The method for enhanced light stability of a colorless-carotenoid phytoene using the recombinant escherichia coli strain producing biodegradable polymer and the method for overproduction of natural phytoene using this strain

Abstract

The present invention relates to providing a recombinant E. coli strain PHY3 capable of simultaneously producing high-performance phytoen and 3HB polymer, and to mass-producing phytoen with improved photostability through the cultivation of said strain. The PHY3 strain of the present invention can effectively produce phytoen by overexpressing the crtB, crtE, and dxs genes and introducing the mevalonic acid synthesis pathway. Furthermore, by overexpressing the phaCAB gene to enable the production of 3HB polymer, it is possible to induce the simultaneous production of phytoen and 3HB polymer from glucose, along with the encapsulation of phytoen within the 3HB polymer. The in vivo encapsulated phytoen produced by the PHY3 strain prepared in the present invention possesses strong physical stability against room temperature and light exposure, making it highly advantageous for maintaining constant efficacy over a long period; thus, it can be widely utilized in various high-value-added industrial fields such as health supplements, functional cosmetics, and pharmaceuticals.

Description

Technology Field

[0001] The present invention relates to a method for improving the photostability of colorless carotenoid phytoene produced by recombinant E. coli having high phytoene production, and a method for mass-producing natural phytoene using the same. Specifically, the invention relates to a method for increasing the light durability of biosynthesized phytoene and improving phytoene productivity by in vivo encapsulating phytoene synthesized within the cells of recombinant E. coli that simultaneously produces high phytoene and biodegradable polymers into the biodegradable polymer poly-3-hydroxybutyrate. Background Technology

[0003] Carotenoids are one of the compounds produced by plants, algae, and microorganisms, consisting of a 40-carbon chain (C 40 It is one of the terpenoid group composed of ). Representative carotenoids include beta-carotene, lycopene, astaxanthin, and lutein. These possess powerful antioxidant properties and are known to have beneficial effects on the human body, such as anticancer, anti-inflammatory, immune-boosting, and anti-aging effects, and are utilized in various industrial fields including food, health supplements, fibers, medicine, and cosmetics.

[0004] As most commercially available carotenoids are artificially synthesized pigments that have been found to cause adverse effects and act as carcinogens in the human body, the demand for natural carotenoids is gradually increasing. However, since most commercially available natural carotenoids are recovered from plants, their economic viability is low due to the high unit costs of plant cultivation and additional processing for extraction; furthermore, productivity and production yield are significantly lower compared to chemically synthesized carotenoids.

[0005] Recently, research on the production of natural carotenoids via microorganisms has been actively conducted as an alternative to overcome the shortcomings of chemically synthesized and plant-derived carotenoids. Furthermore, technologies to enhance the productivity of natural carotenoids are being developed through metabolic engineering, synthetic biology, and fermentation processes. However, due to the structural characteristics of carotenoids, long-term preservation is very difficult because their physical stability against high temperatures and light sources is low. Therefore, technologies to improve the physical stability of carotenoids are required.

[0006] Studies on encapsulating bioactive compounds, including carotenoids, to enhance durability and protect and maintain their activity over long periods are being reported. Polysaccharides, polymers, whey proteins, gelatin, and oils are utilized as materials for encapsulation; these materials are known to possess high hydrophobicity and can form hydrophobic and covalent interactions with hydrophobic bioactive compounds.

[0007] In addition, along with the discovery of materials for the aforementioned encapsulation, various encapsulation methods such as spray drying, emulsification, coacervation, and nanoliposomes have been devised. It has been reported that encapsulated bioactive compounds exhibit increased durability and stability against activity degradation or decomposition caused by physicochemical factors such as humidity, temperature, pH, and light, and that their long-term storage and preservation periods are improved. However, the aforementioned encapsulation methods have limitations in establishing a mass production system because the process is complex and involves multiple steps, resulting in poor uniformity, and the selection of appropriate encapsulation materials based on the physical properties of the bioactive compounds is difficult.

[0008] Therefore, the development of encapsulation technology to enhance the biological production and physicochemical stability of carotenoids, which are bioactive compounds with excellent antioxidant capacity, is considered to be highly advantageous for economic efficiency and commercialization in terms of supply and preservation in various industrial fields such as food, cosmetics, and medicine.

[0009] Prior art regarding a method for mass production of carotenoids is Korean Published Patent No. 10-2021-0089897 A method for producing lycopene by introducing the crtE, crtI, crtB, and ipiHp1 genes into transformed Escherichia coli in which the pfkA and pfkB genes are deleted and the gntR gene is mutated; or the edd and eda genes are introduced and the galR gene is mutated; or the galP gene is introduced, is disclosed in "Transformed Escherichia coli with inactivated Emden-Meyerhof-Parnas pathway and uses thereof," and a method for producing lycopene in large quantities using Escherichia coli transformed with a recombinant vector containing the crtE, crtI, and crtB genes is disclosed in Korean Patent Publication No. 10-2007-0082647 "Method for mass production of lycopene by Escherichia coli."

[0010] However, there is currently no technology regarding a mass production method for carotenoids with enhanced photostability through encapsulation. Accordingly, the inventors have completed the present invention by preparing a recombinant E. coli strain capable of simultaneously biosynthesizing a natural colorless carotenoid phytoene with high antioxidant activity and a biodegradable polymer, and by developing a method to synthesize biosynthesized phytoene with increased physical stability by inducing encapsulation within the strain. The problem to be solved

[0012] The objective of the present invention is to provide a method for increasing the stability of phytoene against light by using a recombinant E. coli strain that simultaneously produces high production capacity of colorless carotenoid phytoene and a biodegradable polymer to biosynthesize the biodegradable polymer poly-3-hydroxybutyrate (3HB) and induce the encapsulation of the hydrophobic metabolite phytoene into 3HB. means of solving the problem

[0014] In order to achieve the above objective,

[0015] The present invention provides a recombinant vector comprising the genes crtE (geranylgeranyl pyrophosphate synthase), crtB (phytoene synthase), and dxs (1-deoxy-D-xylulose-5-phosphate synthase).

[0016] In addition, the present invention provides a recombinant microorganism transformed with the recombinant vector.

[0017] In addition, the present invention comprises the step of culturing the microorganism to produce phytoene; and

[0018] A method for manufacturing phytoene is provided, comprising the step of recovering the generated phytoene. Effects of the invention

[0020] The recombinant E. coli produced in the present invention has been metabolically engineered to simultaneously possess the ability to produce phytoene with high antioxidant capacity and to biosynthesize 3HB, a biodegradable polymer. It was confirmed that by inducing the encapsulation of phytoene within 3HB synthesized within the cell through a simple culture process of the recombinant E. coli, the productivity of phytoene can be improved, while simultaneously compensating for the low photostability of carotenoids. Therefore, the recombinant E. coli strain for producing phytoene and 3HB provided in the present invention possesses high phytoene production capacity and, through improved photostability of phytoene, offers the effect of reducing production and storage costs of said compounds. Furthermore, it can be applied to already commercialized carotenoids such as astaxanthin, lycopene, and beta-carotene, and since it undergoes simpler process steps than existing methods for stabilizing bioactive compounds, it is expected to be utilized as a source technology and source biological material in high value-added industries such as food, cosmetics, and pharmaceuticals. Brief explanation of the drawing

[0022] Figure 1 is a schematic diagram of the metabolic pathway of recombinant E. coli capable of producing phytoene and 3HB polymer. FIG. 2a is a Deinococcus radiodurans derived prepared according to the method of the present invention (Example 1). crtB and crtE This is a graph confirming the phytoen production ability of recombinant E. coli PHY1 co-overexpressing genes by HPLC. FIG. 2b is a graph showing the phytoene production ability of a recombinant E. coli PHY2 strain improved according to the method of the present invention (Example 2). Figure 3 is the result of confirming the presence or absence of 3HB polymer biosynthesis in the recombinant E. coli PHY3 strain improved according to the method of the present invention (Example 3). Figure 4 is a transmission electron microscope image confirming the 3HB polymer production ability of a recombinant E. coli PHY3 strain improved according to the method of the present invention (Example 3). Figure 5 is a graph showing the phytoen productivity of a recombinant E. coli PHY3 strain capable of producing phytoen and 3HB. Figure 6 is a fluorescence microscope image confirming the encapsulation of phytoene by 3HB polymer. Figure 7a is a graph showing phytoene stability under dark conditions. Figure 7b is a graph showing the stability of phytoene under light exposure conditions. Specific details for implementing the invention

[0023] The present invention will be described in detail below.

[0024] The present invention provides a recombinant vector comprising the genes crtE (geranylgeranyl pyrophosphate synthase), crtB (phytoene synthase), and dxs (1-deoxy-D-xylulose-5-phosphate synthase).

[0025] The above crtE gene is denoted by SEQ ID NO. 1, the above crtB gene is denoted by SEQ ID NO. 2, and the above dxs gene is denoted by SEQ ID NO. 3.

[0026] In the present invention, the term, “ crtB ” The gene is a gene that encodes phytoene synthase and can synthesize two molecules of geranylgeranyl pyrophosphate into phytoene.

[0027] In the present invention, the term, “ crtE ” The gene is a gene encoding geranylgeranyl pyrophosphate synthase, which can synthesize geranylgeranyl pyrophosphate via geranyl pyrophophate using dimethylallyl pyrophate and isopentenyl pyrophosphate as precursors.

[0028] In the present invention, the term, “ dxs ” The gene is a gene encoding 1-deoxy-D-xylulose-5-phosphate synthase, which can synthesize 1-deoxy-D-xylulose-5-phosphate using pyruvate and glyceraldehyde-3-phosphophate as substrates.

[0029] The crtE gene, crtB gene, and dxs gene of the present invention are characterized by being derived from Deinococcus radiodurans.

[0030] The vector of the present invention may further include the idi(isopentenyl-pyrophosphate delta-isomerase) gene and the mvaESK1K2D gene group.

[0031] The above idi gene is denoted by sequence number 4, and the above mvaESK1K2D gene group is denoted by sequence number 5.

[0032] In the present invention, the term, “ idi ” The gene is an E. coli-derived gene encoding the enzyme isopentenyl-pyrophosphate delta-isomerase, and functions to regulate the balance of dimethylallyl pyrophosphate and isopentenyl pyrophosphate concentrations in E. coli.

[0033] In the present invention, the term, “ mvaESK1K2D ” The gene family of Enterococcus faecalis encoding acetoacetyl-CoA thiolase ( Enterooccus faecalis ) Origin mvaE of homologous strains encoding the gene, HMG-CoA synthase mvaS The gene, mevalonate-5-kinase, is derived from a homologous strain encoding mevalonate kinase. mvaK2 Streptococcus pneumoniae encoding genes and diph ( Streptococcus pneumoniae ) Origin mvaK1 Gene derived from a homologous strain encoding phosphomevalophomevalonate decarboxylase mvaD It is involved in synthesizing isopentenyl pyrophosphate from acetyl-CoA with a polynucleotide containing a gene.

[0034] The vector of the present invention may further include the phaCAB gene group.

[0035] The above phaCAB gene is denoted by sequence number 6.

[0036] In the present invention, the term, “ phaCAB ” The gene family is derived from the Ralstonia eutropha H16 strain encoding the poly(3-hydroxybutyrate) polymerase enzyme. phaCGene derived from a homologous strain encoding the acetyl-CoA acetyltransferase enzyme phaA Derived from homologous strains encoding the gene and acetoacetyl-CoA reductase enzyme phaB It is involved in synthesizing 3HB polymer from acetyl-CoA with polynucleotides composed of genes.

[0037] In the present invention, the term "gene" refers to a sequence of nucleotides of a nucleic acid molecule (chromosome, plasmid, etc.) to which genetic function is associated. Genes may code for expression products such as polypeptides or polynucleotides. Generally, a gene includes a coding sequence, such as a polypeptide coding sequence, and a non-coding sequence, such as a promoter sequence, a polyadenylation sequence, and a transcriptional regulatory sequence (e.g., an enhancer sequence). Many eukaryotic genes have "exons" (coding sequences) interposed with "introns" (non-coding sequences).

[0038] In the present invention, the term "vector" means a nucleic acid molecule that delivers an inserted nucleic acid molecule into and / or between host cells. This term includes a vector that functions for the insertion of DNA or RNA into a cell, a replica of a vector that functions primarily for the replication of DNA or RNA, and an expression vector that functions for the transcription and / or translation of DNA or RNA. Additionally, vectors providing one or more of the above functions are also included.

[0039] The vector may be a plasmid, a phage particle, or simply a potential genomic insert, for example, a pETL or pET21a plasmid. When transformed into a suitable host microorganism, the vector may replicate and function independently of the host genome, or in some cases, be integrated into the genome itself. In this invention, "plasmid" and "vector" are used interchangeably.

[0040] The recombinant vector of the present invention may include a promoter base sequence.

[0041] The above promoter can be selected from the group consisting of the trc promoter, tac promoter, T7 promoter, lac promoter, and trp promoter.

[0042] In the present invention, the term "promoter" refers to an upstream region of a gene involved in the initiation of transcription (the step of synthesizing RNA from DNA). That is, it refers to a part of a DNA strand to which RNA polymerase binds, or a region where RNA complementary to a DNA strand is synthesized, i.e., transcription begins. Generally, it is mostly located within 1 kbps from the starting region of a specific gene, and the part that promotes transcription outside of this is called an enhancer.

[0044] The present invention provides a recombinant microorganism transformed with the above-mentioned recombinant vector.

[0045] The above recombinant microorganism may be selected from the group consisting of Escherichia coli, Salmonella typhi, Salmonella typimurium, Vibrio cholerae, Mycobacterium bovis, Shigella, Bacillus, Lactobacillus, Staphylococcus, Corynebacterium, Listeria monocytogenes, and Streptococcus.

[0046] The recombinant microorganism of the present invention has high phytoene production ability and poly-3-hydroxybutyrate (3HB) biosynthesizing ability.

[0047] In the present invention, the term "transformation" refers to the process in which extracellular DNA is introduced into a host cell with or without accompanying material. "Transformed cell" refers to a cell into which extracellular DNA has been introduced. Upon introduction into the cell, the DNA may be inserted into a chromosome as nucleic acid or replicated into an extrachromosomal substance.

[0048] In the present invention, the term "recombinant microorganism" refers to a microorganism created by modifying a portion of a gene to suit a specific purpose using genetic recombination technology, such as introducing a useful gene from one organism into another microorganism, deleting a portion of a host microorganism's gene, or regulating its expression level. The above term may be replaced with terms such as "genetically modified microorganism" or "recombinant strain."

[0049] The term “phytoene” in this invention is C 40 H 64 Phytoene is a colorless carotenoid composed of carbon atoms and is a 40-carbon compound that serves as a metabolic intermediate in the biosynthesis of carotenoids. The synthesis of phytoene is the first committed step in the synthesis of carotenoids in plants. Phytoene is produced from two molecules of geranylgeranyl pyrophosphate (GGPP) by phytoene synthase. Two molecules of geranylgeranyl pyrophosphate condense together, and then form phytoene through the removal of pyrophosphate and the transfer of protons.

[0050] The term "Poly-3-hydroxybutyrate (3HB)" in this invention refers to the first discovered polyhydroxyalkanoic acid (PHA), a polyhydroxyalkanoate composed of a 3-hydroxybutyrate (C4H8O3) monomer, and is the most widely studied bioplastic. PHB is a cellular storage material accumulated as a carbon source and energy source by various microorganisms, and is a type of polyester composed of 3-hydroxybutyric acid (3HB).

[0052] The present invention comprises the step of culturing the microorganism to produce phytoene; and

[0053] A method for manufacturing phytoene is provided, comprising the step of recovering the generated phytoene.

[0054] The above phytoen may be encapsulated within a 3HB polymer.

[0055] The above phytoene can have stability against light exposure by being encapsulated within a 3HB polymer.

[0057] The inventors of the novel carotenoid deinoxanthin-producing microorganism Deinococcus radiodurans crtB and crtE A recombinant E. coli strain capable of producing phytoenes was produced by introducing a gene into E. coli and named PHY1. Subsequently, Deinococcus radiodurans's gene was introduced into the PHY1 strain dxs Genes and gene groups corresponding to the mevalonic acid pathway mvaESK1K2D and the above E. coli gene idi A recombinant Escherichia coli PHY2 strain having high phytoen production capacity was prepared by additionally introducing and overexpressing. In addition, for the biosynthesis of the biodegradable polymer 3HB polymer in the PHY2 strain Ralstonia eutropha H16 strain phaCAB Introduce a gene group into the PHY2 strain and phaCAB Recombinant E. coli PHY3 with introduced genes was prepared (see Fig. 1).

[0058] In addition, phytoene was extracted from the above PHY1 and 2 strains using a solvent mixed with methanol and acetone, and HPLC analysis was performed in combination with phytoene standard samples and wild-type E. coli extracts. It was confirmed through retention time that the strains could produce phytoene (see Figs. 2a and 2b). Furthermore, to confirm whether the PHY3 strain synthesized 3HB polymer, a plate assay was performed using LB agar plates containing NileRed (see Fig. 3), and the intracellularly biosynthesized 3HB polymer was confirmed via transmission electron microscopy (see Fig. 4).

[0059] The production volume of biosynthesized phytoene was measured (see Fig. 5). Additionally, confocal microscopy revealed that the biosynthesized phytoene was located within the hydrophobic cell membrane and 3HB, confirming that 3HB encapsulated the phytoene in vivo (see Fig. 6).

[0060] Subsequently, to evaluate the photostability of phytoen encapsulated within a recombinant E. coli strain, the PHY3 strain was freeze-dried, and the residual concentration of phytoen contained in the PHY3 strain was quantified by HPLC while the sample was continuously exposed to a fluorescent lamp for 10 days. As a result, it was confirmed that it exhibited superior photostability compared to phytoen produced from the PHY2 strain prepared under the same conditions (see Figures 7 a and b).

[0063] The present invention will be explained in detail below through the following examples. However, the following examples are merely illustrative of the present invention and do not limit the present invention.

[0065] <Example 1> Preparation of Recombinant Escherichia Coli Strain PHY1 with Phytoene Production Ability

[0066] 1-1. Culture Methods and Experimental Materials for Escherichia coli or Recombinant Escherichia coli

[0067] Example 1-1 above provides an experimental example that is commonly applied to each example, including culture conditions and culture methods for screening Escherichia coli or recombinant Escherichia coli as specified in the present invention, and an overexpression plasmid used in the present invention.

[0068] In the present invention, as a cloning host Escherichia coliThe TOP10 strain (hereinafter referred to as TOP10 strain) was used as the host strain for the production of phytoen and 3HB polymers. The plasmids ptrc99a, pMVA2RBS035, and pBBRMCS1 were used as cloning vectors for gene overexpression as specified in the following examples. LB broth (Difco, BD) was used as the base medium for the preparation and culture of the recombinant E. coli strain. Depending on the resistance markers possessed by the recombinant plasmids contained in the recombinant E. coli, LB broth or LB agar media were prepared by adding antibiotics at concentrations of 50 μg / ml kanamycin, 100 μg / ml ampicillin, or 30 μg / ml chloramphenicol, and the recombinant E. coli strain was cultured.

[0069] Typically, the culture of the E. coli strain used in this invention was performed by inoculating a single colony of the E. coli strain cultured on an LB agar plate into 3 ml of LB broth and incubating it with shaking at 200 rpm for 24 hours at 37°C, and then re-inoculating it into MR medium to a concentration of 1% (v / v) of the pre-culture to cultivate the strain for the production of phytoene and 3HB polymer. The modified MR medium consisted of 10 g / L glucose, 1 g / L yeast extract, 2 g / L (NH4)2HPO4, 6.67 g / L KH2PO4, 0.8 g / L citric acid, and 0.7 g / L MgSO4. 4· 7H2O and 3 mL trace metal solution [10 g / L FeSO 4· 7H2O, 2.25 g / L ZnSO 4· 7H2O, 1 g / L CuSO 4· 5H2O, 0.5 g / L MnSO 4· 4H2O, 0.23 g / L Na2B4O 7· 10H2O, 1.35 g / L CaCl2and 0.1 g / L (NH4)6MO7O 24·It is a minimal medium composed of 4H2O in 0.35% HCl solution. To induce the expression of a gene cloned into an overexpression plasmid, the optical density (OD) of E. coli 600 When ) reached 0.5, isopropyl β-D-1-thiogalactopyranoside (IPTG) at a concentration of 1 mM was added.

[0071] 1-2. crtB and crtE Method for introducing a gene into E. coli and preparing the PHY1 strain

[0072] The E. coli strain PHY1, capable of producing phytoene, was prepared by the following method. First, using the DNA of the Deinococcus radiodurans strain as a template, crtE-F and crtE-R or crtB-F and crtB-R primers were used crtE Genes and crtB Each gene was PCR-coated. The obtained amplification products were treated with restriction enzymes EcoR I / Kpn I ( crtE Amplifier) ​​or EcoR I / Hind III ( crtB The product obtained in the above PCR process using the amplified product crtE and crtB Each gene amplification product was treated and ligated sequentially to ptrc99a treated with the same restriction enzyme. crtE and crtB Genetically cloned ptrc99a was transformed into competent TOP10 strains and screened on LB agar plates containing 100 µg / ml ampicillin. Deinococcus radiodurans derived crtE and crtB The TOP10 strain containing the cloned ptrc99a plasmid was named PHY1.

[0074] <Experimental Example 1> Confirmation of Phytoene Production Ability of PHY1 Strain

[0075] To confirm the phytoene production ability of recombinant E. coli, the PHY1 strain obtained in the above example was cultured in 50 ml of modified MR medium for 24 hours. Subsequently, 1 ml of the culture medium was transferred to a 1.5 ml tube, and the cells were recovered by centrifugation at 13,000 rpm at 4°C for 5 minutes. The cells were then suspended by adding 1 ml of a mixed solvent prepared with acetone and methanol in a ratio of 7:2 (v / v). For phytoene extraction, the suspension was ultrasonically pulverized for 1 minute and centrifuged at 13,000 rpm for 5 minutes to recover the phytoene extract. The recovered phytoene extract was filtered through a syringe filter with 0.2 μm pores and used for HPLC analysis.

[0076] The phytoen production ability of recombinant Escherichia coli was confirmed via HPLC using 5 µl of the phytoen extract prepared in the above example. Specifically, a Zorbax Eclipse XDB-C18 5 µm (4.6 x 250 mm) HPLC column was used, and the column temperature was set to 35°C and the flow rate to 2.0 ml / min. The mobile phase used was a solvent mixture of acetonitrile, methanol, and isopropanol in a ratio of 40:50:10. At this time, 15-cis-phytoen (>95%, Toronto Research Chemical) was used as a standard sample for comparison and quantification.

[0077] As a result, as shown in Figure 2a, phytoene was not produced in the top 10 wild-type E. coli strains, but crtB and crtE It was confirmed that the extract of the PHY1 strain overexpressing [it] showed a peak at the same retention time (23.52 min) as the phytoen standard. Therefore, it was confirmed that recombinant E. coli PHY1 has the ability to produce phytoen and can produce approximately 0.43 ± 0.06 mg / L of phytoen.

[0079] <Example 2> Preparation of Recombinant Escherichia coli PHY2 Strain with Improved Phytoen Productivity

[0080] To further enhance the production capacity of phytoenes from recombinant E. coli, Deinococcus lyodurans derived dxs The gene and mevalonic acid synthesis pathway were introduced into the PHY1 strain.

[0081] Specifically, using dxs-F and dxs-R primers with the DNA of the Deinococcus radiodurans strain as a template, dxs The gene was PCR-coated. The PCR amplified product was treated with restriction enzymes Kpn I / Xba After cutting with I, it was ligated to ptrc99a treated with the same restriction enzyme and transformed into TOP10 strain. dxs Using dxs-F and dxs-R2 primers with ptrc99a containing the cloned gene as a template, the trc promoter sequence and dxs The DNA fragment containing the gene was PCR-treated. The obtained DNA amplification was treated with restriction enzymes Kpn I / Hind Cut using III and prepared in Example 2-1 above crtB and crtE By cloning into the same restriction enzyme site of the ptrc99a plasmid containing the gene, Deinococcus lyodurans derived crtB , crtE , and dxs The preparation of the ptrc99a plasmid containing the gene was completed. The said plasmid was transformed into competent TOP10 strains to produce Deinococcus lyodurans-derived crtB , crtE , and dxs Recombinant E. coli capable of overexpressing genes was produced.

[0082] Subsequently, the mevalonic acid pathway was introduced into the recombinant E. coli prepared above. Specifically, the mevalonic acid biosynthetic pathway required mvaESK1K2D Genes and idi The gene-containing plasmid pMVA2RBS035 crtB , crtE , and dxsThe production of the PHY2 strain was completed by transforming recombinant E. coli containing the ptrc99a plasmid containing the gene.

[0084] <Experimental Example 2> Confirmation of Phytoene Production Ability of PHY2 Strain

[0085] Confirmation of phytoen produced from the PHY2 strain was performed using the same method as in Examples 1-3 above. As a result, it was confirmed that the PHY2 strain could produce 2.8 ± 0.6 mg / L of phytoen, which was found to be 6.5 times greater than the phytoen production capacity of the PHY1 strain.

[0087] <Example 3> Preparation of a recombinant E. coli PHY3 strain producing phytoene and 3HB polymer

[0088] Recombinant E. coli capable of simultaneously producing phytoene and 3HB polymer was prepared by the method of the following example. First, Ralstonia eutropha Using PHB-F and PHB-R primers with H16 strain DNA as a template phaCAB and PCR was performed on a DNA fragment containing the promoter base sequence of the above gene. The obtained PCR amplification product was restriction enzyme Xba I / Spe It was cleaved by treatment with I and cloned into pBBR1MCS treated with the same restriction enzyme. The product prepared by the above process phaCAB A pBBR1MCS plasmid containing [the component] was transformed into a PHY2 strain to obtain a PHY3 strain.

[0090] The primer sequences used in Examples 1 to 3 above are listed in Table 1 below.

[0091] nucleotide sequence (5'-3') crtE-F ctaggaattcatgcgtcccgaactgctcgc crtE-R gttaggtacctcacttctccccgcgtcgcca crtB-F ctaggaattcatgaggtctagggccggtt crtB-R gttaaagccttcagccgtggaccgcgccca dxs-F ctagggtaccatgaacgaacttcccggcac dxs-R taactctagactacacctcaatcggcacgt dxs-R2 taccaagcttctacacctcaatcggcacgt PHB-F ctagtctagaattcatccttctcgcctatg PHB-R aagtactagtgcgctggctgcaccgcaata

[0093] <Experimental Example 3> Confirmation of 3HB Polymer Production and Phytoene Productivity of PHY3 Strain

[0094] To confirm the 3HB polymer biosynthetic ability of the PHY3 strain obtained in Example 3-1 above, the PHY3 strain cultured in LB broth for 24 hours was inoculated onto LB agar plates supplemented with 1 mM IPTG and 0.5 μg / ml NileRed and cultured at 37°C for 48 hours. To compare 3HB production ability, the PHY2 strain was used as a control, and the experiment was performed under the same experimental conditions as the PHY3 strain. Subsequently, photographs were taken of the LB agar plates cultured with the PHY2 and PHY3 strains by exposing them to UV light on a GelDoc (Biorad). As shown in Figure 3, it was observed that only the PHY3 (PHB+) strain exhibited fluorescence upon UV light. This indicates that 3HB polymers are formed within the PHY3 cells.

[0095] In addition, a sample of the recombinant E. coli PHY3 strain was prepared for transmission electron microscopy (TEM) observation. The PHY3 strain was cultured in modified MR medium (50 mL) for 48 hours, and the cells were recovered by centrifugation and washed twice with sterile distilled water. Subsequently, the cells were fixed by treating them with a 2% glutaraldehyde solution. When the interior of the PHY3 cells from the prepared sample was examined via TEM, it was observed that 3HB polymer was synthesized and condensed into spherical clumps within the E. coli cells, as shown in Figure 4.

[0096] The phytoen production capacity of PHY3 was tested using the same method as in Examples 1-3 above. As a result, it was confirmed that PHY3 could produce 4.42 ± 0.79 mg / L of phytoen, which is 10.3 times higher than the phytoen production capacity of the PHY1 strain and 1.6 times higher than that of the PHY2 strain, confirming that the PHY3 strain has high phytoen production capacity. This result implies that the 3HB polymer biosynthesized within the PHY3 strain acts as a carrier molecule to encapsulate phytoen, thereby overcoming the limit of phytoen production capacity that can be contained in general E. coli cells.

[0098] <Experimental Example 4> Confirmation of Encapsulation of Phytoen Using In Vivo 3HB Polymer

[0099] The encapsulation of phytoen acting within the PHY3 strain was confirmed through confocal microscopy analysis. Specifically, cells were recovered from 1 ml of PHY3 strain culture medium, washed twice with 1X PBS, stained with NileRed reagent (0.5 μg / ml), and observed by scanning at wavelengths of 400–650 nm. NileRed is a staining reagent for 3HB polymer and cell membranes; the stained 3HB polymer was detected at 614 nm, and phytoen was detected at 510 nm.

[0100] As shown in Figure 6, it can be confirmed that the 3HB polymer and cell membrane within the cell are stained red by NileRed, a hydrophobic staining reagent. When the above image is superimposed with an image of the green fluorescence wavelength exhibited by Phytoen, most of the Phytoen fluorescence is observed at the same location as the 3HB polymer. The above result indicates that Phytoen is encapsulated in the 3HB polymer.

[0102] <Experimental Example 5> Photostability test of phytoene produced by the PHY3 strain

[0103] To verify the enhancement of photostability of phytoen encapsulated by 3HB polymer within strain PHY3, a comparative experiment was conducted with strain PHY2, which produces non-encapsulated phytoen. Specifically, strains PHY2 and PHY3 were each cultured in modified MR liquid medium (50 mL) for 24 hours, after which 1 mL aliquots of 1.5 mL were taken. Subsequently, each sample was centrifuged to recover cells, which were then freeze-dried. Each freeze-dried sample was left at room temperature under dark and light exposure conditions (fluorescent lamp, Kumho corp. FL4DEX-D, 80 lm / W) for 1, 2, 3, 5, 6, 8, and 10 days. Phytoen extraction and quantification were then performed on the samples corresponding to each day using the same method as in Examples 1-3. The degradation rate of phytoen with respect to light exposure was [First-order kinetic formula] ln ( C t / C 0 ) = - kt It was calculated using ] and plotted as a graph. C t ε₀ represents the concentration of residual phytoene during the time exposed to light, CO₀ represents the initial phytoene concentration, k represents the degradation constant, and t represents the treatment time. In the graph plotted by the above formula, a higher slope value K indicates lower photostability of phytoene due to light exposure, while a lower K value indicates higher photostability.

[0104] In addition, the half-life of phytoene due to light exposure (half-life, T 1 / 2) is T 1 / 2 Calculated by the formula = - ln 0.5 / k. T 1 / 2 represents the time when the concentration of initially produced phytoene decreases to 50%.

[0105] As shown in Figures 7a and 7b, it was confirmed that encapsulated phytoene derived from the PHY3 strain exhibited superior stability compared to unencapsulated phytoene (derived from the PHY2 strain) under both room temperature and light exposure conditions. Specifically, when comparing the phytoene degradation constant K values, the encapsulated phytoene derived from the PHY3 strain showed approximately 4.6 times better phytoene stability under dark conditions (0.0199) compared to the phytoene derived from the PHY2 strain (0.091). Furthermore, under light exposure conditions, the encapsulated phytoene derived from the PHY3 strain showed approximately 3 times improved photostability (0.162) compared to the phytoene derived from the PHY2 strain (0.495).

[0106] In addition, when comparing the half-lives of phytoen under dark and light exposure conditions, the encapsulated phytoen derived from the PHY3 strain was calculated to be 34.8 days (dark conditions) and 4.3 days (light exposure conditions), respectively. On the other hand, the phytoen derived from the PHY2 strain was found to be 7.6 days (dark conditions) and 1.4 days (light exposure conditions) under each condition, confirming that the half-life of the encapsulated phytoen in vivo was improved by up to 4.58 times.

Claims

Claim 1 A set of recombinant vectors comprising: a recombinant vector comprising the genes crtE (geranylgeranyl pyrophosphate synthase), crtB (phytoene synthase), and dxs (1-deoxy-D-xylulose-5-phosphate synthase); a recombinant vector comprising the gene idi (isopentenyl-pyrophosphate delta-isomerase) and the mvaESK1K2D gene group; and a recombinant vector comprising the phaCAB gene group. Claim 2 A recombinant vector set according to claim 1, characterized in that the crtE gene is represented by SEQ ID NO. 1, the crtB gene is represented by SEQ ID NO. 2, and the dxs gene is represented by SEQ ID NO.

3. Claim 3 delete Claim 4 A recombinant vector set according to claim 1, characterized in that the idi gene is denoted by SEQ ID NO. 4 and the mvaESK1K2D gene group is denoted by SEQ ID NO.

5. Claim 5 delete Claim 6 A recombinant vector set according to claim 1, characterized in that the phaCAB gene is represented by SEQ ID NO.

6. Claim 7 A set of recombinant vectors according to claim 1, wherein at least one of the recombinant vectors comprises a promoter base sequence. Claim 8 A set of recombinant vectors according to claim 7, characterized in that the promoter is selected from the group consisting of trc promoter, tac promoter, T7 promoter, lac promoter, and trp promoter. Claim 9 Recombinant microorganism transformed with the set of recombinant vectors of claim 1. Claim 10 In claim 9, the recombinant microorganism is a recombinant microorganism selected from the group consisting of Escherichia coli, Salmonella typhi, Salmonella typimurium, Vibrio cholerae, Mycobacterium bovis, Shigella, Bacillus, Lactobacillus, Staphylococcus, Corynebacterium, Listeria monocytogenes, and Streptococcus. Claim 11 In claim 9, the recombinant microorganism is characterized by having a high phytoene production capacity. Claim 12 A recombinant microorganism according to claim 9, characterized in that the microorganism has the ability to biosynthesize poly-3-hydroxybutyrate (3HB). Claim 13 A method for producing phytoene, comprising the step of culturing the microorganism of claim 9 to produce phytoene; and the step of recovering the produced phytoene. Claim 14 A method for manufacturing phytoen according to claim 13, characterized in that the phytoen is encapsulated within a 3HB polymer. Claim 15 A method for manufacturing phytoene according to claim 13, characterized in that the phytoene has stability against light exposure.

Images