HLA-H in Medicine and Diagnosis

Abstract

The present invention relates to a nucleic acid molecule, vector, host cell, or protein or peptide, or a combination thereof, for use as an immunosuppressant, tumor vaccine, or pregnancy promoter, wherein (I) the nucleic acid molecule encodes a polypeptide comprising or composed of the amino acid sequence of SEQ ID NO: 1 or 54; or (b) is composed of the nucleotide sequence of SEQ ID NO: 2; or (c) is encoded by a polypeptide that is at least 95% identical to the amino acid sequence of SEQ ID NO: 1 or 54; or (d) is composed of a nucleotide sequence that is 95% identical to the nucleotide sequence of SEQ ID NO: 2; or (e) is composed of a degenerate nucleotide sequence for the nucleic acid molecule of (d); or (f) a fragment of any one of (a) to (e) of a nucleic acid molecule, said fragment comprising at least 250 nucleotides, preferably at least 300 nucleotides, more preferably at least 450 nucleotides, and most preferably at least 600 nucleotides; or (g) corresponding to any one of (a) to (f) of a nucleic acid molecule, wherein T is replaced by U; (II) a vector comprising the nucleic acid molecule of (I); (III) a host cell is transformed, transduced, or transfected with the vector of (II); and (IV) a protein or peptide encoded by the nucleic acid molecule of (I).

Description

Technology Field

[0001] The present invention relates to a nucleic acid molecule, vector, host cell, or protein or peptide, or a combination thereof, for use as an immunosuppressant, tumor vaccine, or pregnancy promoter, wherein (I) the nucleic acid molecule encodes a polypeptide comprising or composed of the amino acid sequence of SEQ ID NO: 1 or 54; or (b) is composed of the nucleotide sequence of SEQ ID NO: 2; or (c) is encoded by a polypeptide that is at least 95% identical to the amino acid sequence of SEQ ID NO: 1 or 54; or (d) is composed of a nucleotide sequence that is 95% identical to the nucleotide sequence of SEQ ID NO: 2; or (e) is composed of a degenerate nucleotide sequence for the nucleic acid molecule of (d); or (f) a fragment of any one of (a) to (e) of a nucleic acid molecule, said fragment comprising at least 250 nucleotides, preferably at least 300 nucleotides, more preferably at least 450 nucleotides, and most preferably at least 600 nucleotides; or (g) corresponding to any one of (a) to (f) of a nucleic acid molecule, wherein T is replaced by U; (II) a vector comprising the nucleic acid molecule of (I); (III) a host cell is transformed, transduced, or transfected with the vector of (II); and (IV) a protein or peptide encoded by the nucleic acid molecule of (I).

[0002] This specification incorporates numerous documents, including patent applications and manufacturers' manuals. While the disclosure of these documents is not deemed relevant to the patentability of the present invention, the entirety thereof is incorporated herein by reference. More specifically, all referenced documents are incorporated by reference to the same degree as if each individual document were specifically and individually indicated for inclusion by reference. Background Technology

[0003] The human leukocyte antigen (HLA) system or complex is a gene complex that encodes human major histocompatibility complex (MHC) proteins. These cell-surface proteins play a role in regulating the human immune system. The HLA gene complex is located in the 3 Mbp stretch within chromosome 6p21. The genes in this complex are classified into three basic groups: Class I, Class II, and Class III.

[0004] Humans possess three major MHC class I genes known as HLA-A, HLA-B, and HLA-C. Proteins produced from these genes are present on the surface of almost all cells. On the cell surface, these proteins bind to protein fragments (peptides) released from within the cell. MHC class I proteins mark these peptides for the immune system. When the immune system recognizes a peptide as a foreign substance (e.g., a viral or bacterial peptide), it triggers a response that causes the infected cell to self-destruct.

[0005] Humans have six major MHC class II genes: HLA-DPA1, HLA-DPB1, HLA-DQA1, HLA-DQB1, HLA-DRA, and HLA-DRB1. MHC class II genes provide instructions for creating proteins that are present almost exclusively on the surface of specific immune system cells. Like MHC class I proteins, these proteins display peptides to the immune system.

[0006] Proteins produced by MHC class III genes have somewhat different functions. They are involved in inflammation and other immune system activities. The functions of some MHC genes are unknown.

[0007] HLA genes have as many possible variations as they enable each individual's immune system to respond to a wide range of external invaders. Some HLA genes have hundreds of identified versions (alleles), and each version is assigned a specific number (e.g., HLA-B27). Closely related alleles are classified together. For example, at least 40 very similar alleles are subtypes of HLA-B27. These subtypes are designated from HLA-B*2701 to HLA-B*2743.

[0008] More than 100 diseases are associated with different alleles of the HLA gene. For example, the HLA-B27 allele increases the risk of developing an inflammatory joint disease called ankylosing spondylitis. Many other disorders associated with abnormal immune function and some forms of cancer are also linked to specific HLA alleles. However, it is often unclear what role HLA genes play in the risk of developing these diseases.

[0009] Alongside the three major MHC class I genes, the non-classical MHC class I molecules HLA-E, HLA-F, and HLA-G are encoded by the HLA class I region. Overexpression of HLA-G, -E, and -F is commonly found across various malignancies (Kochan et al., Oncoimmunology. 2013 Nov 1; 2(11): e26491.). HLA-G and HLA-E have been reported as cancer biomarkers and have also been reported to be positively correlated with poor clinical outcomes of cancer.

[0010] HLA class I regions have also been reported to include class I pseudogenes (Hughes, Mol Biol Evol. 1995 Mar; 12(2):247-58) and gene fragments. For example, HLA-H, J, K, and L are classified as class I pseudogenes, and HLA-N, S, and X are classified as gene fragments.

[0011] Therefore, human leukocyte antigen (HLA) genes have a long history of research as important targets in the fields of biomedical science and therapy. However, given the clinical importance of the HLA system, there is a need to focus research on HLA genes, particularly on identifying additional targets for biomedical science and therapy based on the HLA system. This need is addressed by the present invention. Surprisingly, in relation to the present invention, it has been discovered that HLA-H is a target for treating and detecting diseases, particularly by activating or inhibiting the activity of HLA-H. means of solving the problem

[0012] Accordingly, a first aspect of the present invention relates to a nucleic acid molecule, vector, host cell, or protein or peptide, or a combination thereof, for use as an immunosuppressant, tumor vaccine, or pregnancy promoter, wherein (I) the nucleic acid molecule encodes a polypeptide comprising or composed of the amino acid sequence of SEQ ID NO: 1 or 54; or (b) is composed of the nucleotide sequence of SEQ ID NO: 2; or (c) is encoded by a polypeptide that is at least 95% identical to the amino acid sequence of SEQ ID NO: 1 or 54; or (d) is composed of a nucleotide sequence that is 95% identical to the nucleotide sequence of SEQ ID NO: 2; or (e) is composed of a degenerate nucleotide sequence for the nucleic acid molecule of (d); or (f) a fragment of any one of (a) to (e) of a nucleic acid molecule, said fragment comprising at least 250 nucleotides, preferably at least 300 nucleotides, more preferably at least 450 nucleotides, and most preferably at least 600 nucleotides; or (g) corresponding to any one of (a) to (f) of a nucleic acid molecule, wherein T is replaced by U; (II) a vector comprising the nucleic acid molecule of (I); (III) a host cell is transformed, transduced, or transfected with the vector of (II); and (IV) a protein or peptide encoded by the nucleic acid molecule of (I).

[0013] A first aspect of the present invention relates to a nucleic acid molecule, vector, host cell, or protein or peptide, or a combination thereof, for use as an immunosuppressant, tumor vaccine, or pregnancy promoter, wherein (I) the nucleic acid molecule encodes a polypeptide comprising or composed of the amino acid sequence of SEQ ID NO: 1 or 54; or (b) is composed of the nucleotide sequence of SEQ ID NO: 2; or (c) encodes a polypeptide that is at least 70%, preferably at least 80%, more preferably at least 90%, and most preferably at least 95% identical to the amino acid sequence of SEQ ID NO: 1 or 54; or (d) is composed of a nucleotide sequence that is at least 70%, preferably at least 80%, more preferably at least 90%, and most preferably 95% identical to the nucleotide sequence of SEQ ID NO: 2; or (e) is composed of a degenerate nucleotide sequence for the nucleic acid molecule of (d); or (f) a fragment of any one of (a) to (e) of a nucleic acid molecule, said fragment comprising at least 250 nucleotides, preferably at least 300 nucleotides, more preferably at least 450 nucleotides, and most preferably at least 600 nucleotides; or (g) corresponding to any one of (a) to (f) of a nucleic acid molecule, wherein T is replaced by U; (II) a vector comprising the nucleic acid molecule of (I); (III) a host cell is transformed, transduced, or transfected with the vector of (II); and (IV) a protein or peptide encoded by the nucleic acid molecule of (I).

[0014] The term “nucleic acid molecule” according to the present invention includes DNA and RNA, such as cDNA or double or single-stranded genomic DNA. In this regard, “DNA (deoxyribonucleic acid)” means any chain or sequence of chemical building blocks called nucleotide bases, adenine (A), guanine (G), cytosine (C), and thymine (T), linked together on a deoxyribose sugar backbone. DNA may have a single strand of nucleotide bases or two complementary strands capable of forming a double helix structure. “RNA (ribonucleic acid)” means any chain or sequence of chemical building blocks called nucleotide bases, adenine (A), guanine (G), cytosine (C), and uracil (U), linked together on a ribose sugar backbone. RNA may typically have a single strand of nucleotide bases, such as mRNA. Also included are single- and double-stranded hybrid molecules, namely DNA-DNA, DNA-RNA, and RNA-RNA. Nucleic acid molecules may also be modified by various means known in the art. Non-limiting examples of such modifications include methylation, "caps," substitution with one or more naturally occurring nucleotide analogs, and internucleotide modifications such as those having uncharged bonds (e.g., methylphosphonate, phosphotriester, phosphoromidate, carbamate, etc.) and charged bonds (e.g., phosphorothioate, phosphorodithioate, etc.). Nucleic acid molecules referred to as polynucleotides below may include one or more additional covalently bonded moieties, e.g., proteins (e.g., nucleases, toxins, antibodies, signal peptides, poly-L-lysine, etc.), intercalators (e.g., acridine, psoralen, etc.), chelators (e.g., metals, radioactive metals, iron, metal oxides, etc.), and alkylators. Polynucleotides can be derivatized by the formation of methyl or ethyl phosphotriester or alkyl phosphoamidate bonds.Additionally, nucleic acid mimic molecules known in the art, such as synthetic or semi-synthetic derivatives of DNA or RNA and mixed polymers, are included. Such nucleic acid mimic molecules or nucleic acid derivatives according to the present invention include phosphothioate nucleic acid, phosphoamidate nucleic acid, 2'-O-methoxyethyl ribonucleic acid, morpholinonexic acid, HNA (hexitol nucleic acid), PNA (peptide nucleic acid), and LNA (locked nucleic acid) (see Braasch and Corey, Chem Biol 2001, 8: 1). LNA is an RNA derivative in which a ribose ring is bound by a methylene bond between the 2'-oxygen and 4'-carbon. Nucleic acids containing modified bases, for example, thiouracil, thioguanine, and fluorouracil, are also included. Nucleic acid molecules generally carry genetic information, including information that cellular machinery uses to make proteins and / or polypeptides. The nucleic acid molecule according to the present invention may further include a promoter, an enhancer, a reaction element, a signal sequence, a polyadenylation sequence, an intron, 5'- and 3'- non-coding regions, etc.

[0015] The nucleic acid molecule according to the present invention encodes a polypeptide or a fragment thereof derived from the HLA-H protein of SEQ ID NO: 1 or 54, and the protein is encoded by SEQ ID NO: 2. Thus, the nucleic acid molecule according to the present invention is genomic DNA or mRNA. In the case of mRNA, the nucleic acid molecule may additionally include a poly-A tail.

[0016] The term “protein,” used interchangeably with the term “polypeptide” herein, describes a linear molecular chain of amino acids containing a single-chain protein or fragments thereof containing at least 50 amino acids. The term “peptide” as used herein describes a group of molecules composed of up to 49 amino acids, whereas the term “polypeptide” (also referred to as “protein”) as used herein describes a group of molecules composed of at least 50 amino acids. The term “peptide” as used herein describes a group of molecules composed of at least 15 amino acids, at least 20 amino acids, at least 25 amino acids, and an increased affinity of at least 40 amino acids. Groups of peptides and polypeptides are referred to together using the term “(poly)peptide.” (Poly)peptides may further form oligomers composed of at least two identical or different molecules. The corresponding higher-order structures of these polymers are correspondingly referred to as homo- or heteromers, homo- or heterotrimers, etc. The HLA-H protein of SEQ ID NO: 1 contains cysteine ​​at positions 93, 127, 229, and 285 and thus contains potential dimerization sites. Similarly, the HLA-H protein of SEQ ID NO: 54 contains cysteine ​​at positions 89, 124, 225, and 281 and thus contains potential dimerization sites. Furthermore, peptide mimics of these proteins / (poly)peptides in which amino acid(s) and / or peptide bond(s) are replaced by functional analogs are also included in the invention. These functional analogs include all known amino acids other than the 20 amino acids encoded by genes, such as selenocysteine. The terms “(poly)peptide” and “protein” also refer to naturally modified (poly)peptides and proteins, which are carried out, for example, by glycosylation, acetylation, phosphorylation, and similar modifications well known in the art.

[0017] According to the present invention, the term “percentage (%) sequence identity” describes comparing the number of identical nucleotide / amino acid matches (“hits”) of two or more aligned nucleic acid or amino acid sequences with the number of nucleotide or amino acid residues constituting the total length of the template nucleic acid or amino acid sequence. In other words, using alignment, the percentage of identical amino acid residues or nucleotides for two or more sequences or subsequences (e.g., 70%, 75%, 80%, 85%, 90%, or 95% identity) is determined when (sub)sequences are compared and aligned against maximum correspondence through a comparison window or a designated region measured using a sequence comparison algorithm known in the art, or when they are manually aligned and visually inspected. This definition also applies to the complement of any sequence to be aligned.

[0018] Nucleotide and amino acid sequence analysis and alignment related to the present invention are preferably performed using the NCBI BLAST algorithm (Stephen F. Altschul, Thomas L. Madden, Alejandro A. Schffer, Jinghui Zhang, Zheng Zhang, Webb Miller and David J. Lipman (1997), Nucleic Acids Res. 25:3389-3402). BLAST can be used for nucleotide sequences (nucleotide BLAST) and amino acid sequences (protein BLAST). Those skilled in the art know additional suitable programs for aligning nucleic acid sequences.

[0019] As defined herein, at least 70%, preferably at least 80%, more preferably at least 90%, and most preferably at least 95% sequence identity is expected by the present invention. However, increasing preference sequence identity of at least 97.5%, at least 98.5%, at least 99%, at least 99.5%, and at least 99.8% is also expected by the present invention.

[0020] MHC class I molecules generally consist of two chains: the MHC alpha chain (heavy chain) and the beta2-microglobulin chain (light chain). Only the alpha chain spans the membrane. The alpha chain contains three extracellular domains (designated as alpha 1, 2, and 3, with alpha 1 located at the N-terminus). The alpha chain domains alpha 1 and alpha 3 of HLA-H are believed to primarily determine the immunosuppressive capacity of HLA-H, with domain alpha 3 being the most important. It is noted that HLA-H contains a truncated alpha 3 domain of only 13 amino acids, whereas the alpha 3 domains of other HLA classes have approximately 93 amino acids. The nucleotide sequences at SEQ ID NO: 3 and 4 encode the domains alpha 1 and alpha 3 of HLA-H, respectively. The amino acid sequences at SEQ ID NO: 5 and 6 are the amino acid sequences of the domains alpha 1 and alpha 3 of HLA-H, respectively.

[0021] Accordingly, a nucleotide sequence having at least 70% identity with the nucleotide sequence of SEQ ID NO: 2 or any one of a preferred higher identity is preferably a nucleotide sequence having increased preference that is at least 97.5%, at least 98.5%, at least 99%, at least 99.5%, at least 99.8%, and 100% identical to SEQ ID NO: 4. A nucleotide sequence having at least 70% identity with the nucleotide sequence of SEQ ID NO: 2 or any one of a preferred higher identity is also preferably encoding an amino acid sequence having increased preference that is at least 97.5%, at least 98.5%, at least 99%, at least 99.5%, at least 99.8%, and 100% identical to SEQ ID NO: 6. A nucleotide sequence having at least 70% identity with the nucleotide sequence of SEQ ID NO: 2 or any one of a preferred higher identity comprises a nucleotide sequence having increased preference that is at least 97.5%, at least 98.5%, at least 99%, at least 99.5%, at least 99.8%, and 100% identical with SEQ ID NO: 4 and / or comprises a nucleotide sequence having increased preference that is at least 97.5%, at least 98.5%, at least 99%, at least 99.5%, at least 99.8%, and 100% identical with SEQ ID NO: 3. A nucleotide sequence having at least 70% identity with the nucleotide sequence of SEQ ID NO: 2 or any one of a preferred higher identity is encoding an amino acid sequence having increased preference that is at least 97.5%, at least 98.5%, at least 99%, at least 99.5%, at least 99.8%, and 100% identical with SEQ ID NO: 6 and / or at least 97.5%, at least 98.5%, at least 99%, at least 99.5%, and at least 99.It is also more desirable to encode amino acid sequences having the same increased preference of 8% and 100%.

[0022] A nucleotide sequence having at least 70% identity with the nucleotide sequence of SEQ ID NO: 2 or any one of a preferred higher identity is most preferably (i) a nucleotide sequence having increased preference that is at least 97.5%, at least 98.5%, at least 99%, at least 99.5%, at least 99.8%, and 100% identical to SEQ ID NO: 4, and (ii) a nucleotide sequence having increased preference that is at least 97.5%, at least 98.5%, at least 99%, at least 99.5%, at least 99.8%, and 100% identical to SEQ ID NO: 3.

[0023] A particularly preferred example of an amino acid sequence that shares at least 95% identity with SEQ ID NO: 1 is the amino acid sequence of SEQ ID NO: 54. SEQ ID NO: 54 lacks the first four amino acids of SEQ ID NO: 1. However, otherwise it is identical to SEQ ID NO: 1. The first four amino acids of SEQ ID NO: 1 have been found not to be important for the function of the HLA-H protein. Therefore, SEQ ID NO: 54 may also replace or supplement SEQ ID NO: 1 as an alternative sequence of the HLA-H polypeptide in any embodiment described herein.

[0024] The term "degenerate" according to the present invention refers to the degeneration of a genetic code. Since a triplet code consists of 20 amino acids and 4 bases used to encode genetic information and to specify a stop codon, triplet codons are required to produce at least 21 different codes, thus degenerate occurs. The 4³ possible possibilities for the bases of a triplet provide 64 possible codons, which implies that some degenerate must exist. Consequently, some amino acids are encoded by one or more triplets, up to a maximum of six. Degenerate occurs primarily due to a change in the third position of the triplet. This implies that nucleic acid molecules having a nucleotide sequence different from that specified above but still encoding the same polypeptide are within the scope of the present invention. Accordingly, in relation to the first aspect of the present invention, those skilled in the art understand that "consisting of a degenerate nucleotide sequence for the nucleic acid molecule of (e)(d)" as mentioned in entry (I)(e) specifies a nucleic acid molecule encoding the same amino acid sequence as the nucleic acid molecule according to entry (I)(d). This amino acid sequence is the amino acid sequence of SEQ ID NO: 1 or 54 or derived therefrom, said latter amino acid sequence being identical to SEQ ID NO: 1 or 54 at least to the extent required and implied by the sequence identity number mentioned in entry (I)(d) of the principal embodiment.

[0025] A fragment of any one of (I)(a) to (f) according to the first aspect of the present invention comprises at least 150 nucleotides. In this regard, the fragment according to the present invention comprises at least 200, at least 250, at least 300, at least 350, at least 400, at least 450, at least 500, at least 550, at least 600, or at least 650 polynucleotides, and it is most preferable that the fragment is a fragment lacking only a 5'-ATP start codon and / or a 3'-TAG stop codon. Furthermore, it is preferable that the fragment comprises a nucleotide sequence having at least 97.5%, at least 98.5%, at least 99%, at least 99.5%, at least 99.8%, and 100% increased affinity identical to SEQ ID NO: 4, or encodes an amino acid sequence having at least 97.5%, at least 98.5%, at least 99%, at least 99.5%, at least 99.8%, and 100% increased affinity identical to SEQ ID NO: 6. It is more preferable that the fragment comprises a nucleotide sequence having at least 97.5%, at least 98.5%, at least 99%, at least 99.5%, at least 99.8%, and 100% increased preference identical to SEQ ID NO: 4, and / or a nucleotide sequence having at least 97.5%, at least 98.5%, at least 99%, at least 99.5%, at least 99.8%, and 100% increased preference identical to SEQ ID NO: 3. Similarly, it is more preferable that the fragment encodes an amino acid sequence having at least 97.5%, at least 98.5%, at least 99%, at least 99.5%, at least 99.8%, and 100% increased affinity identical to SEQ ID NO: 6, and / or encodes an amino acid sequence having at least 97.5%, at least 98.5%, at least 99%, at least 99.5%, at least 99.8%, and 100% increased affinity identical to SEQ ID NO: 5.It is most preferable that the fragment comprises (i) a nucleotide sequence having at least 97.5%, at least 98.5%, at least 99%, at least 99.5%, at least 99.8%, and 100% increased preference identical to SEQ ID NO: 4 and (ii) a nucleotide sequence having at least 97.5%, at least 98.5%, at least 99%, at least 99.5%, at least 99.8%, and 100% increased preference identical to SEQ ID NO: 3.

[0026] According to a preferred embodiment of the first aspect of the present invention, a nucleic acid molecule is fused to a heterogeneous nucleotide sequence and preferably operably linked to a heterogeneous promoter.

[0027] Heterogeneous nucleotide sequences may be fused directly or indirectly to a nucleic acid molecule according to the present invention. In the case of indirect fusion, preferably, a nucleotide sequence encoding a peptide linker is used for fusion: GS-linker (e.g., Gly-Gly-Gly-Gly-Ser)n (SEQ ID NO: 7), where n is 1 to 3).

[0028] As used herein, a heterogeneous nucleotide sequence refers to a sequence that cannot be found in nature and is fused to the nucleotide sequence of SEQ ID NO: 2. Note that SEQ ID NO: 2 is of human origin, and it is preferable that the heterogeneous nucleotide sequence is also of human origin.

[0029] Therefore, the heterogeneous promoter is a promoter that cannot be found in nature and is operably linked to the nucleotide sequence of SEQ ID NO: 2. The heterogeneous promoter is preferably derived from a human.

[0030] A promoter is a nucleic acid sequence that initiates the transcription of a specific gene, said gene being derived from the HLA-H gene of SEQ ID NO: 2 or according to the present invention of SEQ ID NO: 2. In this regard, "operably linked" means that a heterologous promoter is fused to a nucleic acid molecule according to the present invention, and through the promoter, transcription of the nucleic acid molecule according to the present invention may be initiated, for example, in a prokaryotic or eukaryotic cell. The heterologous promoter may be a constitutive active promoter, a tissue-specific or developmental-stage-specific promoter, an inducible promoter, or a synthetic promoter. Constitutive promoters direct expression in almost all tissues and are largely, though not entirely, independent of environmental and developmental factors. Because their expression is generally not regulated by endogenous factors, constitutive promoters are generally active across species and kingdoms. Tissue-specific or developmental-stage-specific promoters direct the expression of a gene in a specific tissue(s) or a specific developmental stage. The activity of inducible promoters is induced by the presence or absence of biotic or abiotic factors. Inducible promoters are a very powerful tool in genetic engineering because the expression of operably linked genes can be activated or deactivated as needed. Synthetic promoters are constructed by combining key elements of promoter regions of various origins.

[0031] Non-limiting examples of heterogeneous promoters used in the art to heterogeneously express genes are SV40, CMV, HSV, UBC, EF1A, PGK, Vlambda1, RSV, and CAGG (for mammalian systems); COPIA and ACT5C (for fruit fly systems) and GAL1, GAL10, GAL7, and GAL2 (for yeast systems), which may also be used in connection with the present invention.

[0032] Alternatively or additionally, the heterologous nucleic acid sequence may be a coding sequence that causes the nucleic acid sequence of the present invention to produce a fusion protein. Such fusion proteins are discussed in more detail below.

[0033] If a nucleic acid molecule is not fused to a heterologous promoter, it is fused to its own promoter for the purpose of expression.

[0034] The term "vector" according to the present invention preferably means a plasmid, cosmid, virus, bacteriophage, or other vector commonly used in genetic engineering to carry a nucleic acid molecule according to the present invention. The nucleic acid molecule according to the present invention may be inserted into, for example, various commercially available vectors. Non-restrictive examples include prokaryotic plasmid vectors such as the pUC series, pBluescript (Stratagene), pET series expression vectors (Novagen), or pCRTOPO (Invitrogen), and vectors suitable for expression in mammalian cells such as pREP (Invitrogen), pcDNA3 (Invitrogen), pCEP4 (Invitrogen), pMC1neo (Stratagene), pXT1 (Stratagene), pSG5 (Stratagene), EBO-pSV2neo, pBPV-1, pdBPVMMTneo, pRSVgpt, pRSVneo, pSV2-dhfr, pIZD35, pLXIN, pSIR (Clontech), pIRES-EGFP (Clontech), pEAK-10 (Edge Biosystems), pTriEx-Hygro (Novagen), and pCINeo (Promega). Pichia Pastoris ( Pichia pastoris Examples of plasmid vectors suitable for ) include, for example, plasmids pAO815, pPIC9K and pPIC3.5K (all from Invitrogen).

[0035] The nucleic acid molecules inserted into the vector are synthesized, for example, by standard methods or isolated from natural sources. Ligation of coding sequences for transcriptional regulatory elements and / or other amino acid encoding sequences may also be performed using established methods. Transcriptional regulatory elements (part of an expression cassette) that ensure expression in prokaryotes or eukaryotic cells are well known to those skilled in the art. These elements include regulatory sequences that ensure the initiation of transcription (e.g., translation initiation codons, promoters, e.g., naturally-associated or heterologous promoters and / or insulators; see above), internal ribosomal entry sites (IRES) (Owens, Proc. Natl. Acad. Sci. USA 98 (2001), 1471-1476), and poly-A signals that optionally ensure the termination of transcription and the stabilization of the transcript. Additional regulatory elements may include transcription and translation enhancers. Preferably, the polynucleotide encoding the polypeptide / protein or fusion protein according to the present invention is operably linked to such expression regulatory sequences that allow expression in prokaryotes or eukaryotic cells. The vector may further include a nucleic acid sequence encoding a secretory signal as an additional regulatory element. Such sequences are well known to those skilled in the art. Additionally, depending on the expression system used, a leader sequence capable of directing the expressed polypeptide to a cellular compartment may be added to the coding sequence of the polynucleotide of the present invention. Such leader sequences are well known in the art.

[0036] Additionally, it is preferable that the vector include a selection marker. Examples of selection markers include genes encoding resistance to neomycin, ampicillin, hygromycin, and kanamycin. Specially designed vectors enable DNA transfer between different hosts, such as bacterial-fungal cells or bacterial-animal cells (e.g., the gateway system available from Invitrogen). Expression vectors according to the present invention may direct the replication and expression of the polynucleotides and encoded peptides or fusion proteins of the present invention. Apart from introduction via vectors such as phage vectors or viral vectors (e.g., adenoviruses, retroviruses), nucleic acid molecules as described herein may be designed for direct introduction into cells or introduction via liposomes. Additionally, systems based on baculovirus systems or vaccinia viruses or Semlicky forest viruses may be used as eukaryotic expression systems for the nucleic acid molecules of the present invention.

[0037] The term “host cell” means a cell of any organism that is selected, modified, transformed, grown, or used or manipulated in any way for the production of a protein, peptide, or fusion protein according to the present invention by the cell.

[0038] The host cell of the present invention is typically produced by introducing the nucleic acid molecule or vector(s) of the present invention into the host cell, and the presence of these / these mediates the expression of the nucleic acid molecule according to the present invention encoding the protein or peptide or fusion protein according to the present invention. The host from which the host cell is derived or isolated may preferably be any prokaryotic or eukaryotic cell or organism, except for human embryonic stem cells derived directly by the destruction of a human embryo.

[0039] Suitable prokaryotes (bacteria) useful as hosts for the present invention are, for example, Escherichia coli ( E. coli )(for example, E. coliStrains BL21, HB101, DH5a, XL1 Blue, Y1090, and JM101), Salmonella typhimurium ( Salmonella typhimurium ), Serratia Marcescens( Serratia marcescens ), Burkholderia glumae( Burkholderia glumae ), Pseudomonas putida( Pseudomonas putida ), Pseudomonas fluorescens( Pseudomonas fluorescens ), Pseudomonas stutzeri( Pseudomonas stutzeri ), Streptomyces revidans( Streptomyces lividans ), Lactococcus lactis( Lactococcus lactis ), Mycobacterium smegmatis ( Mycobacterium smegmatis ), Streptomyces coelicolore ( Streptomyces coelicolor ) or Bacillus subtilis( Bacillus subtilis These are commonly used for cloning and / or expression, such as ). Appropriate culture media and conditions for the aforementioned host cells are well known in the art.

[0040] Suitable eukaryotic host cells may be vertebrate cells, insect cells, fungal / yeast cells, nematode cells, or plant cells. Fungal / yeast cells include Saccharomyces cerevisiae ( Saccharomyces cerevisiae ) cell, Peachia Pastoris( Pichia pastoris ) cell or Aspergillus( Aspergillus It may be a ) cell. Preferred examples of host cells genetically engineered using the nucleic acid molecule or vector(s) of the present invention are yeast, E. coli ( E. coli ) and / or Bacillus( Bacillus Species of the genus (e.g., Bacillus subtilis) (B. subtilis )) is a cell. In one preferred embodiment, the host cell is a yeast cell (e.g., Saccharomyces cerevisiae ( S. cerevisiae ))am.

[0041] In other preferred embodiments, the host cell is a mammalian host cell, e.g., Chinese hamster ovary (CHO) cell, mouse myeloma lymphoblast, human embryonic kidney cell (HEK-293), human embryonic retinal cell (Crucell's Per.C6), or human amniotic fluid cell (Glycotope and CEVEC). Cells are frequently used in the industry to produce recombinant proteins. CHO cells are the most commonly used mammalian host cell for the industrial production of recombinant protein therapeutics for humans.

[0042] The terms “protein” and “peptide” and preferred embodiments thereof are defined herein in connection with the first aspect of the invention. These definitions and preferred embodiments are applied with necessary modifications to the second aspect of the invention. The peptide according to the invention is preferably at least 80%, preferably at least 90%, most preferably at least 95% identical to the sequence of SEQ ID NO: 1 or 54.

[0043] The protein or peptide according to the present invention can be produced by molecular cloning techniques well known in the art. Recombinant expression can be achieved, for example, using a vector and a host cell as described herein.

[0044] According to a preferred embodiment, the protein or peptide according to the present invention is a fusion protein.

[0045] The "fusion protein" according to the present invention contains at least one additional heterogeneous amino acid sequence. Often, but not necessarily, this additional sequence will be located at the N- or C-terminal end of the (poly)peptide. For example, it is convenient to initially express the polypeptide as a fusion protein in which the additional amino acid residue can be removed by a protinase capable of specifically trimming the fusion protein and releasing the (poly)peptide of the present invention. The amino acid sequence compound may be fused directly or indirectly to a nucleic acid molecule according to the present invention. In the case of indirect fusion, a peptide linker may generally be used for fusion; a GS-linker (e.g., Gly-Gly-Gly-Gly-Ser)n (SEQ ID NO: 7), where n is 1 to 3).

[0046] At least one additional heterogeneous amino acid sequence of the fusion protein comprises an amino acid sequence that confers desired properties, such as modified / enhanced stability, modified / enhanced solubility, and / or the ability to target one or more specific cell types. For example, a fusion protein with an antibody. The term antibody is further defined herein by the following and includes, in particular, antibody fragments and derivatives. The antibody may be, for example, specific to a cell surface marker or an antigen-recognition fragment of said antibody. The protein or peptide according to the present invention may be fused to the N-terminus or C-terminus of the light chain and / or heavy chain(s) of the antibody. The protein or peptide according to the present invention is preferably fused to the N-terminus of the light chain and / or heavy chain(s) of the antibody so that the Fc portion of the antibody freely binds to the Fc-receptor.

[0047] Fusion proteins may also include protein domains known to function in signal transduction and / or to be involved in protein-protein interactions. Examples of such domains are the Ankyrin repeat; arm, Bcl-homology, Bromo, CARD, CH, Chr, C1, C2, DD, DED, DH, EFh, ENTH, F-box, FHA, FYVE, GEL, GYF, hect, LIM, MH2, PDZ, PB1, PH, PTB, PX, RGS, RING, SAM, SC, SH2, SH3, SOCS, START, TIR, TPR, TRAF, tsnare, Tubby, UBA, VHS, W, WW, and 14-3-3 domains. Additional information on these and other protein domains is available in the InterPro database (http: / / www.ebi.ac.uk / interpro / , Mulder et al., 2003, Nucl. Acids. Res. 31: 315-318), Pfam (http: / / www.sanger.ac.uk / Software / Pfam / , Bateman et al., 2002, Nucleic Acids Research 30(1): 276-280) and SMART (http: / / smart.embl-heidelberg.de / , Letunic et al., 2002, Nucleic Acids Res. 30(1), 242-244).

[0048] At least one additional heterogeneous amino acid sequence of the fusion protein according to the present invention may comprise or be composed of (a) a cytokine, (b) a chemokine, (c) a coagulation-promoting factor, (d) a proteinaceous toxic compound, and / or (e) an enzyme for prodrug activation.

[0049] The cytokine is preferably selected from the group consisting of IL-2, IL-12, TNF-alpha, IFN-alpha, IFN-beta, IFN-gamma, IL-10, IL-15, IL-24, GM-CSF, IL-3, IL-4, IL-5, IL-6, IL-7, IL-9, IL-11, IL-13, LIF, CD80, B70, TNF-beta, LT-beta, CD-40 ligand, Fas-ligand, TGF-beta, IL-1-alpha, and IL-1-beta. As is well known in the art, cytokines can be beneficial for the pro-inflammatory or anti-inflammatory response of the immune system. Therefore, depending on the disease to be treated, a fusion protein with a pro-inflammatory or anti-inflammatory cytokine may be preferred. For example, while fusion constructs containing anti-inflammatory cytokines are generally preferred for the treatment of inflammatory diseases, fusion constructs containing pro-inflammatory cytokines are generally preferred for the treatment of cancer.

[0050] Chemokines are preferably selected from the group consisting of IL-8, GRO alpha, GRO beta, GRO gamma, ENA-78, LDGF-PBP, GCP-2, PF4, Mig, IP-10, SDF-1 alpha / beta, BUNZO / STRC33, I-TAC, BLC / BCA-1, MIP-1 alpha, MIP-1 beta, MDC, TECK, TARC, RANTES, HCC-1, HCC-4, DC-CK1, MIP-3 alpha, MIP-3 beta, MCP-1-5, eotaxin, eotaxin-2, I-309, MPIF-1, 6Ckine, CTACK, MEC, lymphotactin, and fractalkyne. The primary role of chemokines is to act as chemotactic attractants that guide cell migration. Cells attracted to chemokines follow signals of increasing chemokine concentration toward the source of the chemokines. It is concluded that chemokines within a fusion protein can be used to guide the movement of proteins or peptides according to the present invention to, for example, specific cell types or body parts.

[0051] A coagulation-promoting factor is preferably a tissue factor. It is a coagulation-promoting factor that facilitates the process of blood changing from a liquid to a gel to form a blood clot. For example, a coagulation-promoting factor can aid in wound healing.

[0052] Proteinotoxic compounds are preferably lysine-A chains, mordesin, cleaved Pseudomonas exotoxin A, diphtheria toxin, and recombinant gelonin. Toxic compounds can exert toxic effects on the entire organism as well as on substructures of the organism, such as specific cell types. Toxic compounds are frequently used in the treatment of tumors. Since tumor cells generally grow faster than normal somatic cells, they preferentially accumulate toxic compounds in larger quantities.

[0053] The enzyme for prodrug activation is preferably selected from the group consisting of carboxypeptidase, glucuronidase, and glucosidase. Among the wide range of genes evaluated for tumor treatment, those encoding prodrug-activating enzymes are particularly attractive because they directly complement the regimen of ongoing clinical chemotherapy. These enzymes can activate prodrugs with low intrinsic toxicity using both bacterial and yeast enzymes, or enhance prodrug activation by mammalian enzymes.

[0054] According to a preferred embodiment, a protein or peptide is fused to a heterogeneous non-protein compound.

[0055] As used herein, the heterogeneous compound is a compound that cannot be found in nature, fused to the amino acid sequence of SEQ ID NO: 1 or 54.

[0056] Heterogeneous non-protein compounds may be fused directly or indirectly to nucleic acid molecules according to the present invention. For example, chemical linkers may be used. Chemical linkers may include various functional groups such as primary amines, sulfhydryls, acids, alcohols, and bromides. Many of our crosslinkers are functionalized with maleimide (sulfhydryl reactive) and succinimidyl ester (NHS) or isothiocyanate (ITC) groups that react with amines.

[0057] The heterogeneous non-protein compound is preferably a pharmaceutically active compound or a diagnostically active compound. The pharmaceutically active compound or the diagnostically active compound is preferably selected from the group consisting of (a) fluorescent dyes, (b) photosensitizers, (c) radionuclides, (d) contrast agents for medical imaging, (e) toxic compounds, or (f) ACE inhibitors, renin inhibitors, ADH inhibitors, aldosterone inhibitors, angiotensin receptor blockers, TSH receptors, LH- / HCG receptors, estrogen receptors, progesterone receptors, androgen receptors, GnRH receptors, GH (growth hormone) receptors, or receptors for IGF-I or IGF-II.

[0058] The fluorescent dye is preferably a component selected from Alexa Fluor or Cy dyes.

[0059] The photosensitizer is preferably the phototoxic red fluorescent protein KillerRed or hematoporphyrin.

[0060] The radionuclides are preferably a group of gamma-emitting isotopes, more preferably 99m Tc, 123 I, 111 In, and / or a group of positron emitters, more preferably 18 F, 64 Cu, 68 Ga, 86 Y, 124 I, and / or a group of beta-emitting agents, more preferably 131 I, 90 Y,177 Lu, 67 Cu, 90 Sr, or an alpha-emitting group, preferably 213 Bi, 211 Selected from At.

[0061] The contrast agents used at our institution are substances used in medical imaging to enhance the visualization of internal structures or body fluids. General contrast agents operate based on X-ray attenuation and magnetic resonance signal enhancement.

[0062] The toxic compound is preferably a small organic compound, more preferably a toxic compound selected from the group consisting of caliceamycin, metansinoids, neocarzinostatin, esperamicin, dynemycin, kedarcidin, maduropeptide, doxorubicin, daunorubicin, and auristatin. In contrast to the proteinaceous toxic compounds described herein, these toxic compounds are non-proteinaceous.

[0063] Nucleic acid molecules, vectors, host cells, or proteins or peptides, or combinations thereof, according to the present invention may be formulated as pharmaceutical compositions. According to the present invention, the term “pharmaceutical composition” relates to a composition intended for administration to a patient, preferably a human patient. The pharmaceutical composition of the present invention comprises the aforementioned compounds. It may optionally comprise additional molecules capable of stabilizing, adjusting, and / or activating the function of the compounds of the present invention by modifying their properties, for example. The composition may be in solid, liquid, or gaseous form, and in particular may be in the form of powder(s), tablet(s), solution(s), or aerosol(s). The pharmaceutical composition of the present invention may optionally and additionally comprise a pharmaceutically acceptable carrier. Examples of suitable pharmaceutical carriers are well known in the art and include phosphate-buffered saline solutions, water, emulsions, e.g., oil / water emulsions, various types of wetting agents, sterile solutions, organic solvents including DMSO, etc. Compositions comprising such carriers may be formulated by well-known conventional methods. These pharmaceutical compositions may be administered to subjects in appropriate doses. Dose therapy is determined by the attending physician and clinical factors. As is well known in the medical community, the dose for any given patient depends on many factors, including the patient's height, body surface area, age, the specific compound to be administered, gender, time and route of administration, general health, and other drugs to be administered concurrently. The therapeutically effective dose for a given situation will be easily determined by routine experimentation, which is within the skill and judgment of the general clinician or physician. Generally, the regimen of regular administration of the pharmaceutical composition should be in the range of 1 µg to 5 g units per day. However, a more preferred dose may be in the range of 0.01 mg to 100 mg per day, much more preferably 0.01 mg to 50 mg, and most preferably 0.01 mg to 10 mg.In addition, for example, if the compound is an iRNA preparation such as siRNA, the total pharmaceutically effective amount of the pharmaceutical composition administered will generally be less than about 75 mg per kg of body weight, for example, less than about 70, 60, 50, 40, 30, 20, 10, 5, 2, 1, 0.5, 0.1, 0.05, 0.01, 0.005, 0.001, or 0.0005 mg per kg of body weight. More preferably, the amount is less than 2000 nmol per kg of body weight, e.g., 1500, 750, 300, 150, 75, 15, 7.5, 1.5, 0.75, 0.15, 0.075, 0.015, 0.0075, 0.0015, 0.00075, or 0.00015 nmol of an iRNA preparation (e.g., about 4.4 × 10⁻⁶ nmol). 16 It will be (copy). The treatment period required to observe changes and the interval at which a response appears after treatment vary depending on the desired effect. Specific amounts can be determined by conventional tests well known to those skilled in the art.

[0064] Immunosuppressants are drugs that can suppress an immune response. For example, they can be used in immunosuppressive therapy to (i) prevent rejection of transplanted organs and tissues (e.g., bone marrow, heart, kidney, liver), (ii) treat autoimmune diseases or diseases most likely of autoimmune origin (e.g., rheumatoid arthritis, multiple sclerosis, myasthenia gravis, psoriasis, vitiligo, systemic lupus erythematosus, sarcoidosis, focal segmental glomerulosclerosis, Crohn's disease, Behcet's disease, pemphigus, scleroderma, and ulcerative colitis), and / or (iii) treat non-autoimmune inflammatory diseases (e.g., long-term control of allergic asthma and ankylosing spondylitis).

[0065] Tumor vaccines can be used to treat existing tumors or prevent their development. Vaccines that treat existing cancer are also known as therapeutic cancer vaccines. Vaccines can be "autologous"; that is, they are prepared from samples taken from the patient and are specific to that patient. The approach to cancer vaccination generally involves isolating proteins from cancer cells and immunizing the patient against those proteins as antigens, with the goal of stimulating the immune system to kill cancer cells. The antigens are derived from HLA-H proteins / peptides according to the present invention.

[0066] Accordingly, the present invention also relates to a method for preparing a tumor vaccine comprising mixing a nucleic acid molecule, a vector, a host cell, a protein or peptide, a binding molecule, preferably an inhibitor according to the present invention or a combination thereof, with at least one pharmaceutically acceptable excipient, a carrier, and / or a diluent.

[0067] Fertility promoters are compounds that increase the likelihood of pregnancy, particularly the possibility of embryo implantation. Implantation is the stage of pregnancy where an already fertilized egg attaches to the uterine wall. Through this attachment, the fetus can receive oxygen and nutrients from the mother to grow. In humans, the attachment and implantation of a fertilized egg occur most effectively about 5 to 6 days after ovulation. It is estimated that implantation failure is caused by inadequate uterine receptivity in two-thirds of cases, and by problems with the embryo itself in another one-third. This also depends on the mother's age. Inadequate uterine receptivity occurs more frequently in younger mothers, while problems with the embryo itself (e.g., chromosomal abnormalities) occur more often in older mothers (especially those over 35). Inadequate uterine receptivity can be caused by abnormal cytokine and hormonal signaling and epigenetic changes. Recurrent implantation failure is a cause of female infertility. Therefore, the implantation rate can be improved by optimizing endometrial receptivity for implantation.

[0068] Accordingly, nucleic acid molecules, vectors, host cells, proteins or peptides, binding molecules, preferably inhibitors according to the present invention, or combinations thereof may be used, for example, in vitro fertilization, wherein oocytes are cultured in the presence of nucleic acid molecules, vectors, host cells, proteins or peptides, binding molecules, preferably inhibitors according to the present invention, or combinations thereof, before being fertilized and transplanted into a mother.

[0069] The detection of HLA-H expression in tissue samples from cancer patients is illustrated in the attached examples. More specifically, HLA-H expression is illustrated in bladder cancer patients in Examples 1 and 2, in bladder cancer patients before and after chemotherapy in Example 3, and in ovarian cancer patients before and after chemotherapy in Example 4. Examples 2 through 4 demonstrate that high levels of HLA-H expression are associated with adverse outcomes, such as low survival rates during immune checkpoint therapy or chemotherapy resistance. Furthermore, Example 4 showed that an increase in HLA-H expression was associated with higher tumor stages and levels. Therefore, it is reasonable to assume that HLA-H expression helps tumors escape the immune system. This, in turn, demonstrates that HLA-H acts as an immunosuppressant.

[0070] This evidence demonstrates that HLA-H is not a pseudogene but a functional gene that actually encodes a protein. In this regard, the entry for the pseudogene HLA-H in the database GeneCards (GC06P032554) is referenced. The database entry mentions the amino acid sequence UniPortKB:P01893 and warns that the protein may be a product of the pseudogene and that the protein can be characterized as "presumed." The experimental data of this institution unexpectedly revealed that HLA-H is not a pseudogene but actually encodes a functional protein. Even more unexpectedly, this functional protein is not the amino acid sequence UniPortKB:P01893 but the amino acid sequence of SEQ ID NO:1.

[0071] The amino acid sequence UniPortKB:P01893 is based on an incorrectly assumed open reading frame. For this reason, SEQ ID NO: 1 and 54 provided herein share approximately 90% sequence identity with a subset of UniPortKB:P01893. Additionally, UniPortKB:P01893 contains an HLA transmembrane domain and does not contain the correct HLA-H disclosed herein. Although UniPortKB:P01893, presumed to be HLA-H, is membrane-bound like HLA-G, it was unexpectedly discovered that HLA-H is actually a soluble HLA. It was not evident from the prior art that the available sequences of HLA-H pseudogenes and presumed HLA-H proteins included in public gene and protein databases were incorrect, nor that SEQ ID NO: 1 and 2 were the correct sequences.

[0072] The data discussed above in the examples also make it at least plausible that vaccination of tumor patients with HLA-H helps to suppress or abolish the escape of the tumor from the immune system through HLA-H expression. Accordingly, the nucleic acid molecules, vectors, host cells, or proteins or peptides or combinations of the present invention may be used as immunosuppressants or tumor vaccines. The nucleic acid molecule is preferably the nucleic acid molecule of item (g) of the first embodiment. WO 2018 / 140525 envisions the use of HLA-H antibodies for cancer treatment, but WO 2018 / 140525 does not disclose any HLA-H, not to mention the correct HLA-H sequences of SEQ ID NOs: 1 and 2 provided herein. Similarly, WO 2018 / 183921 mentions a long list of potential novel immunotherapy targets, in which HLA-H is included in this list. Again, HLA-H sequences are not disclosed.

[0073] Additionally, it is hypothesized that nucleic acid molecules, vectors, host cells, proteins or peptides, or combinations thereof can be used as pregnancy promoters to optimize endometrial receptivity, particularly for implantation. The nucleic acid molecule is preferably the nucleic acid molecule of item (g) of the first embodiment. This is because HLA-G is thought to play a key role in implantation by regulating cytokine secretion, thereby controlling trophoblast cell infiltration and maintaining local immune tolerance (see Roussev and Coulam, J Assist Reprod Genet. 2007 Jul; 24(7): 288-295). Furthermore, pre-implantation embryos are known to express soluble HLA-G and soluble HLA-F. Higher expression levels of soluble HLA-G and soluble HLA-F are associated with a higher implantation rate of the embryo. Therefore, high levels of HLA-H expression are expected to be associated with successful implantation, while low levels of HLA-H expression are expected to be associated with implantation failure.

[0074] The present invention relates to an inhibitor of a nucleic acid molecule defined in relation to the first embodiment of the present invention in a second embodiment and / or a binding molecule of a protein defined in relation to the first embodiment of the present invention, preferably for use as an immunoactivator, preferably for use in the treatment of a tumor, and an inhibitor of a protein defined in relation to the first embodiment of the present invention.

[0075] The binding molecule of a protein according to the present invention is a compound capable of binding to a protein according to the present invention. The binding molecule preferably binds specifically to the protein according to the present invention. Specific binding indicates that the binding molecule essentially does not bind to or does not essentially bind to any other protein or peptide other than the protein according to the present invention. In particular, it is preferable that the binding molecule cannot bind to any HLA protein other than HLA-H. The binding molecule of a protein according to the present invention is suitable for research purposes, for example. For example, an antibody binding to the protein according to the present invention may be used in immunoassays such as ELISA or Western blot. The binding molecule of a protein according to the present invention may preferably inhibit the protein according to the present invention. In this case, the binding molecule is designated as an inhibitor.

[0076] A compound for inhibiting the expression of a nucleic acid molecule and / or protein according to the present invention is, according to the present invention, (i) a compound that reduces or prevents the transcription of a gene encoding a nucleic acid molecule and / or protein according to the present invention, or (ii) a compound that reduces or prevents the translation of an mRNA encoding a protein according to the present invention. The compound of (i) comprises a compound that interferes with the transcription machinery and / or with expression regulatory elements located far from the promoter, such as the promoter and / or enhancer of said gene. The compound of (ii) comprises a compound that interferes with the translation machinery. The compound for inhibiting the expression of a nucleic acid molecule and / or protein according to the present invention specifically inhibits the expression of a nucleic acid molecule and / or protein according to the present invention by, for example, specifically interfering with a promoter region that controls expression. Preferably, transcription of nucleic acid molecules and / or proteins according to the present invention or translation of proteins according to the present invention is reduced by at least 50%, more preferably at least 75%, for example, at least 90% or 95%, much more preferably at least 98%, most preferably about 100% (e.g., compared to the same experimental setup in the absence of the compound).

[0077] A compound that inhibits the activity of nucleic acid molecules and / or proteins according to the present invention causes said nucleic acid molecules and / or proteins to perform their functions with reduced efficiency. A compound that inhibits the activity of nucleic acid molecules and / or proteins according to the present invention specifically inhibits the activity of said nucleic acid molecules and / or proteins. As described in more detail herein, a compound that inhibits the activity of nucleic acid molecules and / or proteins according to the present invention may specifically inhibit the activity of said nucleic acid molecules and / or proteins by interacting with the nucleic acid molecules and / or proteins themselves or by specifically inhibiting (preferably causing apoptosis) cells that produce said nucleic acid molecules and / or proteins and / or bind to said proteins. Preferably, the activity of said nucleic acid molecules and / or proteins according to the present invention is reduced by at least 50%, more preferably at least 75%, e.g., at least 90% or 95%, much more preferably at least 98%, most preferably about 100% (e.g., compared to the same experimental setup in the absence of the compound).

[0078] The activity of nucleic acid molecules and / or proteins according to the present invention is, according to the present invention, preferably the ability to induce resistance to chemotherapy in cancer patients and / or reduce progression-free and overall survival in cancer patients (see also the attached examples). The chemotherapy referred to herein may be adjuvant chemotherapy or neoadjuvant chemotherapy, preferably neoadjuvant chemotherapy. Chemotherapy uses drugs to destroy cancer cells, stop their growth, or improve symptoms. In neoadjuvant chemotherapy (also referred to as pre-operative or primary), drug treatment is administered before the surgical excision of the tumor. This is in contrast to adjuvant chemotherapy, which is drug treatment after surgery. Means and methods for determining such activity are established in the art and are described in the examples below. Accordingly, according to the medical aspect of the present invention, such activity of nucleic acid molecules and / or proteins according to the present invention must be inhibited.

[0079] The inhibitory efficiency of an inhibitor can be quantified by comparing the activity levels with and without the inhibitor. For example, changes in the amount of nucleic acid molecules and / or proteins formed according to the present invention may be used for measurement. The efficiency of multiple inhibitors can be determined simultaneously in a high-throughput format. High-throughput analysis can generally be performed in the wells of micro-titer plates, regardless of whether the analysis is biochemical, cellular, or other, where each plate may contain 96, 384, or 1536 wells. Handling of the plates, including incubation at temperatures other than ambient temperature, and contact between the analysis mixture and the test compounds are preferably performed by one or more computer-controlled robotic systems including pipetting devices. If a large library of test compounds is to be screened and / or screening must be performed within a short time, for example, a mixture of 10, 20, 30, 40, 50, or 100 test compounds may be added to each well. If the well exhibits the expected activity, the mixture of test compounds can be separated to identify one or more test compounds causing the activity in the mixture.

[0080] Compounds that inhibit the expression and / or activity of nucleic acid molecules and / or proteins according to the present invention can be formulated as vesicles such as liposomes or exosomes. Liposomes have attracted significant interest in terms of drug delivery due to the specificity and duration of action they provide. Liposomal cell-type delivery systems have been used to effectively deliver nucleic acids, such as siRNA, into cells in vivo (Zimmermann et al. (2006) Nature, 441:111-114). Liposomes are monolayer or multilayer vesicles having a membrane formed with a lipophilic substance and an aqueous interior. The aqueous portion contains the composition to be delivered. Cationic liposomes have the advantage of being able to fuse with the cell wall. Non-cationic liposomes cannot efficiently fuse with the cell wall but are phagocytosed by macrophages and other cells in vivo. Exosomes are lipid packages capable of carrying various molecules, including RNA (Alexander et al. (2015), Nat Commun; 6:7321). Exosomes containing molecules can be absorbed by receptor cells. Therefore, exosomes are important mediators of intercellular delivery and regulators of cellular niches. Exosomes are useful for diagnostic and therapeutic purposes because they can be used, for example, as contrast agents or drug delivery vesicles.

[0081] The compound for inhibiting the expression and / or activity of nucleic acid molecules and / or proteins according to the present invention may be administered to a subject at an appropriate dose and / or a therapeutically effective amount. This will be further discussed below in relation to the pharmaceutical composition of the present invention.

[0082] The treatment period required to observe changes and the interval at which a response appears after treatment vary depending on the desired effect. Specific amounts can be determined by conventional tests well known to those skilled in the art. Suitable tests are described, for example, in Tamhane and Logan (2002), "Multiple Test Procedures for Identifying the Minimum Effective and Maximum Safe Dose of a Drug", Journal of the American Statistics Association, 97(457):1-9.

[0083] A compound that inhibits the expression and / or activity of nucleic acid molecules and / or proteins according to the present invention is preferably mixed with a pharmaceutically acceptable carrier or excipient to form a pharmaceutical composition. Suitable pharmaceutically acceptable carriers or excipients, as well as formulations of the pharmaceutical composition, have been discussed herein.

[0084] Immunoactivators are drugs capable of promoting an immune response. Immunoactivators can be used in immunoactivation therapy, for example, to promote and / or initiate an immune response against disease cells. The immune response is preferably a cytotoxic immune response and / or a T-cell response against disease cells.

[0085] As mentioned, immunoactivators are preferably used in the context of tumor treatment. As is evident from the attached examples, HLA-H is expressed in tumors. HLA-H is a secreted protein, and the data in the examples below of this invention show that HLA-H is secreted by tumor cells. Therefore, a "cloud" of HLA-H protein is most likely to form around tumor cells, and this cloud protects the tumor, preventing the cells from being recognized and eliminated by the immune system. Binding molecules, preferably inhibitors of the present invention, promote and / or initiate an immune response against tumor cells by removing this protective cloud from the tumor cells. This immunoactivation mechanism is applied to disease cells other than tumor cells with the necessary modifications.

[0086] A tumor is a new growth of abnormal benign or malignant tissue that occurs due to uncontrolled, generally rapid cell proliferation and lacks physiological function. In contrast to non-solid (or liquid) tumors, solid tumors are abnormal masses of tissue that generally do not contain cysts or fluid areas.

[0087] As discussed above in this application, and based on the data in the following examples, it is reasonable to assume that HLA-H expression is utilized by tumors to evade the immune system and to become resistant to established antitumor therapies, such as chemotherapy and immune checkpoint therapy. It is believed that HLA-H acts as an immunosuppressant to aid tumors. Therefore, it is reasonable to assume that HLA-H inhibitors are suitable for use as immunoactivators, particularly for tumor treatment.

[0088] HLA-H inhibitors are preferably used in combination with established antitumor therapies, preferably chemotherapy or immune checkpoint therapy, more preferably immune checkpoint therapy, and most preferably anti-PD-L1 therapy. In Example 1, a positive correlation between HLA-H expression and immune checkpoint PD-L1 was shown, and in Example 2, it was further revealed that tumor patients expressing high levels of HLA-H had reduced survival rates when treated with anti-PD-L1 antibodies. This indicates that patients expressing both PD-L1 and HLA-H should be treated with anti-PD-L1 therapy as well as HLA-H inhibitors to prevent failure of anti-PD-L1 therapy.

[0089] According to a preferred embodiment of the second aspect of the present invention, (I) an inhibitor of a nucleic acid molecule is selected from small molecules, aptamers, siRNA, shRNA, miRNA, ribozymes, antisense nucleic acid molecules, CRISPR-Cas9-based constructs, CRISPR-Cpf1-based constructs, meganucleases, zinc finger nucleases, and transcription activator-like (TAL) effector (TALE) nucleases, and / or (II) a binding molecule of a protein, preferably an inhibitor of a protein, is selected from small molecules, antibodies or antibody mimics, and aptamers, wherein the antibody mimic is preferably selected from affibodies, adnectin, anticalin, DARPin, avimer, nanophytin, afilin, Kunitz domain peptide, Fynomers®, trispecific binding molecules, and probodies.

[0090] As used herein, "low molecule" is preferably an organic molecule. Organic molecules are related to or belong to a class of carbon-based compounds in which carbon atoms are linked together by carbon-carbon bonds. Organic compounds are carbon-containing compounds obtained from plant, animal, or microbial sources, whereas inorganic compounds are the original definition of organic terms related to the source of chemical compounds obtained from mineral sources. Organic compounds may be natural or synthetic. Organic molecules are preferably aromatic molecules, more preferably heteroaromatic molecules. In organic chemistry, the term aromatic is used to describe cyclic (ring-shaped) or planar (flat) molecules that have resonance bonding rings that exhibit higher stability than other geometric or linkage arrangements of the same set of atoms. Aromatic molecules are very stable and do not easily decompose or react with other substances. In heteroaromatic molecules, at least one of the atoms in the aromatic ring is a non-carbon atom, for example, N, S, or O. For all of the aforementioned organic molecules, the molecular weight is preferably in the range of 200 Da to 1500 Da, more preferably in the range of 300 Da to 1000 Da.

[0091] Alternatively, the “low molecule” according to the present invention may be an inorganic compound. Inorganic compounds include all compounds derived from mineral sources that lack carbon atoms (excluding carbon dioxide, carbon monoxide, and carbonates). Preferably, the low molecule has a molecular weight of less than about 2000 Da, or less than about 1000 Da, e.g., less than about 500 Da, and much more preferably less than about Da amu. The size of the low molecule may be determined by methods well known in the art, e.g., mass spectrometry. The low molecule may be designed, for example, based on the crystal structure of a target molecule, wherein the site presumed to be responsible for biological activity may be identified and verified in vivo analysis, such as high-throughput screening (HTS) analysis.

[0092] The term "antibody" as used according to the present invention includes, for example, polyclonal or monoclonal antibodies. Additionally, derivatives or fragments thereof that still retain binding specificity to a target, for example, HLA-H proteins of SEQ ID NO: 1 or 54, are included in the term "antibody." Antibody fragments or derivatives include, in particular, Fab or Fab' fragments, Fd, F(ab')2, Fv or scFv fragments, single-domain VH or V-like domains, such as VhH or V-NAR domains, as well as multimeric forms such as minibodies, diabodies, tribodies or triplebodies, tetrabodies, or chemically conjugated Fab'-multimers (see, e.g., Harlow and Lane "Antibodies, A Laboratory Manual", Cold Spring Harbor Laboratory Press, 198; Harlow and Lane "Using Antibodies: A Laboratory Manual", Cold Spring Harbor Laboratory Press, 1999; Altshuler EP, Serebryanaya DV, Katrukha AG. 2010, Biochemistry (Mosc)., vol. 75(13), 1584; Holliger P, Hudson PJ. 2005, Nat Biotechnol., vol. 23(9), 1126). The multimeric form includes a bispecific antibody capable of simultaneously binding to two different types of antigens. The first antigen may be found in a protein according to the present invention. The second antigen may be, for example, a tumor marker specifically expressed in cancer cells or a specific type of cancer cell.Non-limiting examples of bispecific antibody forms are biclonics (bispecific, full-length human IgG antibodies), DART (dual-affinity retargeting antibodies), and BiTE (composed of two single-strand variable fragments (scFv) of different antibodies) molecules (Kontermann and Brinkmann (2015), Drug Discovery Today, 20(7):838-847).

[0093] The term "antibody" also includes specific examples such as chimeric (human constant domain, non-human variable domain), single-strand, and humanized (human antibodies excluding non-human CDRs) antibodies.

[0094] Various techniques for the production of antibodies are well known in the art and are described, for example, in the literature [cf. Harlow and Lane (1988) and (1999) and Altshuler et al., 2010, loc. cit]. Thus, polyclonal antibodies can be obtained from animal blood after immunization with antigens mixed with additives and adjuvants, and monoclonal antibodies can be produced by any technique providing antibodies generated by continuous cell line culture. Examples of such techniques are, for example, Harlow E and Lane D, Cold Spring Harbor Laboratory Press, 1988; This includes the hybridoma technique, trioma technique, human B cell hybridoma technique (e.g., see Kozbor D, 1983, Immunology Today, vol. 4, 7; Li J, et al. 2006, PNAS, vol. 103(10), 3557) and EBV-hybridoma technique (Cole et al., 1985, Alan R. Liss, Inc, 77-96) originally described by Kohler and Milstein, 1975, for producing human monoclonal antibodies. Additionally, recombinant antibodies can be obtained from monoclonal antibodies or newly produced using various display methods such as phage, ribosome, mRNA, or cell display. A system suitable for the expression of recombinant (humanized) antibodies may be selected from, for example, bacteria, yeast, insect, mammalian cell lines or transgenic animals or plants (e.g., U.S. Patent 6,080,560; Holliger P, Hudson PJ. 2005, Nat Biotechnol., vol.23(9), 11265).Additionally, the technology described for the production of single-strand antibodies (in particular, see U.S. Patent 4,946,778) can be applied to produce single-strand antibodies specific to HLA-H epitopes. Surface plasmon resonance used in the BIAcore system can be used to increase the efficiency of phage antibodies.

[0095] As used herein, the term “antibody mimic” refers to a compound capable of specifically binding to an antigen like an antibody, e.g., the HLA-H protein of SEQ ID NO: 1 or 54 in this example, but which is not structurally related to an antibody. Antibody mimics are generally artificial peptides or proteins with a molar mass of about 3 to 20 kDa. For example, antibody mimics may be selected from the group consisting of Affibodies, Adnectin, Anticalin, DARPin, Avimer, Nanophytin, Afilin, Kunitz domain peptides, Fynomers®, trispecific binding molecules, and Probodies. These polypeptides are well known in the art and are described in more detail herein.

[0096] As used herein, the term "affibody" refers to a family of antibody mimics derived from the Z-domain of staphylococcal protein A. Structurally, affibody molecules are based on a 3-helix bundled domain that can also be incorporated into fusion proteins. Affibody itself has a molecular weight of approximately 6 kDa and is stable under high temperatures and acidic or alkaline conditions. Target specificity is achieved by the randomization of 13 amino acids located on two alpha helices involved in the binding activity of the parent protein domain (Feldwisch J, Tolmachev V.; (2012) Methods Mol Biol. 899:103-26).

[0097] The term “adnectin” (also called “monobody”) as used herein refers to a molecule based on the 10th extracellular domain of human fibronectin III (10Fn3) that adopts a 94-residue Ig-like β-sandwich fold with 2 to 3 exposed loops but lacks a central disulfide bridge (Gebauer and Skerra (2009) Curr Opinion in Chemical Biology 13:245-255). Adnectins with desired target specificity for HLA-H can be genetically engineered by introducing modifications to specific loops of the protein.

[0098] As used herein, the term "anticalin" refers to engineered proteins derived from lipocalin (Beste G, Schmidt FS, Stibora T, Skerra A. (1999) Proc Natl Acad Sci US A. 96(5):1898-903; Gebauer and Skerra (2009) Curr Opinion in Chemical Biology 13:245-255). Anticalin possesses an eight-stranded barrel that forms a highly conserved core unit among lipocalins and naturally forms a binding site for a ligand through four structurally variable loops at the open end. Although anticalin is not homologous to the IgG superfamily, it exhibits features that have been considered typical for antibody binding sites to date: (i) high structural plasticity resulting from sequence variation and (ii) high structural flexibility capable of being induced to fit targets of various shapes.

[0099] The term "DARPin" as used herein refers to an engineered ankyrin repeat domain (166 residues) that typically provides a rigid interface resulting from three repeated β-turns. DARPin generally has three repeats corresponding to an artificial consensus sequence, with six positions randomly assigned per repeat. Consequently, DARPin lacks structural flexibility (Gebauer and Skerra, 2009).

[0100] As used herein, the term “avimer” refers to a class of antibody mimics consisting of two or more peptide sequences of 30 to 35 amino acids each, derived from the A-domains of various membrane receptors and linked by linker peptides. Binding of the target molecule occurs via the A-domain, and the domain with the desired binding specificity, namely the domain for HLA-H, can be selected, for example, by phage display technology. The binding specificities of the different A-domains contained in the avimer may be identical but do not need to be identical (Weidle UH, et al., (2013), Cancer Genomics Proteomics; 10(4):155-68).

[0101] "Nanophytin" (also called apitin) is Sulforobus acidocaldarius ( Sulfolobus acidocaldarius It is an antibody-mimicking protein derived from the DNA-binding protein Sac7d. Nanophytin generally has a molecular weight of about 7 kDa and is designed to specifically bind to target molecules, e.g., HLA-H, by randomizing amino acids on its binding surface (Mouratou B, B_har G, Paillard-Laurance L, Colinet S, Pecorari F., (2012) Methods Mol Biol.; 805:315-31).

[0102] As used herein, the term "apillin" refers to antibody mimics developed by using gamma-B crystalline or ubiquitin as a scaffold and modifying amino acids on the surface of these proteins by random mutagenesis. The selection of apilin with desired target specificity, i.e., screening for HLA-H, is performed, for example, by phage display or ribosome display techniques. Depending on the scaffold, the molecular weight of apilin is approximately 10 or 20 kDa. As used herein, the term apilin also refers to the dimeric or polymeric forms of apilin (Weidle UH, et al., (2013), Cancer Genomics Proteomics; 10(4):155-68).

[0103] "Kunitz domain peptides" are derived from the Kunitz domains of Kunitz-type protease inhibitors such as bovine pancreatic trypsin inhibitor (BPTI), amyloid precursor protein (APP), or tissue factor pathway inhibitor (TFPI). Kunitz domains have a molecular weight of approximately 6 kDA, and domains possessing the necessary target specificity for HLA-H can be selected using display technologies such as phage display (Weidle et al., (2013), Cancer Genomics Proteomics; 10(4):155-68).

[0104] As used herein, the term "Fynomer®" refers to a non-immunoglobulin-derived conjugated polypeptide derived from the human Fyn SH3 domain. Polypeptides derived from Fyn SH3 are well known in the art and are described, for example, in Grabulovski et al. (2007) JBC, 282, p. 3196-3204, WO 2008 / 022759, Bertschinger et al. (2007) Protein Eng Des Sel 20(2):57-68, Gebauer and Skerra (2009) Curr Opinion in Chemical Biology 13:245-255, or Schlatter et al. (2012), MAbs 4:4, 1-12).

[0105] As used herein, the term “triple-specific binding molecule” refers to a polypeptide molecule having three binding domains and thus capable of binding, preferably specifically to three different epitopes. At least one of these three epitopes is an epitope of a protein according to the present invention. Two other epitopes may also be epitopes of a protein according to the present invention or epitopes of one or two different antigens. The triple-specific binding molecule is preferably TriTac. TriTac is a T-cell engager for solid tumors composed of three binding domains designed to have an extended serum half-life and be about one-third the size of a monoclonal antibody.

[0106] The term "probody" as used herein refers to a protease-activated antibody prodrug. A probody consists of an authentic IgG heavy chain and a modified light chain. A masking peptide is fused to the light chain via a peptide linker that can be cleaved by tumor-specific proteases. The masking peptide prevents the probody from binding to healthy tissue, thereby minimizing toxic side effects.

[0107] Aptamers are nucleic acid or peptide molecules that bind to specific target molecules. Aptamers are generally generated by screening from large random sequence pools, but natural aptamers also exist at ribose positions. Aptamers can be used as macromolecular drugs for both basic research and clinical purposes. Aptamers can bind to ribozymes and self-cleave in the presence of target molecules. These compound molecules have further research, industrial, and clinical applications (Osborne et al. (1997), Current Opinion in Chemical Biology, 1:5-9; Stull & Szoka (1995), Pharmaceutical Research, 12, 4:465-483).

[0108] Nucleic acid aptamers are nucleic acid species generally composed of (usually short) strands of oligonucleotides. Typically, they are engineered through repeated rounds of in vitro screening or, equivalently, SELEX (systematic evolution of ligands by exponential enrichment) to bind to various molecular targets, such as small molecules, proteins, nucleic acids, and even cells, tissues, and organisms.

[0109] Peptide aptamers are peptides or proteins generally designed to disrupt interactions between other proteins within a cell. They consist of variable peptide loops with both ends attached to a protein scaffold. This dual structural constraint significantly increases the binding affinity of peptide aptamers to a level comparable to that of antibodies (in the nanomolar range). The variable peptide loop typically contains 10 to 20 amino acids, and the scaffold can be any protein with excellent solubility characteristics. Currently, the bacterial protein Thioredoxin-A is the most commonly used scaffold protein, and the variable peptide loop is inserted into the redox-active site of the wild-type protein, -Cys-Gly-Pro-Cys-loop (SEQ ID NO: 8), where two cysteine ​​side chains can form a disulfide bridge. Peptide aptamer screening can be performed using different systems, but the most widely used is currently the yeast 2-hybrid system.

[0110] Aptamers are useful in biotechnology and therapeutic applications because they provide molecular recognition properties comparable to those of commonly used biomolecules, particularly antibodies. In addition to differential recognition, aptamers offer advantages over antibodies because they can be fully manipulated in vitro, are easily produced by chemical synthesis, possess desirable storage characteristics, and exhibit little to no immunogenicity in therapeutic applications. Unmodified aptamers are rapidly cleared from the bloodstream, with half-lives ranging from minutes to hours, primarily due to nuclease degradation and elimination by the kidneys. Applications of unmodified aptamers currently focus on treating transient conditions such as blood clots or treating organs like the eyes where local delivery is possible. This rapid elimination can be advantageous in applications such as in vivo diagnostic imaging. Scientists can utilize various modifications, such as 2'-fluorine-substituted pyrimidines, polyethylene glycol (PEG) linkages, fusions with albumin, or other half-life-extending proteins, which can extend the half-life of aptamers to days or weeks.

[0111] As discussed, the aforementioned small molecules, antibodies or antibody mimics and aptamers can specifically bind to the protein according to the present invention. Such binding can block the immunosuppressive properties of the protein according to the present invention and, preferably, the ability to induce resistance to chemotherapy in cancer patients and / or reduce progression-free and overall survival in cancer patients. In this case, the small molecules, antibodies or antibody mimics and aptamers are also referred to as blocking small molecules, antibodies or antibody mimics and aptamers. The blocking small molecules, antibodies or antibody mimics and aptamers block the interaction of the protein according to the present invention with other cellular components, such as ligands and receptors, that normally interact with the protein according to the present invention.

[0112] Small molecules, antibodies or antibody mimics, and aptamers may also be produced in the form of drug-conjugates. In this case, the small molecules, antibodies or antibody mimics, and aptamers themselves may not have an inhibitory effect, but the inhibitory effect is imparted solely by the drug. The small molecules, antibodies or antibody mimics, and aptamers impart site-specific binding of the drug to cells that produce and / or bind to the protein according to the present invention. The drug can preferably kill the cells that produce and / or bind to the protein according to the present invention. Thus, by combining the targeting ability of the molecule binding to the protein according to the present invention with the apoptotic ability of the drug, the drug-conjugate becomes an inhibitor capable of distinguishing between healthy tissues and diseased tissues and cells. Cleatable and non-cleavable linkers for designing drug-conjugates are known in the art. Non-limiting examples of drugs capable of killing cells are anti-proliferation drugs and radioisotopes that deliver radiation directly to cancer cells.

[0113] Additionally, it is possible to restrict the binding and / or inhibitory activity of small molecules, antibodies or antibody mimics, and aptamers to specific tissue or cell types, particularly diseased tissue or cell types. For example, a probody can be designed. In the probody, the small molecule, antibody, antibody mimic, or aptamer is bound to a masking peptide that restricts or prevents binding to the protein according to the present invention, and the masking peptide can be cleaved by a protease. A protease is an enzyme that breaks down a protein into smaller pieces by cleaving a specific amino acid sequence known as a substrate. In normal healthy tissues, protease activity is strictly controlled. In cancer cells, protease activity is upregulated. In healthy tissues or cells where protease activity is regulated and minimal, the target binding region of the probody is masked and cannot bind. On the other hand, in diseased tissues or cells where protease activity is upregulated, the target binding region of the probody is not masked and can therefore bind and / or inhibit.

[0114] According to the present invention, the term “small interfering RNA (siRNA),” also known as short interfering RNA or silencing RNA, refers to a class of double-stranded RNA molecules of length 18 to 30, preferably 19 to 25, most preferably 21 to 23, or much more preferably 21 nucleotides, which play various roles in biology. In particular, siRNA is involved in RNA interference (RNAi) pathways in which siRNA interferes with the expression of specific genes. In addition to its role in RNAi pathways, siRNA acts in RNAi-related pathways, for example, antiviral mechanisms or the formation of chromatin structure in the genome.

[0115] Naturally occurring siRNA in nature possesses a well-defined structure: short double-stranded RNA (dsRNA) with 2-nt 3' overhangs at both ends. Each strand contains a 5' phosphate group and a 3' hydroxyl group (-OH). This structure is the result of processing by Dicer, an enzyme that converts long dsRNA or small hairpin RNA into siRNA. siRNA can also be introduced exogenously (artificially) into cells to induce specific knockdowns of target genes. Thus, any gene with a known sequence can be targeted based on sequence complementarity with appropriately tuned siRNA. Double-stranded RNA molecules or their metabolic processing products can mediate target-specific nucleic acid modifications, particularly RNA interference and / or DNA methylation. Exogenously introduced siRNA may not have overhangs at the 3' and 5' ends, but it is desirable for at least one RNA strand to have 5' and / or 3' overhangs. Preferably, one end of the double strand has a 3'-overhang of 1 to 5 nucleotides, more preferably 1 to 3 nucleotides, and most preferably 2 nucleotides. The other end may be a blunt end or have a 3'-overhang of up to 6 nucleotides. In general, any RNA molecule suitable for acting as siRNA is conceived in this invention. The most efficient silencing has so far been achieved with siRNA double strands consisting of 21nt sense and 21nt antisense strands, paired in a manner having a 2nt 3'-overhang. The sequence of the 2nt 3' overhang contributes slightly to the specificity of target recognition, which is limited to unpaired nucleotides adjacent to the first base pair (Elbashir et al. 2001). The 2'-deoxynucleotides of the 3' overhang are as efficient as ribonucleotides but are cheaper to synthesize and may have higher nuclease resistance.siRNA delivery can be performed using any method known in the art, for example, by combining siRNA with saline and administering the combination intravenously or nasally, or by using siRNA with glucose (e.g., 5% glucose) or cationic lipids and polymers via intravenous (IV) or intraperitoneal (IP) systemic routes for in vivo siRNA delivery (De Fougerolles et al. (2008), Current Opinion in Pharmacology, 8:280-285; Lu et al. (2008), Methods in Molecular Biology, vol. 437: Drug Delivery Systems - Chapter 3: Delivering Small Interfering RNA for Novel Therapeutics).

[0116] Short hairpin RNA (shRNA) is an RNA sequence that forms a tight hairpin turn that can be used to silence gene expression through RNA interference. The shRNA is introduced into a cell via a vector and used to ensure that the shRNA is always expressed using the U6 promoter. This vector is typically passed to daughter cells to ensure that gene silencing is inherited. The shRNA hairpin structure is cleaved into siRNA by cellular machinery and then bound to an RNA-induced silencing complex (RISC). This complex binds to and cleaves mRNA that matches the bound siRNA. The si / shRNA used in the present invention is preferably chemically synthesized using appropriately protected ribonucleoside phosphoramidite and a conventional DNA / RNA synthesizer. Suppliers of RNA synthesis reagents are Proligo (Hamburg, Germany), Dharmacon Research (Lafayette, CO, USA), Pierce Chemical (part of Perbio Science, Rockford, IL, USA), Glen Research (Sterling, VA, USA), ChemGenes (Ashland, MA, USA), and Cruachem (Glasgow, UK). Most conveniently, siRNA or shRNA is obtained from commercial RNA oligo synthesis suppliers that sell RNA synthesis products of different qualities and costs. Generally, RNA applicable to the present invention is typically synthesized and readily available in a quality suitable for RNAi.

[0117] Additional molecules affecting RNAi include, for example, microRNA (miRNA). These RNA species are single-stranded RNA molecules. Innately present miRNA molecules regulate gene expression by binding to complementary mRNA transcripts and triggering the degradation of said mRNA transcripts through a process similar to RNA interference. Therefore, exogenous miRNAs can be used as inhibitors of HLA-H after being introduced into individual cells.

[0118] Ribozymes (also known as ribonucleases, RNA enzymes, or catalytic RNA) are RNA molecules that catalyze chemical reactions. While many natural ribozymes catalyze their own cleavage or the cleavage of other RNAs, they have also been found to catalyze the aminotransferase activity of ribosomes. Non-limiting examples of well-characterized small self-cleaving RNAs include hammerhead, hairpin, delta hepatitis virus, and in vitro selective lead-dependent ribozymes, whereas Group I introns are examples of larger ribozymes. The principles of catalytic self-cleavage have been well established in recent years. Hammerhead ribozymes are the most well-characterized among RNA molecules possessing ribozyme activity. Since it has been shown that hammerhead structures can be incorporated into heterologous RNA sequences and that ribozyme activity can be transferred to these molecules, it appears that catalytic antisense sequences can be generated for almost any target sequence provided that the target sequence contains a potentially matching cleavage site. The basic principles constituting hammerhead ribozymes are as follows. Select a target region of RNA containing a GUC (or CUC) triplet. Take two strands of oligonucleotides, each typically containing 6–8 nucleotides, and insert a catalytic hammerhead sequence between them. The best results are generally obtained with a short ribozyme and a target sequence.

[0119] According to the present invention, a recent development also useful is a combination of an aptamer that recognizes small compounds and a hammerhead ribozyme. When a target molecule binds, conformational changes induced in the aptamer can regulate the catalytic function of the ribozyme.

[0120] As used herein, the term "antisense nucleic acid molecule" refers to a nucleic acid complementary to a target nucleic acid. The antisense molecule according to the present invention can interact with the target nucleic acid, and more specifically, can hybridize with the target nucleic acid. Due to the formation of the hybrid, the transcription of the target gene(s) and / or the translation of the target mRNA is reduced or blocked. Standard methods related to antisense technology are described (see, e.g., Melani et al., Cancer Res. (1991) 51:2897-2901).

[0121] CRISPR / Cas9 and CRISPR-Cpf1 technologies can be applied to almost any cell or model organism and can be used for knockout mutations, chromosomal deletions, DNA sequence editing, and gene expression regulation. Gene expression regulation can be performed using a catalytically dead Cas9 enzyme (dCas9) conjugated with a transcription repressor to suppress the transcription of a specific gene (in this case, the HLA-H gene). Similarly, a catalytically inactive "dead" Cpf1 nuclease (CRISPR from Prevotella and Francisella-1) can be fused with a synthetic transcription repressor or activator to downregulate an endogenous promoter, e.g., a promoter that regulates HLA-H expression. Alternatively, the DNA-binding domain of a zinc finger nuclease (ZFN) or TALEN (transcription activator-like effector nuclease) can be designed to specifically recognize the HLA-H gene, its promoter region, or its 5'-UTR to suppress the expression of the HLA-H gene.

[0122] Inhibitors provided as repressive nucleic acid molecules targeting the HLA-H gene or as regulatory molecules involved in HLA-H expression are also considered herein. These molecules that reduce or eliminate the expression of HLA-H or regulatory molecules include, without limitation, meganucleases, zinc finger nucleases, and TALENs. Such methods are described in Silva et al., Curr Gene Ther. 2011;11(1):11-27; Miller et al., Nature biotechnology. 2011;29(2):143-148, and Klug, Annual review of biochemistry. 2010; 79:213-231.

[0123] In relation to the second aspect of the present invention, the binding molecule of the protein defined in relation to the first aspect, preferably the inhibitor of the protein defined in relation to the first aspect, may also be a cell such as a T-cell, wherein the T-cell is preferably a CAR-T-cell.

[0124] The cell generally possesses a binding molecule on its surface, preferably an inhibitor of the protein defined in relation to the first embodiment. In the case of the T-cell binding molecule, the inhibitor is preferably a naturally occurring or chimeric T-cell receptor that specifically targets the protein defined in relation to the first embodiment. Chimeric antigen receptor T cells (also called CAR T cells) are T cells that have been genetically engineered to produce artificial T-cell receptors for use in immunotherapy.

[0125] Therefore, a chimeric antigen receptor (also known as a chimeric immune receptor, chimeric T cell receptor, or artificial T cell receptor) is a receptor protein engineered to provide T cells with a novel ability to specifically target the protein defined in relation to the first embodiment. The receptors are chimeric because they integrate both antigen-binding and T cell-activating functions into a single receptor.

[0126] The present invention relates to the use of a nucleic acid molecule defined in item (I)(g) of the first embodiment of the present invention or a protein or peptide defined in relation to the first embodiment of the present invention for tumor diagnosis and / or tumor grading and / or tumor prognosis prediction and / or classification of the tumor as an HLA-H low-expression tumor or an HLA-H high-expression tumor and / or diagnosis of implantation failure in a sample obtained from a subject in the third embodiment.

[0127] The sample may be a body fluid or a tissue sample taken from the subject's organ. Non-limiting examples of body fluids include whole blood, plasma, serum, urine, peritoneal fluid, pleural fluid, cerebrospinal fluid, tear fluid, or cells in solution. Non-limiting examples of tissues include the colon, liver, breast, ovary, and testis. Tissue samples may be obtained by aspiration or puncture, excision or biopsy, or other surgical methods leading to excised cellular material. The sample may be a processed sample, e.g., frozen, fixed, or buried. The preferred sample type is FFPE (formaline fixed paraffin included) samples. FFPE sample preparation is standard medical practice, and these samples can be preserved for a long period.

[0128] As used herein, the term "diagnosis" refers to the identification of a disease in a subject suffering from symptoms of the disease. According to the present invention, the disease is a tumor or implantation failure. As used herein, the term "grading" refers to determining the degree of cellular degeneration of tumor cells in a subject diagnosed as having a tumor. The most commonly used system for tumor grading is the system based on the guidelines of the American Joint Commission on Cancer. According to these guidelines, the following grade categories are distinguished: GX (ungradable), G1 (well-differentiated, low grade), G2 (moderately differentiated, intermediate grade), G3 (lowly differentiated, high grade); G4 (undifferentiated, high grade). As used herein, the term "prognosis" refers to the possibility or prospect of recovery from a tumor-like disease and / or the prospect or survival of a tumor-like disease. In the case of a tumor, the prognosis may include one or more of the following: change in tumor size of the target lesion, disease-specific survival (DSS), recurrence-free survival (RFS), progression-free survival (PFS), and distant recurrence-free survival, provided that DSS is preferred.

[0129] The term "object" according to the present invention refers to a mammal, preferably a livestock or pet such as a horse, cow, pig, sheep, goat, dog, or cat, most preferably a human.

[0130] As discussed above, increased levels of HLA-H in tumor patients are associated with significantly reduced progression-free survival and overall survival. Therefore, higher levels of HLA-H expression also correspond to higher tumor grades. Furthermore, as HLA-H expression was found in all tumor samples, it was demonstrated in the examples that HLA-H expression can serve not only as a prognostic marker but also as a diagnostic marker for tumors.

[0131] The above use may include positive and / or negative samples as well as a predetermined standard. The control group may be obtained from samples of one or more subjects, for example, at least 5, at least 10, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 200, at least 300, at least 400, at least 500, at least 600, at least 700, at least 800, at least 900, at least 1000, at least 1500, or at least 2000 subjects. The predetermined standard specifies a value previously obtained from the positive and / or negative samples.

[0132] In the case of tumor diagnosis, it is believed that no standard is necessary at all, as healthy subjects are not expected to express HLA-H. Furthermore, the examples indicate that HLA-H expression was detected in all investigated tumor patients. Nevertheless, positive and / or negative samples, as well as predetermined standards, may be included in the application of the tumor diagnosis of the present invention. For diagnosis, a positive sample is one or more subjects known to have a tumor, preferably a tumor in the same body part as the subject to be diagnosed. Similarly, a negative sample is obtained from one or more subjects known to be without a tumor. If the expression level of a nucleic acid molecule according to the present invention or a protein or peptide according to the present invention in the sample has an increased preference of at least 1.5, 2, 3, or 4 times compared to a negative control or a predetermined standard derived therefrom, the subject is diagnosed as having a tumor. If the expression level of a nucleic acid molecule according to the present invention or a protein or peptide according to the present invention in a sample differs from that of a positive control or a predetermined standard derived therefrom by an increased preference of less than 50%, less than 25%, and less than 10%, the subject is diagnosed as having a tumor. For example, if the positive control is set to 100%, a patient exhibiting a value of 150% to 50%, preferably 125% or 75%, is diagnosed as having a tumor.

[0133] Additionally, for the diagnosis of implantation failure, positive and / or negative samples as well as a predetermined standard may be used. For the diagnosis, the positive sample is from one or more female subjects who have experienced at least one implantation failure, preferably at least two implantation failures, and most preferably at least three implantation failures. Two or more implantation failures are also referred to as recurrent or recurrent implantation failures. Similarly, the negative sample is from one or more female subjects who have experienced at least one successful implantation, preferably at least two successful implantations, and most preferably at least three successful implantations. A female subject is diagnosed with implantation failure if the expression level of a nucleic acid molecule of the first embodiment or a protein or peptide of the fourth embodiment in the sample has an increased preference that is reduced by at least 1.5, 2, 3, or 4 times compared to a negative control or a predetermined standard derived therefrom. If the expression level of a nucleic acid molecule according to the present invention or a protein or peptide according to the present invention in a sample differs (i.e., higher or lower) from a positive control or a predetermined standard derived therefrom by less than 50%, less than 25%, and less than 10% of increased preference, the subject is diagnosed as having implantation failure. For example, if the positive control is set to 100%, a patient displaying a value of 125% or 75% is diagnosed as having implantation failure.

[0134] Regarding the classification of tumors as HLA-H low-expression tumors or HLA-H high-expression tumors, it is noted that not every tumor expresses or is expected to express a significant amount of HLA-H. Therefore, to determine whether a binding molecule, preferably an inhibitor according to the present invention, may be a therapeutic option for subjects with tumors, the tumor may be classified as an HLA-H low-expression tumor or an HLA-H high-expression tumor, wherein the binding molecule or inhibitor is an option only in the latter case. For classification, the control group may be from one or more subjects known to have tumors expressing HLA-H and, preferably, tumors known to be treatable by a binding molecule, preferably an inhibitor according to the present invention. If the HLA-H expression of the tumor to be classified has an increasing preference that is reduced by at least 2, at least 3, at least 4, and at least 5 times compared to the control group, the tumor is an HLA-H low-expression tumor. On the other hand, if the HLA-H expression of the tumor to be classified has an increasing preference that is at least 2-fold, at least 3-fold, at least 4-fold, and at least 5-fold increased compared to the control group, the tumor is an HLA-H high-expression tumor.

[0135] Regarding prognosis, positive controls may be derived from one or more subjects who died from a tumor (preferably a tumor in the same body part as the prognosis is predicted), and negative samples may be derived from one or more subjects who survived a tumor for a substantial period without tumor progression (preferably a tumor in the same body part as the prognosis is predicted). Substantial amounts are specified with increased preference for at least 1 year, at least 2 years, at least 3 years, at least 4 years, and at least 5 years. If the expression level of a nucleic acid molecule according to the present invention or a protein or peptide according to the present invention in the sample has an increased preference that is reduced by at least 1.5, 2, 3, or 4 times compared to a positive control or a predetermined standard derived therefrom, the subject has a favorable prognosis. Additionally, if the expression level of a nucleic acid molecule according to the present invention or a protein or peptide according to the present invention in the sample has an increased preference that differs by less than 50%, less than 25%, and less than 10% compared to a negative control or a predetermined standard derived therefrom, the subject has a favorable prognosis. If the expression level of a nucleic acid molecule according to the present invention or a protein or peptide according to the present invention in a sample has an increased preference that is at least 1.5, 2, 3, or 4 times increased compared to a negative control or a predetermined standard derived therefrom, the subject has an undesirable prognosis. Additionally, if the expression level of a nucleic acid molecule according to the present invention or a protein or peptide according to the present invention in a sample has an increased preference that differs from a positive control or a predetermined standard derived therefrom by less than 50%, less than 25%, and less than 10%, the subject has an undesirable prognosis. The prognosis is preferably the prognosis of expected therapeutic success of tumor treatment, wherein the anti-tumor treatment is preferably chemotherapy and / or the patient to be diagnosed preferably has breast cancer.

[0136] For grading, positive samples may come from one or more subjects graded into categories G1 to G4. For grading, two or more positive samples may be used, wherein the positive samples originate from two, preferably three, and most preferably all four of categories G1 to G4. A subject is graded as having a G1 tumor if the expression level of a nucleic acid molecule according to the present invention or a protein or peptide according to the present invention in the sample has an increased preference that differs from a positive G1 control or a predetermined standard derived therefrom by less than 50%, less than 25%, and less than 10%. This applies in accordance with G2 to G4 staging.

[0137] A method for obtaining a level of nucleic acid molecules or proteins or peptides according to the present invention is established in the art.

[0138] For example, levels of nucleic acid molecules according to the present invention can be obtained by real-time quantitative PCR (RT-qPCR), electrophoresis techniques, or DNA microarrays (Roth (2002), Curr. Issues Mol. Biol., 4: 93-100), wherein RT-qPCR is preferred. In these methods, expression levels may be normalized to the (average) expression levels of one or more reference genes in the sample. As used herein, the term “reference gene” refers to a gene having a level of expression that is relatively unchanged relative to RNA transcript / mRNA levels in the system being tested, i.e., cancer. Such genes may be referred to as housekeeping genes. Non-limiting examples of reference genes are CALM2, B2M, RPL37A, GUSB, HPRT1, and GAPDH, preferably CALM2 and / or B2M. Other suitable reference genes are known to those skilled in the art.

[0139] RT-qPCR is described by the examples. RT-qPCR is performed in a thermal cycler capable of illuminating each sample with light of at least one specified wavelength and detecting the fluorescence emitted from the excited fluorophore. The thermal cycler can also rapidly heat and cool the samples, thereby allowing the utilization of the physicochemical properties of nucleic acids and DNA polymerases. Two common methods for detecting PCR products in real-time qPCR are: (1) a non-specific fluorescent dye inserted with double-stranded DNA, and (2) a sequence-specific DNA probe (e.g., TaqMan probe) composed of an oligonucleotide labeled with a fluorescent reporter that is detectable only after hybridization of the probe and its complementary sequence. The latter detection method is used in the examples below. The probe is generally a fluorescently labeled probe. Preferably, the fluorescently labeled probe consists of an oligonucleotide labeled with both a fluorescent reporter dye and a quencher dye (= double-labeled probe). Suitable fluorescent reporters and quencher dyes / moties are known to those skilled in the art and include, but are not limited to, reporter dyes / moties 6-FAMTM, JOETM, Cy5®, Cy3® and quencher dyes / moties dabcyl, TAMRATM, BHQTM-1, -2 or -3. Preferably, the primer for use according to the present invention has a length of 15 to 30 nucleotides and is, in particular, a deoxyribonucleotide. In one embodiment, the primer is designed to (1) be specific to or derived from the target mRNA sequence of HLA-H, (2) provide an amplicon size of less than 120 bp (preferably less than 100 bp), (3) be mRNA specific (considering exon / intron, preferably no genomic DNA amplification), (4) have no tendency to dimerize, and / or (5) have a melting temperature Tm in the range of 58°C to 62°C (preferably, Tm is approximately 60°C).

[0140] As an alternative to qPCR, levels of nucleic acid molecules according to the present invention can also be obtained using electrophoresis techniques or DNA microarrays. Conventional approaches to mRNA identification and quantification are achieved through a combination of sequence-specific probing and gel electrophoresis, which provides information on size. Northern blot is the most commonly applied technique in this class. Ribonuclease protection assays (RPA) have been developed as a more sensitive and less labor-intensive alternative to Northern blot. Hybridization is performed in solution with labeled ribonucleotide probes, after which the unhybridized samples and probes are degraded with a mixture of ribonucleases (e.g., RNase A and RNase T1) that selectively degrade single-stranded RNA. Subsequent denaturation polyacrylamide gel electrophoresis provides a means of quantification and also provides the size of the region hybridized by the probes. In both Northern blot and RPA, the accuracy and precision of quantification are functions of the detection method and the reference or standard used. Most commonly, probes are radiolabeled with 32P or 33P; in this case, the final gel is exposed to an X-ray film or an in-screen, and the intensity of each band is quantified using a densitometer or phosphorus detector, respectively. In both cases, exposure times can be adjusted to meet the required sensitivity, but phosphorus-based techniques are generally more sensitive and have a larger dynamic range. As an alternative to radioactivity, probes can be labeled with antigens or haptens, which are subsequently bound by horseradish peroxidase or alkaline phosphatase conjugated antibodies and quantified by chemiluminescence via a film or phosphorus detector after the addition of the substrate. In all these imaging applications, background subtraction must be performed in the adjacent areas of the gel where the probe is absent. The greatest advantage of the gel format is that all reference standards can be imaged simultaneously with the sample. Likewise, the detection of housekeeping genes is performed under identical conditions for all samples.

[0141] Two techniques have emerged for the construction of DNA microarrays. Generally, the starting point for array design in each case is a series of sequences corresponding to the gene to be investigated or the putative gene. In the first approach, oligonucleotide probes are chemically synthesized, starting from a glass substrate. Due to the variable efficiency of oligonucleotide hybridization to cDNA probes, multiple oligonucleotide probes are synthesized complementarily to each target gene. Additionally, for each fully complementary oligonucleotide on the array, an oligonucleotide with a mismatch at a single nucleotide position is constructed and used for normalization. The oligonucleotide array consists of approximately 10 4 -10 6 probes / cm 2 It is routinely generated at a density of . The second major technique for constructing DNA microarrays is robotically printing cDNA probes directly onto glass slides or other suitable substrates. For each target gene, a DNA clone is obtained, purified, and amplified from a common vector by PCR using universal primers. Probes are robotically deposited as spots in order of size from 50 to 200 µm. In this interval, for example, about 10 3 probes / cm 2 The density of can be achieved.

[0142] The level of a protein or peptide according to the present invention may be determined, for example, using a "molecule that binds to the protein or peptide," preferably a "molecule that specifically binds to the protein or peptide." A molecule that binds to the protein or peptide designates a molecule that occurs by primarily binding to the protein or peptide under known conditions. Among the binding molecules described herein, a "molecule that binds to the protein or peptide," preferably an inhibitor of the protein or peptide according to the present invention, such as an antibody, aptamer, etc., may be used. The level of a protein or peptide according to the present invention may also be obtained using Western blot analysis, mass spectrometry, FACS analysis, ELISA, and immunohistochemistry. These techniques are non-limiting examples of methods that may be used to qualitatively, semi-quantitatively, and / or quantitatively detect the protein or peptide.

[0143] Western blot analysis is a widely used and well-known analytical technique used to detect specific proteins or peptides in a given sample, such as tissue homogenates or body extracts. It utilizes gel electrophoresis to separate natural or denatured proteins or peptides based on the length of the (poly)peptide (denatured conditions) or the three-dimensional structure of the protein (inherent / non-denatured conditions). The proteins or peptides are then transferred to a membrane (typically nitrocellulose or PVDF) where they are probed (detected) using antibodies specific to the target protein.

[0144] In addition, mass spectrometry (MS) is a widely used and well-known analytical technique in which the mass-to-charge ratio of charged particles is measured. Mass spectrometry is used to determine the mass of particles, determine the elemental composition of samples or molecules, and elucidate the chemical structure of molecules such as proteins, peptides, and other compounds. The principle of MS consists of ionizing chemical compounds to generate charged molecules or molecular fragments and measuring their mass-to-charge ratio.

[0145] FACS (Fluorescence activated cell sorting) analysis is a widely used and well-known analytical technique that sorts biological cells based on specific light scattering of the fluorescent properties of each cell. Cells can be fixed in 4% formaldehyde, permeated with 0.2% Triton-X-100, and incubated with fluorescently labeled antibodies (e.g., monoclonal or polyclonal anti-HLA-H antibodies).

[0146] ELISA (Enzyme-linked immunosorbent assay) is a widely used and well-known sensitive analytical technique in which an enzyme is linked to an antibody or antigen as a marker for the detection of a specific protein or peptide.

[0147] Immunohistochemistry (IHC) is the most common application of immunostaining. It involves the process of selectively identifying antigens (proteins) in cells of tissue sections by utilizing the principle that antibodies specifically bind to antigens in biological tissues. Combined with specific devices, IHC provides a quantitative site of protein expression ( in situ It can be used for evaluation (for review, Cregger et al. (2006) Arch Pathol Lab Med, 130:1026-1030). Quantitative IHC utilizes the fact that staining intensity correlates with absolute protein levels.

[0148] In addition to the nucleic acid molecule according to the present invention or the protein or peptide according to the present invention, one or more additional compounds obtained from a sample from a subject may be used for tumor diagnosis and / or tumor grading and / or tumor prognosis prediction. Numerous markers known in the art for tumor diagnosis and / or tumor grading and / or tumor prognosis prediction may be used in conjunction with the nucleic acid molecule according to the present invention or the protein or peptide according to the present invention. Many tumor markers are indicators for specific tumors, such as breast cancer or colorectal cancer. Tumor markers are listed, for example, at the National Cancer Institute (https: / / www.cancer.gov / about-cancer / diagnosis-staging / diagnosis / tumor-markers-fact-sheet) or the CGMD (http: / / cgmd.in / ), a unified database of cancer genes and markers. Using one or more additional markers generally increases the reliability of diagnosis, grading, or prognosis prediction.

[0149] The present invention relates to a tumor diagnosis method comprising the step of detecting, in a fourth embodiment, the presence of a nucleic acid molecule defined in item (I)(g) of the first embodiment of the present invention and / or a protein or peptide defined in relation to the first embodiment of the present invention in a sample obtained from a subject, wherein the presence of a nucleic acid molecule defined in item (I)(g) of the first embodiment of the present invention and / or a protein or peptide defined in relation to the first embodiment of the present invention is an indicator of a tumor in the subject.

[0150] The present invention relates to a method for tumor grading and / or tumor prognosis prediction comprising the step of detecting, in a fifth embodiment, levels of nucleic acid molecules defined in item (I)(g) of the first embodiment of the present invention and / or proteins or peptides defined in relation to the first embodiment of the present invention in a sample obtained from a subject, wherein, compared to a control group, increased levels of nucleic acid molecules defined in item (I)(g) of the first embodiment of the present invention and / or proteins or peptides defined in relation to the first embodiment of the present invention are correlated with higher grade tumors and / or poor tumor prognosis.

[0151] The present invention relates to a kit for tumor diagnosis and / or tumor grading and / or tumor prognosis prediction, comprising, in the sixth aspect, (a) means for detection and / or quantification of nucleic acid molecules defined in item (I)(g) of the first aspect of the present invention and / or proteins or peptides defined in relation to the first aspect of the present invention in a sample obtained from a subject, and (b) instructions for use of the kit.

[0152] The kit of the sixth embodiment of the present invention embodies the means necessary to perform the use of the third embodiment of the present invention in the form of a kit. For this reason, the definitions and preferred embodiments provided herein in relation to the third embodiment of the present invention are equally applicable to the kit of the sixth embodiment of the present invention.

[0153] The means for detection and / or quantification of nucleic acid molecules of the first embodiment is preferably one or more primers and probes for HLA_H shown in Table 1 of the examples used in RT-qPCR, and a pair of specific primers for HLA-H that may be optionally used in relation to each probe. The means for detection of proteins or peptides according to the present invention is preferably the antibodies and / or antibody mimics described herein. For detection and / or quantification, the antibodies and / or antibody mimics may be labeled, for example, by fluorescent dyes or radiolabels. Examples of fluorescent dyes and radiolabels are also described herein.

[0154] The various components of the kit may be packaged in one or more containers, such as one or more vials. In addition to the components, the vials may contain preservatives or buffers for storage. The kit may include instructions on how to use the kit, which preferably inform how to use the components of the kit for tumor diagnosis and / or tumor grading and / or tumor prognosis prediction.

[0155] In addition, as discussed herein, the examples show that HLA-H is expressed in tumors of various stages and is used by the tumor to escape the immune system. High expression levels of HLA-H are associated with a poor prognosis. In Example 4, it was further revealed that elevated HLA-H expression is positively associated with advanced tumor stage. Therefore, the detection and / or quantification of nucleic acid molecules defined in item (I)(g) of the first embodiment of the invention and / or proteins or peptides defined in relation to the first embodiment of the invention by the method and kit described herein in a sample obtained from a subject is a means for tumor diagnosis and / or tumor grading and / or tumor prognosis prediction.

[0156] The present invention relates to a method for monitoring the non-efficacy of tumor treatment in a subject having a tumor, comprising in the seventh embodiment (a) measuring the amount of nucleic acid molecules defined in item (I)(g) of the first embodiment of the present invention and / or proteins or peptides defined in relation to the first embodiment of the present invention in a sample obtained from the subject before the start of treatment; and (b) measuring the amount of nucleic acid molecules defined in item (I)(g) of the first embodiment of the present invention and / or proteins or peptides defined in relation to the first embodiment of the present invention in a sample obtained from the subject one or more times after the start of treatment, wherein the increased amount in b) compared to a) is an indicator of the non-efficacy of tumor treatment and / or the decreased amount in b) compared to a) is an indicator of the efficacy of tumor treatment.

[0157] Similarly, the present invention relates to a method for monitoring the non-efficacy of an immunosuppressive therapy in a subject requiring such therapy, comprising in the ninth embodiment: (a) measuring the amount of nucleic acid molecules defined in item (I)(g) of the first embodiment of the present invention and / or proteins or peptides defined in relation to the first embodiment of the present invention in a sample obtained from the subject before the start of therapy; and (b) measuring the amount of nucleic acid molecules defined in item (I)(g) of the first embodiment of the present invention and / or proteins or peptides defined in relation to the first embodiment of the present invention in a sample obtained from the subject one or more times after the start of therapy, wherein the reduced amount in b) compared to a) is an indicator of the non-efficacy of the immunosuppressive therapy and / or the increased amount in b) compared to a) is an indicator of the efficacy of the immunosuppressive therapy.

[0158] With respect to other aspects of the present invention, the definitions and preferred embodiments provided herein are equally applicable to the eighth and ninth aspects of the present invention.

[0159] For example, means and methods for measuring the amount of nucleic acid molecules and / or proteins or peptides according to the present invention are described herein in connection with the third aspect of the present invention. These means and methods may be used in the same way in connection with the eighth and ninth aspects of the present invention.

[0160] Tumor treatment may be any tumor treatment, e.g., surgery, radiation therapy, or chemotherapy. Tumor treatment is preferably chemotherapy. Chemotherapy involves the administration of chemotherapy agents. Chemotherapy agents that may be used according to the present invention include cell proliferation inhibitory compounds and cytotoxic compounds. Traditional chemotherapy agents act by killing rapidly dividing cells, which is one of the major characteristics of most tumor cells. Chemotherapy agents include, but are not limited to, taxanes, nucleoside analogs, camptothecin analogs, anthracyclines and anthracycline analogs, etoposide, bleomycin, vinorelbine, cyclophosphamide, anmetatars, antimitotic agents, and alkylating agents. Chemotherapy may also be platinum-based, i.e., it involves the administration of platinum-based compounds, e.g., cisplatin. Chemotherapy agents are typically provided in combination for 3 to 6 months. One of the most common treatments involves the administration of cyclophosphamide, known as AC, and doxorubicin (belonging to the group of adriamycin, anthracyclines, and anthracycline analogs). Sometimes, a taxane drug such as docetaxel is added, and this regimen is known as CAT. Taxanes attack the microtubules of cancer cells. Another common treatment that provides equivalent results involves the administration of cyclophosphamide, the antimetabolite methotrexate, and the nucleoside analog (CMF) fluorouracil. Another standard chemotherapy regimen involves the administration of fluorouracil, epirubicin, and cyclophosphamide (FEC), which may be supplemented with a taxane such as docetaxel or vinorelbine.

[0161] The tumor is according to the eighth modality and is preferably a non-luminous tumor. A non-luminous tumor is a hormone receptor (estrogen receptor and / or progesterone receptor) negative tumor or a tumor expressing low levels of hormone receptors (estrogen receptor and / or progesterone receptor). In the case of a breast tumor, luminal A tumor is hormone receptor positive, Her2 negative, and expresses low levels of Ki-67, and luminal B tumor is (i) hormone receptor positive, Her2 negative, and expresses high levels of Ki-67, or (ii) estrogen receptor positive, progesterone receptor negative, Her2 negative, and expresses low levels of Ki-67. Non-luminous breast tumors can be divided into HER2-positive tumors and TNBC (triple-negative breast cancer), which are HER2-negative and hormone receptor (estrogen receptor and / or progesterone receptor) negative.

[0162] Likewise, immunosuppressive therapy may be any immunosuppressive therapy. For example, immunosuppressive therapy may include the administration of one or more immunosuppressive drugs selected from, for example, glucocorticoids, cell proliferation inhibitors, and antibodies. According to the 15th embodiment, the subject may receive a transplanted organ or tissue (e.g., bone marrow, heart, kidney, liver) or have an autoimmune disease or a disease most likely of autoimmune origin (e.g., rheumatoid arthritis, multiple sclerosis, myasthenia gravis, psoriasis, vitiligo, systemic lupus erythematosus, sarcoidosis, focal segmental glomerulosclerosis, Crohn's disease, Behcet's disease, ankylosing spondylitis, and ulcerative colitis) or other non-autoimmune inflammatory disease (e.g., long-term control of allergic asthma or ankylosing spondylitis).

[0163] As shown in Example 4, an increase in HLA-H expression is positively correlated with higher tumor stages. This indicates that clinically more aggressive tumors increase HLA-H expression and become resistant to chemotherapy. Therefore, measuring the amount of nucleic acid molecules defined in item (I)(g) of the first embodiment of the present invention and / or proteins or peptides defined in relation to the first embodiment of the present invention can be used to determine the non-efficacy of tumor treatment in subjects. Since HLA-H helps tumors evade anti-tumor treatment through its immunosuppressive function, nucleic acid molecules defined in item (I)(g) of the first embodiment of the present invention and / or proteins or peptides defined in relation to the first embodiment of the present invention can likewise be used to monitor the non-efficacy of immunosuppressive therapy.

[0164] According to a preferred embodiment of all aspects of the present invention relating to a tumor as described herein, the tumor is cancer.

[0165] Cancer is an abnormal, malignant new tissue resulting from uncontrolled, generally rapid cell proliferation that lacks physiological function.

[0166] According to a more preferred embodiment of all aspects of the present invention relating to tumors as described herein, the cancer is selected from the group consisting of breast cancer, ovarian cancer, endometrial cancer, vaginal cancer, vulvar cancer, bladder cancer, salivary gland cancer, pancreatic cancer, thyroid cancer, kidney cancer, lung cancer, upper gastrointestinal cancer, colorectal cancer, prostate cancer, head and neck squamous cell carcinoma, cervical cancer, glioblastoma, malignant ascites, lymphoma, and leukemia.

[0167] According to a more preferred embodiment of all aspects of the present invention relating to a tumor as described above, the cancer is bladder cancer or gynecological cancer.

[0168] According to a further more preferred embodiment of all aspects of the present invention relating to a tumor as described above, the cancer is breast cancer or ovarian cancer.

[0169] Ovarian cancer is preferred because it is the examiner in Example 4. According to preferred embodiments of all aspects of the present invention as described above, the sample is a body fluid or tissue sample of an organ.

[0170] With respect to the embodiments characterized in this specification, particularly in the claims, each embodiment mentioned in a dependent claim is intended to be combined with each embodiment of each claim (independent or dependent) upon which said dependent claim depends. For example, where independent claim 1 refers to three alternatives A, B, and C, dependent claim 2 refers to three alternatives D, E, and F, and claim 3 refers to three alternatives G, H, and I according to claims 1 and 2, unless specifically stated otherwise, the specification shall not include combinations A, D, G; A, D, H; A, D, I; A, E, G; A, E, H; A, E, I; A, F, G; A, F, H; A, F, I; B, D, G; B, D, H; B, E, G; B, E, H; B, E, I; B, F, G; B, F, H; B, F, I; C, D, G; C, D, H; C, D, I; It should be understood as disclosing specific examples corresponding to C, E, G; C, E, H; C, E, I; C, F, G; C, F, H; and C, F, I without ambiguity.

[0171] Similarly, even where independent and / or dependent claims do not refer to alternatives, if a dependent claim refers to multiple prior claims, any combination of subject matter included thereby is deemed to be explicitly disclosed. For example, where independent claim 1 and dependent claim 2 refer again to claim 1, and dependent claim 3 refers to both claim 2 and claim 1, the combination of the essence of claims 3 and 1 is disclosed clearly and unambiguously, just as the combination of the essence of claims 3, 2 and 1 is disclosed clearly and unambiguously. Where there is an additional dependent claim 4 referring to any one of claims 1 through 3, thus the combination of subject matter of claims 4 and 1, claims 4, 2 and 1, claims 4, 3 and 1, and claims 4, 3, 2 and 1 is disclosed clearly and unambiguously. Brief explanation of the drawing

[0172] Fig. 1. Data distribution of HLA-H gene expression and subtype analysis candidate genes in bladder cancer, including FGF receptors, determined by RNAseq in muscle-invasive bladder cancer samples (n=407). Fig. 2. Spearman correlations of luminal, basal, and EMT markers and HLA-H expression determined by RNAseq in muscle-invasive bladder cancer samples (n=407). Fig. 3. Spearman correlation of HLA-H expression with clinical variables such as sex, histological subtype, age, and lymph node status in muscle-invasive bladder cancer samples (n=407). Fig. 4. Consort diagram of a group of advanced or metastatic urothelial carcinomas. After excluding FFPE blocks with insufficient and / or lymph node tissue, tissues from 55 patients were available for analysis. Fig. 5. Spearman correlation of HLA-H expression determined at the exon 2 / exon 3 boundary using subtype analysis markers determined by a standard IHC panel (n=55). Fig. 6. Spearman correlation of subtype analysis markers determined by RT-qPCR (n=55) and HLA-H expression determined at the exon 2 / exon 3 boundary. Fig. 7. Spearman correlation of HLA-H expression and FGFR target gene expression determined in exon 2 / exon 3 by RT-qPCR (n=55). Fig. 8. Kaplan-Meier plot showing disease-specific survival (DSS) probability in patients with muscle-invasive bladder cancer based on stratification by HLA-H exon 2 / 3 expression quantified by RT-qPCR analysis. Relative mRNA expression is determined by the 40-DCT method using CALM2 as a reference gene. Fig. 9. Kaplan-Meier plot showing disease-specific survival (DSS) probability in patients (n=17) with muscle-invasive bladder cancer metastasized to the lungs, bone, or liver based on stratification by HLA-H exon 2 / 3 expression quantified by RT-qPCR analysis. Relative mRNA expression is determined by the 40-DCT method using CALM2 as the reference gene. Fig. 10. Kaplan-Meier plot showing disease-specific survival (DSS) probability in patients (n=17) with muscle-invasive bladder cancer metastasized to the lung, bone, or liver based on stratification by HLA-H exon 2 / 3 and FGFR2 expression quantified by RT-qPCR analysis. Relative mRNA expression is determined by the 40-DCT method using CALM2 as a reference gene. Fig. 11. Kaplan-Meier plot showing disease-specific survival (DSS) probability in chemotherapy-resistant, muscle-invasive bladder cancer patients (n=18) treated with PD-L1-specific checkpoint inhibitors based on stratification by HLA-H exon 2 / 3 quantified by RT-qPCR analysis. Relative mRNA expression is determined by the 40-DCT method using CALM2 as a reference gene. Fig. 12. Kaplan-Meier plots showing disease-specific survival (DSS) probability in patients with chemotherapy-resistant, muscle-invasive bladder cancer based on IHC-based PD-L1 staining and stratification by HLA-H exon 2 / 3 for tumor-infiltrating immune cells quantified by RT-qPCR analysis as shown. Relative mRNA expression is determined by the 40-DCT method using CALM2 as a reference gene. Fig. 13. Kaplan-Meier plots showing disease-specific survival (DSS) probabilities in patients with chemotherapy-resistant, muscle-invasive bladder cancer stratified by IHC based on PD-L1 staining for tumor cells and HLA-H exon 2 / 3 quantified by RT-qPCR analysis as shown. Relative mRNA expression is determined by the 40-DCT method using CALM2 as a reference gene. Fig. 14. Consort diagram of a group of advanced or metastatic urothelial carcinomas. After excluding matched FFPE block pairs with insufficient tissue, 52 patients before and after neoadjuvant chemotherapy were available for analysis. Fig. 15. Data distribution of HLA-H gene expression and subtype analysis markers and drug targets of bladder cancer determined by RT-qPCR in naive TUR biopsies of muscle-invasive bladder cancer samples (n=52). Fig. 16. Spearman correlation of subtype analysis markers determined by RT-qPCR (n=52) and HLA-H expression determined at the exon 2 / exon 3 boundary. Fig. 17. Split study for pathological complete response (pCR) after 3 cycles of neoadjuvant chemotherapy (Gem / Cis) based on HLA-H exon 2 / exon 3 mRNA expression determined in TUR biopsy samples (n=52) by RT-qPCR. The number of patients in each group and the percentage of chemotherapy responses are indicated. Fig. 18. Split study for pathological complete response (pCR) after 3 cycles of neoadjuvant chemotherapy (Gem / Cis) based on HLA-H exon 2 / exon 3 mRNA expression determined in cystectomy samples (n=52) after chemotherapy by RT-qPCR. The number of patients in each group and the percentage of each chemotherapy response are indicated. Fig. 19. HLA-H exon 2 / exon 3 mRNA expression and HLA-G exon 2 / exon 3 mRNA expression before and after neoadjuvant chemotherapy, quantified by RT-qPCR analysis. Relative mRNA expression is determined by the 40-DCT method using CALM2 as the reference gene. Higher 40-DCT values ​​indicate higher gene expression. Due to the exponential nature of the PCR method, an increase of just 1 in each value signifies a doubling of gene expression. An increase of 3 DCT values ​​signifies an eightfold increase in HLA-H mRNA expression. Fig. 20. Spearman correlation of HLA-H exon 2 / exon 3 mRNA changes determined by RT-qPCR in samples (n=27) before and after chemotherapy with clinicopathological variables and response parameters. Specific details for implementing the invention

[0173] Examples illustrate the present invention.

[0174] Example 1: Spearman correlation between HLA-H expression and bladder cancer candidate genes

[0175] The first cohort consisted of 407 cases accumulated by the Cancer Genome Atlas (TCGA) research network from 19 sites (Network CGAR. Comprehensive molecular characterization of urothelial bladder carcinoma. Nature. 2014;507(7492):315-22. doi: 10.1038 / nature12965. PubMed PMID: 24476821; PubMed Central PMCID: PMCPMC3962515). RNA-Seq (HiSeq) was used for whole-genome analysis of tumor samples as previously described. In this manner, four molecular subtypes were defined based on mRNA expression patterns (i.e., TCGA subtypes): Subtypes I and II are described as luminal analogs; subtype I is defined by FGFR3 alterations and elevated FGFR3 expression, while subtype II is characterized by ERBB2 mutations and estrogen receptor beta (ESR2) enrichment. Subtypes III and IV are described as basal analogs defined by increased expression of epithelial lineage genes and stem / progenitor cell cytokeratin. Clinical and molecular data are publicly available on the cBioPortal for Cancer Genomics website (http: / / www.cbioportal.org / study?id=blca_tcga#clinical). The dataset was downloaded and validated. Since most patients in the TCGA cohort had muscle-invasive bladder cancer (MIBC), patients with stage T0 and T1 were excluded from the analysis. Except for 10 patients who received radiation therapy, the exact treatment regimen was not documented. Therefore, we used documented pN status as a surrogate for surgical treatment. All patients with pNX were excluded from the analysis, as were patients who had received prior therapy, final radiation therapy, or had documented metastases.We analyzed the associations between selected candidate markers for important oncobiological motifs such as HLA gene expression and molecular subtypes (e.g., KRT5, KRT20), hormonal axis (e.g., ESR1, ESR2), attachment motifs (e.g., CDH1, CDH2, CDH11), cell cycle genes (e.g., CCND1, CCNE2), and subtype-specific target genes (e.g., ERBB and FGFR).

[0176] As shown in Figure 1, the substantial amount of HLA-H "like gene" mRNA could be determined by RNA seq reaching an amount similar to that of well-defined genes such as ERBB2, CDH1, FGFR2, and FGFR3.

[0177] Next, we analyzed whether HLA-H expression was associated with other bladder cancer candidate genes for subtype analysis and drug targeting. As shown in Figure 2, HLA-H mRNA expression was negatively associated with the luminal subtype markers ESR2, ERBB2, ERBB3, CDH1, and KRT 20 (p<0.0001), but positively associated with the candidate genes for the basal subtype marker KRT5 (Spearman rho 0.2953; p<0.0001) and the epithelial-mesenchymal transition (EMT) marker SNAI1-3. Additionally, mRNA expression was negatively associated with FGFR2, FGFR3, and FGFR4 with median correlation coefficients ranging from Spearman rho -0.1813 to -0.2404 (p=0.0002, p<0.0001, and p<0.0001, respectively).

[0178] We then analyzed the association between HLA-H mRNA expression and tumor grade (papillary vs. non-papillary) according to tumor stage, nodule status, age, sex, and histological subtype in MIBC. As shown in Figure 3, HLA-H mRNA expression was significantly associated with the non-papillary histological subtype (p=0.0029). No significant associations were found with other clinical variables such as sex, age, or lymph node status.

[0179] Example 2: Determination of HLA mRNA expression levels by reverse transcription quantitative PCR (RT-qPCR) in a cohort of patients with muscle-invasive bladder cancer treated with checkpoint inhibitors after failure of chemotherapy following cystectomy

[0180] Paraffin-embedded tumor tissue specimens obtained from radical cystectomy and corresponding transurethral resection were taken from 78 patients with advanced urothelial carcinoma accompanied by intensively identified MIBC (pT2-T4). Patients were treated with therapeutic antibodies targeting the immunomodulatory checkpoint targets PD-1 or PD-L1. Ethical approval was obtained from all participating centers, and informed consent was obtained from all patients. For RNA extraction from FFPE tissue, a single 10 µm curl was processed according to a commercially available bead-based extraction method (XTRAKT kit; STRATIFYER Molecular Pathology GmbH, Cologne, Germany). Briefly, the melting of the paraffin was performed in a thermal mixer while the FFPE tissue fragments were liquefied using lysis buffer. Tissue lysis was performed with proteinase K solution. Subsequently, the lysate was mixed with germanium-coated magnetic particles in the presence of a special buffer that promotes nucleic acid binding. Purification was performed through a continuous cycle of mixing, magnetization, centrifugation, and decontamination. RNA was eluted with 100 µl of elution buffer, and the RNA eluent was stored at -80°C until use. All extracts were tested for sufficient high-quality RNA content by quantifying the constitutively expressed gene Calmodulin 2 (CALM2), known as a stable reference / housekeeper gene, using real-time qPCR (RT-qPCR). Samples with low CALM2 expression were excluded.

[0181] For detailed analysis of gene expression by the RT-qPCR method, primers adjacent to the target region and fluorescently labeled probes that hybridize between them were used. Target-specific primers and probes were selected using the NCBI Primer Design Tool (www.ncbi.nlm.nih.go). RNA-specific primer / probe sequences were used to enable RNA-specific measurements by positioning them across exon-exon boundaries. Additionally, primers / probes were selected so as not to bind to sequence regions containing known polymorphisms (SNPs). In cases where multiple isomers of the same gene are present, primers were selected to appropriately amplify all relevant or selected splice variants. The specificity of all primer pairs was verified by conventional PCR reactions.

[0182] After further optimizing the primers / probes, the primers and probes listed in Table 1 provided the best results. These primers / probes are superior to primers / probes known in the art, for example, in terms of specificity and amplification efficiency. TaqMan® validation experiments showed that the efficiency of the target and the efficiency of the control amplification were nearly identical, which is a prerequisite for the relative quantification of gene expression by the comparative ΔCT method.

[0183] Primers and probes used for HLA mRNA quantification gene Forward Primer probe Reverse primer HLA-G Ex2 / 3 CCGAACCCTCTTCCTGCTGC CGAGACCTGGGCGGGCTCCC GCGCTGAAATACCTCATGGA HLA-H Ex 2 / 3 GAGAGAACCTGCGGATCGC AGCGAGGGCGGTTCTCACACCATG CCACGTCGCAGCCATACAT KRT5 CGCCACTTACCGCAAGCT TGGAGGGCGAGGAATGCAGACTCA ACAGAGATGTTGACTGGTCCAACTC KRT20 GCGACTACAGTGCATATTACAGACAA TTGAAGAGCTGCGAAGTCAGATTAAGGATGCT CACACCGAGCATTTTGCAGTT PD-1 GGCCAGCCCCTGAAGGA ACCCCTCAGCCGTGCCTGTGTTC GGAAATCCAGCTCCCCATAGTC PDL1 CAAAGTGATACACATTTGGAGGAGACGTAA TGGCATCCAAGATACAAACTCAA TTGAAGATCAGAAGTTCCAATGCT CALM2 GAGCGAGCTGAGTGGTTGTG TCGCGTCTCGGAAACCGGTAGC AGTCAGTTGGTCAGCCATGCT ESR1 GCCAAATTGTGTTTGATGGATTAA ATGCCCTTTTGCCGATGCA GACAAAACCGAGTCACATCAGTAATAG ERBB1 TCTGGACGTGCCAGTGTGAA AGGCCAAGTCCGCAGAAGCCCT CCTGCTCCCTGAGGACACAT MMP28 TGCCTAACGCTAGCCTTCAGA CCTCCTAATGAAGAAAGGAAACCTAATCAGACCCC GGCTTAAGTCCCCAGCTTGA HPRT1 GGGTGTTTATTCCTCATGGACTAATT TGGACAGGACTGAACGTCTTGCTCGAG GGCCTCCCATCTCCTTCATC

[0184] The final cohort consisted of 55 cystectomy specimens taken from primary tumor tissue. Comparative analysis was performed using TUR biopsies and FFPE samples from metastatic lesions or concomitant upper urinary tract tumors (UTUC) whenever possible.

[0185] A gene-specific TaqMan-based primer / probe set was designed for the evaluation of HLA-H mRNA expression, and its sensitivity and specificity were tested. Immunohistochemical staining of CK5, CK20, GATA3, FOXA1, and CD44 was performed to determine whether HLA-H expression was associated with bladder cancer subtypes defined by international classification consensus. Representative FFPE blocks with at least 50% tumor content (minimum tumor size 5×5 mm), well-demarcated invasion margins, and the absence of necrotic areas or granulomatous inflammation were selected. All IHC stainings were performed and read from whole slide sections as follows. Immunohistochemical staining was performed on 4 µm tissue sections using an automated Ventana Benchmark Ultra autostainer (Ventana, Tucson, Arizona, USA).

[0186] Briefly, tissue sections were deparaffinized and heat-treated in Tris / Borate / EDTA solution pH 8.4 (Ventana) to recover antigens, and endogenous peroxidase was blocked with 1% H2O2. PDL1 immunostaining was performed using DAKO’s commercially available assay kits, which were adapted and validated for the Ventana platform (DAKO 28-8, DAKO, USA). CK5 (clone XM26, mouse, monoclone, DiagnosticBioSystems®, dilution 1:50), CK20 (clone Ks 20.8, mouse, monoclone, DAKO®, dilution 1:50), GATA3 (clone L50-823, mouse, monoclone, DCS®, dilution 1:100), CD44 (clone DF1485, mouse, monoclone, Dako®, dilution 1:50), and FOXA1 (clone AB55178, mouse, monoclone, Abcam, dilution 1:2000) were immunostained according to standardized and accredited staining protocols using a Benchmark Ultra autostainer (Ventana, USA). Trace was performed using an UltraVIEW™ DAB system (Ventana). All tissue sections were counterstained with hematoxylin II / Mayer's hematoxylin (Ventana).

[0187] As shown in Figure 5, when determining bladder cancer subtypes in a cohort of advanced, chemotherapy-resistant tumors by IHC, HLA-H mRNA expression is particularly associated with the stem cell marker CD44 (Spearman rho 0.3349; p=0.0125), which occurs more frequently in KRT5-positive basal bladder cancer.

[0188] Molecular subtype classification of bladder cancer has become a key tool for stratifying tumors into hormone-dependent luminal tumors with low immune cell infiltration and basal or inflammatory subtypes with high frequency of tumor infiltration, which affects survival in non-IO treatment settings for muscle-invasive bladder cancer (Pfannstiel C, Strissel PL, Chiappinelli KB, Sikic D, Wach S, Wirtz RM, Wullweber A, Taubert H, Breyer J, Otto W, Worst T, Burger M, Wullich B, Bolenz C, Fuhrich N, Geppert CI, Weyerer V, Stoehr R, Bertz S, Keck B, Erlmeier F, Erben P, Hartmann A, Strick R, Eckstein M; BRIDGE Consortium, Germany; BRIDGE Consortium, Germany; BRIDGE Consortium, Germany; BRIDGE Consortium, Germany. The Tumor Immune Microenvironment Drives a Prognostic Relevance That Correlates with Bladder Cancer Subtypes. Cancer Immunol Res. 2019 Jun;7(6):923-938. doi: 10.1158 / 2326-6066.CIR-18-0758. Epub 2019 Apr 15.).

[0189] Therefore, determining the correlation of HLA-H mRNA expression based on molecular subtype analysis and immune checkpoint targets has attracted significant interest. Additionally, to further explain the potential effects of splicing events occurring in relation to this previously anticipated "pseudogene," different primer probe sets were designed at distinct exon / exon boundaries.

[0190] As shown in Figure 6, mRNA expression of standard markers for molecular subtype analysis within a cohort of chemotherapy-resistant muscle-invasive bladder cancers showed a predominance of PD1-positive immune cell infiltrators in the baseline KRT5-positive subtype. However, there was no negative correlation between KRT5 and KRT20. This indicates that the selected treatment-resistant tumor population is heterogeneous. Interestingly, when quantifying exon / exon boundaries in exons 2 / 3 that code for the extracellular portion of HLA-H, including the exon 2 / exon 3 boundary strongly associated with high PD-L1 expression (Spearman rho 0.5053; p=0.0044), diversity in HLA-H mRNA was evident, whereas this was not the case for PD1 expression, which is dominant in the KRT5 and KRT20-negative subgroups of bladder cancer.

[0191] The correlation between mRNA expression of FGFR1, FGFR2, FGFR3, and FGFR4 and HLA-H splice variants was revealed, and isomers including exon 2 / exon 3 were not associated with FGFR mRNA expression (see Fig. 7). Furthermore, FGFR family expression can be determined as a predictor of survival in advanced or metastatic bladder cancer, and while FGFR2 is associated with favorable outcomes, mutations, fusions, or overexpression of FGFR3 are associated with adverse outcomes despite immuno-oncological treatment with checkpoint inhibitor drugs, as submitted elsewhere (EP19168923.1; applicant STRATIFYER Molecular Pathology GmbH).

[0192] This led to an investigation into whether the interaction between PD-L1 mRNA expression and HLA-H exon 2 / exon 3 mRNA expression affects survival in FGFR2-negative tumors, which have a higher risk of cancer-specific survival despite anti-PD-L1 and PD-1 therapy. As shown in Figure 8, patients with advanced or metastatic urothelial carcinoma exhibited significantly worse disease-specific survival when the primary FGFR2-negative tumor expressed HLA-H as determined by RNA-specific RT-qPCR, as determined from the start of first, second, or third-line treatment with immunomodulatory checkpoint inhibitors such as atezolizumab, pembrolizumab, or nivolumab. The survival probability of patients with FGFR2-negative tumors expressing high levels of HLA-H Ex2 / 3 was 10% after 2 years, whereas the survival probability of patients with FGFR2-negative tumors not expressing HLA-H Ex2 / 3 was 65% after 2 years (p=0.0013).

[0193] To further elucidate the relevance of HLA-H expression to survival after IO therapy, the analysis was refined by also considering the site of primary metastasis. This is based on the initial finding that IO therapy has differential effects depending on the site of metastasis, and is less effective for, for example, visceral metastases to the liver, likely due to the fact that PD1-positive T cells are excluded in the liver of patients with metastatic urothelial carcinoma, which is independent of classical checkpoint mechanisms (Eckstein M, Sikic D, Strissel PL, Erlmeier F. Evolution of PD-1 and PD-L1 Gene and Protein Expression in Primary Tumors and Corresponding Liver Metastases of Metastatic Bladder Cancer., Eur Urology 2018.). Accordingly, patients were grouped according to the first sign of metastasis, with local progression, local lymph nodes, or local retroperitoneal lymph nodes classified as 0 or 0.5, respectively, while bone, liver, lung, lung and bone, or lung and liver were classified with increasing indices (1, 2, 3, 4, and 5, respectively). For this analysis, a dataset of 55 primary tumor tissues with sufficient clinical dates and primary tumor tissue material was available. 20 patients had local progression or lymph node metastasis, while 18 patients had early metastasis to bone or liver and 17 patients had metastasis to lung involvement as a single site or with bone or liver involvement; however, all of them were treated with IO drugs and were mostly > first-line setting (74%).

[0194] Interestingly, negative results regarding HLA-H expression were particularly pronounced in metastatic cases. As shown in Figure 9, high HLA-H exon 2 / 3 mRNA expression (>= 29.95) was associated with inferior disease-specific survival, with 6 HLA-H exon 2 / 3 positive patients having only a 30% survival probability after 1 year, whereas 11 HLA-H exon 2 / 3 negative patients had an 80% survival probability after 1 year, which was a significant trend due to early crossover of the curves that impairs log-rank testing.

[0195] The predicted value may increase when FGFR2 expression is considered. As shown in Figure 10, high HLA-H exon 2 / 3 mRNA expression (>= 29.95) in FGFR-negative patients was associated with inferior disease-specific survival compared to HLA-H exon 2 / 3 positive patients, with a survival probability of only 0% after 1 year, whereas the survival probability after 1 year for HLA-H exon 2 / 3 & FGFR2-negative patients was 70%. Patients with metastatic bladder cancer with high FGFR2 expression had a disease-specific survival rate of 100% after 1 year (p=0.0012).

[0196] As previously mentioned, it was found that mRNA expression at the HLA-H exon 2 / exon 3 boundary is associated with PD-L1 mRNA expression (Spearman rho 0.5053; p=0.0044). Therefore, it seemed reasonable to stratify the entire patient cohort (advanced and metastatic, n=55) according to the basic principles of applied immunomodulatory checkpoint therapy, namely whether PD-1 or PD-L1 therapy was applied. Pembrolizumab and nivolumab bind to PD-1 positive T cells to specifically affect the checkpoint, whereas atezolizumab binds to PD-L1 present on tumor cells or macrophages and additional cell sources, potentially having more multifaceted effects. Importantly, the significance of HLA-H exon 2 / exon 3 boundary expression became particularly pronounced when looking only at patients treated with atezolizumab. As shown in Figure 11, high HLA-H exon 2 / 3 mRNA expression (>= 29.89) was associated with inferior disease-specific survival in HLA-H exon 2 / 3 positive patients, with a survival probability of only 10% after one year, whereas the survival probability after one year in HLA-H exon 2 / 3 negative patients was 80% (p=0.0240).

[0197] We further described the interaction between PD-L1 expression and HLA-H function and, in terms of multifaceted effects, stratified a cohort of patients with advanced and metastatic bladder cancer treated with immunomodulatory checkpoint inhibitors based on PD-L1 protein expression in immune cells (presumably macrophages) based on an IVD test for PD-L1 determination. Here, a cutoff for positivity in 5% of immune cells was chosen to exclude nonspecific staining effects on macrophages based on basic peroxidase activity unrelated to the IHC detection system.

[0198] Interestingly, patients with a low frequency of immune cell infiltration in PD-L1-positive tumors had higher survival rates, whereas patients with a high frequency of PD-L1-positive tumor-infiltrating immune cells showed lower survival rates, particularly when expressing HLA-H exon 2 / exon 3 isomers. As shown in Figure 12, high HLA-H exon 2 / 3 mRNA expression (>= 29.95) was associated with inferior disease-specific survival in patients with more than 5% PD-L1-positive immune cells and in HLA-H exon 2 / 3-positive patients, with a survival probability of only 10% after one year, whereas HLA-H exon 2 / 3-negative patients and patients with low or low frequency of PD-L1-positive immune cells had a survival probability of 60% after one year (p= 0.0156).

[0199] However, knowing that there is overlap between tumor tissues containing PD-L1 positive immune cells and PD-L1 positive tumor cells, we also investigated the interaction between HLA-H expression and PD-L1 expression in tumor cells by taking a standard cutoff of 10% PD-L1 positive tumor cells.

[0200] Again, PD-L1 positive patients with high HLA-H exon 2 / exon 3 expression had inferior survival compared to patients with lower HLA-H exon 2 / exon 3 expression. As shown in Figure 13, high HLA-H exon 2 / 3 mRNA expression (>= 33.19) was associated with inferior disease-specific survival in HLA-H exon 2 / 3 positive patients with at least 10% PD-L1 positive tumor cells and a survival probability of only 0% after 1 year, whereas HLA-H exon 2 / 3 negative patients had a survival probability of 40% after 1 year and patients with less than 10% or no PD-L1 positive tumor cells had a survival probability of 65% (p=0.0022).

[0201] Example 3: Determination of HLA-H mRNA expression levels by reverse transcription quantitative PCR (RT-qPCR) in a cohort of patients with muscle-invasive bladder cancer who received prior treatment with 3 cycles of gemcitabine / cisplatinium chemotherapy

[0202] Paraffin-embedded tumor tissue specimens obtained from transurethral resection and corresponding radical cystectomy prior to chemotherapy were obtained from 55 patients with advanced urothelial carcinoma with histologically confirmed MIBC, UICC stages II and III (cT2-3 and cN0 or cN+M0). The patients were administered gemcitabine 1250 mg / m² 2 (d1, d8) and cisplatin 70 mg / m² 2Radical cystectomy was performed after three preceding cycles of (d1). The primary inclusion criterion was the availability of FFPE tissue before and after treatment. The primary exclusion criterion was variant histology to obtain a homogeneous bladder cancer cohort for analysis. Ethical approval was obtained from the participating centers, and informed consent was obtained from all patients. For RNA extraction from FFPE tissue, single 10 µm curls were processed according to a commercially available bead-based extraction method (XTRAKT kit; STRATIFYER Molecular Pathology GmbH, Cologne, Germany). Briefly, the melting of paraffin was performed in a thermal mixer while liquefying the FFPE tissue fragments using lysis buffer. Tissue lysis was performed with proteinase K solution. Subsequently, the lysate was mixed with germanium-coated magnetic particles in the presence of a special buffer that promotes nucleic acid binding. Purification was performed through a successive cycle of mixing, magnetization, centrifugation, and decontamination. RNA was eluted with 100 µL of elution buffer, and the RNA eluent was stored at -80°C until use. All extracts were tested for sufficient high-quality RNA content by quantifying the constitutively expressed gene Calmodulin 2 (CALM2), known as a stable reference / housekeeper gene. Samples with low CALM2 expression were excluded. The final cohort consisted of 52 cystectomy specimens from primary tumor tissue after excluding 6 samples due to insufficient tumor material. Comparative analysis was performed using FFPE samples from TUR biopsies and cystectomy tissues.

[0203] To confirm the importance of HLA-H expression in bladder cancer apart from IO therapy, HLA-H was quantified in a cohort of muscle-invasive bladder cancers of similar size that had not yet been treated with systemic therapy. As shown in Figure 15, the substantial amount of HLA-H "like gene" mRNA at the exon 2 / exon 3 boundary could be determined by RT-qPCR. In addition, bladder cancer subtype analysis markers (KRT5, KRT20) and targets (PD-1, PD-L1, ESR1, ERBB2, FGFR1-4) were determined.

[0204] First, the association between HLA-H and bladder cancer subtype analysis markers and targets was evaluated in TUR biopsies from a preceding MIBC cohort. As shown in Figure 16, HLA-H expression determined by RT-qPCR at the exon 2 / exon 3 boundary was positively associated with KRT5 and FGR1 expression, both of which are associated with the baseline phenotype. Additionally, there was a negative association with KRT20 and ESR1, with KRT20 being a classic luminal marker. Thus, although the associations did not potentially reach statistical significance due to the limited sample size, they reflected the initial findings in the majority of cystectomy samples from 400 MIBCs, including T1 tumors and variant tissues.

[0205] Next, HLA-H exon 2 / exon 3 mRNA expression correlated with the response to three cycles of neoadjuvant chemotherapy (Gem / Cis) as described above, along with a pathological complete response defined as the absence of significant tumor cells in surgical specimens (cystectomy) following chemotherapy. A total of 42% of patients achieved a pathological complete response. When patients were stratified in a split trial based on relative HLA-H exon 2 / exon 3 mRNA expression, tumors expressing high levels of HLA-H, which accounted for 60% of all tumors, showed a twofold decrease in responsiveness to neoadjuvant chemotherapy; HLA-H positive tumors responded in 29% of cases, while HLA-H negative tumors responded in 62% of cases. This indicates that HLA-H expression was determined from bladder cancer biopsy material prior to chemotherapy. 70% of all tumors with high HLA-H expression did not respond to neoadjuvant chemotherapy.

[0206] Next, HLA-H exon 2 / exon 3 mRNA expression was measured in cystectomy specimens after 3 cycles of neoadjuvant chemotherapy (Gem / Cis). As shown in Figure 18, HLA-H expression remained equally high in non-responding tumors, and nearly identical separation was maintained between resistant and responding tumors. 70% of all tumors with high HLA-H expression did not respond to neoadjuvant chemotherapy.

[0207] Example 4: Determination of HLA-H mRNA expression levels by reverse transcription (RT) quantitative PCR (RT-qPCR) in a cohort of patients with advanced ovarian cancer who received prior treatment with 6 cycles of paclitaxel / cisplatinium chemotherapy

[0208] Between September 2004 and December 2007, 45 newly diagnosed patients with histologically confirmed FIGO stage III-IV epithelial ovarian or peritoneal cancer (hereinafter referred to as ovarian cancer) unsuitable for optimal neoadjuvant surgery and newly diagnosed as candidates for neoadjuvant chemotherapy were enrolled in the study. Other inclusion criteria were age 18 years or older and hematological, renal, hepatic, and cardiac functional suitability for platinum-based chemotherapy. Exclusion criteria were Karnofsky performance status (KPS) of less than 70%, a history of other malignancies, and contraindications to surgery. The possibility of optimal volume reduction surgery was excluded at baseline by open laparoscopy. The initial study population of 45 patients was limited to 35, excluding 9 patients whose biopsy samples were unsuitable for microarray analysis and 1 patient who was found ineligible due to a diagnosis of peritoneal mesothelioma after histological correction. Standard therapy of carboplatin AUC 5 and paclitaxel 175 mg / m2 Q3 was administered as prior treatment for 6 cycles over 3 hours every 3 weeks. In 3 patients aged 75 years or older and 1 patient with poor performance (KPS 70%), monotherapy with carboplatin was preferred over combination chemotherapy.

[0209] Histopathological response was evaluated postoperatively along with analysis of surgical samples. To date, histopathological criteria for describing the therapeutic response following neoadjuvant chemotherapy in ovarian cancer have not been firmly established. According to the literature on responses to first-line chemotherapy in ovarian (Le et al. 2007, Sassen et al. 2007) and breast (Ogston et al. 2003), a complete pathological response postoperatively was considered to be the absence of cancer cells in the surgical specimen, while a very good partial remission was considered to be the persistence of only small clusters (<1 cm) or individual cancer cells and the absence of macroscopic residues. Partial pathological remission was defined as a reduction in tumor burden of 30% to 90% at the time of surgery, whereas stable disease was defined as no reduction in tumor burden or a reduction of less than 30% at the time of surgery compared to the initial diagnostic laparoscopy. Only patients exhibiting complete and very good partial remissions were considered pathological responders, while all other cases were considered pathological non-responders.

[0210] Tissues collected for mRNA analysis were rapidly frozen and stored in liquid nitrogen until analysis. Approximately 20–100 mg of frozen ovarian tumor tissue was pulverized in liquid nitrogen. RNA was extracted using a commercial kit (Qiagen), and RNA integrity was evaluated using an Agilent 2100 Bioanalyzer (Agilent Technologies, Palo Alto, CA, USA). cDNA was synthesized from 1 mg of total RNA using an Invitrogen kit (Invitrogen Corp.), by RT-qPCR using a set of RNA-specific primer probes for HLA-H, and by target genes as well as subtype analysis markers. Analysis was limited to cases where pre- and post-treatment tissue samples were available, and matched pair analysis was possible for a total of 29 patients.

[0211] Similar to the situation with bladder cancer described above, substantial amounts of HLA-H mRNA could be detected in RNA extracts from ovarian cancer patients who underwent pre-treatment biopsy and post-treatment resection, reaching levels similar to those of HLA-G in the same tissue. However, the median mRNA expression for HLA-H exon 2 / exon 3 was lower than that of HLA-G exon 2 / exon 3 (35.00 in 40-DCT) (31.22 in 40-DCT). As expected, there was no close correlation between HLA-H and HLA-G expression.

[0212] When the difference in HLA-H exon 2 / exon 3 mRNA expression was associated with pathological response before and after chemotherapy, an inverse relationship was found between increased HLA-H expression and pathological response after chemotherapy, as indicated by Pearson correlation (r=-0.2290) and Spearman correlation (r=-0.1922). As shown in Figure 20, the correlation with pathological stage revealed that increased HLA-H expression was positively correlated with higher Figo stages (Spearman r = 0.4219; p=0.0226), indicating that clinically more aggressive tumors respond to chemotherapy by increasing HLA-H expression. Interestingly, this ability tended to be dominant in lower-grade tumors (Spearman r = -0.3274; p=0.095).

Claims

Claim 1 A composition comprising a nucleic acid molecule, a protein, or a peptide for tumor diagnosis, tumor grading, tumor prognosis prediction, or tumor classification into HLA-H low-expression tumors or HLA-H high-expression tumors in a sample obtained from a subject, wherein (I) the nucleic acid molecule encodes a polypeptide consisting of an amino acid sequence of SEQ ID NO: 1 or 54; or (b) consists of a nucleotide sequence of SEQ ID NO: 2; or (c) corresponds to the nucleic acid molecule of either (a) and (b), wherein T is replaced with U; and (II) the protein or peptide is encoded by the nucleic acid molecule of (I), and the tumor is bladder cancer or ovarian cancer. Claim 2 A method for providing information for diagnosing a tumor, comprising the step of detecting the presence of a nucleic acid molecule, a protein, or a peptide in a sample obtained from a subject, wherein the presence of the nucleic acid molecule, a protein, or a peptide is an indicator of a tumor in the subject, wherein (I) the nucleic acid molecule is (a) encoding a polypeptide consisting of an amino acid sequence of SEQ ID NO: 1 or 54; or (b) consisting of a nucleotide sequence of SEQ ID NO: 2; or (c) corresponding to any one of the nucleic acid molecules of (a) and (b), wherein T is replaced with U; and (II) the protein or peptide is encoded by the nucleic acid molecule of (I), and the tumor is bladder cancer or ovarian cancer. Claim 3 A method for providing information for tumor grading or tumor prognosis prediction, comprising the step of determining the level of a nucleic acid molecule or a protein or peptide in a sample obtained from a subject, wherein the increased level of said nucleic acid molecule or protein or peptide compared to a control is correlated with a higher grade of the tumor or a poor prognosis of the tumor, wherein (I) said nucleic acid molecule is (a) encoding a polypeptide consisting of an amino acid sequence of SEQ ID NO: 1 or 54; or (b) consisting of a nucleotide sequence of SEQ ID NO: 2; or (c) corresponding to any one of (a) and (b), wherein T is replaced with U; and (II) said protein or peptide is encoded by the nucleic acid molecule of (I), and said tumor is bladder cancer or ovarian cancer. Claim 4 A kit for tumor diagnosis, tumor grading, or tumor prognosis prediction comprising (a) means for detecting and / or quantifying a nucleic acid molecule or a protein or peptide in a sample obtained from a subject, and (b) instructions for use of the kit, wherein (I) the nucleic acid molecule is (a) encoding a polypeptide consisting of an amino acid sequence of SEQ ID NO: 1 or 54; or (b) consisting of a nucleotide sequence of SEQ ID NO: 2; or (c) corresponding to any one of the nucleic acid molecules of (a) and (b), wherein T is replaced with U; and (II) the protein or peptide is encoded by the nucleic acid molecule of (I), and the tumor is bladder cancer or ovarian cancer. Claim 5 A method for providing information for monitoring the non-efficacy of tumor treatment in a subject with a tumor, comprising: (a) determining the amount of a nucleic acid molecule, protein, or peptide in a sample obtained from the subject before the start of treatment; and (b) determining the amount of said nucleic acid molecule, protein, or peptide in a sample obtained from the subject one or more times after the start of treatment, wherein an increased amount in b) compared to a) is an indicator of the non-efficacy of the tumor treatment, or a decreased amount in b) compared to a) is an indicator of the efficacy of the tumor treatment, wherein (I) said nucleic acid molecule is (a) encoding a polypeptide consisting of an amino acid sequence of SEQ ID NO: 1 or 54; or (b) consisting of a nucleotide sequence of SEQ ID NO: 2; or (c) corresponding to any one of the nucleic acid molecules of (a) and (b), wherein T is replaced with U; and (II) said protein or peptide is encoded by the nucleic acid molecule of (I), and said tumor is bladder cancer or ovarian cancer. Claim 6 A method for providing information for monitoring the non-efficacy of immunosuppressive therapy in a subject requiring such therapy, comprising: (a) determining the amount of a nucleic acid molecule, protein, or peptide in a sample obtained from the subject prior to the start of therapy; and (b) determining the amount of said nucleic acid molecule, protein, or peptide in a sample obtained from the subject one or more times after the start of therapy, wherein the amount decreased in b) compared to a) is an indicator of the non-efficacy of the immunosuppressive therapy, or the amount increased in b) compared to a) is an indicator of the efficacy of the immunosuppressive therapy, wherein (I) said nucleic acid molecule is (a) encoding a polypeptide consisting of an amino acid sequence of SEQ ID NO: 1 or 54; or (b) consisting of a nucleotide sequence of SEQ ID NO: 2; or (c) corresponding to any one of the nucleic acid molecules of (a) and (b), wherein T is replaced with U; and (II) the protein or peptide is encoded by the nucleic acid molecule of (I), and the subject is a patient with bladder cancer or ovarian cancer, method. Claim 7 A method of providing information that, in any one of paragraphs 2, 3, 5 and 6, the sample is a sample of body fluid or tissue of an organ. Claim 8 delete Claim 9 delete Claim 10 delete Claim 11 delete Claim 12 delete Claim 13 delete Claim 14 delete

Images