49 (31-72 %) step (%) II A / BIII A / BIV Oligometastatic 30 (50 %)23 (38 %)7 (12 %) Receptor status ER+ive / HER_iveER_ive / HER_iveHER+ive (+3 IHC or 2+ IHC with amplified FISH) 31 (52 %)15 (25 %)14 (23 %) Chemotherapy Anthracycline / taxane regimen (6 cycles) Anthracycline / taxane sequential regimen (8 cycles) Taxane-trastuzumab (4-8 cycles) 9 (15 %)45 (75 %)6 (10 %) surgery Breast-conserving surgery + axillary nodal dissection Mastectomy + axillary nodal dissection 34 (57 %)24 (40 %)

[0226] For mRNA detection, collected tissues were immediately frozen and stored in liquid nitrogen until analysis. Pre-treatment core needle biopsies and post-treatment tissue residues were pulverized in liquid nitrogen. RNA was extracted using a commercial kit (Qiagen), RNA integrity was evaluated on an Agilent 2100 Bioanalyzer (Agilent Technologies, Palo Alto, CA, USA), and cDNA was synthesized from 1 mg of whole RNA using an Invitrogen kit (Invitrogen Corp.) and analyzed on an Affymetrix HG-U133A microarray (Affymetrix Inc., Santa Clara, CA, USA) as described elsewhere (Ihnen et al., Breast Cancer Res Treat. 2008, Volume 112, Issue 3, pp 419-427).

[0227] For validation purposes, total RNA isolated from the same fresh tissue biopsies was subjected to RT-qPCR as previously described to validate array data via an independent technical approach. A gene-specific TaqMan-based primer / probe set was used to evaluate HLA-J expression. For detailed analysis of gene expression by the RT-qPCR method, primers adjacent to the region of interest and fluorescently labeled probes that hybridize between them were used. To standardize the amount of sample RNA, CALM2, RPL37A, and / or GAPDH were selected as reference genes because they were not differentially regulated in the analyzed samples. Paired samples with low RNA content (i.e., raw CT values ​​for CALM2 < 22) for pre-treatment biopsies or post-treatment residues were excluded. Paired pre- and post-treatment samples with sufficient RNA quality were provided from a total of 19 patients. Importantly, in addition to HLA-J RT-qPCR analysis, additional RT-qPCR measurements were completed for subtype-specific markers such as ESR1, MLPH, ERBB2, and KRT5, as well as for the invasion markers MMP1 and MMP7 to assess tumor aggressiveness (Table 2). ESR1 status definition and subtype determination were performed similarly to those previously described (Pentheroudakis et al., Breast Cancer Res Treat. 2008 Jul 31; Koutoula et al., Virchows Arch. 2013 Feb; 462(2):141-54, Noske et al., Breast Cancer Res Treat. 2011 Feb; 126(1): 109-17, Wirtz et al., Breast Cancer Res Treat. 2016 Jun;157(3):437-46.).

[0228] Primers and probes used to determine subtypes and invasive characteristics GenSymbol Probe sequence Forward_sequence Reverse_sequence RPL37A TGGCTGGCGGTGCCTGGA TGTGGTTCCTGCATGAAGACA GTGACAGCGGAAGTGGTATTGTAC GAPDH AAGGTGAAGGTCGGAGTCAACGGATTTG GCCAGCCGAGCCACATC CCAGGCGCCCAATAG ESR1 ATGCCCTTTTGCCGATGCA GCCAAATTGTGTTTGATGGATTAA GACAAAACCGAGTCACATCAGTAATAG ESR1 CTGGAGATGCTGGACGCCC CGTGGTGCCCCTCTATGAC GGCTAGTGGGCGCATGTAG MLPH CCAAATGCAGACCCTTCAAGTGAGGC TCGAGTGGCTGGGAAACTTG AGATAGGGCACAGCCATTGC MLPH CGGGCGTCTTCTGAGAGTCAGATCTTTG CGATGTGGACACCTCTGATGA AGGCATTCCACAGCTGAAATATG ERBB2 AGGCCAAGTCCGCAGAAGCCCT TCTGGACGTGCCAGTGTGAA CCTGCTCCCTGAGGACACAT ERBB2 TGATCATGGTCAAATGTTGGATGATTGACTC CCATCTGCACCATTGATGTCTAC CGGAATCTTGGCCGACATT MMP1 AGAGAGTACAACTTACATCGTGTTGCGGCTCA AGATGAAAGGTGGACCAACAATTT CCAAGAGAATGGCCGAGTTC MMP1 ACAGAGATGAAGTCGGTTTTTCAAAGGGA TTGAAGCTGCTTACGAATTTGC GTCCCTGAACAGCCCAGTACTTA MMP7 CAGTCTAGGGATTAACTTCCTGTATGCT GAACGCTGGACGGATGGTA GAATGGCCAAGTTCATGAGTTG MMP7 AGTGGGAACAGGCTCAGGACTATCTCAAGAG CGGGAGGCATGAGTGAGCTA GGCATTTTTTGTTTCTGAGTCATAGA KRT5 TGGAGGGCGAGGAATGCAGACTCA CGCCACTTACCGCAAGCT ACAGAGATGTTGACTGGTCCAACTC

[0229] The probes in Table 3 correspond to SEQ ID NO: 56 to 68, the forward primers correspond to SEQ ID NO: 69 to 81, and the reverse primers correspond to SEQ ID NO: 82 to 94. For example, the probes and primers for RPL37A are SEQ ID NO: 56, 69, and 82, and the probes and primers for GAPDH are SEQ ID NO: 57, 70, and 83. A TaqMan® validation experiment was performed to demonstrate that the efficiency of target and control amplification is nearly identical, which is a prerequisite for the relative quantification of gene expression by the comparative △CT method. To perform expression analysis of the gene of interest within a biological sample, a 4x double assay-mixture was prepared by mixing each primer / probe of two specific assays. For the individual detection of CT values, the assay probes were modified with different fluorescent probes. Each 4x assay mixture contained 2 μM of unmodified forward and reverse primers and 1.2 μM of probe. For each reaction, 2.5 μL of total RNA extracted from frozen tissue and formalin-fixed paraffin-embedded (FFPE) sections (see above) was mixed with 2.5 μL of assay mixture, 2.5 μL of enzyme mixture, and 2.5 μL of water in one well of a 96-well optical reaction plate. PCR reactions were measured using a Versant qPCR Cycler (Siemens) or Light Cycler 480 (Roche) under appropriate conditions (5 min 50 °C, 1 cycle; 20 sec 95 °C, 1 cycle; 15 sec 95 °C; 1 min 60 °C, 40 cycles) according to the manufacturer's instructions.

[0230] As illustrated in Fig. 6, similar to the results for ovarian cancer (see Fig. 3), all breast cancer samples expressed HLA-J. Again, the dynamic range of HLA-J mRNA expression was extensive, including 7 DCT values, which corresponds to a maximum of 2% of HLA-J expression in breast cancer.7 This implies upregulation (i.e., 128-fold). Importantly, this upregulation occurred frequently after neoadjuvant chemotherapy in advanced breast cancer (comparison of HLA-J mRNA levels after neoadjuvant chemotherapy—light bar and HLA-J mRNA levels—dark bar). Substantial HLA-J upregulation after chemotherapy was observed in 10 out of 19 (~50%) matched sample pairs, whereas downregulation was observed only in patients #25 and #29.

[0231] ESR1 mRNA status was determined by a predefined cutoff setting and correlated well with semi-quantitative IHC determinations in this cohort. As expected, ESR1 mRNA status was inversely associated with MMP7 (Spearman Rho 0.3656; p=0.0498), a triple-negative breast cancer (TNBC) marker and matrix metalloprotease involved in the WNT-dependent invasion process. Furthermore, ESR1 mRNA was not associated with ERBB2 mRNA overexpression, which is expected because half of ERBB2-positive tumors overexpress ESR1 while the other half do not. This demonstrates the validity and representativeness of the analyzed breast cancer cohort.

[0232] Non-parametric Spearman correlation analysis results showed that HLA-J expression in core needle biopsy samples prior to neoadjuvant chemotherapy was significantly associated with the overexpression of ESR1 mRNA status (Spearman Rho 0.5679; p=0.0090) and showed an important trend in the quantitative determination of ES1 mRNA (Spearman Rho 0.4436; p=0.0501).

[0233] Importantly, pre-treatment HLA-J mRNA expression was also strongly correlated with KRT5 mRNA (Spearman Rho 0.6121; p=0.0041). KRT5 is thought to be associated with the baseline-like characteristics of breast cancer arising from TNBC, ERBB2, and Luminal B tumors. This indicates that advanced Luminal tumors with baseline-like characteristics have predominant HLA-J expression in the absence of chemotherapy experience (naive), which refers to de novo HLA-J expression involved in the control of infiltrating lymphocytes.

[0234] Next, we investigated the correlation between HLA-J mRNA expression in tumor tissues after neoadjuvant chemotherapy and pre-treatment biomarkers used for molecular subtypes according to the histopathological response of the remaining tumor tissues.

[0235] Surprisingly, a complete alteration of the pre-treatment association of subtype-specific marker gene expression with respect to HLA-J mRNA expression levels was observed after treatment. For example, in chemotherapy-naive tissues, the strong and significant association between HLA-J mRNA expression and pre-treatment ESR1 mRNA status (Spearman Rho 0.5679; p=0.0090) not only disappeared but also reached almost opposite significance (Spearman Rho -0.4163; p=0.0679). Similarly, the strong association between pre-treatment HLA-J mRNA expression and KRT5 mRNA expression (Spearman Rho 0.6121; p=0.0041) was reversed upon chemotherapy in breast cancer tissues in vivo, but did not reach a significant level in relatively small patients (Spearman Rho -0.3392; p=0.01434). These findings demonstrate that while chemotherapy dramatically upregulates HLA-J mRNA expression in non-luminal and triple-negative breast cancers, HLA-J mRNA expression remains relatively unaffected and does not increase in luminal tumors. This is highly significant as it reveals subtype-specific de novo expression in luminal and triple-negative tumors, as well as a lack of upregulation in luminal tumors, which are known for reduced tumor cell invasion (Schmidt et al., Cancer Res. 2008 Jul 1; 68(13): 5405-13). Unlike previous studies that focused solely on pre-treatment samples, the unique approach taken here explains the dynamics of tumor-driven immune cell regulation during treatment. Importantly, de-regulation of tumor tissue becomes particularly evident in tumor subtypes that lack such motivation in a de novo untreated setting.

[0236] Next, pre-treatment levels of HLA-J expression correlated with the response to chemotherapy according to the "Tumor Regression Grade" (TRG) of Ogston et al. (Breast. 2003 Oct; 12(5):320-7). This TRG system quantifies the degree of tumor size reduction upon treatment by tumor regression grade as follows:

[0237] TRG 1: Slight changes to individual malignant cells, but no decrease in total cellularity.

[0238] TRG 2: Slight loss of tumor cells but total cellularity remains high; < 30% loss.

[0239] TRG 3: 30% to 90% reduction in tumor cells.

[0240] TRG 4: >90% loss of tumor cells.

[0241] As shown in Figure 9, breast tumors showing no signs of reduction according to the Miller-Payne classification (i.e., TRG1 and TRG2; highlighted in dark gray) simultaneously exhibited the highest HLA-J mRNA expression. Additionally, these tumors had higher levels of ESR1 mRNA and lower levels of ERBB2 mRNA. This demonstrates that luminal tumors that respond poorly to neoadjuvant chemotherapy possess luminal characteristics and the highest pre-treatment HLA-J mRNA levels. Therefore, it was concluded that pre-treatment HLA-J mRNA levels can predict the response to chemotherapy.

[0242] To compare the associations between mRNA expression of specific biomarkers and / or target genes and the evaluation of chemotherapy response, Spearman correlations were performed using each continuous variable. To date, ESR1 mRNA and ERBB2 are known as the best response markers for predicting the response of breast tumors to neoadjuvant chemotherapy in breast cancer, as they have been retrospectively and prospectively validated in several large-scale neoadjuvant trials (Denkert et al., Annals of Oncology 2012). The Spearman correlations in this sample set indicate that high ESR1 mRNA levels are associated with low tumor regression grade and are inversely proportional to tumor regression grade. This is consistent with previous reports, although it did not reach statistical significance in this small sample set (Spearman Rho -0.2272; p=0.3495). As expected, ERBB2 mRNA expression is positively correlated with tumor regression grade, and high ERBB2 mRNA levels are associated with high tumor regression grade. This did not reach statistical significance in this small sample set but is consistent with previous reports (Spearman Rho 0.2751; p=0.2543). In contrast, HLA-J mRNA expression is inversely proportional to the tumor regression grade with high significance (Spearman Rho -0.6094; p=0.0056). This suggests that pre-treatment HLA-J mRNA levels are superior to existing breast cancer markers for predicting response to neoadjuvant chemotherapy, and that high levels of HLA-J in pre-treatment core needle biopsies indicate non-responsiveness to chemotherapy.

[0243] Next, we analyzed whether the post-chemotherapy mRNA levels of HLA-J mRNA in residual tumor tissue were related to the response to neoadjuvant chemotherapy.

[0244] Interestingly, it was found that the mRNA levels of breast tumors with no or minimal response to neoadjuvant chemotherapy had similar levels of ESR1 and HLA-J mRNA expression (compare with Figure 9). In contrast, tumors attacked by chemotherapy regimens (light gray) showed a significant increase in HLA-J expression. For reference, 50% of the tumors had HLA-J mRNA levels higher than their highest values ​​prior to treatment. At the same time, the frequency of tumors with low levels of HLA-J decreased dramatically.

[0245] It is important to note that tumor regression grades 3 and 4 are associated with a significant, though not a complete, reduction in tumor burden at the primary site. However, since only a complete response is associated with superior progression-free survival and overall survival, tumors showing only a partial or incomplete response to chemotherapy do not have better survival rates.

[0246] Interestingly, when looking at mRNA levels of biomarkers and / or target gene expression after treatment, tumors with a subtotal response to chemotherapy were more abundant in residing basal-like tumor cells, which simultaneously exhibited significant upregulation of HLA-J mRNA. Increased post-treatment mRNA expression of KRT5 and HLA-J was associated with high TRG status (Spearman Rho 0.5239; p=0.0256 and Spearman Rho 0.5821; p=0.0089, respectively).

[0247] This finding was further investigated by scatter plot analysis of HLA-J mRNA expression based on TRG status. As shown in Figure 13, when comparing TRG2 tumors to TRG3 and TRG4 tumors before neoadjuvant chemotherapy, there is a stepwise decrease in the median HLA-J mRNA expression in core needle biopsies. In contrast, after chemotherapy, the median HLA-J mRNA expression increases stepwise in residual primary disease after neoadjuvant chemotherapy.

[0248] In conclusion, upon chemotherapy treatment in non-luminal tumors with increased immune infiltration, HLA-J mRNA expression increases 4 to 32-fold (as described by Schmidt et al., Clin Cancer Res 2008), and this is also linearly correlated with the degree of response. This can be considered as a reaction of the tumor tissue to the overwhelming immune response triggered by the substantial destruction of tumor cells and the infiltration of dendritic cells or macrophages into tumor antigens.

[0249] The most predictable value of the change in HLA-J mRNA expression during chemotherapy can be expressed by subtracting the pre-treatment level from the post-treatment HLA-J mRNA level for individual tumor pairs (see Fig. 14).

[0250] Finally, we investigated the association between changes in HLA-J mRNA expression and progression-free survival in breast cancer patients. Kaplan-Meier analysis showed that an increase in HLA-J mRNA expression exceeding a DDCT value of 3.5 was associated with worse progression-free survival (p=0.0096).

[0251] In summary, these results demonstrate that pre-treatment HLA-J mRNA expression predicts treatment outcomes and the efficacy of chemotherapy in breast cancer. Furthermore, similar to the situation in ovarian cancer (see Example 1), there are dynamic differences in HLA-J expression during chemotherapy treatment that demonstrate a reaction by tumor tissue to prevent elimination by increased immune infiltration resulting from the destruction of tumor cells induced by chemotherapy and the subsequent recognition of tumor lesions. Similar to the situation in ovarian cancer, the degree of this reaction is associated with a worse prognosis. Thus, a general mechanism by which tumors evade treatment induced by immune recognition and destruction has been identified. The determination of this mechanism was reduced to a simple and highly reproducible analysis system that can be easily applied in a routine clinical setting. Furthermore, tumor-specific differences in this general mechanism were demonstrated by showing differences between luminal tumors by determining ESR1, ERBB2, and / or KRT5 expression levels, which were identified as examples rather than limitations. Previously, as a reduced example for ESR1 mRNA determination, molecular subtypes were shown to have prognostic and predictive value in relation to therapeutic effects in all types of tumors, examples of said tumors including breast cancer (PCT / EP2014 / 067675; EP20140755642), ovarian cancer (WO2009068655A1; PCT / EP2008 / 066449), bladder cancer (WO 2016 / 131875 A1; PCT / EP 2016 / 053372), and lung cancer (US 9,683,229 B2; EP10721373.8). Thus, the present invention, described as an example not limited to breast cancer, is also related to luminal and non-luminal basal tumors arising at other primary tumor sites due to similar tumor vitality at the base. Therefore, inhibition of the evasion mechanism disclosed in this specification also plays an important auxiliary role in current therapies for various indications of cancer.

[0252] Example 4: Detection of HLA-J protein in cancer patient samples using HLA-J antibodies

[0253] Peptide sequence homology analysis of classical (HLA-A to C), non-classical (HLA-E to G), and pseudogenetic (HLA-J and H) was performed using Geneious software in Geneious Alignment. Common nucleotide sequences are highlighted in gray, specifically the analyzed sequences. Differences in peptide sequences relative to common nucleotide sequences are also highlighted in gray. The alpha 3 domain, linkage peptide, and transmembrane domain of HLA-J are highlighted in gray almost consecutively, demonstrating that these regions are unique to HLA-J compared to pseudogenetic HLA-H and classical and non-classical HLA peptide sequences. Due to this uniqueness, HLA-J antibodies were generated against the C-terminus of the unique alpha 3 and transmembrane domains of HLA-J (Fig. 16). The peptide sequence contains 22 amino acids traversing the N-terminus of the alpha 3 domain, the linkage peptide, and the membrane phototransferencing domain.

[0254] To confirm the presence of the predicted HLA-J protein, Western blot analysis was performed on ovarian cancer tissues from patients who did not respond to chemotherapy (n=4; patient IDs: 107, 114, 116, 128) (Fig. 17A). For each patient, HLA-J protein expression was evaluated before (pre) and after (post) chemotherapy. 15 µg of protein tissue lysate was separated under denaturation conditions on a 10% SDS-PAGE gel and transferred wet to a nitrocellulose membrane. After incubation with the specific anti-HLA-J antibody "JULY," followed by incubation with an anti-rabbit antibody conjugated with HPR, and subsequent application of TMB substrate, a purple precipitate was observed. Western blot analysis revealed the presence of an HLA-J protein with an observed size of approximately 55 kDa. Regarding sample 107 post, an additional band at approximately 100 kDa could be detected. The measured size of the HLA-J protein is approximately 26.7 kDa. These findings indicate that HLA-J exists in dimeric and tetrameric forms, primarily composed of cysteine ​​residues capable of forming disulfide bonds. Surprisingly, within patients 107, 116, and 128, changes in protein expression between pre- and post-chemotherapy tissues can be observed. Protein expression increases slightly from pre-treatment to post-treatment in patients #107 and #116. A strong increase in HLA-J protein expression can be observed in tumor tissues from pre-treatment to post-treatment with neoadjuvant chemotherapy in patient #128, as observed in mRNA expression analysis. These results suggest that HLA-J contributes to immune evasion, particularly after neoadjuvant chemotherapy, leading to insufficient responsiveness to chemotherapy regimens. To determine whether HLA-J proteins are present in other types of cancer and during the pre-implantation or late stages of pregnancy, protein lysates obtained from various cancer signs and human placental tissue were analyzed using a Western blot technique similar to that described above (Fig. 17).Importantly, HLA-J proteins can be detected in ovarian cancer ("OC"), breast cancer ("BC"), urinary tract / blacker cancer ("UC"), and placental tissue ("P1"). This demonstrates that HLA-J protein expression occurs in non-physiological conditions (e.g., cancer) and defined physiological situations (e.g., "pregnancy").

[0255] Example 5: Predictive Value of HLA-J Expression in Non-Gynecological Cancers

[0256] To evaluate whether HLA-J upregulation occurs during chemotherapy in non-gynecological cancers, tissue samples were collected from patients (both sexes) with advanced, muscle-invasive bladder cancer before ("TUR"; percutaneous biopsy) and after ("CYS"; cystectomy tissue) chemotherapy. Additionally, to demonstrate tumor-specific expression of HLA-J, non-tumor tissue was collected from cystectomy remnants ("mapping"; normal tissue samples from the same patients). The initial cohort consisted of matched tissue samples from 20 patients with histologically confirmed MIBC, UICC stages II and III (cT2-3 and cN0 or cN+M0). All patients received gemcitabine 1250 mg / m² 2 (d1; d8) Cisplatin 70 mg / m² 2Patients underwent radical cystectomy (RC) after receiving three neoadjuvant therapy cycles of (d1). Representative formalin-fixed paraffin-embedded (FFPE) blocks with at least 50% tumor content (minimum tumor size 5x5 mm) were selected for transurethral resection ("TUR") biopsy and cystectomy specimens ("CYS" specimens), and were selected for having well-defined invasion borders and being free of necrotic areas or granulomatous inflammation. For histopathologically confirmed normal tissue controls, tumor-free areas from the same cystectomy specimens were selected to prepare representative FFPE blocks ("mapping" specimens). RNA was extracted from FFPE using 10 μm sections treated with a commercially available bead-based extraction method (XTRACT kit; STRATIFYER Molecular Pathology GmbH, Cologne, Germany). RNA was eluted with 100 µL of elution buffer, and the RNA eluent was analyzed. RT-qPCR was used for the relative quantification of HLA-J mRNA as well as CALM2 (housekeeping gene) expression, using gene-specific TaqMan®-based assays as described above. Experiments were performed on a Roche Light Cycler LC480 (Roche, Germany) according to the following protocol: 5 min at 50°C, 20 sec at 95°C, 40 cycles of 15 sec at 95°C, and 60 sec at 60°C. Forty amplification cycles were applied, and the cycle quantification threshold (Ct) values ​​for three markers and one reference gene for each sample were estimated as the average of three measurements. The Ct values ​​were normalized by subtracting the Ct value of the housekeeping gene CALM2 from the Ct value of the target gene (ΔCt). HLA-J specific mRNA expression was determined by redundant measurements using single-step RT-qPCR from matched TUR biopsies, CYS samples, and mapping samples, as described above.Relative gene expression was determined using the 40-DCT method described above.

[0257] Importantly, none of the mapping samples exhibited HLA-J expression demonstrating tumor-specific expression of HLA-J. However, in 3 out of 20 patients, tumor-specific expression of HLA-J was detected in CYS samples after neoadjuvant chemotherapy, whereas expression was not detected in the matching TUR biopsy samples prior to chemotherapy treatment (Fig. 18). This indicates that tumor-specific HLA-J expression was induced by chemotherapy, contributing to the chemotherapy-resistant phenotype of these tumors. This demonstrates that increased HLA-J expression after neoadjuvant chemotherapy occurs not only in breast and ovarian cancers but also in non-gynecological cancers such as bladder cancer. Therefore, HLA-J expression can be considered a more common resistance mechanism present in numerous gynecological and non-gynecological tumors.

Claims

Claim 1 A composition for the diagnosis of a tumor, the grading of a tumor, the prediction of the prognosis of a tumor, the classification of a tumor as an HLA-J low-expression tumor or an HLA-J high-expression tumor, or the diagnosis of implantation failure in a sample obtained from a subject, comprising a nucleic acid molecule, a protein, or a peptide, wherein the nucleic acid molecule is a nucleic acid molecule encoding a polypeptide consisting of an amino acid sequence of SEQ ID NO: 1 or a nucleic acid molecule consisting of a nucleotide sequence of SEQ ID NO: 2 in which T is substituted with U; and the protein or peptide is (a) a nucleic acid molecule encoding a polypeptide consisting of an amino acid sequence of SEQ ID NO: 1; or (b) a nucleic acid molecule consisting of a nucleotide sequence of SEQ ID NO: 2; or (c) a nucleic acid molecule in which T in any one of (a) to (b) is substituted with U; a composition for diagnosing a tumor, evaluating the grade of a tumor, predicting the prognosis of a tumor, classifying a tumor as an HLA-J low-expression tumor or an HLA-J high-expression tumor, or diagnosing implantation failure in a sample obtained from a subject, wherein the tumor is selected from the group consisting of gynecological cancer, bladder cancer, and urinary tract cancer. Claim 2 A method for providing information for diagnosing a tumor, comprising detecting the presence of a nucleic acid molecule, a protein, or a peptide in a sample obtained from a subject, wherein the presence of the nucleic acid molecule, the protein, or the peptide indicates a tumor in the subject; wherein the nucleic acid molecule is a nucleic acid molecule encoding a polypeptide consisting of the amino acid sequence of SEQ ID NO: 1 or a nucleic acid molecule consisting of the nucleotide sequence of SEQ ID NO: 2 in which T is substituted with U; and wherein the protein or peptide is encoded by (a) a nucleic acid molecule encoding a polypeptide consisting of the amino acid sequence of SEQ ID NO: 1; or (b) a nucleic acid molecule consisting of the nucleotide sequence of SEQ ID NO: 2; or (c) a nucleic acid molecule in which T is substituted with U in any one of (a) to (b); and wherein the tumor is selected from the group consisting of gynecological cancer, bladder cancer, and urinary tract cancer. Claim 3 A method for providing information for evaluating the grade of a tumor or predicting the prognosis of a tumor, comprising determining the level of a nucleic acid molecule, protein, or peptide in a sample obtained from a subject, wherein the increased level of said nucleic acid molecule, protein, or peptide compared to a control group is associated with a higher grade tumor or an unfavorable tumor prognosis; said nucleic acid molecule is a nucleic acid molecule encoding a polypeptide consisting of the amino acid sequence of SEQ ID NO: 1 or a nucleic acid molecule consisting of the nucleotide sequence of SEQ ID NO: 2 in which T is substituted with U; and said protein or peptide is (a) a nucleic acid molecule encoding a polypeptide consisting of the amino acid sequence of SEQ ID NO: 1; or (b) a nucleic acid molecule consisting of the nucleotide sequence of SEQ ID NO: 2; or (c) a nucleic acid molecule in which T in any one of (a) to (b) is substituted with U; a method for providing information for grade assessment of a tumor or prediction of tumor prognosis, wherein the tumor is selected from the group consisting of gynecological cancer, bladder cancer and urinary tract cancer. Claim 4 A kit for the diagnosis of a tumor, the grading of a tumor, or the prediction of a tumor prognosis, comprising: a means for detecting or quantifying a nucleic acid molecule, a protein, or a peptide in a sample obtained from a subject; and instructions for using the kit, wherein the nucleic acid molecule is a nucleic acid molecule encoding a polypeptide consisting of an amino acid sequence of SEQ ID NO: 1 or a nucleic acid molecule consisting of a nucleotide sequence of SEQ ID NO: 2 in which T is substituted with U; and the protein or peptide is encoded by (a) a nucleic acid molecule encoding a polypeptide consisting of an amino acid sequence of SEQ ID NO: 1; or (b) a nucleic acid molecule consisting of a nucleotide sequence of SEQ ID NO: 2; or (c) a nucleic acid molecule in which T is substituted with U in any one of (a) to (b); and wherein the tumor is selected from the group consisting of gynecological cancer, bladder cancer, and urinary tract cancer. Claim 5 A method for providing information for monitoring the non-efficacy of tumor treatment in a subject having a tumor, comprising: (i) determining the amount of a nucleic acid molecule, protein, or peptide in a sample obtained from the subject before starting treatment; and (ii) determining the amount of a nucleic acid molecule, protein, or peptide in a sample obtained from the subject one or more times after starting treatment, wherein an increased amount in (ii) compared to (i) indicates non-efficacy of tumor treatment or a decreased amount in (ii) compared to (i) indicates efficacy of tumor treatment; said nucleic acid molecule is a nucleic acid molecule encoding a polypeptide consisting of the amino acid sequence of SEQ ID NO: 1 or a nucleic acid molecule consisting of the nucleotide sequence of SEQ ID NO: 2 in which T is substituted with U; and said protein or peptide is (a) a nucleic acid molecule encoding a polypeptide consisting of the amino acid sequence of SEQ ID NO: 1; or (b) a nucleic acid molecule consisting of the nucleotide sequence of SEQ ID NO: 2; or (c) a nucleic acid molecule in which T in any one of (a) to (b) is substituted with U; a method for providing information for monitoring the non-efficacy of tumor treatment in a subject having a tumor, wherein the tumor is selected from the group consisting of gynecological cancer, bladder cancer and urinary tract cancer. Claim 6 A method for providing information for monitoring the non-efficacy of immunosuppressive therapy in a subject requiring treatment, comprising: (i) determining the amount of a nucleic acid molecule, protein, or peptide in a sample obtained from the subject before starting treatment; and (ii) determining the amount of a nucleic acid molecule, protein, or peptide in a sample obtained from the subject one or more times after starting treatment, wherein a reduced amount in ii) compared to i) indicates non-efficacy of immunosuppressive therapy or an increased amount in ii) compared to i) indicates efficacy of immunosuppressive therapy; said nucleic acid molecule is a nucleic acid molecule encoding a polypeptide consisting of an amino acid sequence of SEQ ID NO: 1 or a nucleic acid molecule consisting of a nucleotide sequence of SEQ ID NO: 2 in which T is substituted with U; and said protein or peptide is (a) a nucleic acid molecule encoding a polypeptide consisting of an amino acid sequence of SEQ ID NO: 1; or (b) a nucleic acid molecule consisting of a nucleotide sequence of SEQ ID NO: 2; or (c) a nucleic acid molecule in which T in any one of (a) to (b) is substituted with U; coded by a nucleic acid molecule, wherein the subject is a tumor patient selected from the group consisting of gynecological cancer, bladder cancer and urinary tract cancer, a method for providing information for monitoring the non-efficacy of immunosuppressive therapy in a subject requiring treatment. Claim 7 A method for providing information, wherein, in any one of paragraphs 2, 3, 5, or 6, the sample is a sample of body fluid or organ tissue. Claim 8 delete Claim 9 delete Claim 10 delete Claim 11 delete Claim 12 delete Claim 13 delete Claim 14 delete Claim 15 delete Claim 16 delete Claim 17 delete

Images