Composition for preventing, ameliorating or treating inflammatory bowel disease comprising Lysimachia mauritiana extract as effective component

Abstract

The present invention relates to a composition for the prevention, improvement, or treatment of inflammatory bowel disease containing an extract of *Scutellaria baicalensis* as an active ingredient. When the extract of *Scutellaria baicalensis* of the present invention was administered to an animal model of inflammatory bowel disease induced by DSS (Dextran sulfate sodium), the length of the large intestine, which was reduced due to DSS administration, increased, and body weight and DAI (disease activity index) improved. Furthermore, the IgA content in the small intestine lavage fluid decreased, and the secretion of increased inflammatory cytokines in the serum decreased. Therefore, the composition of the present invention can be usefully used for the prevention, improvement, or treatment of inflammatory bowel disease.

Description

Technology Field

[0001] The present invention relates to a composition for the prevention, improvement, or treatment of inflammatory bowel disease containing an extract of sea buckthorn as an active ingredient. Background Technology

[0002] Inflammatory bowel disease (IBD) encompasses conditions such as ulcerative colitis, Crohn's disease, and Behcet's disease; the activation of inflammatory cells is known to be a significant etiology, and treatment requires the suppression of this activation using anti-inflammatory drugs and immunosuppressants. In other words, even among intestinal diseases, treatment methods must vary depending on the specific etiology. Particularly in the case of inflammatory bowel disease, establishing measures to suppress and alleviate inflammation-related symptoms is the most critical factor in treating the disease. The persistent or inappropriate activation of the intestinal immune system plays a significant role in the pathophysiology of chronic mucosal inflammation, ultimately leading to mucosal destruction and ulcers through the infiltration of neutrophils, macrophages, lymphocytes, and mast cells.

[0003] In the presence of inflammatory bowel disease, various inflammatory cytokines are secreted from the intestinal mucosa. TNF-α is found in high levels in the colonic lumen and colonic epithelial cells of patients with ulcerative colitis, and recent studies have indicated that TNF-α plays a significant role in the pathogenesis of ulcerative colitis. Infliximab, an anti-TNF-α antibody, is known to be effective not only in treating boils but also in treating previously untreated Crohn's disease; however, these treatments are costly and can cause side effects in some patients, such as fluid reactions or infectious complications. Currently, treatments for inflammatory bowel disease utilize 5-aminosalicylic acid (5-ASA) drugs that block the production of prostaglandins, such as sulfasalazine, or steroid-based immunosuppressants. Sulfasalazine is prone to causing side effects or adverse reactions such as abdominal fullness, headache, rash, liver disease, leukopenia, agranulocytosis, and male infertility.

[0004] Meanwhile, sea magpie beard ( Lysimachia mauritiana It is a dicotyledonous plant distributed in rocky coastal areas of southern regions, including Jeju Island and Ulleungdo; its young leaves are edible, and its fruits are used for ornamental purposes. In traditional Korean medicine, it is used as a cardiotonic and diuretic, and is known to be effective for hypertension, diabetes, edema, and bruises.

[0005] As for technologies related to sea buckthorn, Korean Registered Patent No. 1574731 discloses a pharmaceutical composition and a health functional food for the prevention or treatment of inflammatory diseases containing a sea buckthorn extract, and Korean Published Patent No. 2023-0161341 discloses a composition for the prevention, improvement, or treatment of arthritis and joint pain containing a sea buckthorn extract as an active ingredient; however, there has not yet been any disclosure regarding a composition for the prevention, improvement, or treatment of inflammatory bowel disease containing a sea buckthorn extract as an active ingredient according to the present invention. The problem to be solved

[0006] The present invention was derived from the above requirements, and the present invention provides a composition for the prevention, improvement, or treatment of inflammatory bowel disease containing an extract of *Scutellaria baicalensis* as an active ingredient. The present invention was completed by confirming that when the extract of *Scutellaria baicalensis* of the present invention was administered to an animal model of inflammatory bowel disease induced by DSS (Dextran sulfate sodium), the length of the large intestine reduced by DSS administration was increased, body weight and DAI (disease activity index) were improved, as well as the IgA content in the small intestine lavage fluid was reduced and the secretion of increased inflammatory cytokines in the serum was reduced. means of solving the problem

[0007] To achieve the above objective, the present invention provides a pharmaceutical composition for the prevention or treatment of inflammatory bowel disease comprising an extract of sea buckthorn as an active ingredient.

[0008] In addition, the present invention relates to sea magpie beard ( Lysimachia mauritiana Provides a health functional food composition for the prevention or improvement of inflammatory bowel disease comprising an extract as an active ingredient.

[0009] In addition, the present invention provides a feed additive for the prevention or improvement of inflammatory bowel disease comprising an extract of sea buckthorn as an active ingredient.

[0010] In addition, the present invention provides a veterinary composition for the prevention or treatment of inflammatory bowel disease comprising an extract of sea buckthorn as an active ingredient.

[0011] In addition, the present invention provides a herbal medicine composition for the prevention or treatment of inflammatory bowel disease comprising an extract of sea buckthorn as an active ingredient. Effects of the invention

[0012] The present invention relates to a composition for the prevention, improvement, or treatment of inflammatory bowel disease containing an extract of *Scutellaria baicalensis* as an active ingredient. When the extract of *Scutellaria baicalensis* according to the present invention is administered to an animal model of inflammatory bowel disease induced by DSS (Dextran sulfate sodium), the length of the large intestine, which was reduced due to DSS administration, is increased, and body weight and DAI (disease activity index) are improved. Furthermore, the IgA content in the small intestine lavage fluid is reduced, and the secretion of increased inflammatory cytokines in the serum is reduced. Brief explanation of the drawing

[0013] Figure 1 shows the experimental schedule of an animal model of colitis induction to confirm the effect of sea aster extract on inflammatory bowel disease. Figure 2 shows the results of confirming the change in colon length after administering the sea buckthorn extract to a DSS-induced colitis animal model. ### indicates that the colon length of the control group was statistically significantly reduced compared to the normal group, p<0.001, and *** indicates that the colon length of the group administered the sea buckthorn extract of the present invention (LM) was statistically significantly increased compared to the control group, p<0.001. Figure 3 shows the change in body weight following the administration of the sea buckthorn extract of the present invention in an animal model of colitis induction, where ### indicates that the body weight of the control group was statistically significantly reduced compared to the normal group on day 11, and p<0.001. * indicates that the body weight of the group administered the sea buckthorn extract of the present invention (LM) was statistically significantly increased compared to the control group, and p<0.05. Figure 4 shows the disease activity index (DAI) following the administration of the sea buckthorn extract of the present invention in an animal model of colitis induction. Figure 5 shows the change in IgA following the administration of the sea buckthorn extract of the present invention in an animal model of colitis induction, where ### indicates that the IgA content of the control group increased statistically significantly compared to the normal group, and p<0.001. *, **, *** indicate that the IgA content of the sea buckthorn extract administration group (LM) or the positive control group of the present invention decreased statistically significantly compared to the control group, where * is p<0.05, ** is p<0.01, and *** is p<0.001. Figure 6 shows the results of confirming the gene expression level of IL-6 following the administration of the extract of *Scutellaria baicalensis* of the present invention in an animal model of colitis induction. # indicates that the gene expression level of IL-6 in the control group was statistically significantly increased compared to the normal group, with p<0.05. * and ** indicate that the gene expression level of IL-6 in the positive control group (PC) or the group administered the extract of *Scutellaria baicalensis* of the present invention (LM) was statistically significantly decreased compared to the control group, with * being p<0.05 and ** being p<0.01. Specific details for implementing the invention

[0014] The present invention relates to a pharmaceutical composition for the prevention or treatment of inflammatory bowel disease comprising an extract of sea buckthorn as an active ingredient.

[0015] The above inflammatory bowel disease is preferably selected from ulcerative colitis, Crohn's disease, and Behcet's disease, but is not limited thereto, and the inflammatory bowel disease may be an inflammatory bowel disease caused by fine dust.

[0016] The above-mentioned sea aster extract may be any one of the extracts selected from the above-ground parts, underground parts, and whole plant, and preferably, sea aster leaf extract, but is not limited thereto.

[0017] The above sea buckthorn extract may be prepared by a method comprising the following steps, but is not limited thereto:

[0018] 1) A step of extracting by adding an extraction solvent to dried sea aster;

[0019] 2) A step of filtering the extract of step 1); and

[0020] 3) A step of preparing an extract by concentrating the filtered extract from step 2) under reduced pressure and drying it.

[0021] In step 1) above, the extraction solvent is preferably water, a C1 to C4 lower alcohol, or a mixture thereof, more preferably ethanol, and even more preferably 50% (v / v) ethanol, but is not limited thereto.

[0022] In the method for preparing the above extract, the extraction of sea aster may be performed using any conventional method known in the industry, such as filtration, hot water extraction, immersion extraction, reflux cooling extraction, and ultrasonic extraction. The vacuum concentration in step 3) is preferably performed using a vacuum vacuum concentrator or a vacuum rotary evaporator, but is not limited thereto. Additionally, drying is preferably performed by vacuum drying, vacuum drying, boiling drying, spray drying, or freeze-drying, but is not limited thereto.

[0023] The composition of the present invention is preferably prepared in any one of the formulations selected from capsules, powders, granules, tablets, suspensions, emulsions, syrups, and aerosols, but is not limited thereto.

[0024] The composition of the present invention may further include pharmaceutically acceptable carriers, excipients, or diluents in addition to the active ingredient, and may be in various oral or parenteral formulations. When formulating, it is prepared using commonly used fillers, extenders, binders, wetting agents, disintegrants, surfactants, and other diluents or excipients. Solid formulations for oral administration include capsules, powders, granules, tablets, pills, etc., and these solid formulations are prepared by mixing at least one excipient, for example, starch, calcium carbonate, sucrose or lactose, gelatin, etc., with one or more compounds. In addition, lubricants such as magnesium stearate and talc are also used in addition to simple excipients. Liquid formulations for oral administration include suspensions, emulsions, syrups, and aerosols; in addition to commonly used simple diluents such as water and liquid paraffin, they may contain various excipients, such as humectants, sweeteners, flavorings, and preservatives. Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized agents, and suppositories. Propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate may be used as non-aqueous solvents and suspension solvents. Witepsol, Macrogol, Tween 61, cocoa dough, laurin dough, and glycerogelatin may be used as bases for suppositories. For parenteral administration, it is preferable to select a method of topical application or injection via the abdominal cavity, rectum, vein, muscle, subcutaneous, intrauterine dura mater, or cerebrovascular system.

[0025] The pharmaceutical composition according to the present invention is administered in a pharmaceutically effective amount. In the present invention, "pharmaceutically effective amount" means an amount sufficient to treat a disease with a reasonable benefit / risk ratio applicable to medical treatment, and the level of the effective amount may be determined based on factors including the type and severity of the patient's disease, drug activity, sensitivity to the drug, time of administration, route of administration and elimination rate, duration of treatment, concurrently used drugs, and other factors well known in the medical field. The composition of the present invention may be administered as an individual therapeutic agent or in combination with other therapeutic agents, may be administered sequentially or simultaneously with conventional therapeutic agents, and may be administered as a single or multiple doses. It is important to administer an amount that obtains maximum effect with a minimum amount without side effects by taking all of the above-mentioned factors into account, and this can be easily determined by a person skilled in the art.

[0026] The dosage of the composition of the present invention varies depending on the patient's body weight, age, gender, health status, diet, time of administration, method of administration, excretion rate, and severity of the disease. The daily dosage is 0.01 to 2,000 mg / kg based on the amount of sea buckthorn extract, preferably 30 to 500 mg / kg, more preferably 50 to 300 mg / kg, and may be administered 1 to 6 times a day. The composition of the present invention may be used alone or in combination with methods using surgery, radiation therapy, hormone therapy, chemotherapy, and biological response modulators.

[0027] In addition, the present invention relates to sea magpie beard ( Lysimachia mauritiana This invention relates to a health functional food composition for the prevention or improvement of inflammatory bowel disease containing an extract as an active ingredient.

[0028] The above composition is preferably prepared in any one formulation selected from powder, granules, pills, tablets, capsules, candy, syrup, and beverage, but is not limited thereto.

[0029] When the health functional food composition of the present invention is used as a food additive, the above-mentioned sea aster extract may be added as is or used together with other foods or food ingredients, and may be used appropriately according to conventional methods. The amount of the active ingredient can be appropriately determined according to its purpose of use (prevention, health, or therapeutic treatment). Generally, when manufacturing food or beverages, the composition of the present invention is added in an amount of 15 parts by weight or less, preferably 10 parts by weight or less, relative to the raw materials. However, in the case of long-term consumption for the purpose of health and hygiene or health control, the above amount may be less than the above range, and since there are no issues regarding safety, the active ingredient may be used in an amount greater than the above range. There are no special restrictions on the type of food. Examples of foods to which the above-mentioned sea buckthorn extract can be added include meat, sausage, bread, chocolate, candies, snacks, confectionery, pizza, ramen, other noodles, chewing gum, dairy products including ice cream, various soups, beverages, tea, drinks, alcoholic beverages, and vitamin complexes, and include all health functional foods in the conventional sense.

[0030] When the composition of the present invention is used as a health beverage, it may contain various flavoring agents or natural carbohydrates as additional ingredients, as in conventional beverages. The aforementioned natural carbohydrates are monosaccharides such as glucose and fructose, disaccharides such as maltose and sucrose, polysaccharides such as dextrin and cyclotensin, and sugar alcohols such as xylitol, sorbitol, and erythritol. As sweeteners, natural sweeteners such as thaumatin and stevia extract, or synthetic sweeteners such as saccharin and aspartame may be used. The proportion of the above natural carbohydrates is generally about 0.01 to 0.04 g, preferably about 0.02 to 0.03 g per 100 g of the composition of the present invention. The composition of the present invention may contain various nutrients, vitamins, electrolytes, flavoring agents, coloring agents, pectic acid and its salts, alginic acid and its salts, organic acids, protective colloid thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohol, carbonating agents used in carbonated beverages, etc. In addition, the composition of the present invention may contain fruit pulp for the production of natural fruit juices, fruit juice beverages, and vegetable beverages. These ingredients may be used independently or in combination. Although the proportion of these additives is not critical, the composition of the present invention is generally selected in the range of 0.01 to 0.1 parts by weight per 100 parts by weight.

[0031] In addition, the present invention relates to a feed additive for the prevention or improvement of inflammatory bowel disease comprising an extract of sea buckthorn as an active ingredient.

[0032] The feed additive of the present invention corresponds to an auxiliary feed under the Feed Management Act. In the present invention, the term "feed" may refer to any natural or artificial prescribed food, single meal, etc., or the components of said single meal, intended for or suitable for animals to eat, consume, and digest. The types of said feed are not particularly limited, and feeds commonly used in the relevant technical field may be used. Non-limiting examples of said feed include plant-based feeds such as grains, root vegetables, food processing by-products, algae, fibers, pharmaceutical by-products, oils and fats, starches, meal, or grain by-products; and animal-based feeds such as proteins, inorganic substances, oils and fats, minerals, single-cell proteins, zooplankton, or food waste. These may be used individually or in a mixture of two or more types.

[0033] In addition, the present invention relates to a veterinary composition for the prevention or treatment of inflammatory bowel disease comprising an extract of sea buckthorn as an active ingredient.

[0034] The veterinary composition of the present invention may further include suitable excipients and diluents according to conventional methods. Examples of excipients and diluents that may be included in the veterinary composition of the present invention include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, cetanol, stearyl alcohol, liquid paraffin, sorbitan monostearate, polysorbate 60, methylparaben, propylparaben, and mineral oil. The veterinary composition according to the present invention may further include fillers, anticoagulants, lubricants, humectants, spices, emulsifiers, preservatives, etc. The veterinary composition according to the present invention may be formulated using methods well known in the art to provide rapid, sustained, or delayed release of the active ingredient after administration to an animal, and the formulation may be in the form of powder, granules, tablets, capsules, suspensions, emulsions, solutions, syrups, aerosols, soft or hard gelatin capsules, suppositories, sterile injectable solutions, sterile topical preparations, etc. The effective amount of the veterinary composition according to the present invention may be appropriately selected according to the individual animal. It may be determined according to the severity of the disease or condition, the age, weight, health status or sex of the individual, sensitivity to the active ingredient of the present invention, the route of administration, the duration of administration, factors including other compositions combined with or used simultaneously with the composition, and other factors well known in the physiological or veterinary field.

[0035] In addition, the present invention relates to a herbal medicine composition for the prevention or treatment of inflammatory bowel disease comprising an extract of sea buckthorn as an active ingredient.

[0036] The herbal medicine composition according to the present invention refers to a conventional dried medicinal material used in the manufacture of herbal medicine. The herbal medicine composition of the present invention may be an extract obtained by extracting using an extraction solvent selected from water, C1-C4 lower alcohols, or mixtures thereof according to a conventional method, or an extract in powder form obtained by drying thereof, and there are no particular restrictions on the formulation. For example, it may be manufactured in the form of pills, tablets, capsules, or liquids.

[0037] The present invention will be described in more detail below using examples. These examples are solely for the purpose of more specifically explaining the present invention, and it is obvious to those skilled in the art that the scope of the present invention is not limited by them.

[0038] Preparation Example 1. Preparation of Seaside Siberian Beard Extract

[0039] 7.5 L of 50% (v / v) ethanol was added to 500 g of sea aster leaves and refluxed once at 80°C for 4 hours, after which the extract was filtered, concentrated under reduced pressure, and dried to obtain sea aster leaf extract.

[0040] Example 1. Establishment of an animal model

[0041] According to the experimental schedule shown in Figure 1, the effect of sea buckthorn extract on inflammatory bowel disease using an animal model of colitis was confirmed.

[0042] The colitis experimental animal model used was C57BL / 6J mice (6 weeks old, male) purchased from DBL, which were acclimatized for one week before use. The groups were classified into a normal group (Normal), a control group with induced colitis (Control), a positive control group (PC), a group administered 100 mg / kg of the sea buckthorn extract prepared in Preparation Example 1 (LM 100 mg / kg), and a group administered 200 mg / kg of the sea buckthorn extract (LM 200 mg / kg). Eight mice were divided into each experimental group for the experiment. The positive control group was administered 100 mg / kg of mesalazine, while the normal group was provided with regular feed and regular purified water. The colitis-induced group was fed regular feed for 11 days, after which 3.5% DSS (dextran sulfate sodium), a colitis-inducing substance, was dissolved in regular purified water and supplied for 7 days. Subsequently, on the 11th day, the supply was switched to regular purified water. The positive control group and the group administered sea buckthorn extract were orally administered 200 µl each of mesalazine dissolved in physiological saline and sea buckthorn extract for 11 days, and the inducer, 3.5% DSS, was dissolved in ordinary purified water and administered for 7 days, after which it was switched to ordinary purified water on the 11th day.

[0043] Example 2. Change in colon length in an animal model of colitis

[0044] The length of the large intestine, an indicator of colitis, was measured by extracting large intestine tissue from mice after they were sacrificed on the 12th day.

[0045] As a result, the length of the colon in the colitis-induced group was shortened compared to the normal group, whereas the group administered sea aster extract maintained a length significantly similar to the normal group at both 100 mg / kg and 200 mg / kg (Fig. 2).

[0046] Example 3. Body weight change in an animal model of colitis

[0047] Mouse body weight was measured once a day during the 7 days of DSS treatment.

[0048] As a result, the body weight of the colitis-induced group (Control) decreased compared to the normal group, but the body weight of the group administered 200 mg / kg of sea aster extract (LM 200 mg / kg) compared to the control group remained similar to that of the normal group (Fig. 3).

[0049] Example 4. Measurement of DAI in an animal model of colitis

[0050] The disease activity index (DAI) was calculated as a sum of scores obtained by measuring the mouse's body weight loss, stool consistency, degree of bloody stool, and presence or absence of anal bleeding daily according to the criteria listed in Table 1.

[0051] Disease Activity Index (DAI) weight Loose stool bleeding 0 points (no decrease) 0 points (normal) 0 points (no bloody stools or bleeding) 1 point (1~5%) 1 point (slightly loose stool) 1 point (brown stool) 2 points (5~10%) 2 points (loose stool) 2 points (bloody stool) 3 points (10~20%) 3 points (diarrhea) 3 points (bloody stool, anal bleeding) 4 points (20%~) 4 points (severe diarrhea) 4 points (severe bloody stool, anal bleeding)

[0052] As a result, compared to the normal group, the control group with induced colitis showed an increased DAI score, but the positive control group and the group administered 100 mg / kg of sea aster extract had similar scores, which were lower than the control group with induced colitis, and the score decreased significantly in the group administered 200 mg / kg of sea aster extract (Fig. 4).

[0053] Example 5. Confirmation of changes in IgA content in small intestine washing solution

[0054] IgA, an immune antibody in the intestinal tract, is known to play an important role in the mucosal immune response within the intestinal tract. To measure this, 1 ml of PBS was added to a 5 cm section of the mouse small intestine and flowed through a tube. The supernatant was collected after centrifugation (13,000 rpm, 10 min, 4°C). The IgA content of the collected sample was measured using an IgA mouse ELISA kit (Abcam).

[0055] As a result, IgA levels, which indicate dysfunction of the humoral immune response in colitis, were found to increase in the colitis-induced group, whereas in contrast, IgA levels were significantly reduced in the groups administered 100 mg / kg and 200 mg / kg of sea aster extract and the positive control group (Fig. 5).

[0056] Example 6. Confirmation of changes in IL-6 gene expression levels in colon tissue

[0057] RNA was extracted using a Total RNA prep kit (BIOFACT Inc., Daejeon, South Korea) to determine the expression level of the pro-inflammatory cytokine IL-6 in mouse colon tissue. After synthesizing cDNA using 1 μg of Total RNA, the IL-6 expression level was confirmed via RT-qPCR.

[0058] Primer sequence gene direction Sequence(5'->3') Sequence number IL-6 Forward direction CCGGAGAGGAGACTTCACAG 1 IL-6 reverse direction TCCAGTTTGGTAGCATCCATC 2 Actin Forward direction TGGAATCCTGTGGCATCCATGAAAC 3 Actin reverse direction TAAAACGCAGCTCGTAACAG 4

[0059] As a result, compared to the normal group, the gene expression of IL-6 increased in the colitis-induced group (Control), but it was confirmed that the gene expression of IL-6 was significantly decreased in the groups administered 100 mg / kg and 200 mg / kg of sea aster extract and the positive control group (Fig. 6).

Claims

Claim 1 A pharmaceutical composition for the prevention or treatment of inflammatory bowel disease comprising an extract of *Scutellaria baicalensis* as an active ingredient. Claim 2 A pharmaceutical composition for the prevention or treatment of inflammatory bowel disease according to claim 1, characterized in that the inflammatory bowel disease is ulcerative colitis, Crohn's disease, or Behcet's disease. Claim 3 A pharmaceutical composition for the prevention or treatment of inflammatory bowel disease according to claim 1, characterized in that the inflammatory bowel disease is an inflammatory bowel disease induced by fine dust. Claim 4 A pharmaceutical composition for the prevention or treatment of inflammatory bowel disease, characterized in that, in claim 1, the sea aster extract is a sea aster leaf extract. Claim 5 A pharmaceutical composition for the prevention or treatment of inflammatory bowel disease according to claim 1, characterized in that the extraction solvent of the sea aster extract is water, a C1-C4 lower alcohol, or a mixture thereof. Claim 6 A pharmaceutical composition for the prevention or treatment of inflammatory bowel disease according to claim 1, characterized by further comprising, in addition to the active ingredient, a carrier, an excipient, or a diluent. Claim 7 Sea magpie beard ( Lysimachia mauritiana A health functional food composition for the prevention or improvement of inflammatory bowel disease comprising an extract as an active ingredient. Claim 8 A health functional food composition for the prevention or improvement of inflammatory bowel disease, characterized in that, in claim 7, the composition is prepared in any one formulation selected from powder, granules, pills, tablets, capsules, candies, syrups, and beverages. Claim 9 A feed additive for the prevention or improvement of inflammatory bowel disease containing sea buckthorn extract as an active ingredient. Claim 10 A veterinary composition for the prevention or treatment of inflammatory bowel disease comprising an extract of sea buckthorn as an active ingredient. Claim 11 A herbal medicine composition for the prevention or treatment of inflammatory bowel disease containing an extract of *Scutellaria baicalensis* as an active ingredient.

Images